Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες"

Transcript

1 Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες Οι πρωτεΐνες αποτελούν δοµικά και λειτουργικά συστατικά των κυττάρων και των ιστών. Οι πρωτεΐνες είναι µεγαλοµοριακές ενώσεις, αποτελούµενες από αλληλουχία διαφόρων αµινοξέων ενωµένων µεταξύ τους µε πεπτιδικό δεσµό Στη πρωτεϊνική δοµή συµµετέχουν υδρογονικοί δεσµοί µεταξύ των πλευρικών αλυσίδων των αµινοξέων, µεταξύ των ατόµων υδρογόνου και οξυγόνου του πεπτιδικού δεσµού και µεταξύ ατόµων της πρωτεϊνικής επιφάνειας και του περιβάλλοντος νερού. Οι µη πολικές πλευρικές αλυσίδες των ουδέτερων αµινοξέων συνδέονται µε υδρόφοβες οµάδες. Ο ρόλος των πρωτεϊνών είναι σηµαντικός για όλες σχεδόν τις λειτουργίες των έµβιων συστηµάτων. Η σηµασία τους διαφαίνεται από τις παρακάτω λειτουργίες: Ενζυµική δράση. Όλα τα γνωστά ένζυµα-καταλύτες των βιοχηµικών αντιδράσεων είναι πρωτεϊνικής φύσης. Συνήθως τα ένζυµα αυξάνουν την ταχύτητα κάποιων αντιδράσεων τουλάχιστον 10 6 φορές. Μηχανική στήριξη. Η µεγάλη αντοχή του δέρµατος και των οστών οφείλονται στην παρουσία του κολλαγόνου, µιας πρωτεΐνης που σχηµατίζει ίνες. Κίνηση - συστολή. Οι πρωτεΐνες είναι τα κύρια συστατικά των µυών, των οποίων η συστολή επιτυγχάνεται µε την ολισθητική κίνηση δύο ειδών πρωτεϊνικών νηµατίων, της ακτίνης και της µυοσίνης. Επίσης η κίνηση των χρωµοσωµάτων στη µίτωση και η µέσω µαστιγίων προώθηση του σπέρµατος επιτυγχάνεται µε συσταλτά πρωτεϊνικά συγκροτήµατα. Μεταφορά και αποθήκευση. Οι πρωτεΐνες χρησιµεύουν στη µεταφορά µικροµορίων και ιόντων. Π.χ. η αιµοσφαιρίνη µεταφέρει οξυγόνο στα ερυθροκύτταρα και η µυοσφαιρίνη στους µυς. Η τρανσφερρίνη µεταφέρει σίδηρο στο πλάσµα του αίµατος, ο οποίος αποθηκεύεται στο συκώτι σαν σύµπλοκο µε φερριτίνη, µια άλλη πρωτεΐνη. Έλεγχος της ανάπτυξης και διαφοροποίησης. Οι πρωτεΐνες χρησιµεύουν στην ελεγχόµενη έκφραση των γενετικών πληροφοριών, ουσιώδη διαδικασία για την κανονική ανάπτυξη και διαφοροποίηση των κυττάρων. Ρύθµιση λειτουργιών. Πολλές λειτουργίες ρυθµίζονται από ειδικές πρωτεΐνες, όπως π.χ. η όραση που ρυθµίζεται από τη ροδοψίνη (πρωτεΐνη-φωτοϋποδοχέας στα ραβδία του αµφιβληστροειδή), η µετάδοση των νευρικών παλµών που ρυθµίζεται από την ακετυλχολίνη κ.ά. Ανοσοπροστασία. Τα αντισώµατα είναι πολύ ειδικές πρωτεΐνες που αναγνωρίζουν ξένους εισβολείς, όπως οι ιοί, τα βακτήρια και κύτταρα άλλων οργανισµών και προσδένονται σε αυτούς µε σκοπό την εξουδετέρωση του εισβολέα.

2 Ταξινόµηση πρωτεϊνών µε βάση τον βιολογικό τους ρόλο ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ ΑΝΤΙΠΡΟΣΩΠΕΥΤΙΚΑ ΕΙ Η Ένζυµα Καταλυτική δράση Οξειδοαναγωγάσες, τρανσφεράσες, υδρολάσες, λυάσες, ισοµεράσες, λιγάσες Στηρικτικές Μηχανική στήριξη και σύνδεση ιστών Κολλαγόνο, ελαστίνη, κερατίνη, λιποπρωτεΐνη Συσταλτές Μυϊκές κινήσεις Μυοσίνη, ακτίνη Μεταφορικές Μεταφορά αδιάλυτων ή Αιµοσφαιρίνη, αλβουµίνες τοξικών ουσιών Γενετικές Ρύθµιση γονιδίων Ιστόνες, νουκλεοπρωτεϊνες Ρυθµιστικές ή Ρύθµιση λειτουργίας Ινσουλίνη, γλυκαγόνη, ACTH ορµονικές οργάνων, ιστών και αδένων Ανοσοπρωτεϊνες Ανοσολογική προστασία Ιντερφερόνη, γ-σφαιρίνες ΚΡΥΣΤΑΛΛΩΣΗ ΠΡΩΤΕΙΝΩΝ o Η κρυστάλλωση των πρωτεϊνών είναι µια τεχνική που αρχικά χρησιµοποιήθηκε για την αποµόνωση και τον έλεγχο καθαρότητας των πρωτεϊνών, καθώς η µικροκρυσταλλικότητα των µορίων είναι ένδειξη καθαρότητάς τους. Τα τελευταία χρόνια η χρήση της κρυστάλλωσης για το σκοπό αυτόν έχει εγκαταλειφθεί καθώς οι κρύσταλλοι µπορούν να περιέχουν µέχρι και 10% άλλες προσµίξεις. o Για την δοµική µελέτη µορίων µε ακτίνες Χ η κρυστάλλωση του µορίου αποτελεί το πρωταρχικό βήµα. Τα πρώτα περιθλασιγράµµατα ακτίνων-χ από κρυστάλλους πρωτεϊνών πάρθηκαν από κρυστάλλους πεψίνης από τους Bernal και Crowfoot (D.Hodgkin) το Τα βιολογικά µακροµόρια σαν πολυµερή αµινοξικών καταλοίπων ή νουκλεοτιδίων διπλώνονται σε τριτοταγή και τεταρτοταγή δοµή κυρίως λόγω αλληλεπιδράσεων Van der Waals, διπόλου-διπόλου, δεσµών υδρογόνου (C-O... H-N), γεφυρών S-S και περιστασιακά λόγω γεφυρών άλατος µεταξύ φορτισµένων αµινοξικών καταλοίπων (- COO H3N-). Οι υδατοδιαλυτές πρωτεΐνες διατάσσουν τις υδροφοβικές οµάδες τους προς τον πυρήνα εκθέτοντας τις υδρόφιλες οµάδες στην επιφάνεια, µε αποτέλεσµα να θεωρούνται σαν πολυ-ηλεκτρολύτες ικανοί να διαλυτοποιηθούν στο νερό (πρωτικός πολικός διαλύτης). Η σταθερότητα των µακροµορίων στο διάλυµα βασίζεται στον ανταγωνισµό µεταξύ αλληλεπιδράσεων διαλύτη-διαλελυµένης ουσίας και ενδοµοριακών αλληλεπιδράσεων που οδηγούν στην απόκτηση της τεταρτοταγούς δοµής.

3 Η ισορροπία µεταξύ των αλληλεπιδράσεων που ελέγχουν την διαλυτότητα και/ή την διαµόρφωση των πρωτεϊνών στον χώρο τροποποιείται από τους παρακάτω παράγοντες : α) Θερµοκρασία: αύξηση της θερµοκρασίας,προκαλεί αύξηση της αταξίας των διαλελυµένων µορίων αλλά επίσης επιτρέπει µακροµοριακές διευθετήσεις υψηλότερης ελεύθερης ενέργειας. β) ph: Αλλαγές του ph επηρεάζουν τόσο τον διαλύτη όσο και την διαλελυµένη ουσία γ) Αλάτια: δρουν µε διαφόρους τρόπους: (i) Είναι υπεύθυνα για την ιοντική ισχύ και επηρεάζουν τις µακροµοριακές ηλεκτροστατικές αλληλεπιδράσεις. Η άπωση µεταξύ ηλεκτρολυτών του ιδίου φορτίου µειώνεται. (ii) Μπορούν να σχηµατίζουν απ ευθείας αλληλεπιδράσεις µε φορτισµένα αµινοξικά κατάλοιπα (αργινίνη, λυσίνη ασπαρτικό, γλουταµικό) στην επιφάνεια των πρωτεϊνών (iii) ρουν µε διπολικές-µονοπολικές αλληλεπιδράσεις µε τις διπολικές οµάδες των µακροµορίων (πεπτιδικοί δεσµοί, αµινο, υδροξυ, καρβοξυλικές οµάδες και αµίδια) και µπορούν να οδηγήσουν σε µερική αποδιάταξη της πρωτεΐνης). (iv) Σχηµατίζουν µη πολικές αλληλεπιδράσεις µεταξύ των υδροφοβικών καταλοίπων εκτεθειµένων στο διαλύτη και των υδροφοβικών τµηµάτων των οργανικών αλατιών (σουλφονικών, καρβοξυλικών, αµµωνιακών ). δ) Ανταγωνιστές δεσµών υδρογόνου. Μόρια όπως η ουρία, τα φορµαµίδια, τα γουανιδινικά αλάτια σε υψηλές συγκεντρώσεις (>=4 Μ) ανταγωνίζονται τους δεσµούς υδρογόνου των µορίων του νερού και τους ενδοµοριακούς δεσµούς υδρογόνου της πρωτεΐνης δρώντας σαν αποδιατακτικοί παράγοντες, ενώ στην αντίθετη περίπτωση σταθεροποιούν τους υδροφοβικούς δεσµούς. ε) Οργανικοί διαλύτες : Τροποποιούν την διηλεκτρική σταθερά και έτσι προκαλούν αλλαγές σε διάφορες αλληλεπιδράσεις. Οι αλληλεπιδράσεις που κρατούν τις πρωτεΐνες στο κρυσταλλικό πλέγµα ονοµάζονται κρυσταλλικές επαφές (ίδιες σε κάθε οργανωµένη βασική µονάδα µορίων που περιέχεται στην στοιχειώδη κυψελίδα του κρυσταλλικού πλέγµατος). ΒΙΒΛΙΟΓΡΑΦΙΑ 1. "Θέµατα Μοριακής Βιοφυσικής" (1987) Σ.Ι.Χαµόδρακα, Εκδόσεις Συµµετρία, Αθήνα. 2. "Crystallization of Nucleic Acids and Proteins. A Practical Approach" (1992) A.Ducruix and R.Giege, Oxford University Press, Oxford-New York-Tokyo. 3. "Protein Crystallography" (1976) Blundell, T.L. & Johnson, L.N., Academic Press, London-New York-San Francisco.

4 εσοξυριβοζονουκλεϊνικό οξύ (DNA) Το DNA είναι το χηµικό µόριο στο οποίο έχει αποτυπωθεί ο γενετικός κώδικας των έµβιων όντων. Το DNA είναι ένα µεγάλου µήκους, υπό µορφή διπλής έλικας, µεγαλοµόριο πολυδεσοξυριβοζονουκλεοτιδίων. Κάθε µόριο δεσοξυριβοζο-νουκλεοτιδίου αποτελείται από τρία τµήµατα: την αζωτούχο βάση (τύπου πουρίνης ή πυριµιδίνης), ένα σάκχαρο (δεσοξυριβόζη) και ένα φωσφορικό οξύ. Το DNA περιέχει 4 είδη αζωτούχων βάσεων: την αδενίνη (Α) και τη γουανίνη (G) (πουρίνες διπλής αλυσίδας), τη θυµίνη (Τ) και την κυτοσίνη (C) (πυριµιδίνες απλής αλυσίδας). Το 1953, o J. Watson και ο F. Crick πρότειναν µια τρισδιάστατη δοµή του DNA βασισµένη σε πρότυπα που ανέπτυξαν ως αποτέλεσµα ανάλυσης φασµάτων ακτίνων -Χ ινών DNA ο M. Wilkins και η R. Franklin. Σύµφωνα µε το µοντέλο της ''διπλής έλικας'', το µόριο του DNA αποτελείται από δυο αντιπαράλληλους κλώνους που περιελίσσονται γύρω από έναν κοινό άξονα. Το ''βήµα'' της έλικας είναι 34 Å και έχει 10 νουκλεοτίδες. Κάθε κλώνος του DNA αποτελείται από την εναλλαγή των τεσσάρων βάσεων, διαταγµένων µε συγκεκριµένη σειρά κατά µήκος του κάθε κλώνου. Οι ''οδηγίες'' για την αναπαραγωγή των κυττάρων βρίσκονται κωδικοποιηµένες στη διαδοχή των βάσεων, το αλφάβητο της ζωής! ηλαδή η γενετική πληροφορία αποτελείται από ''µηνύµατα'' γραµµένα στο αλφάβητο των 4 γραµµάτων: Α C G T (σύµβολα των αζωτούχων βάσεων του DNA). Μια σειρά µερικών χιλιάδων βάσεων αποτελεί ένα γονίδιο και κάθε µόριο DNA περιλαµβάνει χιλιάδες γονίδια. Ένα συγκεκριµένο γονίδιο καθορίζει την αντίστοιχη δοµή µιας ειδικής πρωτεΐνης, ή τµήµατος πρωτεΐνης. Πριν από τη διαίρεση ενός κυττάρου, η οποία θα οδηγήσει σε δυο θυγατρικά κύτταρα, τα µόρια του DNA του κυττάρου - γονέα διπλασιάζονται έτσι, ώστε τα θυγατρικά κύτταρα να έχουν από ένα πλήρες set γονιδίων. ηλαδή τα µόρια του DNA αυτοαντιγράφονται. Κατά µέσο όρο υπάρχουν κύτταρα στο σώµα ενός ανθρώπου και, µε µερικές εξαιρέσεις, το καθένα τους περιέχει ένα τέλειο αντίγραφο του DNA αυτού του ανθρώπου, ίδιο µε αυτό του αρχικού κυττάρου της γονιµοποίησης.

5 Η κυτταρική µεµβράνη Tο κύτταρο και τα οργανίδια του (π.χ. ο πυρήνας, τα µιτοχόνδρια, οι χλωροπλάστες) χωρίζονται από το περιβάλλον τους και επικοινωνούν µε αυτό µε µεµβράνες (µε το γενικό όνοµα βιολογικές µεµβράνες) που επιτελούν σπουδαίο ρόλο στην εξέλιξη της ζωής. To κύτταρο έχει πολλές µεµβράνες, την εξωτερική που ονοµάζεται πλασµατική µεµβράνη και εσωτερικές: στο ενδοπλασµατικό δίκτυο, στα µιτοχόνδρια, τους χλωροπλάστες κ.λ.π. Οι µεµβράνες εξυπηρετούν και δοµικούς αλλά και λειτουργικούς σκοπούς στο κύτταρο (διαχωριστικές επιφάνειες, ρύθµιση διαπερατότητας ιόντων και µορίων, αγωγή νευρικού παλµού και διάδοση πληροφορίας από και προς το κύτταρο, µετατροπή φωτός σε βιοχηµική ενέργεια, µορφογένεση, αναγνώριση προτύπων κ.λ.π.). Ταυτόχρονα, οι µεµβράνες αποτελούν συνήθως και τον πρωταρχικό στόχο στην εισβολή βακτηρίων και ιών, στη δράση χηµικών και φαρµακευτικών ουσιών, καθώς και στην έκθεση σε φυσικούς παράγοντες του περιβάλλοντος κόσµου. Συνοπτικά, ο ρόλος τους είναι ιδιαίτερα σηµαντικός στις εξής τέσσερις κύριες διεργασίες: Μετατροπή ενέργειας, Μεταφορά ύλης, Μετάδοση σήµατος, Επεξεργασία πληροφορίας. Σύνθεση και αρχιτεκτονική δοµή των µεµβρανών Στη σύνθεση όλων των κυτταρικών µεµβρανών συµµετέχουν, σε διαφορετικό ποσοστό, τα εξής κύρια συστατικά: πρωτεΐνες, λιπίδια, υδρογονάθρακες, γλυκοπρωτεΐνες, λιποπρωτεΐνες, ιόντα και νερό. Ο τρόπος µε τον οποίο συντάσσονται τα επιµέρους συστατικά των µεµβρανών για να σχηµατίσουν τη χωρική δοµή της µεµβράνης των έµβιων συστηµάτων, προϋποθέτει την ύπαρξη µιας λιπιδικής διπλοστοιβάδας στη δοµή όλων των βιολογικών µεµβρανών, που ταιριάζει µε τη χαρακτηριστική θερµοδυναµική σταθερότητα τους. Οι λιπιδικές διπλοστοιβάδες είναι αυτο-συναρµολογούµενες δοµές, επίπεδες ή σφαιρικές (λιποσώµατα) και έχουν χρησιµοποιηθεί µέχρι σήµερα σε ποικίλες βιοεφαρµογές. Η βασική δοµή όλων των βιολογικών µεµβρανών είναι ενιαία και αποτελείται σχηµατικά από ένα βασικό πλέγµα φωσφολιπιδίων, τα οποία είναι διατεταγµένα σε διπλοστοιβάδα, µε τις πολικές κεφαλές προς την εξωτερική υδατική φάση και τις υδρόφοβες λιπαρές αλυσίδες προς το εσωτερικό. Βυθισµένες σε αυτό το λιπιδικό πλέγµα µε τυχαία κατανοµή βρίσκονται οι πρωτεΐνες. Άλλες είναι βυθισµένες στο εσωτερικό της µεµβράνης, άλλες διαχέονται παράλληλα µε την επιφάνεια της µεµβράνης (περιφερειακές) και άλλες διασχίζουν τη φωσφολιπιδική διπλοστοιβάδα (διαµεµβρανικές), σχηµατίζοντας µε αυτόν τον τρόπο ένα µωσαϊκό, το οποίο όµως δεν είναι άκαµπτο αλλά δυναµικά «ρευστό». Οι κύριες δυνάµεις που προσδιορίζουν την οργάνωση της µεµβρανικής δοµής είναι δυνάµεις ηλεκτροστατικής υφής (ανάµεσα σε ιόντα) και δυνάµεις Van der Waals (υδρόφοβες/υδρόφιλες αλληλεπιδράσεις και δεσµοί υδρογόνου στο υδάτινο περιβάλλον της κυτταρικής µεµβράνης). Οι κυτταρικές µεµβράνες έχουν πάχη που ποικίλλουν από 50 έως 90 Å.

6 Φαινόµενα µεταφοράς µέσω των κυτταρικών µεµβρανών Η διαβατότητα ή εκλεκτική διαπερατότητα της βιολογικής µεµβράνης είναι µια από τις σπουδαιότερες ιδιότητες αυτής της βιολογικής δοµής. Ανάλογα µε το µέγεθος των µεταφεροµένων ουσιών, διακρίνουµε δυο κύριους τρόπους µεταφοράς ουσιών µέσω των κυτταρικών µεµβρανών, τη µικροµεταφορά και τη µακροµεταφορά. Η µικροµεταφορά αναφέρεται στη µεταφορά µικροσωµατιδίων µέσω της µεµβράνης, όπως τα ιόντα, τα µικροµόρια, το νερό. Η µακροµεταφορά αναφέρεται στη µεταφορά κάποιων µοριακών συµπλεγµάτων, στερεών ή υγρών, όπως στην περίπτωση της φαγοκύττωσης ή της πινοκύττωσης. Η κυτταροφαγία ή φαγοκύττωση οδηγεί στον εγκλωβισµό, µεγάλων σχετικά, στερεών σωµατιδίων που επιτυγχάνεται µε προεκτάσεις του πρωτοπλάσµατος (ψευδοπόδια) που αγκαλιάζουν το σωµατίδιο και ενώνονται πίσω του, φέρνοντάς το έτσι στο εσωτερικό του κυττάρου. Η κυτταροποσία ή πινοκύττωση οδηγεί στον εγκλωβισµό µικροσκοπικών σταγόνων υγρού, στο οποίο αιωρούνται σωµατίδια και µακροµόρια. Αυτά τα σωµατίδια προσκολλώνται στην επιφάνεια του κυττάρου, η οποία εγκολπώνεται και τα ''καταπίνει''. Η απλούστερη διαδικασία µικροµεταφοράς, µε την οποία µόρια ύλης διαπερνούν τη µεµβράνη, είναι η ελεύθερη διάχυση. Ο ρυθµός διάχυσης είναι συνάρτηση της διαλυτότητας των µορίων στα λιπίδια, που εκφράζεται µε το λόγο της συγκέντρωσης της ουσίας στα λίπη ως προς την αντίστοιχη συγκέντρωση στο νερό (C λίπη / C νερό ). Για ουσίες που δεν διαλύονται στα λιπίδια (π.χ. Na +, K +, Cl -, γλυκόζη, αµινοξέα κ.ά), ο ρυθµός διάχυσης είναι συνάρτηση του µεγέθους των µορίων συγκρινόµενου µε αυτό των ''πόρων'' της µεµβράνης. Όλα τα παραπάνω (ελεύθερη διάχυση, διάλυση µορίων στα λιπίδια, διέλευση µικρών ουσιών από πόρους) συνιστούν διαδικασίες παθητικής µεταφοράς µορίων µέσα από τη µεµβράνη, χωρίς κατανάλωση ενέργειας. Σε πολλές περιπτώσεις η ανταλλαγή ύλης µε το περιβάλλον της κυτταρικής µεµβράνης γίνεται µε ενεργό µεταφορά ουσιών ή και µε διευκολυνόµενη διάχυση. Με διευκολυνόµενη διάχυση µεταφέρονται µόρια που δεν µπορούν να περάσουν µέσα από ιοντικά κανάλια, ούτε και από το στρώµα των λιπιδίων (µη λιποδιαλυτά µόρια), όπως είναι π.χ. ορισµένα σάκχαρα απαραίτητα στο µεταβολισµό του κυττάρου.

7 Τα µόρια που αναλαµβάνουν ρόλο ''µεσάζοντα'' στη διευκολυνόµενη διάχυση λέγονται ιονοφόρα και παίζουν το ρόλο τους είτε σαν µεταφορείς αυτοί καθαυτοί, είτε σχηµατίζοντας προσωρινούς πόρους για να περάσουν ουσίες. Τα ιονοφόρα δρουν µε έναν από τους παρακάτω τρόπους: α) παραλαµβάνουν κατιόντα από το εξωτερικό περιβάλλον της µεµβράνης και, παρέχοντας τους ένα υδροφοβικό κάλυµµα, τα µεταφέρουν και τα αποθέτουν στο εσωτερικό, β) δηµιουργούν ''κανάλια'' στη µεµβράνη µέσα από τα οποία περνούν εκλεκτικά τα κατάλληλα ιόντα. Ένα παράδειγµα ιονοφόρου µεταφορέα είναι η βαλινοµυκίνη (valinomycin), η οποία ''ενσωµατώνεται'' στην κυτταρική µεµβράνη, λόγω των υδρόφοβων απολήξεων του µορίου της, αυξάνοντας σηµαντικά την ταχύτητα µεταφοράς των ιόντων K +. Ένα µόνο µόριο βαλινοµυκίνης διευκολύνει την (παθητική) διάχυση των ιόντων K + έτσι, ώστε η ταχύτητα διάχυσης να φθάνει τα 10 4 K + /s. Ένα άλλο παράδειγµα ιονοφόρου µορίου είναι ένα αντιβιοτικό, η γραµισιδίνη Α (gramicydin A), το οποίο ''ενσωµατώνεται'' στη λιπιδική διπλοστοιβάδα αυξάνοντας σηµαντικά την ηλεκτρική αγωγιµότητα της µεµβράνης, µέσω της δηµιουργίας πόρων, πολύ επιλεκτικών στη διαπερατότητα ιόντων Να +. Η ροή ιόντων Να + ανά πόρο γραµισιδίνης φθάνει τα 10 7 Να + /s. Τα ιονοφόρα-µεταφορείς ιόντων είναι κυρίως αντιβιοτικά ή ουσίες βακτηριακής προέλευσης (π.χ. τοξίνες βακτηρίων), που ανταγωνίζονται τη δράση άλλων, βλαβερών, µικρο-οργανισµών (βακτήρια, βάκιλοι) διαταράσσοντας τις µεµβρανικές λειτουργίες τους. Η ενεργός µεταφορά πραγµατοποιείται µε ταυτόχρονη κατανάλωση ενέργειας, η οποία προέρχεται από τον µεταβολισµό των τροφών και βρίσκεται αποθηκευµένη στο µόριο της τριφωσφορικής αδενοσίνης (ΑΤΡ). Η διευκολυνόµενη διάχυση γίνεται µε τη βοήθεια φορέων, δηλαδή πολύ ειδικών πρωτεϊνών. Κάθε µια από τις πρωτεΐνες-φορείς µπορεί να αντιδράσει µόνο µε µια ειδική χηµική οµάδα της ουσίας που διαχέεται και, τελικά, µετά την πρόσκαιρη αυτή σύνδεση, η ουσία αποδίδεται στην άλλη πλευρά της µεµβράνης και ο φορές παραµένει ανέπαφος. Απλή διάχυση Μέσω της υδρόφοβης λιπιδικής µήτρας Παθητική (Εντροπική) Μέσω των ιοντικών καναλιών ΜΙΚΡΟΜΕΤΑΦΟΡΑ ιευκολυνόµενη διάχυση: µε τη βοήθεια µορίων - φορέων (χωρίς ενζυµατική δράση) Ενεργή : µε τη βοήθεια µακροµοριακών δοµών (Αντι-εντροπική) (µε ενζυµατική δράση) Φαινόµενα µικρο-διαπερατότητας της κυτταρικής µεµβράνης

8 Ασύµµετρη κατανοµή ιόντων στις δυο πλευρές της µεµβράνης Η ασύµµετρη κατανοµή των ιόντων γεννά µια διαφορά ηλεκτρικού δυναµικού, η οποία ονοµάζεται διαµεµβρανικό δυναµικό ανάπαυσης και είναι της τάξης των δεκάδων mv. Τα ηλεκτρικά δυναµικά στα βιολογικά συστήµατα µπορούν να δηµιουργηθούν από διάφορες πηγές, όπως ελεύθερα ιόντα, φορτισµένες χηµικές οµάδες ή απολήξεις µε ηλεκτρική πόλωση σε βιοµόρια, οξειδοαναγωγικές αντιδράσεις και αντιδράσεις µεταφοράς ηλεκτρονίων σε ορισµένα βιοσυστήµατα, καθώς και άλλα ηλεκτροχηµικά, ηλεκτροµηχανικά ή θερµοηλεκτρικά φαινόµενα. Τα βιοηλεκτρικά δυναµικά καταγράφονται µε τη βοήθεια µικροηλεκτροδίων και κατάλληλων συσκευών µέτρησης. Η διαµεµβρανική διαφορά δυναµικού, V MR, είναι εξ ορισµού: V MR = V i - V e όπου V i είναι το ενδοκυττάριο δυναµικό και V e το εξωκυττάριο δυναµικό. Το δυναµικό στο εσωτερικό του κυττάρου είναι αρνητικό σε σχέση µε το δυναµικό στο εξωτερικό, εξαιτίας της παρουσίας οργανικών ανιόντων κύρια πρωτεϊνικής φύσης στο εσωτερικό. Επειδή V i <0 και V e >0, συµπεραίνουµε ότι V MR <0. Τα ιόντα Na + και Cl - επικρατούν στο εξωτερικό του κυττάρου ενώ τα ιόντα K + στο εσωτερικό.

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΒΙΟΦΥΣΙΚΗ. Αναλυτική περιγραφή της ύλης

ΒΙΟΦΥΣΙΚΗ. Αναλυτική περιγραφή της ύλης Αναλυτική περιγραφή της ύλης ΒΙΟΦΥΣΙΚΗ Εισαγωγή (τι είναι Βιοφυσική, η σχέση της µε τις άλλες Φυσικές επιστήµες και τη Βιολογία, κλάδοι της Βιοφυσικής) υνάµεις - αλληλεπιδράσεις µεταξύ µορίων Το νερό και

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2015 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Λέξεις-κλειδιά Κυτταρική ή πλασματική μεμβράνη... Βασικές ιδιότητες της πλασματικής μεμβράνης... Βασικές λειτουργίες

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 2: Στοιχεία Μικροβιολογίας και Βιοχημείας των Βιομηχανικών Ζυμώσεων(1/5), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Βιοϊατρική τεχνολογία

Βιοϊατρική τεχνολογία Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοϊατρική τεχνολογία Ενότητα 2: Βιοϊατρική Τεχνολογία - Biomedical Technology Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία

Διαβάστε περισσότερα

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ Θερινό εξάμηνο 2011 Ο ρόλος του νερού στο φυτό Βασικότερο συστατικό των ιστών

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Η ανόργανη θρέψη των φυτών

Η ανόργανη θρέψη των φυτών Η ανόργανη θρέψη των φυτών Οργανικά θρεπτικά στοιχεία σάκχαρα που προέρχονται από τη διαδικασία της φωτοσύνθεσης με τις επακόλουθες μετατροπές Ανόργανα θρεπτικά στοιχεία προέρχονται από το έδαφος, με τη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη

ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη Ακαδ. έτος 2008-2009 - Διδάσκουσα: Μυρσίνη Μακροπούλου Από

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

9/5/2015. Σάκχαρα. πηγή ενεργειακού δυναµικού για τα φυτικά κύτταρα. Πρωτεΐνες. Ποσό της ηλιακής ενέργειας που φθάνει στη γη 13 x 10 23 cal

9/5/2015. Σάκχαρα. πηγή ενεργειακού δυναµικού για τα φυτικά κύτταρα. Πρωτεΐνες. Ποσό της ηλιακής ενέργειας που φθάνει στη γη 13 x 10 23 cal Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Ροή της βιολογικής ενέργειας και ρόλος των ενζύµων» Ορεστιάδα 2015 Ροή της βιολογικής ενέργειας Ποσό της ηλιακής ενέργειας που

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ Διάχυση Η διάχυση είναι το κύριο φαινόμενο με το οποίο γίνεται η παθητική μεταφορά διαμέσου ενός διαχωριστικού φράγματος Γενικά στη διάχυση ένα αέριο ή

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΗ ΣΧΟΛΗ ΑΓΡΙΝΙΟΥ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΕΤΟΣ ΣΠΟΥΔΩΝ 1ο Ζωολογία Δ. Ματθόπουλος 1 ΥΠΕΥΘΥΝΟΙ Από έδρας Δ. Ματθόπουλος Ζωολογία Δ. Ματθόπουλος

Διαβάστε περισσότερα

1.Μαθησιακοί στόχοι του μαθήματος

1.Μαθησιακοί στόχοι του μαθήματος BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1.Μαθησιακοί στόχοι του μαθήματος της ΒΙΟΧΗΜΕΙΑΣ (ΕΤΥ-232) 1)εξοικείωση των φοιτητών με τον μοριακό σχεδιασμό της ζωής 2)εμπέδωση της δομής και λειτουργίας

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΥΣ ΚΑΘΗΓΗΤΕΣ κύριο ΚΕΦΑΛΛΩΝΙΤΗ ΓΙΑΝΝΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης.

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. (α) Να ονομάσετε τα

Διαβάστε περισσότερα

Καθηγητής Δ. Μόσιαλος

Καθηγητής Δ. Μόσιαλος Μικροβιολογία-Ιολογία Επίκουρος Καθηγητής Καθηγητής Δ. Μόσιαλος Βιοενεργητική μικροβίων Βακτηριακή Γενετική Επισκόπηση Βακτηριοφάγων Προκαρυωτική ποικιλότητα (Βακτήρια) Προκαρυωτική ποικιλότητα (Αρχαία)

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2010 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Η κυτταρική ή πλασματική μεμβράνη αποτελεί το εξωτερικό όριο του κυττάρου από το περιβάλλον και περικλείει

Διαβάστε περισσότερα

Ενέργεια:η ικανότητα επιτέλεσης έργου. Μορφές ενέργειας. η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων

Ενέργεια:η ικανότητα επιτέλεσης έργου. Μορφές ενέργειας. η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων Ενέργεια -Μεταβολισµός Ενέργεια:η ικανότητα επιτέλεσης έργου Μορφές ενέργειας η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων ηλιακή, θερµότητα, χηµική, ηλεκτρική, πυρηνική. κινητική η ενέργεια

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth. ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.gr Σύνοψη των όσων εξετάσαμε για τους ιοντικούς διαύλους: 1. Διαπερνούν

Διαβάστε περισσότερα

Βιοϊατρική τεχνολογία

Βιοϊατρική τεχνολογία Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοϊατρική τεχνολογία Ενότητα 3: Μεμβράνες - Ηλεκτρικά δυναμικά, Νευρικό & μυϊκό σύστημα Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ

Διαβάστε περισσότερα

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση.

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση. ΙΣΤΟΙ 1. Τα κύτταρα που αποτελούν τον οργανισµό µας, διακρίνονται σε διάφορους τύπους, παρά το γεγονός ότι όλα, τελικώς, προέρχονται από το ζυγωτό, δηλαδή το πρώτο κύτταρο µε το οποίο ξεκίνησε η ζωή µας.

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα