Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών"

Transcript

1 Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ , Λευκωσία ΚΥΠΡΟΣ τηλ: (εσωτ. 2879)

2 Σύνοψη Εισαγωγή Ρόλος των πρωτεϊνών Σύσταση και χημική δομή Δευτεροταγής δομή Τριτοταγής και Τεταρτοταγής δομή Συζήτηση...

3 Οι πρωτεΐνες αποτελούν την Εργαλειοθήκη του κυττάρου

4 Οι πρωτεΐνες αποτελούν την Εργαλειοθήκη του κυττάρου Ενζυμική Κατάλυση Μεταφορά και Αποθήκευση Κίνηση Μηχανική στήριξη Μοριακή αναγνώριση/δέσμευση Κυτταρική επικοινωνία...

5 Οι πρωτεΐνες είναι μόρια με καθορισμένη χημική δομή Γραμμικά Πολυμερή (Fischer & Hofmeister, 's) Δομική μονάδα στη φύση: L-α-αμινοξέα Η αμινοξική ακολουθία είναι συγκεκριμένη (Sanger, 1952)

6 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

7 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

8 Πλευρικές αλυσίδες (R) και φυσικοχημεία πρωτεϊνών

9 Ο πεπτιδικός δεσμός

10 Πολυπεπτιδική αλυσίδα

11 Φ, Ψ και πρωτεϊνικές στερεοδιατάξεις Επίπεδες πεπτιδικές ομάδες Μήκη δεσμών, γωνίες δεσμών ~ σταθερά Οι Φ, Ψ αποτελούν τις μοναδικές ελεύθερες παραμέτρους της πολυπεπτιδικής αλυσίδας (πόσες??)

12 Διάγραμμα Ramachandran Left handed ΕΙΔΙΚΕΣ ΠΕΡΙΠΤΩΣΕΙΣ GLY PRO

13 Η δομή των πρωτεϊνών ακολουθεί μια ιεραρχία Πρωτοταγής Αμινοξική Ακολουθία Δευτεροταγής Τοπικές διαμορφώσεις της πολυπεπτιδικής αλυσίδας Τριτοταγής Τρισδιάστατο Δίπλωμα (Fold) Τεταρτοταγής Αλληλεπιδράσεις πρωτεΐνης-πρωτεΐνης

14 Δευτεροταγής δομή πρωτεϊνών Ελικοειδείς δομές Δεξιόστροφη α-έλικα πολυαλανίνης

15 Σχηματισμός Υδρογονικών Δεσμών

16 Χαρακτηριστικά ελικοειδών δομών

17 Η δεξιόστροφη α-έλικα

18 Εκτεταμένες δομές - β-κλώνοι Το 10-πεπτίδιο VLIFWYTCQM σε εκτεταμένη διαμόρφωση

19 Σχηματισμός Υδρογονικών Δεσμών β-πτυχωτές επιφάνειες

20 Χαρακτηριστικά εκτεταμένων δομών

21 Άλλες δευτεροταγείς δομές Δεν επιδεικνύουν κανονικότητες Δύσκολη κατάταξη περιγραφή Loop/Coil Συνοπτικά: Στροφές (Φουρκέτες, Ω) β-διόγκωση (β-bulge) Τυχαίες (μη κανονικές) δομές [random coil] Αριστερόστροφη έλικα κολλαγόνου Δισουλφιδικοί δεσμοί

22 Υπερδευτεροταγείς Δομές (Motifs) Κανονικοί συνδυασμοί 2-ταγών δομών Όχι απαραίτητα δομικά ανεξάρτητες Συχνή εμφάνιση (ενεργειακή προτίμηση??) Συσχέτιση με λειτουργικά χαρακτηριστικά Συχνή συσχέτιση με μοτίβα 1-ταγούς δομής

23 Δάκτυλος Zn (C2H2)

24 HTH-motif

25 Motifs και ακολουθία?? Subtilisin Asp102, His57, Ser195 Chymotrypsin Asp32, His64, Ser221

26 Δίπλωμα (folding) (Πολικές) Αλληλεπιδράσεις με Η2Ο Καθοδηγείται από ενδομοριακές αλληλεπιδράσεις Υδροφοβικές [Δημιουργία Υδρόφοβου Πυρήνα] Ιοντικά ζεύγη/δεσμοί άλατος Δεσμοί (γέφυρες) Υδρογόνου Ομοιοπολικοί δεσμοί (??) Ακολουθία??=> 3D-δομή The Folding Problem

27 Αυτοτελή Δομικά Στοιχεία (domains) Αυθύπαρκτες δομικές οντότητες Διακριτή οργάνωση Ανεξάρτητες στο Δίπλωμα Λειτουργική αυτοτέλεια Όχι πάντα συνεχόμενα τμήματα πολυπεπτιδικής αλυσίδας Όχι πάντα από την ίδια πολυπεπτιδική αλυσίδα Όμοια domains?? Κοινή Λειτουργία??

28 Εκφυλισμός ανωτέρου επιπέδου!! Τεράστια ποικιλία αμινοξικών ακολουθιών Περιορισμένα (~104) είδη διπλώματος Μωσαϊκές δομές LEGO Σύντηξη γονιδίων (gene fusion) Ανακατάταξη εξονίων (exon shuffling)

29 Τεταρτοταγής Δομή Πρωτεϊνών Σχηματισμός Υπερμοριακών Δομών Why? Δημιουργία πολύπλοκων κυτταρικών μηχανών Εντοπισμός συνιστωσών μεταβολικών μονοπατιών Δημιουργία μοριακών ικριωμάτων Συνεργατικότητα μεταξύ υπομονάδων How?? Συμμετρικά (χώρου, γραμμική, σημείου) ή Ασύμμετρα Συμπληρωματικότητα επιφανειών επαφής [ειδικότητα] Κυρίως υδροφοβικές αλληλεπιδράσεις Δεσμοί άλατος/η-δεσμοί

30 Coiled-coils Φερμουάρ Λευκίνης Τροπομυοσίνη

31

32

33 Συζήτηση...

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Εισαγωγή στη Μοριακή Προσοµοίωση

Εισαγωγή στη Μοριακή Προσοµοίωση Κεφάλαιο 6 Εισαγωγή στη Μοριακή Προσοµοίωση 6.1. Μοριακή Μηχανική 6.1.1. Εισαγωγή στη µεθοδολογία του «απ αρχής» διπλώµατος της πρωτείνης. Η ενέργεια κάθε µορίου µπορεί θεωρητικά να υπολογιστεί µε την

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή Κεφάλαιο 2 2.1 Εισαγωγή 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο της δευτεροταγούς δοµής 2.4 Η α-έλικα έχει διϖολική ροϖή 2.5 Κάϖοια αµινοξέα ϖροτιµώνται

Διαβάστε περισσότερα

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών

Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών Αρχές Δοµικής Βιοπληροφορικής Πρωτεϊνών (σε

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.

ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ. Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth. ΓΕΝΙΚΗ ΦΥΣΙΟΛΟΓΙΑ Γιώργος Ανωγειανάκις Εργαστήριο Πειραματικής Φυσιολογίας 2310-999054 (προσωπικό) 2310-999185 (γραμματεία) anogian@auth.gr Σύνοψη των όσων εξετάσαμε για τους ιοντικούς διαύλους: 1. Διαπερνούν

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM

ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM Γενικό Λύκειο Μοιρών 2012-2013 ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ: AN EXPERIMENTAL BIOLOGY MYSEYM ΩΣΜΩΣΗ-ΜΕΤΟΥΣΙΩΣΗ Γρηγοράκη Αγγελική Ντρετάκη Αγάπη Πηρουνάκη Στέλλα Πολυχρονάκη Παναγιώτα ΠΕΡΙΕΧΟΜΕΝΑ Εισαγωγή..3 Μεθοδολογία.4

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑ ΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Πρόβλεψη της δοµής και της λειτουργίας των πρωτεϊνών µέσω

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Tάσος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο ΚΥΚΛΙΚΟΣ ΔΙΧΡΩΙΣΜΟΣ Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο όταν το διάνυσμα του ηλεκτρικού πεδίου ταλαντεύεται κατά μήκος μιας ίσιας γραμμής τότε τα κύματα λέγονται επίπεδα ή γραμμικώς πολωμένα Γραμμικώς

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ Αυτοσυγκρότηση υπερμοριακων δομών Υπενθύμιση: κολλαγονο ΚΑΨΙΔΙΑ (ΚΕΛΥΦΗ) ΙΩΝ ΚΑΙ

Διαβάστε περισσότερα

ΤΟ ΜΕΤΑΞΙ ΙΑΘΕΜΑΤΙΚΗ ΠΡΟΣΕΓΓΙΣΗ ΤΟΥ ΜΕΤΑΞΙΟΥ- Ι ΑΚΤΙΚΗ ΠΡΟΤΑΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ

ΤΟ ΜΕΤΑΞΙ ΙΑΘΕΜΑΤΙΚΗ ΠΡΟΣΕΓΓΙΣΗ ΤΟΥ ΜΕΤΑΞΙΟΥ- Ι ΑΚΤΙΚΗ ΠΡΟΤΑΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΤΟ ΜΕΤΑΞΙ ΙΑΘΕΜΑΤΙΚΗ ΠΡΟΣΕΓΓΙΣΗ ΤΟΥ ΜΕΤΑΞΙΟΥ- Ι ΑΚΤΙΚΗ ΠΡΟΤΑΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Κωνσταντογιάννη Μαρία MSc Χηµικός Εκπαιδευτικός, Mεταπτυχιακή ιχηνετ-εκπα, Τηλ.- Fax.210 9353556, e-mail:markonst@yahoo.gr Εισαγωγή

Διαβάστε περισσότερα

Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΜΕ ΕΦΑΡΜΟΓΗ ΤΟΥ ΣΥΝΕΧΟΥΣ ΜΕΤΑΣΧΗΜΑΤΙΣΜΟΥ ΚΥΜΑΤΙΔΙΩΝ

Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΜΕ ΕΦΑΡΜΟΓΗ ΤΟΥ ΣΥΝΕΧΟΥΣ ΜΕΤΑΣΧΗΜΑΤΙΣΜΟΥ ΚΥΜΑΤΙΔΙΩΝ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ & ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ Διπλωματική Εργασία ΕΝΤΟΠΙΣΜΟΣ ΠΕΠΤΙΔΙΟΥ ΣΗΜΑΤΟΣ ΣΕ ΔΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ

οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ οµή και λειτουργία των πρωτεϊνών Κρύσταλλοι ανθρώπινης ινσουλίνης. Η ινσουλίνη είναι µια πρωτεϊνική ορ- µόνη, απολύτως απαραίτητη για τη διατήρηση των επιπέδων του σακχάρου στο αίµα. (Κάτω) Αυτό που προσδιορίζει

Διαβάστε περισσότερα

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια, 2007-2008 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους:

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: (α) Αποτελούν βασικά δομικά συστατικά του σώματος (β) Εξυπηρετούν ενεργειακές

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson Francis Crick δίπλα το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2013 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ Η ΕΝΝΟΙΑ ΤΗΣ ΚΑΤΑΛΥΣΗΣ ΣΤΗΝ ΧΗΜΕΙΑ ΚΑΙ ΤΗΝ ΒΙΟΛΟΓΙΑ Παράδειγμα: η αναγωγή του αζώτου σε αμμωνία Ν 2 + 3Η

Διαβάστε περισσότερα

5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων

5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων 5. Συμμετρία, Πολικότητα και Οπτική Ενεργότητα των μορίων ιδακτικοί στόχοι Μετά την ολοκλήρωση της μελέτης του κεφαλαίου αυτού θα μπορείτε να... o προβλέπετε με βάση τη συμμετρία αν ένα μόριο έχει μόνιμη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 ο ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

1.Μαθησιακοί στόχοι του μαθήματος

1.Μαθησιακοί στόχοι του μαθήματος BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1.Μαθησιακοί στόχοι του μαθήματος της ΒΙΟΧΗΜΕΙΑΣ (ΕΤΥ-232) 1)εξοικείωση των φοιτητών με τον μοριακό σχεδιασμό της ζωής 2)εμπέδωση της δομής και λειτουργίας

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Σηµειώσεις Βιοπληροφορικής. Στοιχεία Αρχιτεκτονικής της τρισδιάστατης δοµής πρωτεϊνών. Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δοµών

Σηµειώσεις Βιοπληροφορικής. Στοιχεία Αρχιτεκτονικής της τρισδιάστατης δοµής πρωτεϊνών. Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δοµών Σηµειώσεις Βιοπληροφορικής Στοιχεία Αρχιτεκτονικής της τρισδιάστατης δοµής πρωτεϊνών. Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δοµών ΒΑΣΙΛΗΣ ΠΡΟΜΠΟΝΑΣ ΑΘΗΝΑ 2004-2005, ΛΕΥΚΩΣΙΑ 2006 ΣΤΟΙΧΕΙΑ ΠΡΩΤΕΪΝΙΚΗΣ

Διαβάστε περισσότερα

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ εσµός Υδρογόνου 1) Τι ονοµάζεται δεσµός υδρογόνου; εσµός ή γέφυρα υδρογόνου : είναι µια ειδική περίπτωση διαµοριακού δεσµού διπόλου-διπόλου,

Διαβάστε περισσότερα

3. 2. 6. 4 Μηχανισµός αποδιάταξης πρωτεϊνών µε µηχανική κατεργασία. 3. 2. 6. 5 Μηχανισµός αποδιάταξης πρωτεϊνών µε πίεση

3. 2. 6. 4 Μηχανισµός αποδιάταξης πρωτεϊνών µε µηχανική κατεργασία. 3. 2. 6. 5 Μηχανισµός αποδιάταξης πρωτεϊνών µε πίεση Άσκηση 3 Πρωτεΐνες 3. 1 Σκοπός της άσκησης 3. 2 Εισαγωγή-Θεωρητικό Μέρος 3. 2. 1 Γενικά περί πρωτεϊνών 3. 2. 2 Ταξινόµηση των πρωτεϊνών 3. 2. 3 Δοµή των πρωτεϊνών 3. 2. 4 Ιδιότητες των πρωτεϊνών 3. 2.

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777 ΘΕΜΑ Α Α1. α Α2. γ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ο αριθμός mol OH ΘΕΜΑ Α Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα