Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών"

Transcript

1 Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ , Λευκωσία ΚΥΠΡΟΣ τηλ: (εσωτ. 2879)

2 Σύνοψη Εισαγωγή Ρόλος των πρωτεϊνών Σύσταση και χημική δομή Δευτεροταγής δομή Τριτοταγής και Τεταρτοταγής δομή Συζήτηση...

3 Οι πρωτεΐνες αποτελούν την Εργαλειοθήκη του κυττάρου

4 Οι πρωτεΐνες αποτελούν την Εργαλειοθήκη του κυττάρου Ενζυμική Κατάλυση Μεταφορά και Αποθήκευση Κίνηση Μηχανική στήριξη Μοριακή αναγνώριση/δέσμευση Κυτταρική επικοινωνία...

5 Οι πρωτεΐνες είναι μόρια με καθορισμένη χημική δομή Γραμμικά Πολυμερή (Fischer & Hofmeister, 's) Δομική μονάδα στη φύση: L-α-αμινοξέα Η αμινοξική ακολουθία είναι συγκεκριμένη (Sanger, 1952)

6 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

7 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

8 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

9 Ο πεπτιδικός δεσμός

10 Πολυπεπτιδική αλυσίδα

11 Φ, Ψ και πρωτεϊνικές στερεοδιατάξεις Επίπεδες πεπτιδικές ομάδες Μήκη δεσμών, γωνίες δεσμών ~ σταθερά Οι Φ, Ψ αποτελούν τις μοναδικές ελεύθερες παραμέτρους της πολυπεπτιδικής αλυσίδας (πόσες??)

12 Διάγραμμα Ramachandran Left handed ΕΙΔΙΚΕΣ ΠΕΡΙΠΤΩΣΕΙΣ GLY PRO

13 Η δομή των πρωτεϊνών ακολουθεί μια ιεραρχία Πρωτοταγής Αμινοξική Ακολουθία Δευτεροταγής Τοπικές διαμορφώσεις της πολυπεπτιδικής αλυσίδας Τριτοταγής Τρισδιάστατο Δίπλωμα (Fold) Τεταρτοταγής Αλληλεπιδράσεις πρωτεΐνης-πρωτεΐνης

14 Δευτεροταγής δομή πρωτεϊνών Ελικοειδείς δομές Δεξιόστροφη α-έλικα πολυαλανίνης

15 Σχηματισμός Υδρογονικών Δεσμών

16 Χαρακτηριστικά ελικοειδών δομών

17 Η δεξιόστροφη α-έλικα

18 Εκτεταμένες δομές - β-κλώνοι Το 10-πεπτίδιο VLIFWYTCQM σε εκτεταμένη διαμόρφωση

19 Σχηματισμός Υδρογονικών Δεσμών β-πτυχωτές επιφάνειες

20 Χαρακτηριστικά εκτεταμένων δομών

21 Άλλες δευτεροταγείς δομές Δεν επιδεικνύουν κανονικότητες Δύσκολη κατάταξη περιγραφή Loop/Coil Συνοπτικά: Στροφές (Φουρκέτες, Ω) β-διόγκωση (β-bulge) Τυχαίες (μη κανονικές) δομές [random coil] Αριστερόστροφη έλικα κολλαγόνου Δισουλφιδικοί δεσμοί

22 Υπερδευτεροταγείς Δομές (Motifs) Κανονικοί συνδυασμοί 2-ταγών δομών Όχι απαραίτητα δομικά ανεξάρτητες Συχνή εμφάνιση (ενεργειακή προτίμηση??) Συσχέτιση με λειτουργικά χαρακτηριστικά Συχνή συσχέτιση με μοτίβα 1-ταγούς δομής

23 Δάκτυλος Zn (C2H2)

24 HTH-motif

25 Motifs και ακολουθία?? Subtilisin Asp102, His57, Ser195 Chymotrypsin Asp32, His64, Ser221

26 Δίπλωμα (folding) (Πολικές) Αλληλεπιδράσεις με Η2Ο Καθοδηγείται από ενδομοριακές αλληλεπιδράσεις Υδροφοβικές [Δημιουργία Υδρόφοβου Πυρήνα] Ιοντικά ζεύγη/δεσμοί άλατος Δεσμοί (γέφυρες) Υδρογόνου Ομοιοπολικοί δεσμοί (??) Ακολουθία??=> 3D-δομή The Folding Problem

27 Αυτοτελή Δομικά Στοιχεία (domains) Αυθύπαρκτες δομικές οντότητες Διακριτή οργάνωση Ανεξάρτητες στο Δίπλωμα Λειτουργική αυτοτέλεια Όχι πάντα συνεχόμενα τμήματα πολυπεπτιδικής αλυσίδας Όχι πάντα από την ίδια πολυπεπτιδική αλυσίδα Όμοια domains?? Κοινή Λειτουργία??

28 Εκφυλισμός ανωτέρου επιπέδου!! Τεράστια ποικιλία αμινοξικών ακολουθιών Περιορισμένα (~104) είδη διπλώματος Μωσαϊκές δομές LEGO Σύντηξη γονιδίων (gene fusion) Ανακατάταξη εξονίων (exon shuffling)

29 Τεταρτοταγής Δομή Πρωτεϊνών Σχηματισμός Υπερμοριακών Δομών Why? Δημιουργία πολύπλοκων κυτταρικών μηχανών Εντοπισμός συνιστωσών μεταβολικών μονοπατιών Δημιουργία μοριακών ικριωμάτων Συνεργατικότητα μεταξύ υπομονάδων How?? Συμμετρικά (χώρου, γραμμική, σημείου) ή Ασύμμετρα Συμπληρωματικότητα επιφανειών επαφής [ειδικότητα] Κυρίως υδροφοβικές αλληλεπιδράσεις Δεσμοί άλατος/η-δεσμοί

30 Coiled-coils Φερμουάρ Λευκίνης Τροπομυοσίνη

31

32

33 Συζήτηση...

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Κατάταξη 2. Λειτουργίες 1. Πεπτιδικές ορμόνες 3. Πεπτιδικός δεσμός 1. Χαρακτηριστικά

Διαβάστε περισσότερα

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι

Διαβάστε περισσότερα

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής - Αναφέρεται στην αναδίπλωση της πολυπεπτιδικής αλυσίδας πάνω στον εαυτό της και στο τελικό σχήμα που θα πάρει στο χώρο -Σ αυτή τη διαμόρφωση σημαντικό ρόλο

Διαβάστε περισσότερα

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Β-1 Οι συμπαγείς, σφαιροειδείς πρωτεΐνες Είναι ευδιάλυτες στο νερό Έχουν σφαιρικό σχήμα Έχουν τα περισσότερα πολικά αμινοξέα στην εξωτερική

Διαβάστε περισσότερα

Κεφάλαιο 1. Οι δομικοί λίθοι

Κεφάλαιο 1. Οι δομικοί λίθοι Κεφάλαιο 1 Οι δομικοί λίθοι Κεφάλαιο 1 Οι Δομικοί Λίθοι των Πρωτεϊνών Εικόνα 1.1 Η αμινοξική αλληλουχία μιας πρωτεϊνικής πολυπεπτιδικής αλυσίδας ονομάζεται πρωτοταγής δομή. Διαφορετικές περιοχές της αλληλουχίας

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Υπερδευτεροταγής Δομή Πρωτεϊνών

Υπερδευτεροταγής Δομή Πρωτεϊνών Υπερδευτεροταγής Δομή Πρωτεϊνών Δομικά μοτίβα Τα μοτίβα ακολουθιών (sequence motifs) είναι τοπικά διατηρημένες ακολουθίες που σχετίζονται (ή όχι) με μια συγκεκριμένη λειτουργία (βλ. τη βάση δεδομένων PROSITE)

Διαβάστε περισσότερα

Πρωτεινική αναδίπλωση

Πρωτεινική αναδίπλωση Πρωτεινική αναδίπλωση Η αμινοξική αλληλουχία καθορίζει την τριτοταγή δομή - Οι πληροφορίες για τη βιολογικά δραστική στερεοδιάταξη είναι κωδικοποιημένες στην αμινοξική αλληλουχία Ριβονουκλεάση- Anfinsen,

Διαβάστε περισσότερα

Κεφάλαιο 22 Πρωτεΐνες

Κεφάλαιο 22 Πρωτεΐνες Κεφάλαιο 22 Πρωτεΐνες Σύνοψη Οι πρωτεΐνες είναι μακρομόρια που προκύπτουν από την ένωση α-αμινοξέων. Τα α-αμινοξέα είναι οργανικές ενώσεις που έχουν μία αμινομάδα (ΝΗ 2 ) και καρβοξύλιο (COOH) συνδεδεμένα

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 2 η διάλεξη

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 2 η διάλεξη Βιοφυσική ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο 2009-10) 2 η διάλεξη Πρωτεΐνες Πρωτεΐνη: πολυμερές από αμινοξέα 20 διαφορετικά αμινοξέα CH 2 Pro Ένα από αυτά είναι η Προλίνη CH 2 CH 2 NH C α

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Πρωτοταγής δομή (αλληλουχία αμινοξέων) Δευτεροταγής δομή Η διάταξη της πεπτιδικής αλυσίδας στον χωρο αυτής καθ αυτής (χωρίς να ληφθούν υπ όψη οι ομάδες R) Τριτοταγής

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής Κεφάλαιο 2 Μοτίβα πρωτεϊνικής δομής Εικόνα 2.1 Το μοντέλο του Kendrew για τη δομή χαμηλής διακριτικότητας της μυοσφαιρίνης όπως φαίνεται από τρεις διαφορετικές οπτικές γωνίες. Οι επιμήκεις περιοχές αντιπροσωπεύουν

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

Άσκηση 7. Προσομοίωση 3D Δομών Βιομορίων μέσω. Ομολογίας & Threading

Άσκηση 7. Προσομοίωση 3D Δομών Βιομορίων μέσω. Ομολογίας & Threading Άσκηση 7 Προσομοίωση 3D Δομών Βιομορίων μέσω Ομολογίας & Threading Προσομοίωση 2ταγούς δομής πρωτεϊνών Δευτεροταγής Δομή: Η 2ταγής δομή των πρωτεϊνών είναι σταθερή τοπική διαμόρφωση της πολυπεπτιδικής

Διαβάστε περισσότερα

ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ

ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ Παππάς Χρήστος Επίκουρος καθηγητής ΑΜΙΝΟΞΕΑ Αμινοξέα είναι οργανικά μόρια που διαθέτουν καρβοξύλιο (-α) και αμινομάδα (-ες). Πλευρική αλυσίδα R NH 2 α O α- αμινοξύ OH Είναι

Διαβάστε περισσότερα

ΔΟΜΗ ΠΡΩΤΕΪΝΩΝ II. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου

ΔΟΜΗ ΠΡΩΤΕΪΝΩΝ II. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου ΔΟΜΗ ΠΡΩΤΕΪΝΩΝ II Σελίδα 1 Υπολογιστικός Προσδιορισμός Δομής πειραματικός προσδιορισμός δομών κρυσταλλογραφία ακτίνων X πυρηνικός μαγνητικός συντονισμός (NMR) χρόνος / κόστος / περιορισμοί sequence - structure

Διαβάστε περισσότερα

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας αμινοξέα Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων Λυσίνη CORN Ισομερές L Ισομερές D R = πλευρική αλυσίδα (side chain) Τα περισσότερα αμινοξέα είναι ασύμμετρα Όλα τα αμινοξέα που βρίσκονται στις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Πρωτεΐνες Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Ενεργειακή ανάλυση βιομορίων

Ενεργειακή ανάλυση βιομορίων Ενεργειακή ανάλυση βιομορίων Τα βιομόρια ως φυσικά συστήματα πρωτεΐνες, DNA, πεπτίδια, μικρά μόρια (ligands, φάρμακα) Αλληλεπιδράσεις μεταξύ των ατόμων + επίδραση του περιβάλλοντος νερού σταθεροποίηση

Διαβάστε περισσότερα

Εισαγωγή στη Μοριακή Προσοµοίωση

Εισαγωγή στη Μοριακή Προσοµοίωση Κεφάλαιο 6 Εισαγωγή στη Μοριακή Προσοµοίωση 6.1. Μοριακή Μηχανική 6.1.1. Εισαγωγή στη µεθοδολογία του «απ αρχής» διπλώµατος της πρωτείνης. Η ενέργεια κάθε µορίου µπορεί θεωρητικά να υπολογιστεί µε την

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών

Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών (σε

Διαβάστε περισσότερα

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή Κεφάλαιο 2 2.1 Εισαγωγή 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο της δευτεροταγούς δοµής 2.4 Η α-έλικα έχει διϖολική ροϖή 2.5 Κάϖοια αµινοξέα ϖροτιµώνται

Διαβάστε περισσότερα

«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ»

«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του;

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; Β-Α γιατί το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του άρα θα γράφεται

Διαβάστε περισσότερα

Αρχές οµικής Βιοπληροφορικής. Πρωτεΐνες. Αµινοξέα. (Υδρόφοβα)

Αρχές οµικής Βιοπληροφορικής. Πρωτεΐνες. Αµινοξέα. (Υδρόφοβα) Αρχές οµικής Βιοπληροφορικής Πρωτεΐνες Αµινοξέα (Υδρόφοβα) Αµινοξέα Αµινοξέα (πολικά) Αµινοξέα φορτισµένα πολικά Αµινοξέα (φορτισµένα) Αµινοξέα Αµινοξέα Αµινοξέα Τί µένει; Σπάνια αµινοξέα πρωτεϊνών (π.χ.

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Κεφάλαιο 5 β-δομές Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Οι β-επικράτειες είναι οι δομές οι οποίες αποτελούν την δεύτερη μεγάλη ομάδα πρωτεϊνικών επικρατειών. Η ομάδα αυτή παρουσιάζει τη μεγαλύτερη ποικιλομορφία

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

Κεφάλαια 8 ο Ένζυμα και κατάλυση

Κεφάλαια 8 ο Ένζυμα και κατάλυση Κεφάλαια 8 ο Ένζυμα και κατάλυση Τα ένζυμα είναι βιομόρια που μεσολαβούν στους χημικούς μετασχηματισμούς και στη μετατροπή της ενέργειας Κύρια χαρακτηριστικά τους η ισχύς και η εξειδίκευση Πλέον θα τα

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΑΜΙΝΟΞΕΑ-ΠΡΩΤΕΪΝΕΣ. Γνωστικό αντικείμενο: Βιολογία. Δημιουργός: ΠΑΝΑΓΙΩΤΗΣ ΚΩΣΤΑΡΙΔΗΣ

ΑΜΙΝΟΞΕΑ-ΠΡΩΤΕΪΝΕΣ. Γνωστικό αντικείμενο: Βιολογία. Δημιουργός: ΠΑΝΑΓΙΩΤΗΣ ΚΩΣΤΑΡΙΔΗΣ ΑΜΙΝΟΞΕΑ-ΠΡΩΤΕΪΝΕΣ Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Βιολογία Δημιουργός: ΠΑΝΑΓΙΩΤΗΣ ΚΩΣΤΑΡΙΔΗΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το παρόν

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Τα τείχη έχουν πέσει: Κυτταρική Βιολογία, Βιοχημεία, Γενετική γέννησαν τη σύγχρονη Βιοϊατρική. Βιοχημεία Ι Α-2

Τα τείχη έχουν πέσει: Κυτταρική Βιολογία, Βιοχημεία, Γενετική γέννησαν τη σύγχρονη Βιοϊατρική. Βιοχημεία Ι Α-2 Περιεχόμενο της σύγχρονης Βιοχημείας Η περιγραφή της δομής, της οργάνωσης και της λειτουργίας του κυττάρου σε μοριακό επίπεδο Η διερεύνηση της σχέσης δομής-λειτουργίας των βιομορίων Η μελέτη του μεταβολισμού

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Χαρακτηριστικά της δομής της Μυοσφαιρίνης

Χαρακτηριστικά της δομής της Μυοσφαιρίνης Χαρακτηριστικά της δομής της Μυοσφαιρίνης Η μυοσφαιρίνη είναι ενα εξαιρετικά συμπαγές μόριο.οι διαστάσεις είναι 45Χ35Χ25 Α και υπαρχει πολύ λίγος αδειος χώρος στο εσωτερικό τού μορίου Γυρω στα 75% της

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Ζήτηµα 1ο Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth. ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.gr Σύνοψη των όσων εξετάσαμε για τους ιοντικούς διαύλους: 1. Διαπερνούν

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1ο ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ 2010-11 ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1 ο : ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ ΚΑΙ ΒΙΟΧΗΜΕΙΑ 1. Τι είναι η Βιοχημεία και με ποιες ενώσεις ασχολείται. 2. Πόσα και ποια στοιχεία

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM Γενικό Λύκειο Μοιρών 2012-2013 ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM ΩΣΜΩΣΗ-ΜΕΤΟΥΣΙΩΣΗ Γρηγοράκη Αγγελική Ντρετάκη Αγάπη Πηρουνάκη Στέλλα Πολυχρονάκη Παναγιώτα ΠΕΡΙΕΧΟΜΕΝΑ Εισαγωγή..3 Μεθοδολογία.4

Διαβάστε περισσότερα

Η πλειοψηφία των αμινοξέων είναι του τύπου :

Η πλειοψηφία των αμινοξέων είναι του τύπου : ΚΕΦΑΛΑΙΟ 5 Η πλειοψηφία των αμινοξέων είναι του τύπου : H 2 NCHCOOH R O συνδυασμός καρβοξυλίου και αμινομάδας στο μόριό τους έχει ως αποτέλεσμα να συμπεριφέρονται είτε ως οξέα είτε ως βάσεις (αμφολύτες).

Διαβάστε περισσότερα

Προγνωστικές μέθοδοι με βάση αμινοξικές αλληλουχίες

Προγνωστικές μέθοδοι με βάση αμινοξικές αλληλουχίες Προγνωστικές μέθοδοι με βάση αμινοξικές αλληλουχίες Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus ΣΥΝΟΨΗ Εισαγωγή Πρόγνωση της δομής πρωτεϊνών

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑ ΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Πρόβλεψη της δοµής και της λειτουργίας των πρωτεϊνών µέσω

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ Διδάσκοντες: Δ.Δ. Λεωνίδας, Α.-Μ. Ψαρρά Κωδικός e-class: SEYC194 28/9/2015 Δ.Δ. Λεωνίδας 28/9/2015 Δ.Δ. Λεωνίδας Βιοχημεία είναι η Χημεία που εμφανίζεται μέσα στους ζώντες οργανισμούς

Διαβάστε περισσότερα

Οργανική χηµεία και βιοχηµεία

Οργανική χηµεία και βιοχηµεία Οργανική χηµεία και βιοχηµεία Ερωτήσεις πολλαπλής επιλογής 1. Στις χηµικές ενώσεις, που αποτελούν το κύτταρο, περιέχονται περίπου a) δέκα χηµικά στοιχεία b) ενενήντα χηµικά στοιχεία c) είκοσι χηµικά στοιχεία

Διαβάστε περισσότερα

Κυκλικός διχρωισµός, Circular Dichroism (CD)

Κυκλικός διχρωισµός, Circular Dichroism (CD) Κυκλικός διχρωισµός, Circular Dichroism (CD) Κυκλικός διχρωισµός Προβλήµατα που µπορούν να διερευνηθούν µε CD: Στοιχεία δευτεροταγούς δοµής. Αλλαγές στη διαµόρφωση πρωτεϊνών που οφείλονται σε µεταβολές

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ 1)Πώς το φαινόμενο Bohr επηρεάζει την πρόσδεση οξυγόνου στην αιμοσφαιρίνη; Που συνδέονται τα ιόντα

Διαβάστε περισσότερα

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Είναι απλή πολυπεπτιδική αλυσίδα 307 αμινοξέων Είναι συμπαγής και έχει σχήμα ελλειψοειδές διαστάσεων 50 x 42 x 38 A Περιέχει περιοχές α-έλικος 38%

Διαβάστε περισσότερα

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Tάσος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΑΘΗΝΑ 2001 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1. Εισαγωγή στην Μοριακή Αναγνώριση 1.1. Εισαγωγή 1.2. Παραδείγματα Κεφάλαιο 2. Δομικά στοιχεία βιομορίων

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Γιώργος Τσιάµης Επίκουρος Καθηγητής Περιβαλλοντικής Μικροβιολογίας Η Περιβαλλοντική Μικροβιολογία επηρεάζει σε µεγάλο βαθµό τις περιβαλλοντικές επιστήµες γιατί συµβάλλει στην!

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο ΚΥΚΛΙΚΟΣ ΔΙΧΡΩΙΣΜΟΣ Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο όταν το διάνυσμα του ηλεκτρικού πεδίου ταλαντεύεται κατά μήκος μιας ίσιας γραμμής τότε τα κύματα λέγονται επίπεδα ή γραμμικώς πολωμένα Γραμμικώς

Διαβάστε περισσότερα

Η δομή συναντά τη λειτουργία: η Μολυβοτρανσφεράση

Η δομή συναντά τη λειτουργία: η Μολυβοτρανσφεράση Η δομή συναντά τη λειτουργία: η Μολυβοτρανσφεράση Στέφανος Γιαγτζόγλου Η σχέση αλληλεξάρτησης δομής-λειτουργίας αποτελεί βασικό θέμα της βιολογίας. Μια σημαντική εφαρμογή αυτής της σχέσης αποτελεί το πώς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα Ευκαρυωτικό χρωµόσωµα και χρωµατίνη 10/03/2015 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου. Στην

Διαβάστε περισσότερα

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ Αυτοσυγκρότηση υπερμοριακων δομών Υπενθύμιση: κολλαγονο ΚΑΨΙΔΙΑ (ΚΕΛΥΦΗ) ΙΩΝ ΚΑΙ

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα