Έκφραση της γενετικής πληροφορίας

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Έκφραση της γενετικής πληροφορίας"

Transcript

1 Η ροή της γενετικής πληροφορίας Έκφραση της γενετικής πληροφορίας To DNA ενός οργανισμού είναι ο μοριακός «σκληρός δίσκος» που περιέχει αποθηκευμένες ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και τη λειτουργία του οργανισμού. Ταυτόχρονα περιέχει την πληροφορία για τον αυτοδιπλασιασμό του, εξασφαλίζοντας έτσι τη μεταβίβαση των γενετικών οδηγιών από ένα κύτταρο στα θυγατρικά του και από έναν οργανισμό στους απογόνους του. Το πρώτο βήμα για την έκφραση της πληροφορίας που υπάρχει στο DNA είναι η μεταφορά της στο RNA με τη διαδικασία της μεταγραφής. To RNA μεταφέρει με τη σειρά του, μέσω της διαδικασίας της μετάφρασης, την πληροφορία στις πρωτεΐνες που είναι υπεύθυνες για τη δομή και λειτουργία των κυττάρων και κατ' επέκταση και των οργανισμών. Η σχέση αυτή συνοψίζεται στο ακόλουθο σχήμα, όπου τα βέλη δείχνουν την κατεύθυνση της μεταφοράς της γενετικής πληροφορίας: Το σχήμα αυτό αποτελεί το κεντρικό δόγμα της Μοριακής Βιολογίας όπως ονομάστηκε από τον F. Crick (1958). Η γενετική πληροφορία είναι η καθορισμένη σειρά των βάσεων, όπως η πληροφορία μιας γραπτής φράσης είναι η σειρά των γραμμάτων που την αποτελούν. Η πληροφορία υπάρχει σε τμήματα του DNA με συγκεκριμένη ακολουθία, τα γονίδια. Αυτά, διά μέσου της μεταγραφής και της μετάφρασης, καθορίζουν τη σειρά των αμινοξέων στην πρωτεΐνη. Οι πορείες της μεταγραφής και της μετάφρασης των γονιδίων αποτελούν τη γονιδιακή έκφραση. Για αρκετό καιρό οι ερευνητές πίστευαν ότι όλη η ροή της γενετικής πληροφορίας γινόταν προς τη μία μόνο κατεύθυνση, δηλαδή ότι το DNA μεταγραφόταν σε RNA. Σήμερα είναι γνωστό ότι μερικοί ιοί έχουν RNA ως γενετικό υλικό. Ένα ένζυμο που υπάρχει στους ίδιους τους ιούς, η αντίστροφη μεταγραφάση, χρησιμοποιεί ως καλούπι το RNA, για να συνθέσει DNA. Επιπλέον, σε ορισμένους ιούς το RNA έχει την ικανότητα να αυτοδιπλασιάζεται. Έτσι σήμερα το κεντρικό δόγμα περιγράφεται ως εξής: Συνοψίζοντας, λοιπόν, διαπιστώνουμε ότι η αντιγραφή του DNA διαιωνίζει τη γενετική πληροφορία, ενώ η μετάφραση χρησιμοποιεί αυτή την πληροφορία, για να κατασκευάσει ένα πολυπεπτίδιο. Η μεταγραφή καθορίζει ποια γονίδια θα εκφραστούν, σε ποιους ιστούς (στους πολυκύτταρους ευκαρυωτικούς οργανισμούς), και σε ποια στάδια της ανάπτυξης. Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν το ίδιο DNA. Σε κάθε ομάδα κυττάρων όμως εκφράζονται διαφορετικά γονίδια. Στα πρόδρομα ερυθροκύτταρα, για παράδειγμα, εκφράζονται κυρίως τα γονίδια των αιμοσφαιρινών, ενώ στα Β-λεμφοκύτταρα τα γονίδια των αντισωμάτων. Τα γονίδια διακρίνονται σε δύο κατηγορίες: Στα γονίδια που μεταγράφονται σε mrna και μεταφράζονται στη συνέχεια σε πρωτεΐνες και Στα γονίδια που μεταγράφονται και παράγουν trna, rrna, και snrna.

2 Το απλοειδές ανθρώπινο γονιδίωμα έχει μήκος 3x109 ζεύγη βάσεων. Από αυτό, μικρό ποσοστό μεταγράφεται σε RNA, δηλαδή αποτελεί τα γονίδια. Υπάρχουν τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή: το αγγελιαφόρο RNA (mrna), το μεταφορικό RNA (trna), το ριβοσωμικό RNA (rrna) και το μικρό πυρηνικό RNA (snrna). Τα τρία πρώτα είδη υπάρχουν και στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς, αλλά το τέταρτο υπάρχει μόνο στους ευκαρυωτικούς. 1. Αγγελιαφόρο RNA (mrna). Τα μόρια αυτά μεταφέρουν την πληροφορία του DNA για την παραγωγή μιας πολυπεπτιδικής αλυσίδας. 2. Ριβοσωμικό RNA (rrna). Τα μόρια αυτά συνδέονται με πρωτεΐνες και σχηματίζουν το ριβόσωμα, ένα «σωματίδιο» απαραίτητο για την πραγματοποίηση της πρωτεϊνοσύνθεσης. 3. Μεταφορικό RNA (trna). Κάθε μεταφορικό RNA συνδέεται με ένα συγκεκριμένο αμινοξύ και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης. 4. Μικρό πυρηνικό RNA (snrna). Είναι μικρά μόρια RNA, τα οποία συνδέονται με πρωτεΐνες και σχηματίζουν μικρά ριβονουκλεοπρωτείνικά σωματίδια. Τα σωματίδια αυτά καταλύουν την «ωρίμανση» του mrna, μια διαδικασία που, όπως θα αναφερθεί παρακάτω, γίνεται μόνο στους ευκαρυωτικούς οργανισμούς. Μεταγραφή του DNA Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Η μεταγραφή καταλύεται από ένα ένζυμο, την RNA πολυμεράση (στους ευκαρυωτικούς οργανισμούς υπάρχουν τρία είδη RNA πολυμερασών). Η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές, με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν α ρυθμιστικά στοιχεία της μεταγραφής του DNA και επιτρέπουν στην RNA πολυμεράση να αρχίσει σωστά τη μεταγραφή. Οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου. Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια, τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα εοξυριβονουκλεοτίδια μίας αλυσίδας του DNA σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνδέει τα ριβονουκλεοτίδια που προστίθενται το ένα μετά το άλλο, με 3'- 5'φωσφοδιεστερικό δεσμό. Η μεταγραφή έχει προσανατολισμό 5' 3' όπως και η αντιγραφή (Εικόνα 2.4). Η σύνθεση του RNA σταματά στο τέλος του γονιδίου, όπου ειδικές αλληλουχίες οι οποίες ονομάζονται αλληλουχίες ληξης της μεταγραφής, επιτρέπουν την απελευθέρωσή του. Το μόριο RNA που συντίθεται είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. To RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Στους προκαρυωτικούς οργανισμούς το mrna αρχίζει να μεταφράζεται σε πρωτεΐνη πριν ακόμη ολοκληρωθεί η μεταγραφή του. Αυτό είναι δυνατό, επειδή δεν υπάρχει πυρηνική μεμβράνη. (Εικόνα 2.5α). Αντίθετα, στους ευκαρυωτικούς οργανισμούς, το mrna που παράγεται κατά τη μεταγραφή ενός γονιδίου συνήθως δεν είναι έτοιμο να μεταφραστεί, αλλά υφίσταται μια πολύπλοκη διαδικασία ωρίμανσης (Εικόνα 2.5β και 2.6). Η διαδικασία αυτή αποτελεί ένα από τα πιο ενδιαφέροντα ευρήματα της Μοριακής Βιολογίας, γιατί οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Δηλαδή, η αλληλουχία που μεταφράζεται σε αμινοξέα διακόπτεται από ενδιάμεσες αλληλουχίες οι οποίες δε μεταφράζονται σε αμινοξέα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες αλληλουχίες ονομάζονται εσώνια. Όταν ένα γονίδιο που περιέχει εσώνια μεταγράφεται, δημιουργείται το πρόδρομο mrna που περιέχει και εξώνια και εσώνια. Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της ωρίμανσης, κατά την οποία τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snrna και από πρωτεΐνες και λειτουργούν ως ένζυμα: κόβουν τα εσώνια και συρράπτουν τα εξώνια μεταξύ τους. Έτσι σχηματίζεται το «ώριμο» mrna. Αυτό, παρ' ότι αποτελείται αποκλειστικά από εξώνια, έχει δύο περιοχές που δε μεταφράζονται σε αμινοξέα. Η μία βρίσκεται στο

3 5' άκρο και η άλλη στο 3' άκρο. Οι αλληλουχίες αυτές ονομάζονται 5' και 3' αμετάφραστες περιοχές, αντίστοιχα. To mrna μεταφέρεται από τον πυρήνα στο κυπαρόπλασμα και ειδικότερα στα ριβοσώματα όπου είναι η θέση της πρωτεϊνοσύνθεσης (Εικόνα 2.5β). Εικόνα 2.5 α. Μεταγραφή - μετάφραση στους προκαρυωτικούς οργανισμούς, β. Μεταγραφή - μετάφραση στους ευκαρυωτικούς οργανισμούς. Εικόνα 2.6 Ωρίμανση του πρόδρομου μορίου του mrna στον πυρήνα και μεταφορά του στο κυτταρόπλασμα, στους ευκαρυωτικούς οργανισμούς.

4 Ο γενετικός κώδικας είναι η αντιστοίχιση τριπλετών βασεων σε αμινοξέα Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mrna με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Γι' αυτό η πρωτεϊνοσύνθεση είναι πραγματικά μία διαδικασία «μετάφρασης» από τη γλώσσα των βάσεων στη γλώσσα των αμινοξέων. Επειδή ο αριθμός των διαφορετικών αμινοξέων που συγκροτούν τις πρωτεΐνες είναι είκοσι και, αντίστοιχα, ο αριθμός των διαφορετικών νουκλεοτιδίων που συγκροτούν το RNA είναι τέσσερα, θεωρήθηκε πιθανό ότι τρία νουκλεοτίδια αντιστοιχούν σε ένα αμινοξύ και γι' αυτό ο γενετικός κώδικας ονομάστηκε κώδικας τριπλέτας. Ο κώδικας τριπλέτας είναι φυσική συνέπεια του γεγονότος ότι τέσσερα νουκλεοτίδια, αν συνδυαστούν ανά ένα (4 1 =4) ή ανά δύο (4 2 = 16), δε δίνουν αρκετούς συνδυασμούς για να κωδικοποιηθούν τα είκοσι αμινοξέα. Αν όμως συνδυαστούν ανά τρία (4 3 =64) οι συνδυασμοί είναι παραπάνω από αρκετοί (Πίνακας 2.1). Τα βασικά χαρακτηριστικά του γενετικού κώδικα είναι: 1. Ο γενετικός κώδικας είναι κώδικας τριπλέτας, δηλαδή μια τριάδα νουκλεοτιδίων, το κωδικόνιο, κωδικοποιεί ένα αμινοξύ. 2. Ο γενετικός κώδικας είναι συνεχής, δηλαδή το mrna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο. 3. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος, δηλαδή κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο. 4. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Αυτό πρακτικά σημαίνει ότι το mrna από οποιονδήποτε οργανισμό μπορεί να μεταφραστεί σε εκχυλίσματα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη. 5. Ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος. Με εξαίρεση δύο αμινοξέα (μεθειονίνη και τρυπτοφάνη) τα υπόλοιπα 18 κωδικοποιούνται από δύο μέχρι και έξι διαφορετικά κωδικόνια. Τα κωδικόνια

5 που κωδικοποιούν το ίδιο αμινοξύ ονομάζονται συνώνυμα. 6. Ο γενετικός κώδικας έχει κωδικόνιο έναρξης και κωδικόνια λήξης. Το κωδικόνιο έναρξης σε όλους τους οργανισμούς είναι το AUG και κωδικοποιεί το αμινοξύ μεθειονίνη. Υπάρχουν τρία κωδικόνια λήξης, τα UAG, UGA και UAA. Η παρουσία των κωδικονίων αυτών στο μόριο του mrna οδηγεί στον τερματισμό της σύνθεσης της πολυπεπτιδικής αλυσίδας. Ο όρος κωδικόνιο δεν αφορά μόνο το mrna αλλά και το γονίδιο από το οποίο παράγεται. Έτσι, για παράδειγμα, το κωδικόνιο έναρξης AUG αντιστοιχεί στο κωδικόνιο έναρξης της κωδικής αλυσίδας του γονιδίου ATG κ.ο.κ. Το τμήμα ενός γονιδίου, και του mrna του που κωδικοποιεί μια πολυπεπτιδική αλυσίδα, αρχίζει με το κωδικόνιο έναρξης και τελειώνει με το κωδικόνιο λήξης. Μετάφραση Η μετάφραση του mrna, δηλαδή η αντιστοίχιση των κωδικονίων σε αμινοξέα και η διαδοχική σύνδεση των αμινοξέων σε πολυπεπτιδική αλυσίδα, πραγματοποιείται στα ριβοσώματα με τη βοήθεια των trna και τη συμμετοχή αρκετών πρωτεϊνών και ενέργειας. Τα ριβοσώματα μπορούν να χρησιμοποιηθούν ως θέση μετάφρασης για οποιοδήποτε mrna. Αυτό εξηγεί γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών». Κάθε ριβόσωμα αποτελείται από δύο υπομονάδες, μια μικρή και μια μεγάλη, και έχει μία θέση πρόσδεσης του mrna στη μικρή υπομονάδα και δύο θέσεις εισδοχής των trna στη μεγάλη υπομονάδα. Κάθε μόριο trna έχει μια ειδική τριπλετα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο κωδικόνιο του mrna. Επιπλέον, κάθε μόριο trna διαθέτει μια ειδική θέση σύνδεσης με ένα συγκεκριμένο αμινοξύ. Η πρωτεϊνοσύνθεση διακρίνεται σε τρία στάδια: την έναρξη, την επιμήκυνση και τη λήξη. Έναρξη: Κατά την έναρξη της μετάφρασης το mrna προσδένεται, μέσω μιας αλληλουχίας που υπάρχει στην 5' αμετάφραση περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος, σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων. Το πρώτο κωδικόνιο του mrna είναι πάντοτε AUG και σ' αυτό προσδένεται το trna που φέρει το αμινοξύ μεθειονίνη. Όμως δεν έχουν όλες οι πρωτεΐνες του οργανισμού ως πρώτο αμινοξύ μεθειονίνη. Αυτό συμβαίνει γιατί, σε πολλές πρωτεΐνες, μετά τη σύνθεσή τους απομακρύνονται ορισμένα αμινοξέα από το αρχικό αμινικό άκρο τους. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του mrna στη μικρή υπομονάδα του ριβοσώματος και του trna που μεταφέρει τη μεθειονίνη ονομάζεται σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (Εικόνα 2.9α). Στη συνέχεια η μεγάλη υπομονάδα του ριβοσώματος συνδέεται με τη μικρή (Εικόνα 2.9β.). Επιμήκυνση: Κατά την επιμήκυνση ένα δεύτερο μόριο trna με αντικωδικόνιο συμπληρωματικό του δεύτερου κωδικονίου του mrna τοποθετείται στην κατάλληλη εισδοχή του ριβοσώματος, μεταφέροντας το δεύτερο αμινοξύ. Μεταξύ της μεθειονίνης και του δεύτερου αμινοξέος σχηματίζεται πεπτιδικός δεσμός και αμέσως μετά, το πρώτο trna αποσυνδέεται από το ριβόσωμα και απελευθερώνεται στο κυτταρόπλασμα όπου συνδέεται πάλι με μεθειονίνη, έτοιμο για επόμενη χρήση. Το ριβόσωμα και το mrna έχουν τώρα ένα trna, πάνω στο οποίο είναι προσδεμένα δύο αμινοξέα. Έτσι αρχίζει η επιμήκυνση της πολυπεπτιδικής αλυσίδας. Στη συνέχεια το ριβόσωμα κινείται κατά μήκος του mrna κατά ένα κωδικόνιο. Ένα τρίτο trna έρχεται να προσδεθεί μεταφέροντας το αμινοξύ του. Ανάμεσα στο δεύτερο και στο τρίτο αμινοξύ σχηματίζεται πεπτιδικός δεσμός. Η πολυπεπτιδική αλυσίδα συνεχίζει να αναπτύσσεται καθώς νέα trna μεταφέρουν αμινοξέα τα οποία συνδέονται μεταξύ τους (Εικόνα 2.10). Λήξη: Η επιμήκυνση σταματά σε ένα κωδικόνιο λήξης (UGA, UAG ή UAA), επειδή δεν υπάρχουν trna που να αντιστοιχούν σε αυτά. Το τελευταίο trna απομακρύνεται από το ριβόσωμα και η πολυπεπτιδική αλυσίδα απελευθερώνεται (Εικόνα 2.11). Σημειώνεται ότι πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mrna, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mrna είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με mrna ονομάζεται πολύσωμα (Εικόνα 2.12). Έτσι, η πρωτεϊνοσύνθεση είναι μια «οικονομική διαδικασία». Ένα κύτταρο μπορεί να παραγάγει

6 μεγάλα ποσά μιας πρωτείνης από ένα ή από δύο αντίγραφα ενός γονιδίου. Εικόνα 2.9 Η πρωτεϊνοσύνθεση αρχίζει με το σχηματισμό ενός συμπλόκου έναρξης. Εικόνα 2.12 α. Ένα πολύσωμα αποτελείται από πολλά ριβοσώματα τα οποία προσδένονται κατά μήκος ενός μορίου mrna και το μεταφράζουν β. Εικόνα ενός πολυσώματος στο ηλεκτρονικό μικροκόπιο.

7 Κεφάλαιο 6 Μεταλλάξεις Το γενετικό υλικό μπορεί να υποστεί αλλαγές με πολλούς διαφορετικούς τρόπους. Το γεγονός αυτό δεν προκαλεί έκπληξη. Σκεφθείτε με πόσους τρόπους μπορεί να αλλάξουν οι λέξεις που υπάρχουν σ' αυτή τη σελίδα. Οι αλλαγές στην αλληλουχία του DNA, που ονομάζονται μεταλλάξεις, δημιουργούν συνήθως ένα διαφορετικό φαινότυπο χωρίς όμως αυτό να είναι πάντοτε απαραίτητο. Αυτό εξαρτάται από τον τρόπο με τον οποίο η αλλαγή επιδρά στο γονιδιακό προϊόν, δηλαδή στην πρωτεΐνη. Οι γενετιστές κατατάσσουν τις μεταλλάξεις σε δύο μεγάλες κατηγορίες: Τις γονιδιακές και τις χρωμοσωμικές. Ο τυπικός αυτός διαχωρισμός σχετίζεται με την έκταση της αλλαγής. Αν αυτή αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή έλλειψη, τότε ονομάζεται γονιδιακή μετάλλαξη. Αν αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομάζεται χρωμοσωμική ανωμαλία. Οι μεταλλάξεις συμβάλλουν στη δημιουργία γενετικής ποικιλότητας στον πληθυσμό και ευθύνονται για πολλές κληρονομικές ασθένειες, καθώς και για πολλές περιπτώσεις καρκίνου. Μεταλλάξεις μπορεί να συμβούν σε οποιοδήποτε γεννητικό ή σωματικό κύτταρο ενός οργανισμού. Μόνο οι μεταλλάξεις των γεννητικών κυττάρων, εν τούτοις, μπορεί να μεταβιβαστούν από τη μια γενιά στην επόμενη. Αυτό όμως δε σημαίνει ότι οι σωματικές μεταλλάξεις είναι λιγότερο σημαντικές για την υγεία. Στην πραγματικότητα αποτελούν την πλειονότητα των μεταλλάξεων, δεδομένου ότι ένας ενήλικος οργανισμός αποτελείται από 1013 περίπου σωματικά κύτταρα. Η μελέτη της δρεπανοκυτταρικής αναιμίας αποτελεί σταθμό στην κατανόηση των μηχανισμών δημιουργίας των μεταλλάξεων Η πρώτη γενετική ασθένεια που βρέθηκε ότι είναι αποτέλεσμα συγκεκριμένης γονιδιακής μετάλλαξης ήταν η δρεπανοκυτταρική αναιμία. Το 1949, ο Linus Pauling και οι συνεργάτες του ανακάλυψαν ότι η αιμοσφαιρίνη των ενηλίκων, HbA, που αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες, δύο α και δύο β, διέφερε στα φυσιολογικά άτομα σε σχέση με εκείνα που έπασχαν από δρεπανοκυτταρική αναιμία. Σήμερα γνωρίζουμε ότι η διαφορά εντοπίζεται στο έκτο αμινοξύ της β-πολυπεπτιδικής αλυσίδας, όπου το γλουταμινικό οξύ αντικαθίσταται από βαλίνη. Η μεταλλαγμένη αιμοσφαιρίνη συμβολίζεται ως HbS. Η αλλαγή στην ακολουθία των αμινοξέων είναι αποτέλεσμα μιας γονιδιακής μετάλλαξης στην τριπλέτα που κωδικοποιεί το γλουταμινικό οξύ. Στην κωδική αλυσίδα του DNA δηλαδή, αλλάζει μία βάση και το φυσιολογικό κωδικόνιο GAG, που κωδικοποιεί το γλουταμινικό οξύ, αντικαθίσταται από το GTG, που κωδικοποιεί τη βαλίνη. Αυτή η μετάλλαξη οδηγεί σε αλλαγή της στερεοδιάταξης της αιμοσφαιρίνης, η οποία έχει ως αποτέλεσμα την αλλαγή της μορφής των ερυθροκυττάρων, τα οποία, σε συνθήκες έλλειψης οξυγόνου, παίρνουν χαρακτηριστικό δρεπανοειδές σχήμα (Εικόνα 6.1). Τα δρεπανοκύτταρα εμποδίζουν τη φυσιολογική κυκλοφορία του αίματος στα τριχοειδή αγγεία δημιουργώντας προβλήματα σε διάφορα όργανα όπως στο σπλήνα και τους πνεύμονες. Τα δρεπανοκύτταρα καταστρέφονται ταχύτερα από τα φυσιολογικά με συνέπεια την εμφάνιση συμπτωμάτων αναιμίας. Ασθενείς με δρεπανοκυπαρική αναιμία είναι ομόζυγοι για το μεταλλαγμένο γονίδιο που συμβολίζεται με β s. Τα άτομα αυτά παράγουν μόνο HbS, και καθόλου HbA. Τα ετερόζυγα άτομα (φορείς) έχουν ένα φυσιολογικό β γονίδιο και ένα μεταλλαγμένο και δεν εμφανίζουν τα συμπτώματα της ασθένειας. Στους φορείς προκαλείται δρεπάνωση μόνο σε συνθήκες μεγάλης έλλειψης οξυγόνου, όπως σε υψόμετρο μεγαλύτερο από m. Εικόνα 6.1 Η δρεπανοκυτταρική αναιμία δημιουργείται από μια μετάλλαξη του γονιδίου που κωδικοποιεί τη β- πολυπεπτιδική αλυσίδα της αιμοσφαιρίνης, α. Στο μοντέλο του μορίου της αιμοσφαιρίνης φαίνεται η θέση της μετάλλαξης, β. φυσιολογικό ερυθροκύτταρο, επάνω και δρεπανοειδές ερυθροκύτταρο, κάτω

8 Όταν το γονίδιο «μεγαλώνει» από γενιά σε γενιά Ένας τύπος μετάλλαξης που ανακαλύφθηκε πρόσφατα είναι η τρινουκλεοτιδική επέκταση, κατά την οποία αυξάνεται ο αριθμός των επαναλήψεων μίας συγκεκριμένης τριπλέτας νουκλεοτιδίων από γενιά σε γενιά. Η τρινουκλεοτιδική επέκταση είναι το αίτιο της μυοτονικής δυστροφίας, μιας αυτοσωμικής επικρατούς μορφής μυϊκής δυστροφίας η οποία εμφανίζεται με σοβαρότερα συμπτώματα από τη μια γενιά στην επόμενη. Για παράδειγμα, ο παππούς μπορεί να εμφανίζει μόνο ήπια αδυναμία στα χέρια. Η κόρη μπορεί να έχει μέτρια αδυναμία σε χέρια και πόδια. Τα παιδιά της, εάν κληρονομήσουν το γονίδιο, μπορεί να εμφανίζεται σοβαρή μυϊκή αδυναμία. Για πολλά χρόνια η αιτιολογία αυτού του φαινομένου ήταν άγνωστη. Εντούτοις, μόλις προσδιορίστηκε η αλληλουχία του γονιδίου, αποκαλύφθηκε ότι η επιδείνωση των συμπτωμάτων οφείλεται στην αύξηση του μεγέθους του γονιδίου. Το γονίδιο που δημιουργεί την ασθένεια βρίσκεται στο χρωμόσωμα 19 και εμφανίζει πολλές επαναλήψεις της τριπλέτας CTG. Ένα φυσιολογικό άτομο έχει 5 έως 37 επαναλήψεις της τριπλέτας, ενώ ένα άτομο που πάσχει εμφανίζει από 50 έως και χιλιάδες επαναλήψεις. Το σύνδρομο του εύθραυστου Χ είναι η δεύτερη σε συχνότητα, μετά το σύνδρομο Down, αιτία διανοητικής καθυστέρησης που σχετίζεται με γενετική ανωμαλία. Η ονομασία του οφείλεται στη θραύση, κάτω από συγκεκριμένες συνθήκες, μικρού τμήματος του χρωμοσώματος Χ στους πάσχοντες. Ανάλυση του DNA έδειξε ότι το σύνδρομο του εύθραυστου Χ οφείλεται στο μεγάλο αριθμό επαναλήψεων της τριπλέτας CGG στην αλληλουχία βάσεων του DNA σε ένα συγκεκριμένο γονίδιο (EMR1) του χρωμοσώματος Χ. Τα φυσιολογικά άτομα έχουν κατά μέσο όρο 30 επαναλήψεις της συγκεκριμένης τριπλέτας. Οι επαναλήψεις της τριπλέτας CGG στα άτομα που πάσχουν ξεκινούν από 200 και ξεπερνούν σε μερικές περιπτώσεις τις Τα άτομα που πάσχουν έχουν κληρονομήσει το γονίδιο σε «λανθάνουσα μορφή», δηλαδή από άτομα που δεν πάσχουν αλλά φέρουν επαναλήψεις της τριπλέτας CGG στο γονίδιο (προμετάλλαξη). Ο αριθμός των επαναλήψεων της τριπλέτας σε οικογένειες που φέρουν τη μετάλλαξη σε λανθάνουσα μορφή αυξάνεται από γενιά σε γενιά. Υπάρχουν πολλοί διαφορετικοί τύποι γονιδιακών μεταλλάξεων Το παράδειγμα της δρεπανοκυτταρικής αναιμίας δείχνει ότι μία ασθένεια μπορεί να είναι το αποτέλεσμα αντικατάστασης μίας μόνο από τα δισεκατομμύρια βάσεων DNA! Αλλαγή αυτού του τύπου ονομάζεται αντικατάσταση βάσης, και μπορεί να έχει ποικίλα αποτελέσματα στην πρωτείνη που παράγεται από το αντίστοιχο γονίδιο (Εικόνα 6.2). Στην περίπτωση που η διαφορετική τριπλέτα που προέκυψε κωδικοποιεί το ίδιο αμινοξύ (συνώνυμο κωδικόνιο) δεν αλλάζει η ακολουθία αμινοξέων στην παραγόμενη πρωτεΐνη. Στις περισσότερες όμως περιπτώσεις, μια αντικατάσταση βάσης δημιουργεί μια τριπλέτα που κωδικοποιεί ένα διαφορετικό αμινοξύ και κατά συνέπεια μια αλλαγμένη πρωτεΐνη. Εάν το διαφορετικό αμινοξύ βρίσκεται στο ενεργό κέντρο ενός ενζύμου ή κοντά σε αυτό, τότε η ενεργότητά του, δηλαδή η ικανότητα κατάλυσης αντιδράσεων, μπορεί να ελαττωθεί ή και να μηδενισθεί. Επίσης, σε άλλα είδη πρωτεϊνών η μετάλλαξη μπορεί να οδηγήσει σε αλλαγή της δομής τους και συνεπώς και της λειτουργίας τους, όπως στην περίπτωση της HbS στη δρεπανοκυτταρική αναιμία. Σε άλλες περιπτώσεις μία αντικατάσταση βάσης μπορεί να μετατρέψει ένα κωδικόνιο, που κωδικοποιεί κάποιο αμινοξύ, σε ένα κωδικόνιο λήξης, με αποτέλεσμα τον τερματισμό σύνθεσης της πολυπεπτιδικής αλυσίδας. Στις περισσότερες από αυτές τις περιπτώσεις καταστρέφεται η λειτουργικότητα της πρωτεΐνης.

9 Εικόνα 6.2 Οι κύριες κατηγορίες γονιδιακών μεταλλάξεων. Ένας άλλος σημαντικός τύπος γονιδιακών μεταλλάξεων περιλαμβάνει προσθήκη ή έλλειψη βάσεων (Εικόνα 6.2). Αλλαγές στον αριθμό των βάσεων έχουν ως αποτέλεσμα την εμφάνιση μεταλλαγμένων φαινοτύπων. Η προσθήκη ή η έλλειψη διαδοχικών βάσεων σε οποιοδήποτε αριθμό πολλαπλάσιο του τρία δημιουργεί, αντίστοιχα, προσθήκη ή έλλειψη ενός ή περισσότερων αμινοξέων στην πολυπεπτιδική αλυσίδα, που μπορεί να αλλάζει τη λειτουργικότητά της. Αν όμως ο αριθμός των βάσεων είναι διαφορετικός του τρία ή πολλαπλασίων του, τότε διαταράσσεται το πλαίσιο ανάγνωσης των τριπλετών. Συνεπώς η αλληλουχία των αμινοξέων δεν εμφανίζει πλέον πολλές ομοιότητες με την αρχική. Σκεφτείτε: Τι θα δημιουργήσει μεγαλύτερο πρόβλημα στον οργανισμό: Η έλλειψη μίας βάσης ή τριών συνεχόμενων βάσεων; Οι μεταλλάξεις δεν είναι πάντοτε βλαβερές Μολονότι οι περισσότερες μεταλλάξεις οδηγούν σε αποτέλεσμα που δεν είναι ευνοϊκό για τον οργανισμό, μερικές από αυτές εμφανίζουν πλεονεκτήματα. Χωρίς τις μεταλλάξεις, η γενετική ποικιλότητα θα περιοριζόταν αρκετά και η εξέλιξη, όπως τη γνωρίζουμε σήμερα, δε θα είχε συμβεί. Οι περισσότερες από τις μεταλλάξεις θεωρούνται επιβλαβείς, επειδή έχουν σοβαρές επιπτώσεις στον οργανισμό. Πολλές όμως δεν είναι επιβλαβείς και χαρακτηρίζονται ως ουδέτερες. Για παράδειγμα, μεταλλάξεις που οδηγούν σε αλλαγή ενός μόνο αμινοξέος μπορεί να έχουν ελάχιστη επίδραση στη στερεοδιάταξη και στη λειτουργικότητα της πρωτεΐνης. Οι αλλαγές που συμβαίνουν σ' ένα γονίδιο και δεν οδηγούν σε αλλαγή της αλληλουχίας των αμινοξέων της δημιουργούμενης πρωτεΐνης, λόγω εκφυλισμού του γενετικού κώδικα, ονομάζονται σιωπηλές μεταλλάξεις. Αλλαγές στην αλληλουχία των βάσεων παρατηρούνται όχι μόνο σε περιοχές του DNA που μεταγράφονται (γονίδια) αλλά και στις υπόλοιπες. Ποιοι παράγοντες προκαλούν μεταλλάξεις Οι μεταλλάξεις που εμφανίζονται αιφνίδια μέσα στον πληθυσμό ονομάζονται αυτόματες και θεωρείται ότι προέρχονται από λάθη που γίνονται κατά την αντιγραφή του DNA ή κατά το διαχωρισμό των χρωμοσωμάτων. Όλες οι μεταλλάξεις δε δημιουργούνται αυτόματα. Πολλοί τύποι μεταλλάξεων μπορεί να προκληθούν από

10 παράγοντες του περιβάλλοντος, που ονομάζονται μεταλλαξογόνοι. Σ' αυτούς περιλαμβάνονται διάφορες χημικές ουσίες, καθώς και διάφοροι τύποι ακτινοβολιών, όπως η Χ και η γ-ακτινοβολία, καθώς και η κοσμική και η υπεριώδης ακτινοβολία. Μερικές από τις χημικές ουσίες που έχουν μεταλλαξογόνο δράση είναι η φορμαλδεΰδη, ορισμένες χρωστικές, αρωματικοί κυκλικοί υδρογονάνθρακες Ακόμη και η καφείνη. Πολλές από αυτές τις ουσίες βρίσκονται σε γεωργικά, βιομηχανικά και φαρμακευτικά προϊόντα που χρησιμοποιούνται ευρύτατα. Πώς λοιπόν ένα κύτταρο μπορεί να διατηρήσει σταθερή μια αλληλουχία βάσεων απαραίτητη για τη ζωή υπερπηδώντας αυτές τις αλλαγές που δημιουργούνται από τους διάφορους μεταλλαξογόνους παράγοντες; Η απάντηση είναι ότι τα κύτταρα περιέχουν πάρα πολλά ένζυμα, που αναγνωρίζουν τις βλάβες και επιδορθώνουν το DNA. Περισσότερο από 99.9% των λαθών της αντιγραφής του DNA επιδιορθώνονται με αυτό τον τρόπο. Θα μπορούσαμε λοιπόν να παρομοιάσουμε το κύτταρο με ένα αυτοκίνητο, το οποίο ενώ βρίσκεται διαρκώς σε κίνηση διαθέτει μια ομάδα μηχανικών, που επιδιορθώνει όλες τις βλάβες του, αμέσως μόλις προκύψουν και έτσι το αυτοκίνητο δε σταματά να λειτουργεί φυσιολογικά. Ακτινοβολία και μεταλλάξεις Ο ανθρώπινος πληθυσμός εκτίθεται με πολλούς τρόπους σε ακτινοβολίες π.χ. για ιατρικούς σκοπούς (ακτινοσκοπήσεις, ακτινοθεραπεία) ή για επαγγελματικούς λόγους (ερευνητικά ή πυρηνικά εργαστήρια). Επίσης εκτίθεται στην κοσμική ακτινοβολία, που φθάνει στη Γη από το διάστημα, και στην ακτινοβολία που εκπέμπουν τα ραδιενεργά κοιτάσματα. Κατά περιόδους εκτίθεται σε μεγάλα ποσά ακτινοβολίας που εκλύονται κατά τη διάρκεια δοκιμών ατομικών όπλων και σε πυρηνικά ατυχήματα. Η υπεριώδης ακτινοβολία περιλαμβάνεται στους μεταλλαξογόνους παράγοντες Μεγάλος αριθμός ασθενειών στον άνθρωπο είναι αποτέλεσμα μεταλλάξεων Στη συνέχεια, αναφέρονται μερικές συχνά εμφανιζόμενες ασθένειες του ανθρώπου, που οφείλονται σε μεταλλάξεις. Οι περισσότερες δεν είναι αποτέλεσμα ενός μόνο τύπου μετάλλαξης. Μπορεί να είναι αποτέλεσμα αντικαταστάσεων, ελλείψεων ή προσθηκών διαφορετικού αριθμού βάσεων. Αυτό έχει ως αποτέλεσμα τη μεγάλη ετερογένεια των συμπτωμάτων ανάμεσα σε άτομα που πάσχουν από την ίδια ασθένεια. Γενετικές διαταραχές στις αιμοσφαίρινες του ανθρώπου Τα ερυθρά αιμοσφαίρια του ανθρώπου περιέχουν κυρίως μια πρωτεΐνη, την αιμοσφαιρίνη, Κάθε μόριο αιμοσφαιρίνης έχει σφαιρικό σχήμα στο χώρο και αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες ανά δύο όμοιες, καθεμιά από τις οποίες συνδέεται με μία ομάδα αίμης (Εικόνα 6.3), Οι αιμοσφαιρινες του ενηλίκου ατόμου διαφέρουν από τις αντίστοιχες του εμβρύου, Η κύρια αιμοσφαιρίνη κατά την εμβρυϊκή ηλικία είναι η αιμοσφαιρίνη F (HbF) με σύσταση α 2 γ 2 δηλαδή αποτελείται από δύο πολυπεπτιδικές αλυσίδες α και από δυο γ, Κατά την ενήλικη ζωή η κύρια αιμοσφαιρίνη είναι ή HbA με σύσταση α 2 β 2, ενώ ανιχνεύονται και μικρές ποσότητες μιας άλλης αιμοσφαιρίνης, της HbA 2, με σύσταση α 2 δ 2. Τα ενήλικα άτομα επίσης συνθέτουν πολύ μικρή ποσότητα (λιγότερο από 1 %) της HbF. Τα γονίδια που κωδικοποιούν τις αλυσίδες των αιμοσφαιρινών εμφανίζουν πολλές μεταλλάξεις, που οδηγούν στη δημιουργία αιμοσφαιρινοπαθειών. Στο γονίδιο της πολυπεπτιδικής αλυσίδας β έχουν βρεθεί περισσότερες από 300 διαφορετικές μεταλλάξεις. Εάν μια μετάλλαξη επηρεάζει αμινοξέα σημαντικά για τη λειτουργικότητα της πρωτεΐνης, όπως αυτά που βρίσκονται κοντά στην περιοχή πρόσδεσης της αίμης, τότε δημιουργείται σοβαρό πρόβλημα για τον οργανισμό. Υπάρχουν όμως και μεταλλάξεις που περνούν σχεδόν απαρατήρητες ή που δημιουργούν μόνον ήπια αναιμία. Τέτοιες είναι οι μεταλλάξεις που αφορούν περιοχή της αλυσίδας που δεν είναι σημαντική για τη λειτουργία του μορίου. Μια από τις σοβαρότερες αιμοσφαιρινοπάθειες είναι η θαλασσαιμία, που οφείλεται σε ελαττωμένη σύνθεση είτε των α είτε των β αλυσίδων και οδηγεί αντίστοιχα σε α- ή β-θαλασσαιμία. Η β-θαλασσαιμία χαρακτηρίζεται από μεγάλη ετερογένεια, δηλαδή προκαλείται από πολλά διαφορετικά είδη γονιδιακών μεταλλάξεων όπως αντικαταστάσεις, ελλείψεις και προσθήκες βάσεων. Τα συμπτώματα της ασθένειας διαφέρουν ως προς τη βαρύτητα μεταξύ διαφόρων ατόμων και σχετίζονται με το είδος της μετάλλαξης που τα προκαλεί. Τα συμπτώματα μπορεί να κυμαίνονται από σοβαρή αναιμία (παντελής έλλειψη πολυπεπτιδικής αλυσίδας β, συνεπώς και HbA) έως λιγότερο σοβαρή αναιμία (ελάττωση σύνθεσης πολυπεπτιδικής αλυσίδας β, συνεπώς σύνθεση HbΑ σε πολύ μικρή ποσότητα). Τα ομόζυγα άτομα με β-θαλασσαιμία εμφανίζουν σοβαρή αναιμία. Η αντιμετώπιση γίνεται με συχνές μεταγγίσεις αίματος, οι οποίες όμως σταδιακά δημιουργούν πρόβλημα λόγω της υπερφόρτωσης του οργανισμού με σίδηρο. Το πρόβλημα αυτό αντιμετωπίζεται με φαρμακευτική αγωγή (αποσιδήρωση). Στα ομόζυγα

11 άτομα παρατηρείται σε πολλές περιπτώσεις αύξηση της HbF, η οποία υποκαθιστά μερικώς τη λειτουργία της HbA. Τα ετερόζυγα άτομα -φορείς- εμφανίζουν ήπια αναιμία και αυξημένη σύνθεση HbA2, η οποία αποτελεί διαγνωστικό δείκτη. Η ασθένεια κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Συνεπώς, όταν και οι δύο γονείς είναι φορείς της ασθένειας, ο κίνδυνος εμφάνισης της β-θαλασσαιμίας στους απογόνους τους είναι 25%. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β-θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής Αφρικής και της Ν,Α. Ασίας, όπου εμφανιζόταν ελονοσία, Η αυξημένη συχνότητα οφείλεται στην ανθεκτικότητα των φορέων στην προσβολή από το πλασμώδιο (πρωτόζωο) που προκαλεί την ελονοσία, επειδή τα ερυθροκύτταρά τους δεν ευνοούν τον πολλαπλασιασμό του. Συνεπώς, η προστασία που προσδίδει η μετάλλαξη ως προς την ελονοσία αποτελεί ένα πλεονέκτημα, που τους παρέχει αυξημένη πιθανότητα επιβίωσης και δυνατότητα αναπαραγωγής Τα γονίδια που κωδικοποιούν την πολυπεπτιδική αλυσίδα α είναι διπλά, δηλαδή υπάρχουν δύο γονίδια α σε κάθε ομόλογο χρωμόσωμα. Η α-θαλασσαιμία είναι αποτέλεσμα, σχεδόν σε όλες τις περιπτώσεις, ελλείψεων ολόκληρου του γονιδίου που κωδικοποιεί την πολυπεπτιδική αλυσίδα α. Εφόσον σε κάθε άτομο υπάρχουν συνολικά τέσσερα γονίδια α, ελλείψεις μπορεί να δημιουργηθούν σε ένα, δύο, τρία, ή και στα τέσσερα από αυτά τα γονίδια. Όσο περισσότερα γονίδια α λείπουν τόσο βαρύτερα είναι τα συμπτώματα της ασθένειας. Η έλλειψη των γονιδίων α επηρεάζει όλες τις αιμοσφαιρίνες του ανθρώπου που αναφέρθηκαν, επειδή η πολυπεπτιδική αλυσίδα α αποτελεί συστατικό αυτών των αιμοσφαιρινών. Μεταλλάξεις σε γονίδια που κωδικοποιούν ένζυμα δημιουργούν τις διαταραχές του μεταβολισμού Οι μεταβολικές οδοί στον άνθρωπο ακολουθούν ορισμένα στάδια, καθένα από τα οποία ελέγχεται από κάποιο ένζυμο. Έχουν περιγραφεί περίπου 200 διαταραχές του μεταβολισμού, οι οποίες αφορούν κυρίως τη λειτουργικότητα ενζύμων. Η δημιουργία μεταλλάξεων σε γονίδια που κωδικοποιούν κάποια από αυτά τα ένζυμα προκαλεί διάφορες κληρονομικές ασθένειες όπως η φαινυλκετονουρία και ο αλφισμός, οι οποίες κληρονομούνται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Η φαινυλκετονουρία (PKU = Phenyl Keton Urea) είναι μία ασθένεια η οποία προκαλείται από την έλλειψη του ενζύμου που στα φυσιολογικά άτομα μετατρέπει το αμινοξύ φαινυλαλανίνη σε τυροσίνη (Εικόνα 6.4), με αποτέλεσμα τη συσσώρευση φαινυλαλανίνης. Στα άτομα που είναι ομόζυγα για το υπολειπόμενο μεταλλαγμένο γονίδιο παρεμποδίζεται η φυσιολογική ανάπτυξη και λειτουργία των κυττάρων του εγκέφαλου, με συνέπεια τη διανοητική καθυστέρηση.εάν η ασθένεια ανιχνευθεί νωρίς, κατά τη νεογνική ηλικία, τότε η εμφάνιση των συμπτωμάτων που σχετίζονται με αυτήν μπορεί να αποφευχθεί με τη χρησιμοποίηση, εφ' όρου ζωής, κατάλληλου διαιτολογίου με περιορισμένη ποσότητα φαινυλαλανίνης. Ο αλφισμός οφείλεται στην έλλειψη ενός ενζύμου, το οποίο είναι απαραίτητο για το σχηματισμό της χρωστικής μελανίνης. Στα άτομα που πάσχουν από αλφισμό υπάρχει έλλειψη της χρωστικής στο δέρμα, στα μαλλιά και στην ίριδα του οφθαλμού. Ο αλφισμός εμφανίζει ετερογένεια, δηλαδή άλλα άτομα εμφανίζουν παντελή έλλειψη ενεργότητας του ενζύμου, ενώ άλλα εμφανίζουν μειωμένη ενεργότητα Εικόνα 6.4 Διάγραμμα στο οποίο φαίνονται τα σημεία όπου υπάρχει «εμπόδιο» που διακόπτει το μεταβολισμό της φαινυλαλανίνης προς μελανίνη στη φαινυλκετονουρία (1) και στον αλφισμό (2). Το εμπόδιο δημιουργείται από έλλειψη των αντιστοίχων ενζύμων που προκαλείται από μεταλλάξεις στα γονίδια που τα κωδικοποιούν

12 Χρωμοσωμικές ανωμαλίες Όπως έχουμε ήδη αναφέρει, οι μεταλλάξεις είναι αλλαγές στην ακολουθία και στον αριθμό των βάσεων στο γονιδίωμα ενός οργανισμού. Οι μεγάλες σε έκταση αλλαγές αποτελούν τις χρωμοσωμικές ανωμαλίες. Η ανάλυση των χρωμοσωμικών ανωμαλιών έγινε δυνατή μετά την ανάπτυξη τεχνικών που επιτρέπουν την παρατήρηση και τη λεπτομερή μελέτη των χρωμοσωμάτων. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες, ενώ οι αλλαγές στη δομή αποτελούν τις δομικές χρωμοσωμικές ανωμαλίες. Οι αλλαγές αυτές έχουν συνήθως ως αποτέλεσμα την τροποποίηση του φαινοτύπου του ατόμου. Οι αριθμητικές χρωμοσωρικές ανωμαλίες είναι αποτέλεσμα λαθών στη μειωτική διαίρεση Αν κατά τη διάρκεια της μειωτικής διαίρεσης δεν πραγματοποιηθεί φυσιολογικά ο διαχωρισμός των ομόλογων χρωμοσωμάτων ή των αδελφών χρωματίδων, ένα φαινόμενο που ονομάζεται μη-διαχωρισμός, τότε δημιουργούνται γαμέτες με αριθμό χρωμοσωμάτων μεγαλύτερο ή μικρότερο του φυσιολογικού. Η γονιμοποίηση των μη φυσιολογικών γαμετών, που προκύπτουν, με φυσιολογικό γαμέτη έχει ως αποτέλεσμα τη δημιουργία ζυγωτού με «λανθασμένη» ποσότητα γενετικού υλικού, το οποίο δεν αναπτύσσεται φυσιολογικά (Εικόνα 6,5). Τα άτομα που προκύπτουν και έχουν περίσσεια ή έλλειψη μικρού αριθμού χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος ονομάζεται μονοσωμία, ενώ η ύπαρξη ενός επιπλέον τρισωμία. Εικόνα 6.5 Μη διαχωρισμός χρωμοσωμάτων α. κατά τη διάρκεια της 1ης και β. κατά τη διάρκεια της 2ης μειωτικής διαίρεσης. Γονιμοποίηση των μη φυσιολογικών γαμετών, που προκύπτουν, με φυσιολογικό γαμέτη έχει ως αποτέλεσμα τη δημιουργία ζυγωτών με μη φυσιολογικό αριθμό χρωμοσωμάτων. Η μονοσωμία είναι συνήθως θανατηφόρος για τον οργανιομό, διότι τα χρωμοσώματα με τα γονίδια που περιέχουν, με εξαίρεση τα φυλετικά, πρέπει να υπάρχουν σε δύο «δόσεις», για να εξασφαλιστεί η σωστή ανάπτυξη του ζυγωτού. Οι αριθμητικές χρωμοσωμικές ανωμαλίες δημιουργούνται στα αυτοσωμικά ή στα φυλετικά χρωμοσώματα. Στη συνέχεια αναφέρονται οι συχνότερα εμφανιζόμενες περιπτώσεις στον άνθρωπο. Το σύνδρομο Down (Τρισωμία 21) είναι η πιο κοινή αριθμητική χρωμοσωμική ανωμαλία. Τα άτομα με σύνδρομο Down εμφανίζουν καθυστέρηση στην ανάπτυξη, χαρακτηριστικές δυσμορφίες στο πρόσωπο και διανοητική καθυστέρηση. Στον καρυότυπο των ατόμων που πάσχουν, σε όλες σχεδόν τις περιπτώσεις, εμφανίζεται ένα

13 επιπλέον χρωμόσωμα 21 (Εικόνα 6.6). Η ύπαρξη του επιπλέον χρωμοσώματος είναι αποτέλεσμα μη διαχωρισμού των χρωμοσωμάτων του 21 ου ζεύγους κατά το σχηματισμό γαμετών στη μείωση. Με αυτό τον τρόπο δημιουργείται ωάριο, και σε σχετικά λιγότερες περιπτώσεις σπερματοζωάριο, με δύο χρωμοσώματα 21. Γονιμοποίηση του γαμέτι που έχει το επιπλέον χρωμόσωμα 21 με ένα φυσιολογικό θα δημιουργήσει στο ζυγωτό τρισωμία 21. Η πιθανότητα γέννησης παιδιού με σύνδρομο Down σχετίζεται με την ηλικία της μητέρας. Μελέτες δείχνουν ότι μια μέλλουσα μητέρα ηλικίας 45 ετών έχει πολύ μεγαλύτερη πιθανότητα να αποκτήσει παιδί με σύνδρομο Down σε σχέση με μια μέλλουσα μητέρα ηλικίας 19 ετών (Εικόνα 6.7). Άλλες σχετικά συχνές αριθμητικές χρωμοσωμικές ανωμαλίες που αφορούν τα αυτοσωμικά χρωμοσώματα είναι η τρισωμία 13 και η τρισωμία 18. Τα άτομα που πάσχουν από αυτές εμφανίζουν βαρύτερα συμπτώματα από εκείνα που πάσχουν από σύνδρομο Down, πιθανόν επειδή τα χρωμοσώματα 13 και 18 είναι μεγαλύτερα σε μέγεθος και περιέχουν περισσότερα γονίδια, Εκτός από αριθμητικές ανωμαλίες που αφορούν τα αυτοσωμικά χρωμοσώματα παρατηρούνται αριθμητικές ανωμαλίες και στα φυλετικά χρωμοσώματα. Δύο από τα χαρακτηριστικά σύνδρομα αυτής της κατηγορίας είναι το σύνδρομο Klinefelter και το σύνδρομο Turner. Τα άτομα με σύνδρομο Klinefelter έχουν φυσιολογικό αριθμό αυτοσωμικών χρωμοσωμάτων (44) και τρία φυλετικά χρωμοσώματα, τα ΧΧΥ, αντί του φυσιολογικού ζεύγους ΧΥ (Εικόνα 6.8). Τα άτομα αυτά έχουν εξωτερικά χαρακτηριστικά αρσενικού ατόμου είναι όμως στείρα. Τα χαρακτηριστικά του συνδρόμου εμφανίζονται μετά την εφηβεία. Τα άτομα που πάσχουν από το σύνδρομο Turner έχουν φυσιολογικό αριθμό αυτοσωμικών χρωμοσωμάτων (44) αλλά μόνο ένα χρωμόσωμα Χ από το ζεύγος των φυλετικών χρωμοσωμάτων (ΧΟ) (Εικόνα 6.9). Αυτή είναι η μοναδική μονοσωμία που έχει βρεθεί στον άνθρωπο. Τα άτομα αυτά δεν εμφανίζουν δευτερογενή χαρακτηριστικά του φύλου, παρ' όλο που έχουν φαινότυπο θηλυκού ατόμου, και είναι στείρα. Εικόνα 6.6 Τα περισσότερα άτομα με σύνδρομο Down έχουν τρία αντίγραφα του χρωμοσώματος 21. α. Άτομο με σύνδρομο Down που συμμετέχει στους Special Olympics. β. Καρυότυπος αρσενικού ατόμου με σύνδρομο Down. Με βελάκι σημειώνεται το επιπλέον χρωμόσωμα 21 Εικόνα 6.8 Καρυότυπος ατόμου που πάσχει από σύνδρομο Klinefelter Εικόνα 6.9 Καρυότυπος ατόμου που πάσχει από σύνδρομο Turner. Οι δομικές χρωμοσωμικές ανωμαλίες αλλάζουν τη μορφολογία των χρωμοσωμάιων Οι δομικές χρωμοσωμικές ανωμαλίες είναι αλλαγές στη δομή ενός ή περισσότερων χρωμοσωμάτων. Οι δομικές

14 αλλαγές στο χρωμόσωμα μπορεί να αφορούν μερικά γονίδια ή ένα μεγάλο τμήμα του χρωμοσώματος. Η δημιουργία δομικών χρωμοσωμικών ανωμαλιών είναι αποτέλεσμα διάφορων μηχανισμών κατά τη διάρκεια του κυτταρικού κύκλου. Για παράδειγμα, η θραύση τμήματος από ένα ή περισσότερα χρωμοσώματα και, στη συνέχεια, η λανθασμένη επανένωσή του μπορεί να έχει ως αποτέλεσμα έλλειψη, μετατόπιση ή κάποια άλλη αναδιάταξη των γονιδίων στο χρωμόσωμα. Οι δομικές χρωμοσωμικές ανωμαλίες είναι αποτέλεσμα της δράσης μεταλλαξογόνων παραγόντων όπως οι ακτινοβολίες και οι διάφορες χημικές ουσίες. Οι δομικές χρωμοσωμικές ανωμαλίες έχουν ως αποτέλεσμα την αλλαγή στην ποσότητα ή στη διάταξη της γενετικής πληροφορίας στα χρωμοσώματα. Ανάλογα με τον τύπο της αλλαγής διακρίνονται διάφορα είδη δομικών χρωμοσωμικών ανωμαλιών (Εικόνα 6.10). Η έλλειψη είναι η απώλεια γενετικού υλικού. Το σύνδρομο φωνή της γάτας (cri-du-chat) οφείλεται στην έλλειψη ενός τμήματος από το χρωμόσωμα 5. Το σύνδρομο ονομάζεται έτσι, γιατί το κλάμα των νεογέννητων που πάσχουν μοιάζει με το κλάμα της γάτας (cri-du-chat). Τα άτομα που πάσχουν από το συγκεκριμένο σύνδρομο εμφανίζουν διανοητική καθυστέρηση. Ο διπλασιασμός είναι η επανάληψη ενος χρωμοσωμικού τμήματος στο χρωμόσωμα. Η αναστροφή δημιουργείται από θραύσεις σε δύο διαφορετικά σημεία ενός χρωμοσώματος και επανένωση του τμήματος ύστερα από αναστροφή. Η αναστροφή έχει ως συνέπεια την αλλαγή της διάταξης των γονιδίων στο χρωμόσωμα. Τέλος, η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος του χρωμοσώματος και στη συνέχεια ένωσής του σε ένα άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις έχουμε «ανταλλαγή» χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δε χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίζουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη-φυσιολογικοί γαμέτες. Για τη διαπίστωση των δομικών χρωμοσωμικών ανωμαλιών είναι απαραίτητη η χρώση των χρωμοσωμάτων με τεχνικές που δημιουργούν ζώνες στο χρωμόσωμα, όπως ζώνες Giemsa Εικόνα 6.10 Είδη δομικών χρωμοσωμικών ανωμαλιών. Ατομα με σύνδρομο Down και «φυσιολογικό» αριθμό χρωμοσωμάτων Έχει υπολογιστεί ότι το 4% περίπου των ατόμων που εμφανίζουν τα χαρακτηριστικό του συνδρόμου Down έχουν

15 φυσιολογικό αριθμό χρωμοσωμάτων δηλαδή 46. Η εμφάνιση των χαρακτηριστικών του συνδρόμου Down οφείλεται στην παρουσία «τριών περίπου» αντιγράφων του χρωμοσώματος 21. Τα δύο αντίγραφα στον καρυότυπο αποτελούν το φυσιολογικό ζεύγος των χρωμοσωμάτων. Το επιπλέον αντίγραφο, που είναι συνήθως ο μεγάλος βραχίονας του χρωμοσώματος 21, έχει μετατοπιστεί σε κάποιο άλλο χρωμόσωμα. Τα επιπλέον αντίγραφα των γονιδίων, που εντοπίζονται στο μεγάλο βραχίονα του χρωμοσώματος 21, φαίνεται να ευθύνονται για την εμφάνιση των συμπτωμάτων της συγκεκριμένης ασθένειας. Τα επιτεύγματα της έρευνα στη Γενετική συνεισφέρουν στην ανάπτυξη μεθόδων για τη διάγνωση των γενετικών ασθενειών. Οι γνώσεις που έχουμε αποκτήσει σε μοριακό επίπεδο για τους μηχανισμούς που δημιουργούν τις γενετικές ασθένειες μας έχουν προσφέρει τη δυνατότητα ανάπτυξης μεθόδων με τις οποίες ανιχνεύουμε γενετικές ανωμαλίες στα μέλη μιας οικογένειας ή στα άτομα ενός πληθυσμού. Η διάγνωση των γενετικών ασθενειών μας βοηθά: Στον όσο το δυνατόν πιο έγκαιρο εντοπισμό γενετικών ανωμαλιών στα άτομα που εξετάζονται. Στον εντοπισμό των φορέων γενετικών ασθενειών. Στον προσδιορισμό της πιθανότητας εμφάνισης μιας γενετικής ασθένειας στους απογόνους μιας οικογένειας στην οποία έχει παρουσιαστεί η ασθένεια. Η έγκαιρη διάγνωση μιας γενετικής ασθένειας προσφέρει τη δυνατότητα σχεδιασμού θεραπευτικής αγωγής, έτσι που να ελαχιστοποιούνται οι επιπλοκές της ασθένειας όπως στην περίπτωση της φαινυλκετονουρίας (PKU). Ο έλεγχος για τον εντοπισμό των πιθανών φορέων, όπως στις περιπτώσεις της δρεπανοκυτταρικής αναιμίας και των θαλασσαιμιών, πραγματοποιείται με σκοπό τον υπολογισμό της πιθανότητας δημιουργίας απογόνων που πάσχουν από τις συγκεκριμένες κληρονομικές ασθένειες. Ακόμη, στην περίπτωση διάγνωσης γενετικών ανωμαλιών κατά τη διενέργεια του προγεννητικού ελέγχου, δίνεται η δυνατότητα διακοπής της κύησης. Η διάγνωση των γενετικών ασθενειών μπορεί να πραγματοποιηθεί: Με τη μελέτη του καρυοτύπου, όπως για παράδειγμα κατά τον προγεννητικό έλεγχο. Με διάφορες βιοχημικές δοκιμασίες. Με την ανάλυση της αλληλουχίας των βάσεων του DNA (μοριακή διάγνωση). Στη συνέχεια αναφέρονται δύο περιπτώσεις εφαρμογής της παραπάνω μεθοδολογίας για τη διάγνωση της φαινυλκετονουρίας και της δρεπανοκυτταρικής αναιμίας. Η εφαρμογή προγράμματος ελέγχου των νεογνών για τη φαινυλκετονουρία έχει μειώσει σημαντικά τις περιπτώσεις διανοητικής καθυστέρησης από αυτή την ασθένεια. Ο έλεγχος για τη φαινυλκετονουρία πραγματοποιείται με τον υπολογισμό της συγκέντρωσης της φαινυλαλανίνης στο αίμα των νεογέννητων.

16 Η δρεπανοκυτταρική αναιμία είναι μία από τις λίγες γενετικές ασθένειες της οποίας ο μηχανισμός δημιουργίας έχει μελετηθεί διεξοδικά. Αυτό μας δίνει τη δυνατότητα διάγνωσης της ασθένειας με τη χρησιμοποίηση πολλών διαφορετικών τεχνικών. Μία από αυτές είναι η παρατήρηση της μορφολογίας των ερυθρών κυττάρων σε συνθήκες έλλειψης οξυγόνου. Στην περίπτωση όπου το άτομο πάσχει, τα ερυθροκύπαρά του παίρνουν δρεπανοειδές σχήμα (δοκιμασία δρεπάνωσης). Για τη διάγνωση της δρεπανοκυτταρικής αναιμίας χρησιμοποιούνται επίσης τεχνικές που επιτρέπουν τον προσδιορισμό της αιμοσφαιρίνης HbS στα ερυθροκύτταρα όπως και τον εντοπισμό του μεταλλαγμένου γονιδίου β S. Η γενετική καθοδήγηση μειώνει τις πιθανότητες απόκτησης απογόνων με γενετικές ανωμαλίες. Η γενετική καθοδήγηση είναι μία διαδικασία κατά την οποία ειδικοί επιστήμονες δίνουν πληροφορίες σε μεμονωμένα άτομα, ζευγάρια και οικογένειες που πάσχουν από κάποια γενετική ασθένεια ή έχουν αυξημένες πιθανότητες να την εμφανίσουν. Οι πληροφορίες αυτές είναι απαραίτητες για τους ενδιαφερόμενους, γιατί τους βοηθούν στη λήψη αποφάσεων, κυρίως σχετικά με την απόκτηση υγιών απογόνων. Ο ειδικός επιστήμονας είναι σε θέση να συμβουλέψει τους ενδιαφερόμενους, μόνο όταν διαθέτει τα απαραίτητα στοιχεία που του επιτρέπουν να γνωρίζει τη συγκεκριμένη γενετική ασθένεια, τη συχνότητα εμφάνισης της, τον τρόπο με τον οποίο κληρονομείται, τις επιπτώσεις στα άτομα που πάσχουν από αυτή, τους τρόπους αντιμετώπισής της κ.ά. Αν, για παράδειγμα, διαπιστωθεί ότι δύο υποψήφιοι γονείς είναι ετερόζυγοι για το γονίδιο β S, τότε ο σύμβουλος τους πληροφορεί ότι υπάρχει 25% πιθανότητα να αποκτήσουν παιδί που πάσχει από δρεπανοκυτταρική αναιμία (ομόζυγο για το γονίδιο β S ). Αν, όπως στο προηγούμενο παράδειγμα, υπάρχει αυξημένη πιθανότητα το έμβρυο να πάσχει από κάποια ανωμαλία, τότε είναι απαραίτητη η διενέργεια προγεννητικού ελέγχου. Με βάση τα αποτελέσματα του προγεννητικού ελέγχου καλούνται οι γονείς να αποφασίσουν, στην περίπτωση που το έμβρυο πάσχει από σοβαρή γενετική ανωμαλία, τη διακοπή της κύησης. Παρ' ότι γενετική καθοδήγηση μπορεί να ζητήσουν όλοι οι υποψήφιοι γονείς, υπάρχουν ομάδες ατόμων οι οποίες είναι απαραίτητο να απευθυνθούν σε ειδικούς πριν προχωρήσουν στην απόκτηση απογόνων. Σ' αυτές περιλαμβάνονται: Ατομα-φορείς γενετικών ασθενειών. Ατομα με οικογενειακό ιστορικό γενετικών ασθενειών. Γυναίκες ηλικίας 35 ετών και άνω. Γυναίκες με πολλαπλές αποβολές. Με την αμνιοπαρακέντηση λαμβάνεται από τον αμνιακό σάκο, με τη βοήθεια βελόνας, μικρή ποσότητα αμνιακού υγρού. Μέσα σε αυτό βρίσκονται εμβρυϊκά κύτταρα. Τα κύτταρα αυτά μπορούν να χρησιμοποιηθούν για την ανάλυση DNA και τη βιοχημική ανάλυση ορισμένων πρωτεϊνών και ενζύμων, όπως στην περίπτωση της φαινυλκετονουρίας. Επίσης, ύστερα από καλλιέργεια, τα εμβρυϊκά αυτά κύτταρα χρησιμοποιούνται για τη διάγνωση χρωμοσωμικών ανωμαλιών, με μελέτη του καρυότυπου. (Εικόνα 6.11). Η αμνιοπαρακέντηση πραγματοποιείται από την 12η-16η εβδομάδα της κύησης και αποτελεί έναν ασφαλή και αξιόπιστο τρόπο διάγνωσης των γενετικών ανωμαλιών. Με αμνιοπαρακέντηση μπορεί να ελεγχθεί η ύπαρξη περισσότερων από 100 γενετικών ανωμαλιών. Εναλλακτική μέθοδος προγεννητικού ελέγχου είναι η λήψη χοριακών λαχνών. Πραγματοποιείται συνήθως την 9η-12η εβδομάδα της κύησης και περιλαμβάνει τη λήψη εμβρυϊκών κυττάρων από τις προεκβολές (λάχνες) του χόριου (εμβρυϊκή μεμβράνη που συμμετέχει στο σχηματισμό του πλακούντα) (Εικόνα 6.11). Τα κύτταρα από τις χοριακές λάχνες μπορούν να χρησιμοποιηθούν τόσο για τον έλεγχο των χρωμοσωμάτων (καρυότυπος) όσο και για βιοχημικές αναλύσεις και ανάλυση DNA όπως στη δρεπανοκυπαρική αναιμία. Η αμνιοπαρακέντηση, σε σχέση με τη λήψη χοριακών λαχνών, μας δίνει τη δυνατότητα παρασκευής χρωμοσωμάτων καλύτερης ποιότητας. Αντίθετα, η λήψη χοριακών λαχνών δίνει τη δυνατότητα πιο έγκαιρης διάγνωσης. Στην περίπτωση διάγνωσης, με τον προγεννητικό έλεγχο, σοβαρών γενετικών ανωμαλιών είναι δυνατή η διακοπή της κύησης χωρίς να δημιουργεί πρόβλημα υγείας στη μητέρα.

17 Εικόνα 6.11 Προγεννητικός έλεγχος: α. με αμνιοπαρακέντηση ή β. με λήψη χοριακών λαχνών. Αυτόματες αποβολές και χρωμοσωμικές μεταλλάξεις Αυτόματη αποβολή είναι η διακοπή της κύησης πριν από την εικοστή τέταρτη εβδομάδα. Οι περισσότερες αποβολές, περίπου το 75%, συμβαίνουν πριν από την 16η εβδομάδα και παρατηρούνται στο 12% των κυήσεων. Μελέτες απέδειξαν ότι στο 50% των αποβολών τα έμβρυα έχουν χρωμοσωμικές ανωμαλίες. Από αυτές σε μεγαλύτερη συχνότητα εμφανίζονται οι τρισωμίες. Είναι φανερό ότι η αυθόρμητη αποβολή του εμβρύου λειτουργεί σαν είδος «αμυντικού μηχανισμού», ο οποίος αποτρέπει τη γέννηση παιδιού που φέρει σημαντικές χρωμοσωμικές ανωμαλίες. Ο καρκίνος προκαλείται από μεταλλάξεις γονιδίων που ελένγχουν τον κυτταρικό πολλαπλασιασμό Ο καρκίνος χαρακτηρίζεται από τον ανεξέλεγκτο πολλαπλασιασμό κυττάρων ενός ιστού. Αυτά σχηματίζουν μάζες κυττάρων (καρκινικοί όγκοι) ή μεταναστεύουν στο αίμα όπως στις διάφορες μορφές λευχαιμιών. Αποτελέσμα τα μελετών έχουν οδηγήσει στο συμπέρασμα ότι σχεδόν όλες οι περιπτώσεις καρκίνου προέρχονται από μεταλλάξεις γονιδίων σωματικών κυττάρων. Υπάρχουν δύο τύποι γονιδίων που σχετίζονται με την καρκινογένεση. Τα ογκογονίδια και τα ογκοκατασταλτικά γονίδια. Σχετικές έρευνες οδηγούν στο συμπέρασμα ότι ο καρκίνος σε γενετικό επίπεδο είναι το αποτέλεσμα: Μετατροπής πρωτο-ογκογονιδίων σε ογκογονίδια Απουσίας λειτουργικότητας ογκοκατασταλτικών γονιδίων και Αδρανοποίησης των μηχανισμών επιδιόρθωσης του DNA. Τα ογκογονίδια «προέρχονται» από γονίδια που υπάρχουν φυσιολογικά στο ανθρώπινο γονιδίωμα και ονομάζονται πρωτο-ογκογονίδια. Για ποιο λόγο όμως το κύτταρο να φέρει γονίδια τα οποία κάτω από συγκεκριμένες συνθήκες θα οδηγήσουν στην καταστροφή του; Βρέθηκε ότι όλα τα πρωτο-ογκογονίδια έχουν πολύ σημαντικό ρόλο στη φυσιολογική λειτουργία του κυττάρου, ενεργοποιώντας τον κυτταρικό πολλαπλασιασμό, σε περιπτώσεις που αυτός είναι απαραίτητος όπως στην επούλωση τραυμάτων. Όμως διάφορα είδη μεταλλάξεων, που μπορεί να προκληθούν από μεταλλαξογόνους παράγοντες, μετατρέπουν τα πρωτο-ογκογονίδια σε ογκογονίδια, τα οποία υπερλειτουργούν και οδηγούν το κύτταρο σε ανεξέλεγκτο πολλαπλασιασμό και δημιουργία καρκίνου. Η μετατροπή ενός πρωτο-ογκογονιδίου σε ογκογονίδιο μπορεί να είναι το αποτέλεσμα μιας γονιδιακής μετάλλαξης ή μιας χρωμοσωμικής ανωμαλίας, συνηθέστερα μετατόπισης. Τα ογκοκατασταλτικά γονίδια είναι γονίδια που ελέγχουν την κυτταρική διαίρεση, καταστέλλοντάς την, όποτε είναι απαραίτητο. Η αναστολή της δράσης τους που είναι συνήθως αποτέλεσμα μετάλλαξης, κυρίως έλλειψης γονιδίου, αφαιρεί από το κύτταρο τη δυνατότητα ελέγχου του πολλαπλασιασμού και οδηγεί σε καρκινογένεση. Χαρακτηριστικό παράδειγμα αποτελεί ο καρκίνος του αμφιβληστροειδούς (ρετινοβλάστωμα) που είναι αποτέλεσμα έλλειψης ενός ογκοκατασταλτικού γονιδίου.

18 Τέλος, βλάβες στους μηχανισμούς επιδιόρθωσης του DNA έχουν ως αποτέλεσμα την αυξημένη συχνότητα εμφάνισης καρκίνου. Τα άτομα, για παράδειγμα, που πάσχουν από μελαγχρωματική ξηροδερμία εμφανίζουν πολλαπλάσια συχνότητα καρκίνων του δέρματος, κυρίως στις περιοχές που εκτίθενται στην ακτινοβολία του ήλιου, σε σχέση με τα φυσιολογικά άτομα. Είναι γνωστό ότι η ασθένεια δημιουργείται από ανικανότητα επιδιόρθωσης βλαβών που προκαλούνται από την υπεριώδη ακτινοβολία λόγω μετάλλαξης των γονιδίων που επιδιορθωτικά ένζυμα. Όπως έγινε φανερό, ο καρκίνος σχετίζεται με αλλαγές στο γενετικό υλικό. Εντούτοις δεν κληρονομείται ως απλός Μενδελικός χαρακτήρας, αλλά είναι αποτέλεσμα αλληλεπίδρασης γενετικών και περιβαλλοντικών παραγόντων. Η πολυπλοκότητα της ασθένειας αυτής σχετίζεται με τα παρακάτω αίτια: Ο καρκίνος, σε αντίθεση με τις κληρονομικές ασθένειες, όπως η δρεπανοκυτταρική αναιμία, δεν προκαλείται από μία μετάλλαξη, αλλά από τη «συσσώρευση» αρκετών γενετικών αλλαγών στα κύτταρα. Οι μεταλλάξεις αυτές είναι αποτέλεσμα διαφορετικών περιβαλλοντικών μεταλλαξογόνων παραγόντων όπως η ακτινοβολία ή χημικές ουσίες. Στη δημιουργία κάθε είδους καρκίνου συμμετέχουν συνήθως τόσο τα ογκογονίδια όσο και τα ογκοκατασταλτικά γονίδια. Για παράδειγμα, στον καρκίνο του παχέος εντέρου βρέθηκε ότι συμμετέχουν αρκετά γονίδια και των δύο τύπων, τα οποία έχουν υποστεί μεταλλάξεις. Στάδια δημιουργίας καρκίνου του παχέος εντέρου Περιλαμβάνουν διαδοχική απενεργοποίηση ογκοκατασταλτικών γονιδίων και ενεργοποίηση ογκογονιδίων. Περίληψη Μετάλλαξη είναι μια αλλαγή στην αλληλουχία του DNA. Ο αντίστοιχος φαινότυπος ονομάζεται μεταλλαγμένος. Οι μεταλλάξεις προκαλούνται τυχαία ή από μεταλλαξογόνους παράγοντες, που είναι χημικές ουσίες και ακτινοβολίες. Οι μεταλλάξεις μπορεί να είναι γονιδιακές ή χρωμοσωμικές. Όταν η αλλαγή αφορά μικρό αριθμό βάσεων, τότε η μετάλλαξη είναι γονιδιακή. Όταν σχετίζεται με αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομαζεται χρωμοσωμική ανωμαλία. Οι γονιδιακές μεταλλάξεις είναι διαφόρων ειδών. Στην αντικατάσταση βάσης αλλάζει μία μόνο βάση του DNA. Στην προσθήκη ή έλλειψη προστίθενται ή αφαιρούνται αντίστοιχα βάσεις. Η αλλαγή αυτή μπορεί να τροποποιήσει το γονιδιακό προϊόν με δυσμενείς συνέπειες για τον οργανισμό... Οι χρωμοσωμικές ανωμαλίες αλλάζουν τον αριθμό ή τη δομή των χρωμοσωμάτων. Οι τρισωμίες (ένα επιπλέον χρωμόσωμα) εμφανίζονται συχνότερα από τις μονοσωμίες (έλλειψη ενός χρωμοσώματος) και προκαλούν λιγότερες βλάβες. Οι αριθμητικές χρωμοσωμικές ανωμαλίες των φυλετικών χρωμοσωμάτων είναι λιγότερο σοβαρές από αυτές των αυτοσωμάτων. Οι αριθμητικές χρωμοσωμικές ανωμαλίες δημιουργούνται από μη διαχωρισμό των χρωμοσωμάτων κατά τη μείωση. Έλλειψη είναι απώλεια γενετικού υλικού από ένα χρωμόσωμα. Κατά την αμοιβαία μετατόπιση δύο μη ομόλογα χρωμοσώματα ανταλλάσουν τμήματα. Αναστροφή είναι η λανθασμένη τοποθέτηση τμήματος χρωμοσώματος το οποίο έχει κοπεί και έχει τοποθετηθεί ύστερα από στροφή 180 μοιρών. Οι χρωμοσωμικές ανωμαλίες μελετώνται με τη δημιουργία του καρυότυπου, που αποτελεί απεικόνιση των χρωμοσωμάτων του ατόμου που μελετάται.

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα