ΕΠΙΣΚΟΠΗΣΗ ΣΕ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΠΙΣΚΟΠΗΣΗ ΣΕ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗΣ"

Transcript

1 ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΪΑΤΡΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΠΙΣΚΟΠΗΣΗ ΣΕ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗΣ Καθ. Δημήτριος Κουτσούρης Δρ. Ιωάννης Μακρής 1

2 1. Η δομή και η λειτουργία του DNA Η ζωή εξαρτάται από την ικανότητα των κυττάρων ν' αποθηκεύουν, ν' ανακαλούν και να μεταφράζουν τις γενετικές πληροφορίες που απαιτούνται για τη δημιουργία και συντήρηση ενός ζωντανού οργανισμού. Οι κληρονομικές πληροφορίες μεταβιβάζονται από ένα κύτταρο στα θυγατρικά κύτταρα κατά την κυτταρική διαίρεση και από γενεά σε γενεά των οργανισμών μέσω των αναπαραγωγικών κυττάρων. Αυτές οι οδηγίες αποθηκεύονται σε κάθε ζωντανό κύτταρο ως γονίδια (genes): τα πληροφοριακά γενετικά στοιχεία τα οποία καθορίζουν τα χαρακτηριστικά ενός είδους στο σύνολο του αλλά και τα χαρακτηριστικά των ξεχωριστών οργανισμών που ανήκουν στο είδος αυτό. Από μελέτες στους απλούς μύκητες τη δεκαετία του 1940, διαπιστώθηκε ότι οι γενετικές πληροφορίες αποτελούνται κυρίως από οδηγίες για την κατασκευή των πρωτεϊνών. Οι πρωτεΐνες είναι τα μακρομόρια που επιτελούν τις περισσότερες κυτταρικές λειτουργίες: λειτουργούν ως δομικοί λίθοι για διάφορες κυτταρικές δομές, δρουν ως ένζυμα που καταλύουν όλες τις χημικές αντιδράσεις του κυττάρου, ρυθμίζουν την έκφραση των γονιδίων, προσδίδουν στα κύτταρα την ικανότητα να μετακινούνται και να επικοινωνούν μεταξύ τους. Επομένως, οι ιδιότητες και οι λειτουργίες ενός κυττάρου καθορίζονται σχεδόν αποκλειστικά από τις πρωτεΐνες που μπορεί να συνθέσει. Η άλλη καθοριστική πρόοδος που σημειώθηκε τη δεκαετία του 1940 ήταν η ταυτοποίηση του δεοξυριβονουκλεϊκού οξέος (deoxyribonucleic acid, DNA) ως πιθανού φορέα των γενετικών πληροφοριών. Ωστόσο, ο μηχανισμός με τον οποίο αντιγράφονται οι κληρονομικές πληροφορίες για να μεταβιβαστούν από κύτταρο σε κύτταρο και το πώς εξειδικεύονται οι πρωτεΐνες από τις οδηγίες που περιέχονται στο DNA παρέμεναν ένα μυστήριο έως το 1953, όταν ο James Watson και ο Francis Crick καθόρισαν τη δομή του DNA. Η δομή των Watson και Crick έλυσε αμέσως το πρόβλημα του τρόπου αντιγραφής του DNA και προσέφερε τις πρώτες ενδείξεις για το πώς ένα μόριο DNA μπορεί να κωδικοποιεί τις οδηγίες για τη σύνθεση των πρωτεϊνών. Σήμερα, το γεγονός ότι το DNA είναι το γενετικό υλικό είναι θεμελιώδες για τη βιολογική σκέψη. Ήδη από τις αρχές του εικοστού αιώνα, οι βιολόγοι είχαν αναγνωρίσει ότι τα γονίδια βρίσκονται στα χρωμοσώματα, τα οποία τότε ήταν γνωστά ως νηματοειδείς δομές στον πυρήνα των ευκαρυωτικών κυττάρων, που γίνονται ορατά καθώς το κύτταρο αρχίζει να διαιρείται. Αργότερα, με την εφαρμογή βιοχημικών αναλύσεων, βρέθηκε ότι τα χρωμοσώματα αποτελούνται από DNA και πρωτεΐνες. Στις αρχές της δεκαετίας του 1950, το DNA πρώτη φορά υποβλήθηκε σε ανάλυση περίθλασης ακτινών Χ, μια τεχνική για τον καθορισμό της τρισδιάστατης ατομικής δομής ενός μορίου. Τα πρώτα αποτελέσματα των σχετικών μελετών υπέδειξαν ότι το DNA αποτελείται από δύο κλώνους που περιελίσσονται σε μια έλικα. Η παρατήρηση ότι το DNA ήταν δίκλωνο (double-stranded) είχε αποφασιστική σημασία. 2

3 Προσέφερε μια από τις κύριες ενδείξεις που οδήγησαν, το 1953, στην περιγραφή ενός ορθού μοντέλου για τη δομή του DNA. Μόνο όταν προτάθηκε το μοντέλο αυτό των Watson-Crick έγιναν αντιληπτές οι δυνατότητες του DNA για αντιγραφή και αποθήκευση πληροφοριών Ένα μόριο DNA αποτελείται από δύο συμπληρωματικές αλυσίδες νουκλεοτιδίων Ένα μόριο DNA συνίσταται από δύο μακριές πολυνουκλεοτιδικές αλυσίδες οι οποίες αποτελούνται από τέσσερα είδη νουκλεοτιδίων. Καθεμία από αυτές τις αλυσίδες αναφέρεται ως αλυσίδα DNA (DNA chain) ή κλώνος DNA (DNA strand). Οι δύο αλυσίδες συγκρατούνται με δεσμούς υδρογόνου μεταξύ των βάσεων των νουκλεοτιδίων (Εικόνα 1). Τα νουκλεοτίδια αποτελούνται από μια πεντόζη, με την οποία συνδέονται μια ή περισσότερες φωσφορικές ομάδες, και μια αζωτούχο βάση. Στην περίπτωση των νουκλεοτιδίων του DNA, η πεντόζη είναι δεοξυριβόζη (απ' όπου και η ονομασία δεοξυριβονουκλεϊκό οξύ) που συνδέεται με μια φωσφορική ομάδα, ενώ η βάση μπορεί να είναι αδενίνη (Α), κυτοσίνη (C), γουανίνη (G) ή θυμίνη (Τ). Τα νουκλεοτίδια συνδέονται ομοιοπολικά μεταξύ τους σε μια αλυσίδα μέσω των σακχάρων και των φωσφορικών ομάδων τους, που σχηματίζουν έτσι έναν «σκελετό» εναλλασσόμενων μονάδων, σακχάρου-φωσφορικής ομάδαςσακχάρου-φωσφορικής ομάδας. Επειδή οι τέσσερις υπομονάδες διαφέρουν μεταξύ τους μόνο ως προς τη βάση, κάθε πολυνουκλεοτιδική αλυσίδα του DNA μπορεί να θεωρηθεί σαν ένα περιδέραιο που είναι περασμένες τέσσερα είδη από «χάντρες» (οι τέσσερις βάσεις A, C, G και Τ). Αυτά τα ίδια σύμβολα (A, C, G και Τ} χρησιμοποιούνται επίσης για να υποδηλώσουν τα τέσσερα διαφορετικά νουκλεοτίδια, δηλαδή τις βάσεις μαζί με τα σάκχαρα και τις φωσφορικές ομάδες τους. 3

4 Εικόνα 1. Το DNA και οι δομικοί λίθοι του. Το DNA συντίθεται από τέσσερα είδη νουκλεοτιδίων, τα οποία συνδέονται ομοιοπολικά μεταξύ τους και σχηματίζουν πολυνουκλεοτιδικές αλυσίδες μ ένα σακχαροφωσφορικό σκελετό από τον οποίο προβάλλουν οι βάσεις (A, C, G και T). Ένα μόριο DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες (κλώνοι DNA) που συγκρατούνται με δεσμούς υδρογόνου μεταξύ των ζευγαρωμένων βάσεων. Τα τρίγωνα στα άκρα των κλώνων του DNA υποδηλώνουν την πολικότητά τους. Οι δύο κλώνοι διατάσσονται αντιπαράλληλα. Στο σχήμα αριστερά, το DNA φαίνεται ευθυγραμμισμένο. Στην πραγματικότητα, όπως φαίνεται δεξιά, στρεβλώνεται και σχηματίζει μια διπλή έλικα. Ο τρόπος με τον οποίο συνδέονται μεταξύ τους τα νουκλεοτίδια προσδίδει σ' έναν κλώνο DNA χημική πολικότητα. Η πολικότητα μιας αλυσίδας DNA υποδεικνύεται με τον ορισμός του ενός άκρου ως 3' και του άλλου ως 5'. Ο συμβατικός αυτός ορισμός βασίζεται στις λεπτομέρειες του χημικού δεσμού μεταξύ των νουκλεοτιδικών υπομονάδων. Οι δύο πολυνουκλεοτιδικές αλυσίδες στη διπλή έλικα (double helix) το, DNA συγκρατούνται με δεσμούς υδρογόνου μεταξύ των βάσεων των διαφορετικών κλώνων. Επομένως, όλες οι βάσεις βρίσκονται στο εσωτερικό της έλικας, ενώ ο σακχαρο-φωσφορικός σκελετός στο εξωτερικό της (Εικόνα 1-1). Ωστόσο, οι βάσεις δεν ζευγαρώνουν στην τύχη: η Α πάντα ζευγαρώνει με την Τ και η G με την C (Εικόνα 2). Σε κάθε περίπτωση, μια πιο ογκώδη βάση με δύο δακτυλίους (μια βάση πουρίνης) ζευγαρώνει με μια βάση μ έναν δακτύλιο (μια βάση πυριμιδίνης). Το ζευγάρωμα ανάμεσα στις συμπληρωματικές βάσεις επιτρέπει στα ζεύγη των βάσεων (base pairs) να συσκευάζονται στο εσωτερικό της διπλής έλικας στην πιο ευνοϊκή, από ενεργειακή άποψη, διάταξη. Σε αυτή τη διάταξη, κάθε ζεύγος βάσεων έχει παρόμοιο εύρος, ώστε να διατηρεί τον σακχαρο-φωσφορικό σκελετό σε ίση απόσταση κατά μήκος του μορίου του DNA (Εικόνα 3), ενώ, επιπρόσθετα, οι σακχαρο-φωσφορικοί σκελετοί περιελίσσονται ο 4

5 ένας γύρω από τον άλλο για να σχηματίσουν μια διπλή έλικα (Εικόνα 4) που περιέχει 10 βάσεις Εικόνα 2. Τα ζεύγη των συμπληρωματικών βάσεων στη διπλή έλικα του DNA. Το σχήμα και η χημική δομή των βάσεων επιτρέπουν να σχηματίζονται δεσμοί υδρογόνου μόνο μεταξύ των βάσεων Α και Τ και μεταξύ των βάσεων G και C. Σε αυτά τα ζεύγη βάσεων, τα άτομα τα οποία μπορούν να σχηματίζουν δεσμούς υδρογόνου πλησιάζουν χωρίς να διαταράσσεται η διπλή έλικα. Ανάμεσα στις βάσεις Α και Τ σχηματίζονται δύο δεσμοί υδρογόνου, ενώ ανάμεσα στις G και C τρεις. Οι βάσεις ζευγαρώνουν με αυτόν τον τρόπο μόνο όταν οι πολυνουκλεοτιδικές αλυσίδες είναι αντιπαράλληλες. Εικόνα 3. Οι δύο κλώνοι της δίκλωνης έλικας του DNA συγκρατούνται μεταξύ τους σχηματίζοντας ζεύγη βάσεων. Ένα βραχύ τμήμα της διπλής έλικας όπως φαίνεται από τα πλάγια. Παρουσιάζονται τέσσερα ζεύγη βάσεων. Τα νουκλεοτίδια συνδέονται ομοιοπολικά μεταξύ τους με φωσφοδιεστερικούς δεσμούς ανάμεσα στην 3 υδροξυλομάδα (-ΟΗ) του ενός και την 5 φωσφορική ομάδα (Ρ) του επόμενου. Επομένως, κάθε πολυνουκλεοτιδικός κλώνος εμφανίζει μια χημική πολικότητα: αυτό σημαίνει ότι τα δύο άκρα του διαφέρουν από χημική άποψη. Το 3 άκρο φέρει μια ελεύθερη υδροξυλομάδα (-ΟΗ) που βρίσκεται στην 3 θέση του δακτυλίου του σακχάρου, ενώ το 5 άκρο φέρει μια ελεύθερη φωσφορική ομάδα που συνδέεται στην 5 θέση του δακτυλίου του σακχάρου. 5

6 ανά στροφή. Αυτή η περιέλιξη επίσης συνεισφέρει στην ενεργειακά ευνοϊκή διαμόρφωση της διπλής έλικας του DNA. Τα μέλη κάθε ζεύγους βάσεων προσαρμόζονται μέσα στη διπλή έλικα μόνο όταν οι δύο κλώνοι της είναι αντιπαράλληλοι (antiparallel), δηλαδή μόνο όταν η πολικότητα του ενός κλώνου έχει αντίθετο προσανατολισμό από την πολικότητα του άλλου (Εικόνα 1). Για το λόγο αυτό ο κάθε κλώνος ενός μορίου DNA περιέχει μια αλληλουχία νουκλεοτιδίων η οποία είναι ακριβώς συμπληρωματική (complementary) προς την αλληλουχία των νουκλεοτιδίων του άλλου κλώνου. Αυτό έχει ζωτική σημασία για την αντιγραφή του DNA. Εικόνα 4. Η διπλή έλικα του DNA έχει μια μείζονα και μια ελάσσονα αύλακα. Ένα χωροπληρωτικό υπόδειγμα 1 ½ στροφών της διπλής έλικας του DNA. Η περιστροφή του ενός κλώνου γύρω από τον άλλο δημιουργεί δύο αύλακες στη διπλή έλικα. Όπως φαίνεται στην εικόνα, η ευρύτερη αύλακα ονομάζεται μείζων, ενώ η μικρότερη ελάσσων Αντιγραφή του DNA Σε κάθε κυτταρική διαίρεση το κύτταρο πρέπει ν' αντιγράψει το γονιδίωμά του με αξιοσημείωτη πιστότητα. Το κύτταρο επιτυγχάνει αυτή την ακρίβεια ενώ διπλασιάζει το DNA με ταχύτητα έως 1000 νουκλεοτίδια ανά δευτερόλεπτο. Εικόνα 5. Ένας κλώνος DNA ως εκμαγείο. Επιλεκτική σύνδεση συμβαίνει ανάμεσα σε νουκλεοτίδια ικανά να σχηματίζουν ζεύγη βάσεων (Α με Τ, και G με C). Αυτό επιτρέπει στον κάθε κλώνο να δρα ως εκμαγείο για τον σχηματισμό του συμπληρωματικού του κλώνου. 6

7 Με άλλα λόγια, αν ορίσουμε τους δύο κλώνους ενός μορίου DNA ως Κ και Κ', τότε ο κλώνος Κ μπορεί ν' αποτελέσει το εκμαγείο για τη σύνθεση ενός νέου κλώνου Κ', ενώ ο Κ' μπορεί ν' αποτελέσει το εκμαγείο για τη σύνθεση ενός νέου κλώνου Κ (Εικόνες 5,6). Έτσι, οι γενετικές πληροφορίες του DNA αντιγράφονται με πιστότητα με μια αξιοθαύμαστα απλή διεργασία κατά την οποία οι κλώνοι Κ και Κ' πρώτα διαχωρίζονται και μετά, ο καθένας τους ξεχωριστά, λειτουργεί ως εκμαγείο για την παραγωγή ενός νέου συμπληρωματικού συνόδου κλώνου, ταυτόσημου με τον αρχικό συνεταίρο του. Εικόνα 6. Το DNA δρα ως εκμαγείο για το διπλασιασμό του. Καθώς το νουκλεοτίδιο Α ζευγαρώνει επιτυχώς μόνο με το Τ και το G μόνο με το C, ο κάθε κλώνος του DNA μπορεί να καθορίσει την αλληλουχία των νουκλεοτιδίων του συμπληρωματικού του κλώνου. Κατ αυτόν τον τρόπο, το δίκλωνο DNA αντιγράφεται με πιστότητα. Οι κλώνοι εκμαγεία (πορτοκαλί) και οι νέοι κλώνοι (κόκκινοι) είναι χημικώς ταυτόσημοι. Με την αντιγραφή του DNA, από το αρχικό μόριο του DNA παράγονται δύο πλήρεις διπλές έλικες. Εκτός από σποραδικά λάθη, η κάθε νέα έλικα του DNA έχει ταυτόσημη αλληλουχία νουκλεοτιδίων με την αρχική (Εικόνα 6). Επειδή κάθε αρχικός ή πατρικός κλώνος λειτουργεί ως εκμαγείο για τη σύνθεση ενός νέου κλώνου, η καθεμία από τις δύο νέες ή θυγατρικές διπλές έλικες του DNA θ' αποτελείται από έναν αρχικό (πατρικό) κλώνο και από έναν άλλο, εντελώς νέο κλώνο. Αυτός ο τρόπος αντιγραφής αποκαλείται ημισυντηρητικός (Εικόνα 7). 7

8 Εικόνα 7. Η αντιγραφή του DNA. Σε κάθε γύρο αντιγραφής, ο καθένας από τους δύο κλώνους του DNA χρησιμοποιείται ως εκμαγείο για το σχηματισμό ενός συμπληρωματικού κλώνου DNA. Επομένως, οι αρχικοί κλώνοι παραμένουν ανέπαφοι μετά από πολλές κυτταρικές διαιρέσεις. Η αντιγραφή του DNA είναι «ημισυντηρητική» επειδή κάθε θυγατρική διπλή έλικα DNA αποτελείται από έναν παλαιό (συντηρημένο) και έναν νεοσυντιθεμένο κλώνο Από το DNA στις Πρωτεΐνες: Πώς Διαβάζουν τα Κύτταρα το Γονιδίωμα Η δομή του DNA (δεοξυριβονουκλεϊνικό οξύ) καθορίστηκε στις αρχές της δεκαετίας του Τότε έγινε σαφές ότι οι κληρονομικές πληροφορίες των κυττάρων κωδικοποιούνται στην αλληλουχία των νουκλεοτιδίων του DNA. Οι κληρονομικές πληροφορίες μεταβιβάζονται αμετάβλητες από ένα κύτταρο στους απογόνους του μέσω της διεργασίας της αντιγραφής του DNA. Ο κώδικας του DNA έχει αποκρυπτογραφηθεί και η γλώσσα των γονιδίων μπορεί πλέον να διαβαστεί. Πριν ακόμα αποκρυπτογραφηθεί ο γενετικός κώδικας, ήταν γνωστό ότι οι γενετικές πληροφορίες κατευθύνουν με κάποιο τρόπο τη σύνθεση των πρωτεϊνών. Οι πρωτεΐνες είναι τα κύρια συστατικά των κυττάρων και καθορίζουν όχι μόνο τη δομή αλλά επιπλέον και τις λειτουργίες τους. Οι ιδιότητες και η λειτουργία μιας πρωτεΐνης καθορίζονται από τη γραμμική σειρά - την αλληλουχία -των διαφόρων αμινοξέων στην πολυπεπτιδική αλυσίδα της. Κάθε πρωτεΐνη έχει τη δική της, μοναδική αλληλουχία αμινοξέων. Η αλληλουχία των αμινοξέων υπαγορεύει πώς θα διπλωθεί η αλυσίδα ώστε να σχηματιστεί ένα μόριο με χαρακτηριστική στερεοδομή και χημεία. Συνεπώς, οι γενετικές οδηγίες που μεταφέρονται από το DNA πρέπει 8

9 με κάποιο τρόπο να καθορίζουν την αλληλουχία των αμινοξέων των πρωτεϊνών. Το ίδιο το DNA δεν κατευθύνει την πρωτεϊνοσύνθεση, αλλά δρα σαν ένας επόπτης που αναθέτει τις διάφορες αναγκαίες δραστηριότητες σε μια ομάδα εργατών. Όταν το κύτταρο χρειάζεται μια συγκεκριμένη πρωτεΐνη, η αλληλουχία των νουκλεοτιδίων στο κατάλληλο τμήμα του τεράστιου μορίου του DNA ενός χρωμοσώματος, πρώτα αντιγράφεται σ' ένα άλλο είδος νουκλεϊνικού οξέος, γνωστό ως RNA (ριβονουκλεϊνικό οξύ, ribonucleic acid). Αυτά τα RNA αντίγραφα του DNA χρησιμοποιούνται ως εκμαγεία που κατευθύνουν τη σύνθεση των πρωτεϊνών. Κάθε δευτερόλεπτο, σε κάθε κύτταρο του σώματός μας συμβαίνουν πολλές χιλιάδες ανάλογες μετατροπές από το DNA σε πρωτεΐνες. Επομένως, η ροή των γενετικών πληροφοριών στα κύτταρα είναι από το DNA στο RNA και από εκεί στις πρωτεΐνες (Εικόνα 8). Όλα τα κύτταρα, από τα βακτήρια έως τον άνθρωπο, εκφράζουν τις γενετικές πληροφορίες τους με αυτόν ακριβώς τον τρόπο. Πρόκειται για μια αρχή η οποία είναι τόσο θεμελιώδης ώστε αποκαλείται το κεντρικό δόγμα της Μοριακής Βιολογίας. Εικόνα 8. Το κεντρικό δόγμα της Μοριακής Βιολογίας. Από το DNA στις πρωτεΐνες. Σε όλα τα ζωντανά κύτταρα, η ροή των γενετικών πληροφοριών είναι από το DNA στο RNA (μεταγραφή) και από το RNA στις πρωτεΐνες (μετάφραση). Οι μηχανισμοί με τους οποίους τα κύτταρα αντιγράφουν το DNA σε RNA, συνιστούν μια διεργασία γνωστή ως μεταγραφή. Στη συνέχεια χρησιμοποιούν τις πληροφορίες του RNA για την παραγωγή πρωτεϊνών, μια διεργασία γνωστή ως μετάφραση. Υπάρχουν όμως αρκετές παραλλαγές σε αυτό το γενικό θέμα. Ανάμεσα τους βασική θέση κατέχει η συρραφή του RNA (RNA splicing), που συμβαίνει στα ευκαρυωτικά κύτταρα και οδηγεί σε αναδιάταξη των RΝΑ μεταγραφών πριν από τη μετάφρασή τους σε πρωτεΐνη. Άλλες αλλαγές τροποποιούν το μήνυμα του μορίου του RΝΑ και συνεπώς έχουν καίρια σημασία για την κατανόηση της αποκωδικοποίησης του γονιδιώματος από τα κύτταρα. 9

10 Τμήματα του DNA μεταγράφονται σε RNA Το πρώτο βήμα στην έκφραση ενός τμήματος των γενετικών οδηγιών ενός κυττάρου είναι η αντιγραφή της κατάλληλης αλληλουχίας των νουκλεοτιδίων του DNA, δηλαδή του κατάλληλου γονίδιου, σε μια αλληλουχία νουκλεοτιδίων του RNA. Η διεργασία αυτή αποκαλείται μεταγραφή (transcription), επειδή παρόλο που οι πληροφορίες αντιγράφονται σε μια διαφορετική χημική μορφή, εξακολουθούν να γράφονται ουσιαστικά στην ίδια γλώσσα, δηλαδή στη γλώσσα των νουκλεοτιδίων. Όπως και το DNA, το RNA είναι ένα γραμμικό πολυμερές που αποτελείται από τέσσερα διαφορετικά νουκλεοτίδια τα οποία συνδέονται μεταξύ τους με φωσφοδιεστερικούς δεσμούς (Εικόνα 9). Εικόνα 9. Η χημική δομή του RNA. (Α) Το RNA περιέχει το σάκχαρο ριβόζη το οποίο διαθέτει μια επιπλέον ομάδα ΟΗ από τη δεοξυριβόζη, δηλαδή το σάκχαρο που χρησιμοποιείται στο DNA. (Β) Το RNA περιέχει τη βάση ουρακίλη, η οποία έχει μια ομάδα CH3 λιγότερη από την ομόλογό της βάση στο DNA, δηλαδή τη θυμίνη. (Γ) Ένα μικρό τμήμα RNA. Η χημική σύνδεση ανάμεσα στα νουκλεοτίδια του RNA είναι η ίδια που χρησιμοποιείται και στο DNA. To RNA εμφανίζει τις εξής διαφορές από το DNA: (1) τα νουκλεοτίδια του είναι ριβονουκλεοτίδια, δηλαδή περιέχουν το σάκχαρο ριβόζη (απ όπου και η ονομασία ριβονουκλεϊνικό οξύ) αντί του σακχάρου δεοξυριβόζη, (2) όπως και το DNA, περιέχει τις βάσεις αδενίνη (Α), γουανίνη (G) και κυτοσίνη (C), αλλά αντί για θυμίνη (Τ) περιέχει ουρακίλη (U). Η U, 10

11 όπως και η Τ, ζευγαρώνει (με δεσμούς υδρογόνου) με την Α. Για το λόγο αυτό, οι κανόνες συμπληρωματικότητάς των βάσεων που περιγράφηκαν για το DNA ισχύουν επίσης και για το RNA. Παρόλο που αυτές οι χημικές διαφορές τους δεν είναι μεγάλες, εν τούτοις το DNA και το RNA διαφέρουν πολύ ως προς τη συνολική δομή τους. To DNA πάντοτε βρίσκεται στα κύτταρα υπό μορφή δίκλωνης έλικας, ενώ τo RNA είναι μονόκλωνο. Επιπλέον, μια αλυσίδα RNA μπορεί να διπλωθεί σε ποικίλες δομές, όπως διπλώνεται μια πολυπεπτιδική αλυσίδα για να σχηματίσει την τελική δομή μιας πρωτεΐνης, ενώ το DNA δεν έχει αυτή τη δυνατότητα. Η ικανότητα του RNA να διπλώνεται σε πολύπλοκες τρισδιάστατες δομές προσδίδει στο RNA τη δυνατότητα να επιτελεί και άλλες λειτουργίες μέσα στα κύτταρα εκτός από τη μεταφορά πληροφοριών ανάμεσα στο DNA και στις πρωτεΐνες. Ενώ το DNA λειτουργεί αποκλειστικά ως απόθεμα πληροφοριών, τα διάφορα είδη του RNA έχουν δομικές, πληροφοριακές ή ακόμα και καταλυτικές λειτουργίες Στα κύτταρα παράγονται αρκετά είδη RNA Τα περισσότερα γονίδια που βρίσκονται στο DNA ενός κυττάρου καθορίζουν την αλληλουχία των αμινοξέων των διάφορων πρωτεϊνών. Τα μόρια του RNA που μεταγράφονται από αυτά τα γονίδια (τα οποία τελικά κατευθύνουν τη σύνθεση των πρωτεϊνών) συλλογικά αποκαλούνται αγγελιοφόρα RNA (messenger RNA, mrna). Για άλλα γονίδια τελικό προϊόν είναι το ίδιο το RNA. (Πίνακας 1). Πίνακας 1. Τα είδη των μορίων RNA που παράγονται στα κύτταρα Είδος RNA mrna rrna trna Μικρά RNA Λειτουργία Κωδικοποιεί πρωτεΐνες Είναι συστατικό του ριβοσωματίου και συμμετέχει στη σύνθεση των πρωτεϊνών Χρησιμοποιείται στην πρωτεϊνοσύνθεση ως μόριο προσαρμογής μεταξύ του mrna και των αμινοξέων Χρησιμοποιούνται στη συρραφή του προ- mrna, στη μεταφορά των πρωτεϊνών στο ενδοπλασματικό δίκτυο και σε άλλες διεργασίες του κυττάρου Αυτά τα μη αγγελιοφόρα μόρια του RNA, όπως και οι πρωτεΐνες, χρησιμεύουν ως δομικά και ενζυμικά συστατικά των κυττάρων και παίζουν καίριο ρόλο στη μετάφραση του γενετικού μηνύματος σε πρωτεΐνη. Το ριβοσωμικό RNA (ribosomal RNA, rrna) σχηματίζει το κέντρο των ριβοσωματίων. πάνω στα οποία πραγματοποιείται η μετάφραση του mrna σε πρωτεΐνη, ενώ το μεταφορικό RNA (transfer RNA, trna) σχηματίζει τους συναρμολογητές που επιλέγουν τα 11

12 αμινοξέα και τα συγκρατούν στην κατάλληλη θέση πάνω στο ριβοσωμάτιο για να ενσωματωθούν σε μια πρωτεΐνη. Ενώ τα μόρια του DNA συνήθως είναι πολύ μακριά και περιέχουν τις οδηγίες για χιλιάδες διαφορετικές πρωτεΐνες, ένα μόριο RNA είναι πολύ βραχύτερο, επειδή περιέχει τις πληροφορίες μόνο ενός τμήματος του DNA. Στα ευκαρυωτικά κύτταρα, κάθε mrna συνήθως περιέχει πληροφορίες οι οποίες έχουν μεταγραφεί μόνο από ένα γονίδιο και κωδικοποιεί μια μοναδική πρωτεΐνη. Στα βακτήρια, μια ομάδα από γειτονικά γονίδια μεταγράφονται σ' ένα ενιαίο mrna, το οποίο όμως περιέχει τις πληροφορίες για αρκετές διαφορετικές πρωτεΐνες. Για ν' αρχίσει τη μεταγραφή, η RNA πολυμεράση πρέπει ν αναγνωρίσει την αφετηρία ενός γονιδίου και να προσδεθεί ισχυρά στη συγκεκριμένη περιοχή του DNA. Αυτή η περιοχή είναι γνωστή ως υποκινητής (ή προαγωγέας, promoter). Η πρόσδεση της RNA πολυμεράσης στον υποκινητή εξαρτάται και από τη συμμετοχή επιπρόσθετων πρωτεϊνών. Μόλις έλθει σε επαφή με το DNA του υποκινητή και συνδεθεί ισχυρά, η RNA πολυμεράση ανοίγει την περιοχή της διπλής έλικας που βρίσκεται ακριβώς μπροστά της και έτσι αποκαλύπτει τα νουκλεοτίδια σ' ένα βραχύ τμήμα του DNA κάθε κλώνου (Εικόνα 10A). Στη συνέχεια, ο ένας από τους δύο εκτεθειμένους κλώνους του DNA δρα ως εκμαγείο για να σχηματιστούν συμπληρωματικά ζεύγη βάσεων με τα εισερχόμενα ριβονουκλεοτίδια. Δύο από αυτά συνδέονται μεταξύ τους από την πολυμεράση και έτσι αρχίζει η αλυσίδα του RNA. Κατόπιν, η αλυσίδα επιμηκύνεται, έως ότου η RNA πολυμεράση συναντήσει ένα δεύτερο σήμα πάνω στο DNA, την αλληλουχία τερματισμού (stop site), οπότε σταματά και απελευθερώνει τόσο το DNA εκμαγείο όσο και τη νεοσυντεθειμένη αλυσίδα του RNA (Εικόνα 10Β). Επειδή το DNA είναι δίκλωνο, θεωρητικά από κάθε γονίδιο θα μπορούσαν να μεταγράφονται δυο διαφορετικά μόρια RNA, χρησιμοποιώντας ως εκμαγείο καθέναν από τους δυο κλώνους του DNA. Ωστόσο, ο υποκινητής είναι ασύμμετρος και συνδέεται με την πολυμεράση μόνο προς μια κατεύθυνση. Επομένως, μόλις διευθετηθεί σωστά πάνω σ' έναν υποκινητή, η RNA πολυμεράση δεν έχει άλλη επιλογή παρά να μεταγράψει τον κατάλληλο κλώνο του DNA, εφόσον μεταγραφή μπορεί να γίνει μόνο προς την κατεύθυνση 5 3'. Η κατεύθυνση της μεταγραφής σε σχέση με το χρωμόσωμα ως σύνολο ποικίλλει από γονίδιο σε γονίδιο. Η RNA πολυμεράση αρχίζει να μεταγράφει μόνο αφού προηγουμένως προσδεθεί ισχυρά στο DNA. Αυτό σημαίνει ότι ένα τμήμα του DNA μπορεί να μεταγραφεί μόνο υπό την προϋπόθεση ότι πριν από αυτό θα βρίσκεται μια αλληλουχία υποκινητή. Έτσι εξασφαλίζεται ότι σε RNA θα μεταγράφονται μόνο εκείνα τα τμήματα ενός μορίου DNA τα οποία περιέχουν ένα γονίδιο. Στα βακτήρια, τα γονίδια βρίσκονται πολύ κοντά το ένα στο άλλο μέσα στο DNA και ανάμεσα τους παρεμβάλλονται πολύ μικρά τμήματα μη μεταγραφόμενου DNA. Αντίθετα, στο DNA των φυτών και των ζώων, συμπεριλαμβανόμενου και του ανθρώπου, τα γονίδια είναι διάσπαρτα πάνω στο DNA και διαχωρίζονται το ένα από το άλλο από τμήματα DNA μήκους έως 100,000 ζευγών νουκλεοτιδίων. Η μεταγραφή αυτών των περιοχών του διαστηματικού DNA (spacer DNA), οι οποίες, απ' όσο γνωρίζουμε, δεν κωδικοποιούν γενετικές οδηγίες, θ' αποτελούσε μια σπατάλη 12

13 των πολύτιμων αποθεμάτων του κυττάρου. Εικόνα 10. Η μεταγραφή ενός βακτηριακού γονιδίου από την RNA πολυμεράση. (Α) Παραγωγή ενός μορίου RNA στα βακτήρια. Η βακτηριακή RNA πολυμεράση περιέχει μια υπομονάδα που αποκαλείται παράγοντας σίγμα και αναγνωρίζει τον υποκινητή πάνω στο DNA. Μόλις αρχίσει η μεταγραφή, ο παράγοντας σίγμα απομακρύνεται και η πολυμεράση συνεχίζει να μεταγράφει το RNA από μόνη της. Η αλυσίδα του RNA επιμηκύνεται έως ότου η πολυμεράση συναντήσει ένα σήμα τερματισμού πάνω στο DNA. Εκεί το ένζυμο σταματά και απελευθερώνει το DNA εκμαγείο και το νεοσυντεθειμένο μετάγραφο. Στη συνέχεια, η πολυμεράση συνδέεται μ έναν ελεύθερο παράγοντα σίγμα και αναζητά έναν άλλο υποκινητή για να ξαναπιάσει δουλειά. Οι περιοχές που σκιάζονται με πράσινο χρώμα στο πάνω μέρος του διαγράμματος (Β) αντιπροσωπεύουν τις αλληλουχίες του DNA που είναι απαραίτητες για τη δημιουργία του υποκινητή Από το RNA στις πρωτεΐνες Η μεταγραφή είναι ένα μέσο μεταφοράς πληροφοριών επειδή το DNA και το RNA 13

14 μοιάζουν από χημική και δομική άποψη και επιπλέον το DNA δρα ως κύριο εκμαγείο για τη σύνθεση του RNA με ζευγάρωμα των συμπληρωματικών βάσεων. Αντίθετα, η μετατροπή των πληροφοριών του RNA σε πρωτεΐνη αντιπροσωπεύει μια μετάφραση των πληροφοριών σε μια άλλη γλώσσα που χρησιμοποιεί πολύ διαφορετικά σύμβολα. Επειδή στο mrna υπάρχουν μόνο τέσσερα διαφορετικά νουκλεοτίδια ενώ στις πρωτεΐνες υπάρχουν είκοσι διαφορετικά αμινοξέα, η μετάφραση των πληροφοριών είναι αδύνατο να πραγματοποιηθεί με μια αντιστοιχία ένα προς ένα ανάμεσα σ' ένα νουκλεοτίδιο του RNA και ένα αμινοξύ της αντίστοιχης πρωτεΐνης. Οι κανόνες με τους οποίους η αλληλουχία των νουκλεοτιδίων ενός γονιδίου, μέσω του mrna, μεταφράζεται στην αλληλουχία των αμινοξέων μιας πρωτεΐνης συλλογικά αναφέρονται ως γενετικός κώδικας (genetic code). Η αλληλουχία των νουκλεοτιδίων ενός μορίου mrna διαβάζεται διαδοχικά ανά ομάδες τριών νουκλεοτιδίων. Επειδή το RNA είναι ένα γραμμικό πολυμερές από τέσσερα διαφορετικά νουκλεοτίδια, υπάρχουν 4 χ 4 χ 4 = 64 δυνατοί συνδυασμοί από τρία νουκλεοτίδια: ΑΑΑ, ADA, AUG κ.ο.κ. Ωστόσο, στις πρωτεΐνες συνήθως υπάρχουν μόνο 20 διαφορετικά αμινοξέα. Επομένως, είτε ορισμένες τριπλέτες νουκλεοτιδίων δεν χρησιμοποιούνται ποτέ είτε ο κώδικας είναι πλεονάζων και ορισμένα αμινοξέα καθορίζονται από περισσότερες από μια τριπλέτες. Όπως φαίνεται στην Εικόνα 1-11, όπου παρουσιάζεται πλήρως αποκρυπτογραφημένος ο γενετικός κώδικας, σωστό είναι το δεύτερο εναλλακτικό ενδεχόμενο. Κάθε ομάδα τριών διαδοχικών νουκλεοτιδίων του RNA αποκαλείται κωδικόνιο (codon) και κάθε κωδικόνιο καθορίζει ένα αμινοξύ (Εικόνα 11). Εικόνα 11. Η αλληλουχία νουκλεοτιδίων ενός mrna μεταφράζεται στην αλληλουχία των αμινοξέων μιας πρωτεΐνης μέσω του γενετικού κώδικα. Όλα τα κωδικόνια που προσδιορίζουν ένα αμινοξύ γράφονται πάνω από τη σύντμηση του ονόματος του αμινοξέος (επίσης δίνονται και τα μονογραμματικά σύμβολα όλων των αμινοξέων. Συμβατικά, το νουκλεοτίδιο που εντοπίζεται στο 5' άκρο ενός κωδικονίου γράφεται πάντα πρώτο από αριστερά. Τα περισσότερα αμινοξέα αντιπροσωπεύονται από περισσότερα από ένα κωδικόνια και όλα τα κωδικόνια που καθορίζουν το ίδιο αμινοξΰ εμφανίζουν ορισμένα χαρακτηριστικά γνωρίσματα. Έτσι, τα κωδικόνια για το ίδιο αμινοξύ συνήθως περιέχουν τα ίδια νουκλεοτίδια στις δύο πρώτες θέσεις τους και διαφέρουν μόνο στην τρίτη θέση. Τρία κωδικόνια δεν καθορίζουν κάποιο αμινοξύ αλλά δρουν ως θέσεις τερματισμού {κωδικόνια τερματισμού) και σηματοδοτούν το τέλος της κωδικοποιητικής αλληλουχίας. Το κωδικόνιο AUG λειτουργεί τόσο ως εναρκτήριο κωδικόνιο (σηματοδοτεί την αρχή ενός μηνύματος) όσο και ως το κωδικόνιο που καθορίζει τη μεθειονίνη. Ο κώδικας αυτός χρησιμοποιείται οικουμενικά από όλους τους σημερινούς οργανισμούς. Οι λίγες μικρές διαφορές που έχουν εντοπιστεί αφορούν κυρίως στο DNA των μιτοχονδρίων. Τα μιτοχόνδρια διαθέτουν τα δικά τους, ιδιαίτερα, συστήματα μεταγραφής και σύνθεσης πρωτεϊνών τα οποία λειτουργούν αρκετά ανεξάρτητα από τα αντίστοιχα συστήματα του υπόλοιπου κυττάρου και μπορούν ν' ανεχθούν περιορισμένες αλλαγές στον κατά τ' άλλα, οικουμενικό κώδικα. Θεωρητικά, μια αλληλουχία RNA μπορεί να μεταφραστεί σε οποιοδήποτε από τα τρία 14

15 διαφορετικά πλαίσια ανάγνωσης (reading frames), ανάλογα με το σημείο από το οποίο αρχίζει η διεργασία της αποκωδικοποίησης (Εικόνα 12). Ωστόσο, μόνο ένα από τα τρία δυνατά πλαίσια ανάγνωσης ενός mrna κωδικοποιεί την αιτούμενη πρωτεΐνη. Ένα ειδικό σήμα στην αρχή κάθε μηνύματος θέτει το σωστό πλαίσιο ανάγνωσης. Εικόνα 12. Τα τρία πιθανά πλαίσια ανάγνωσης κατά την πρωτεϊνοσύνθεση. Κατά τη διεργασία της μετάφρασης μιας αλληλουχίας νουκλεοτιδίων σε μια αλληλουχία αμινοξέων, η αλληλουχία των νουκλεοτιδίων ενός μορίου mrna διαβάζεται από το 5' προς το 3' άκρο σε διαδοχικές ομάδες τριών νουκλεοτιδίων. Επομένως, θεωρητικά, ανάλογα με το πλαίσιο ανάγνωσης, η ίδια αλληλουχία RNA μπορεί να καθορίζει τρεις εντελώς διαφορετικές πρωτεΐνες. Ωστόσο, στην πραγματικότητα, μόνο το ένα από αυτά τα πλαίσια ανάγνωσης κωδικοποιεί το κατάλληλο μήνυμα Το μήνυμα του RNA αποκωδικοποιείται στα ριβοσωμάτια Η ακριβής και ταχεία μετάφραση του mrna σε πρωτεΐνη προϋποθέτει τη λειτουργία μιας μεγάλης μοριακής μηχανής, η οποία μετακινείται κατά μήκος της αλυσίδας του mrna, συλλαμβάνει συμπληρωματικά μόρια trna, τα συγκρατεί σε κατάλληλες θέσεις και διασυνδέει τ' αμινοξέα που μεταφέρουν ώστε να σχηματιστεί μια πρωτεϊνική αλυσίδα. Αυτή η μηχανή παρασκευής πρωτεϊνών είναι το ριβοσωμάτιο, ένα μεγάλο σύμπλοκο που αποτελείται από 50 και πλέον διαφορετικές πρωτεΐνες (γνωστές ως ριβοσωματικές πρωτεΐνες, ribosomal proteins) και αρκετά μόρια RNA τα οποία αποκαλούνται ριβοσωματικά RNA (ribosomal RNA, rrna). Ένα συνηθισμένο ζωντανό κύτταρο περιέχει στο κυτταρόπλασμα εκατομμύρια ριβοσωμάτια. Σ' ένα ευκαρυωτικό κύτταρο, οι υπομονάδες των ριβοσωματίων παρασκευάζονται στον πυρήνα. Εκεί, μόρια νεοσυντεθειμένου rrna συνδυάζονται με ριβοσωματικές πρωτεΐνες, οι οποίες έχουν εισαχθεί στον πυρήνα από το κυτταρόπλασμα, όπου είχαν συντεθεί. Κατόπιν, οι ξεχωριστές υπομονάδες εξάγονται στο κυτταρόπλάσμα για να συμμετάσχουν στην πρωτεϊνοσύνθεση (Εικόνα 13). 15

16 Εικόνα 13. Η παραγωγή μιας πρωτεΐνης από ένα ευκαρυωτικό κύτταρο. Η τελική συγκέντρωση κάθε πρωτεΐνης σ ένα ευκαρυωτικό κύτταρο εξαρτάται από την αποτελεσματικότητα καθενός από τα βήματα που εικονίζονται εδώ. Ακόμα και αφότου ολοκληρωθεί η μετάφραση, η δραστικότητα μιας πρωτεΐνης μπορεί να ρυθμιστεί με αποδόμηση, πρόσδεση μικρών μορίων ή άλλες μετασυνθετικές τροποποιήσεις (π.χ. φωσφορυλίωση) Ανάμεσα στο DNA και τις πρωτεΐνες παρεμβάλλονται πολλά στάδια Είδαμε ότι πολλά διαφορετικά είδη χημικών αντιδράσεων απαιτούνται για την παραγωγή μιας πρωτεΐνης από τις πληροφορίες που περιέχονται σ ένα γονίδιο (Εικόνα 13). Επομένως η συγκέντρωση μιας πρωτεΐνης σ ένα κύτταρο εξαρτάται από την αποτελεσματικότητα με την οποία διεξάγεται το καθένα από τα πολλά ξεχωριστά στάδια. Τα κύτταρα διαθέτουν την ικανότητα να μεταβάλλουν τη συγκέντρωση των περισσοτέρων πρωτεϊνών σύμφωνα με τις ανάγκες τους και μπορούν ρυθμίσουν όλα τα βήματα που παρουσιάζονται στην εικόνα 13. Ωστόσο,$ κοινό σημείο ελέγχου της έκφρασης των γονιδίων ενός κυττάρου είναι η έναρξη της μεταγραφής με την αντιγραφή τη μεταγραφή και τη μετάφραση να αποτελούν οικουμενικές διεργασίες με θεμελιώδη σημασία για τη ζωή. 16

17 1.4. Χρωμοσώματα Στους ευκαρυώτες, όπως ο άνθρωπος, το DNA του πυρήνα κατανέμεται σε μια ομάδα διαφορετικών χρωμοσωμάτων. Για παράδειγμα, το ανθρώπινο γονιδίωμα περιέχει περίπου 3.2 Χ 10 9 νουκλεοτίδια που κατανέμονται σε 24 χρωμοσώματα. Κάθε χρωμόσωμα αποτελείται από ένα μοναδικό, εξαιρετικά μακρύ γραμμικό μόριο DNA που αλληλεπιδρά με πρωτεΐνες οι οποίες διπλώνουν και συσκευάζουν τη λεπτή ίνα του DNA σε μια πιο συμπαγή δομή. Το σύμπλοκο του DNA και των πρωτεϊνών αποκαλείται χρωματίνη (από τη λέξη χρώμα, εξαιτίας της ικανότητας του να βάφεται με ειδικές χρωστικές. Τα χρωμοσώματα μεταβάλλουν τη δομή και τη δράση τους ανάλογα με το στάδιο του κυτταρικού κύκλου: στη μίτωση είναι έντονα συμπυκνωμένα και μεταγραφικά ανενεργά, ενώ κατά τη μεσόφαση είναι λιγότερο συμπυκνωμένα και μεταγραφικά ενεργά. Τα ευκαρυωτικά χρωμοσώματα παρουσιάζουν επίσης μια αξιοσημείωτη αστάθεια, εξαιτίας της ύπαρξης μεταθετών στοιχείων. Στην κλασική κυτταρογενετική χρησιμοποιούνται οι όροι χρωματίδιο και χρωμόνημα. Χρωματίδιο είναι η μια από τις δύο συμμετρικές δομές που παρατηρείται στα μεταφασικά χρωμοσώματα. Κάθε χρωματίδιο περιέχει ένα απλό μόριο DNA, το οποίο έχει ενωθεί με τις ιστόνες και έχει υποστεί την κατάλληλη διαδικασία συμπύκνωσης. Χρωμόνημα είναι το λεπτό ινίδιο που παρατηρείται στην πρόφαση και αντιστοιχεί σε χρωματίδιο που βρίσκεται στα αρχικά στάδια της συμπύκνωσης. Χρωματίδιο και χρωμόνημα είναι διαφορετικά ονόματα της ίδιας δομής από την οποία σχηματίζονται τα χρωμοσώματα. Τα χρωμομέρη είναι συσσωματώματα χρωματίνης που μερικές φορές, ανάλογα με το στάδιο του κυτταρικού κύκλου, είναι ορατά κατά μήκος του χρωμονήματος. Τα χρωμοσώματα ταξινομούνται σε τέσσερις τύπους ανάλογα με τη θέση του κεντρομέρους. Στα τελοκεντρικά χρωμοσώματα, το κεντρομέρος βρίσκεται στο άκρο των χρωμοσωμικών βραχιόνων, ενώ τα ακροκεντρικά χρωμοσώματα έχουν ένα μικρό βραχίονα. Τα υπομετακεντρικά χρωμοσώματα έχουν βραχίονες με διαφορετικό μήκος, ενώ τα μετακεντρικά χρωμοσώματα έχουν βραχίονες με το ίδιο σχεδόν μήκος. Η θέση του χρωμοσώματος στην οποία βρίσκεται το κεντρομέρος ονομάζεται πρωτογενής περίσφιξη. Τα δύο θυγατρικά μόρια DNA, τα οποία δημιουργούνται από την αντιγραφή του αρχικού DNA μορίου κατά τη φάση S του κυτταρικού κύκλου, αναδιπλώνονται ξεχωριστά το ένα από το άλλο και δημιουργώντας τα δύο αδελφά χρωματίδια, συγκρατούνται στο κεντρομέρος (Εικόνα 14). 17

18 Εικόνα 14. Προέλευση μεσοφασικού χρωμοσώματος. Εκτός από τα γαμετικά κύτταρα (σπερματοζωάρια και ωάρια) και πολύ εξειδικευμένα κύτταρα χωρίς καθόλου DNA (όπως τα ερυθροκύτταρα), όλα τα υπόλοιπα ανθρώπινα κύτταρα περιέχουν δύο αντίγραφα του κάθε χρωμοσώματος, ένα μητρικής και ένα πατρικής προέλευσης. Τα δύο χρωμοσώματα ενός ζευγαριού αποκαλούνται ομόλογα. Το μόνο ζεύγος μη ομόλογων χρωμοσωμάτων είναι το ζεύγος των φυλετικών χρωμοσωμάτων στους άρρενες, οι οποίοι κληρονομούν ένα χρωμόσωμα Υ από τον πατέρα και ένα χρωμόσωμα Χ από τη μητέρα τους. Η παρουσίαση του συνόλου των 46 χρωμοσωμάτων του ανθρώπου αποκαλείται καρυότυπος του ανθρώπου (Εικόνα 15). Αν τμήματα διαφόρων χρωμοσωμάτων χαθούν ή ανταλλαγούν μεταξύ χρωμοσωμάτων, οι αλλαγές αυτές μπορεί ν ανιχνευθούν από τις αλλαγές στα πρότυπα της ζώνωσης (banding patterns) (Εικόνα 16). Οι κυτταρογενετιστές χρησιμοποιούν τις αλλαγές στα πρότυπα της ζώνωσης για ν ανιχνεύσουν χρωμοσωματικές ανωμαλίες που σχετίζονται με ορισμένα κληρονομικά ελαττώματα ή με συγκεκριμένα είδη καρκίνου. 18

19 Εικόνα 15. Η τοποθέτηση των χρωμοσωμάτων ανάλογα με το σχήμα τους δημιουργεί τον καρυότυπο. Εικόνα 16. Τα πρότυπα της ζώνωσης των χρωμοσωμάτων του ανθρώπου Τα χρωμοσώματα περιέχουν μακρές σειρές γονιδίων Η σημαντικότερη λειτουργία των χρωμοσωμάτων είναι να μεταφέρουν τα γονίδια που 19

20 είναι οι λειτουργικές μονάδες της κληρονομικότητας. Ένα γονίδιο ορίζεται ως το τμήμα του DNA που περιέχει τις πληροφορίες για την παρασκευή μιας ορισμένης πρωτεΐνης. Αυτός ο ορισμός είναι σωστός για τα περισσότερα γονίδια. Ωστόσο, ορισμένα γονίδια έχουν ως τελικό προϊόν ένα μόριο RNA αντί για ένα μόριο πρωτεΐνης. Όπως οι πρωτεΐνες τα μόρια του RNA επιτελούν ποικίλες δομικές και καταλυτικές λειτουργίες στα κύτταρα. Δεν είναι παράδοξο που υπάρχει αντιστοιχία ανάμεσα στην πολυπλοκότητα ενός οργανισμού και στον αριθμό των γονιδίων του γονιδιώματός του. Για παράδειγμα, ένα απλό βακτήριο διαθέτει λιγότερα από 500 γονίδια, ενώ ο άνθρωπος περίπου 30,000 γονίδια. Τα βακτήρια και μερικοί μονοκύτταροι ευκαρυώτες έχουν ιδιαίτερα συμπαγές γονιδίωμα: τα μόρια DNA που απαρτίζουν τα χρωμοσώματά τους αποτελούνται σχεδόν αποκλειστικά από σειρές σφιχτά συσκευασμένων γονιδίων. Αντίθετα, τα χρωμοσώματα πολλών ευκαρυωτών (μεταξύ τους και ο άνθρωπος) ανάμεσα στα γονίδια περιέχουν μεγάλες ποσότητες παρεμβαλλόμενου DNA που δεν φαίνεται να μεταφέρει ουσιώδεις πληροφορίες. Αυτό το DNA μερικές φορές αναφέρεται ως <άχρηστο> (junk DNA), επειδή δεν έχει ακόμα καθοριστεί σαφώς η χρησιμότητά του για το κύτταρο. Παρότι η ακριβής αλληλουχία νουκλεοτιδίων αυτού του DNA ίσως δεν έχει σημασία, το ίδιο το DNA πιθανόν παίζει αποφασιστικό ρόλο στην εξέλιξη των ειδών και στη σωστή δρστικότητα των γονιδίων. Γενικά, όσο πιο περίπλοκος είναι ένας οργανισμός τόσο μεγαλύτερο είναι το γονιδίωμά του. Ωστόσο, αυτή η σχέση δεν ισχύει πάντα. Για παράδειγμα, το ανθρώπινο γονιδίωμα είναι 200 φορές μεγαλύτερο από το αντίστοιχο του ζυμομήκητα S. Cerevisiae, αλλά 30 φορές μικρότερο από το γονιδίωμα μερικών φυτών και 200 φορές μικρότερο από το γονιδίωμα ενός είδους αμοιβάδας. Επίσης η κατανομή του DNA στα χρωμοσώματα διαφέρει από είδος σε είδος. Ο άνθρωπος έχει 46 χρωμοσώματα, ένα είδος μικρού ελαφιού έχει μόλις 6 χρωμοσώματα, ενώ μερικά είδη έχουν άνω από 100. ακόμα και πολύ συγγενικά είδη με γονιδίωμα παρόμοιου μεγέθους μπορεί να έχουν πολύ διαφορετικό αριθμό και μέγεθος χρωμοσωμάτων. Συνεπώς, παρότι ο αριθμός των γονιδίων αδρά συσχετίζεται με την πολυπλοκότητα του είδους, δεν υπάρχει απλή σχέση ανάμεσα στον αριθμό των γονιδίων ή των χρωμοσωμάτων και στο συνολικό μέγεθος του γονιδιώματος. Το γονιδίωμα και τα χρωμοσώματα κάθε σύγχρονου είδους έχουν διαμορφωθεί από μια ξεχωριστή, κατά περίπτωση, σειρά φαινομενικά τυχαίων γενετικών γεγονότων υπό την επίδραση πιέσεων επιλογής. Υπάρχουν δύο γενικοί τύποι γονιδίων στο ανθρώπινο γονιδίωμα: RNA γονίδια που δεν κωδικοποιούν και γονίδια που κωδικοποιούν πρωτεΐνη. Τα RNA γονίδια αντιπροσωπεύουν 2-5 τοις εκατό του συνόλου και κωδικοποιούν λειτουργικά RNA μόρια. Πολλά από αυτά τα RNAs συμμετέχουν στον έλεγχο της γονιδιακής έκφρασης, κυρίως στην πρωτεϊνοσύνθεση. Τα γονίδια που κωδικοποιούν πρωτεΐνες αντιπροσωπεύουν την πλειοψηφία του συνολικού αριθμού των γονιδίων και εκφράζονται σε δύο στάδια: μεταγραφή και μετάφραση. Παρουσιάζουν απίστευτη ποικιλομορφία στο μέγεθος και την οργάνωση και δεν έχουν καμία 20

21 χαρακτηριστική δομή. Υπάρχουν, εντούτοις, διάφορα συντηρημένα χαρακτηριστικά γνωρίσματα. Τα όρια ενός τέτοιου γονιδίου ορίζονται ως τα σημεία στα οποία η μεταγραφή αρχίζει και τελειώνει. Ο πυρήνας του γονιδίου είναι η περιοχή κωδικοποίησης, η οποία περιέχει την ακολουθία νουκλεοτιδίων που τελικά μεταφράζεται στην ακολουθία αμινοξέων στην πρωτεϊνη. Η περιοχή κωδικοποίησης αρχίζει με ένα κωδικόνιο έναρξης, το οποίο είναι κανονικά ATG. Τελειώνει με το ένα από τρία κωδικόνια λήξης: TAA, TAG ή TGA. Σε κάθε πλευρά της κωδικοποιήσιμης περιοχής υπάρχουν ακολουθίες DNA που μεταγράφονται αλλά δεν μεταφράζονται. Αυτές οι <μη μεταφράσιμες> περιοχές περιλαμβάνουν συχνά τα ρυθμιστικά στοιχεία που ελέγχουν την πρωτεϊνική σύνθεση (Εικόνα 17). Μαζί η κωδικοποιήσιμη αλλά και η μη μεταφράσιμη περιοχή μπορούν να διακοπούν από ιντρόνια. Τα περισσότερα ανθρώπινα γονίδια διαιρούνται σε εξόνια και ιντρόνια. Τα εξόνια είναι τα τμήματα που βρίσκονται στο ώριμο αντίγραφο (αγγελιοφόρο RNA-mRNA), ενώ τα ιντρόνια αφαιρούνται από το αρχικό μετάγραφο με μια διαδικασία που λέγεται αφαίρεση (splicing). Τελικά κάθε μετάγραφο αποκτά μια ουρά πολύ (Α). Αυτό άλλοτε συμβαίνει μετά τη συρραφή των εξονίων και άλλοτε προτού ολοκληρωθούν οι τελικές αντιδράσεις της συρραφής. Μόλις ολοκληρωθεί αυτό το βήμα το RNA είναι πλέον ένα λειτουργικό μόριο mrna το οποίο μπορεί να εγκαταλείψει τον πυρήνα και να μεταφραστεί σε πρωτεΐνη. Η συρραφή του RNA προσδίδει στους ευκαρυώτες ένα επιπλέον πλεονέκτημα έναντι των προκαρυωτών. Τα πρωτογενή μετάγραφα πολλών ευκαρυωτικών γονιδίων μπορεί να συρραφούν με ποικίλους τρόπους ώστε να παραχθούν διαφορετικά mrna, ανάλογα με το είδος του κυττάρου στο οποίο εκφράζεται το γονίδιο ή το συγκεκριμένο αναπτυξιακό στάδιο του οργανισμού. Το μικρότερο γονίδιο στο ανθρώπινο γονιδίωμα είναι μόνο 500 νουκλεοτίδια και δεν έχει κανένα ιντρόνιο. Κωδικοποιεί την πρωτεΐνη ιστόνη. Το μεγαλύτερο ανθρώπινο γονίδιο κωδικοποιεί την πρωτεΐνη δυστροφίνη, η οποία λείπει ή δεν είναι λειτουργική στην ασθένεια μυϊκή δυστροφία. Αυτό το γονίδιο είναι 2,5 εκατομμύρια νουκλεοτίδια και κάνει πάνω από 16 ώρες για να παραγάγει ένα ενιαίο μετάγραφο. Ωστόσο, περισσότερο από 99% του γονιδίου αποτελείται από τα 79 ιντρόνιά του. 21

22 Εικόνα 17. Απλουστευμένη περιγραφή της γονιδιακής δομής. Ένα γονίδιο που κωδικοποιεί πρωτεΐνη καθορίζεται από το μήκος του πρωτογενούς μετάγραφού του. Ο υποκινητής και οποιοδήποτε άλλο ρυθμιστικό στοιχείο βρίσκονται έξω από το γονίδιο. Η κωδικοποιήσιμη περιοχή είναι η πληροφορία που χρειάζεται για να καθορίσει την αλληλουχία των αμινοξέων στην πρωτεΐνη. Οι μη κωδικοποιήσιμες περιοχές βρίσκονται στο mrna αλλά δεν χρησιμοποιούνται για να καθορίσουν την πρωτεϊνική αλληλουχία. Είναι κυρίως ρυθμιστικές. Τέλος, τα ιντρόνια βρίσκονται στο πρωτογενές μετάγραφο αλλά αφαιρούνται από το mrnα 1.5. Καθορισμός της αλληλουχίας των γονιδίων και χρήση υπολογιστών Για να μπορέσουμε να αποφανθούμε για το αν ένα τυχαίο τμήμα DNA είναι γονίδιο ή όχι απαραίτητη προϋπόθεση αποτελεί η ικανότητα αξιόπιστης διάκρισης των κωδικοποιητικών από τις μη κωδικοποιητικές αλληλουχίες. Αρχικά αναζητούμε ανοιχτά πλαίσια ανάγνωσης (open reading frames ORFs). Τα ORFs είναι μακριές αλληλουχίες οι οποίες δεν περιέχουν κωδικόνια τερματισμού. Μια τυχαία αλληλουχία νουκλεοτιδίων αναμένεται να περιέχει ένα κωδικόνιο τερματισμού της πρωτεϊνοσύνθεσης κάθε 20 κωδικόνια (επειδή υπάρχουν 3 κωδικόνια τερματισμού μέσα στο σύνολο των 64 κωδικονίων). Συνεπώς, η ανεύρεση ενός ORF, δηλαδή μιας συνεχούς αλληλουχίας νουκλεοτιδίων που κωδικοποιεί πάνω από 100 αμινοξέα, είναι το πρώτο βήμα για την αναγνώριση ενός καλού υποψηφίου για τον τίτλο του πιθανού γονιδίου. Σήμερα η αναζήτηση ORFs γίνεται με προγράμματα ηλεκτρονικού υπολογιστή (βιοπληροφορική), που εντοπίζουν πιθανά κωδικόνια έναρξης (συνήθως ATG) και κωδικόνια τερματισμού (TAA, TAG ή TGA) (Εικόνα 18). Εικόνα 18. Προγράμματα ηλεκτρονικού υπολογιστή χρησιμοποιούνται για την ανεύρεση γονιδίων. Σε αυτό το παράδειγμα μια αλληλουχία DNA μήκους 7500 ζευγών νουκλεοτιδίων από τον παθογόνο ζυμομύκητα Candida albicans αναλύθηκε από ένα πρόγραμμα ηλεκτρονικού υπολογιστή που μετέφρασε την αλληλουχία και στα έξι πιθανά ανοιχτά πλαίσια ανάγνωσης. Στην παραπάνω εικόνα οπτικοποιείται το αποτέλεσμα της ανάλυσης: κάθε πλαίσιο ανάγνωσης παρουσιάζεται υπό μορφή οριζόντιας στήλης στην οποία τα κωδικόνια τερματισμού (TGA, TAA και TAG) σημαίνονται από τις μεγαλύτερες κάθετες γραμμές, ενώ τα κωδικόνια της μεθειονίνης από τις μικρότερες γραμμές. Τέσσερα ανοιχτά πλαίσια ανάγνωσης (κίτρινο) αναγνωρίζονται ευκρινώς από τη στατιστικώς σημαντική απουσία κωδικονίων τερματισμού. Σε καθένα από αυτά, το πιθανό κωδικόνιο έναρξης (ATG) επισημαίνεται με κόκκινο. Τα υπόλοιπα κωδικόνια ATG κωδικοποιούν τη μεθειονίνη. Μια από τις πιο αποτελεσματικές μεθόδους επίσης για την αναγνώριση γονιδίων 22

23 στηρίζεται στην ομολογία με γονίδια άλλων οργανισμών. Για παράδειγμα ακόμα και ένα πολύ μικρό ORF ενδέχεται να είναι ένα εξόνιο αν η αλληλουχία των αμινοξέων που κωδικοποιεί ταιριάζει με μια γνωστή πρωτεΐνη ενός άλλου οργανισμού. Επίσης, αν ένα υποψήφιο ORF είναι πολύ διατηρημένο σε αρκετά διαφορετικά γονιδιώματα, είναι πολύ πιθανό να κωδικοποιεί πρωτεΐνη, έστω και αν το γονίδιο που το περιέχει δεν έχει ακόμα αναγνωριστεί ή μελετηθεί σε κανέναν οργανισμό. Με τη βοήθεια τέτοιων συγκρίσεων (π.χ. άνθρωπος έναντι ποντικού έναντι ψαριού fugu) μπορεί ν αναγνωριστούν μικρά ORFs άγνωστης λειτουργίας και με περισσότερη προσπάθεια να συναρμολογηθούν σε ολόκληρα γονίδια. Για να καθοριστεί ποια γονίδια εκφράζονται σ ένα ορισμένο είδος κυττάρων ή σ έναν ορισμένο ιστό, απομονώνεται mrna από ποικίλους διαφορετικούς ιστούς και μετατρέπεται σε συμπληρωματικό DNA (cdna). Επειδή mrna μετάγραφα παράγονται με μεταγραφή και συρραφή από γονίδια που κωδικοποιούν πρωτεΐνες, αυτή η συλλογή από cdna αντιπροσωπεύει τις αλληλουχίες όλων των γονιδίων που εκφράζονται στα κύτταρα από τα οποία απομονώθηκε το mrna. Τα cdna παρασκευάζονται από ποικίλους ιστούς επειδή η συγκεκριμένη προσέγγιση επιδιώκει ν αναγνωρίσει όλα τα γονίδια και διαφορετικοί ιστοί εκφράζουν διαφορετικά γονίδια. Ένα επιπλέον όφελος από την ανάλυση του cdna προέρχεται από το γεγονός ότι το mrna δεν περιέχει ούτε ιντρόνια ούτε το μη απαραίτητο διατμηματικό DNA που παρεμβάλλεται ανάμεσα στα γονίδια. Συνεπώς, οι αλληλουχίες του cdna αντιστοιχούν επακριβώς στις κωδικοποιητικές αλληλουχίες του γονιδιώματος. Μετά το κόψιμο ενός μεγάλου μορίου DNA σε μικρότερα κομμάτια με τη χρησιμοποίηση μιας νουκλεάσης περιορισμού, τα κλάσματα του DNA πρέπει να διαχωριστούν το ένα από το άλλο. Συνήθως αυτό επιτυγχάνεται με ηλεκτροφόρηση σε πηκτή, μια τεχνική που διαχωρίζει τα κλάσματα με βάση το μήκος τους. Το μείγμα των κλασμάτων του DNA τοποθετείται στο ένα άκρο μιας λεπτής φέτας πηκτής αγαρόζης ή πολυακρυλαμίδης που περιέχει ένα μικροσκοπικό δίκτυο πόρων. Στη συνέχεια, ένα ηλεκτρικό πεδίο εφαρμόζεται διαμέσου της πηκτής. Επειδή το DNA έχει αρνητικό φορτίο, τα κλάσματα μεταναστεύουν προς το θετικό ηλεκτρόδιο. Τα μεγαλύτερα κλάσματα μετακινούνται βραδύτερα, επειδή η πορεία τους παρακωλύεται από το στρώμα της αγαρόζης. Μέσα σε λίγες ώρες, τα κλάσματα του DNA θα έχουν μετακινηθεί μέσα στην πηκτή σύμφωνα με το μέγεθός τους, σχηματίζοντας μια <σκάλα> από ξεχωριστές ζώνες, η καθεμιά από τις οποίες αποτελείται από ένα σύνολο μορίων DNA ταυτόσημου μήκους (Εικόνα 19Α). Συχνά η απομόνωση ενός ορισμένου κλάσματος DNA μπορεί να γίνει πολύ εύκολα, απλώς κόβοντας με ξυράφι ένα μικρό κομμάτι της πηκτής που περιέχει τη σχετική ζώνη. Για να γίνουν ορατές οι ζώνες του DNA πάνω στην πηκτή της αγαρόζης ή της πολυακρυλαμίδης, το DNA πρέπει με κάποιο τρόπο να σημανθεί ή να χρωσθεί. Μια ευαίσθητη μέθοδος χρώσης του DNA συνίσταται σε έκθεσή του σε μια χρωστική που προσδένεται στο DNA και φθορίζει κάτω από υπεριώδες φως (Εικόνα 19Β). Μια ακόμα πιο ευαίσθητη μέθοδος ανίχνευσης περιλαμβάνει την ενσωμάτωση ενός ραδιοϊσοτόπου στα μόρια του DNA πριν από την ηλεκτροφόρηση. Το ισότοπο που χρησιμοποιείται συχνά είναι ο 32 P, επειδή μπορεί να 23

24 ενσωματωθεί στις φωσφορικές ομάδες του DNA και, επιπλέον, επειδή εκπέμπει ένα β- σωματίδιο πλούσιο σε ενέργεια που ανιχνεύεται εύκολα με την τεχνική της αυτοραδιογραφίας (Εικόνα 19Γ). Εικόνα 19. Διαχωρισμός και ανίχνευση μορίων DNA με βάση το μέγεθός τους με ηλεκτροφόρηση σε πηκτή. Έχουν αναπτυχθεί αρκετές μέθοδοι για την ανάλυση της αλληλουχίας του DNA. Η πιο διαδεδομένη είναι η μέθοδος των διδεοξυνουκλεοτιδίων (dideoxy method) κατά την οποία πραγματοποιείται σύνθεση DNA in vitro παρουσία τριφωσφορικών διδεοξυριβονουκλεοτιδίων που προκαλούν τερματισμό των νέων κλώνων του DNA (Εικόνα 20Α). Αυτή η τεχνική χρησιμοποιεί την DNA πολυμεράση και παράγει αντίγραφα του υπό ανάλυση κλάσματος του DNA. Οι σχετικές αντιδράσεις αντιγραφής του DNA πραγματοποιούνται in vitro, υπό συνθήκες που εξασφαλίζουν ότι οι νέοι κλώνοι του DNA θα τερματίζονται όταν φτάσουν σ ένα ορισμένο νουκλεοτίδιο (A, C, G, ή T) (Εικόνα 120Β). Όπως φαίνεται στην εικόνα 20Γ, η μέθοδος αυτή παράγει ένα σύνολο διαφορετικών DNA αντιγράφων που σταματούν σε κάθε θέση μέσα στο αρχικό DNA και επομένως διαφέρουν σε μήκος μόνο κατά ένα νουκλεοτίδιο. Τα αντίγραφα του DNA μπορεί να διαχωριστούν με βάση το μήκος τους με ηλεκτροφόρηση σε πηκτή και να καθοριστεί η αλληλουχία των νουκλεοτιδίων του αρχικού DNA από τη σειρά των DNA αντιγράφων στην πηκτή. Η ίδια βασική μέθοδος εξακολουθεί να χρησιμοποιείται και σήμερα με σημαντικές 24

25 βελτιώσεις. Η ανάλυση είναι πλέον εντελώς αυτοματοποιημένη: ρομποτικές συσκευές αναμειγνύουν τ αντιδραστήρια και στη συνέχεια <φορτώνουν>, <τρέχουν> και <διαβάζουν> τη σειρά των νουκλεοτιδίων πάνω στην πηκτή. Η ανάλυση διευκολύνεται από τη χρησιμοποίηση διδεοξυνουκλεοτιδίων σημασμένων το καθένα με διαφορετική χρωστική. Έτσι, οι τέσσερις αντιδράσεις σύνθεσης μπορεί να εκτελεστούν στο ίδιο σωληνάριο και τα προϊόντα να διαχωριστούν στην ίδια στήλη μιας πηκτής. Ένας ανιχνευτής που βρίσκεται στο κάτω άκρο της πηκτής <διαβάζει> και καταγράφει το χρώμα της φθορίζουσας χρωστικής κάθε ζώνης που περνά από μπροστά του και ένας υπολογιστής καταγράφει τις πληροφορίες για επακόλουθες αναλύσεις (Εικόνα 21). Στη συνέχεια, η πλήρης αλληλουχία του γονιδιώματος < συναρμολογείται> από αυτές τις πρώτες <αναγνώσεις>: συγκεκριμένα, μεγάλα τμήματα αλληλουχίας συντίθενται από ένα σύνολο μικρότερων κλασμάτων. Αυτά τα κλάσματα εμφανίζουν κάποιου βαθμού επικάλυψη και έτσι μπορεί να ενωθούν με τους γείτονές τους. 25

26 Εικόνα 20. Η ενζυμική μέθοδος ανάλυσης του DNA. 26

27 Εικόνα 21. Η αυτοματοποιημένη ανάλυση της αλληλουχίας του DNA. Εδώ παρουσιάζεται ένα πολύ μικρό τμήμα από τα δεδομένα μιας αυτοματοποιημένης ανάλυσης αλληλουχίας όπως εμφανίζεται στην οθόνη ενός υπολογιστή. Κάθε έγχρωμη κορυφή αντιπροσωπεύει με τη σειρά του το επόμενο νουκλεοτίδιο στην αλληλουχία του DNA Αλυσιδωτή αντίδραση της πολυμεράσης (polymerase chain reaction, PCR) Η τεχνική της αλυσιδωτής αντίδρασης της πολυμεράσης (polymerase chain reaction, PCR), διεκπεραιώνεται in vitro χωρίς να χρειάζονται κύτταρα. Με την τεχνική PCR, μια ορισμένη αλληλουχία νουκλεοτιδίων μπορεί ν αντιγραφεί σε μεγάλες ποσότητες γρήγορα και εκλεκτικά από οποιοδήποτε δείγμα DNA που την περιέχει. Για παράδειγμα, η αλυσιδωτή αντίδραση της πολυμεράσης χρησιμοποιείται ευρέως σε διαγνωστικές δοκιμασίες για την ανίχνευση παθολογικών γονιδίων όπως επίσης και για την παραγωγή μεγάλων ποσοτήτων μιας γενετικής αλληλουχίας από ένα μικρό δείγμα ανθρώπινου DNA. Η τεχνική PCR βασίζεται στη χρησιμοποίηση της DNA πολυμεράσης για τον πολλαπλασιασμό ενός εκμαγείου DNA σ επανειλημμένους κύκλους αντιγραφής. Το ένζυμο καθοδηγείται στην αλληλουχία που επιδιώκεται ν αντιγραφεί από βραχεία ολιγονουκλεοτίδια που δρουν ως εκκινητές (primers), τα οποία υβριδίζονται με την αρχή και το τέλος του εκμαγείου της επιθυμητής αλληλουχίας του DNA. Οι εκκινητές σχεδιάζονται έτσι ώστε να υποβοηθούν την εκκίνηση της αντιγραφής του DNA σε κάθε κλώνο του αρχικού δίκλωνου DNA. Οι εκκινητές παρασκευάζονται με χημική σύνθεση και γι αυτό η τεχνική PCR χρησιμοποιείται μόνο για την κλωνοποίηση κλασμάτων DNA γνωστή αλληλουχία των δύο άκρων τους. Υπό την καθοδήγηση των εκκινητών, η DNA πολυμεράση παράγει πολλά αντίγραφα (συνήθως δισεκατομμύρια) της επιλεγμένης αλληλουχίας (Εικόνα 14). Η τεχνική PCR είναι εξαιρετικά ευαίσθητη: μπορεί ν ανιχνεύσει έστω και ένα αντίγραφο μια αλληλουχίας DNA σ ένα δείγμα, 27

28 επαυξάνοντας το τόσο πολύ ώστε να μπορεί ν ανιχνευθεί με κατάλληλη χρώση μετά από διαχωρισμό με ηλεκτροφόρηση σε πηκτή. Υπάρχουν πάρα πολλές ιδιαίτερα χρήσιμες εφαρμογές της τεχνικής PCR. Οι πιο σημαντικές αφορούν πρώτον τη χρησιμοποίησή της για την άμεση κλωνοποίηση σχετικά μικρών κλασμάτων DNA (για παράδειγμα, μικρότερων από 10,000 ζεύγη νουκλεοτιδίων) από ένα κύτταρο. Το αρχικό εκμαγείο για την αντίδραση με PCR μπορεί να είναι DNA ή RNA και έτσι μπορεί να παραχθεί ένα γενωμικό DNA αντίγραφο ή ένα cdna αντίγραφο. Μια άλλη εφαρμογή της τεχνικής PCR, η οποία βασίζεται στην αξιοσημείωτη ευαισθησία της, είναι η ανίχνευση λοιμώξεων σε πολύ πρώιμα στάδια. Στην περίπτωση αυτή, ως εκκινητές χρησιμοποιούνται βραχείες αλληλουχίες συμπληρωματικές με το γονιδίωμα του μικροβίου και μετά από πολλούς κύκλους αντιγραφής μπορεί να διαπιστωθεί η παρουσία (ή η απουσία) σ ένα δείγμα αίματος έστω και ενός αντιγράφου του γονιδιώματος ενός ιού. Για πολλές λοιμώξεις, η PCR είναι η πιο ευαίσθητη μέθοδος ανίχνευσης και ήδη για το σκοπό αυτό αντικαθιστά ανοσολογικές μεθόδους που χρησιμοποιούν αντισώματα εναντίον των πρωτεϊνών του περιβλήματος των ινών. Επίσης, η PCR προσφέρει πολλές δυνατότητες στην ιατροδικαστική επιτρέποντας την ανάλυση πολλών μικρών δειγμάτων. Έτσι, ακόμα και όταν κανείς ξεκινήσει με ίχνη αίματος και ιστών που περιέχουν τα κατάλοιπα έστω και ενός κυττάρου μπορεί ν αποκτήσει ένα DNA αποτύπωμα του ανθρώπου από τον οποίο προήλθε το κύτταρο. Το γονιδίωμα κάθε ανθρώπου (εκτός των ταυτοσήμων διδύμων) είναι μοναδικό ως προς την αλληλουχία των νουκλεοτιδίων του. Επομένως, το DNA που επαυξάνεται με την τεχνική PCR χρησιμοποιώντας ένα συγκεκριμένο ζεύγος εκκινητών πιθανότατα θα διαφέρει ως προς την αλληλουχία του από άνθρωπο σε άνθρωπο. Με κατάλληλα επιλεγμένη ζεύγη εκκινητών που καλύπτουν πολύ μεταβλητά τμήματα του ανθρώπινου γονιδιώματος, η τεχνική PCR μπορεί ν αποδώσει ένα χαρακτηριστικό αποτύπωμα του DNA για κάθε άνθρωπο. 28

29 Εικόνα 22. Η επαύξηση του DNA με την τεχνική PCR. Οι γνώσεις σχετικά με την αλληλουχία του DNA που πρόκειται να επαυξηθεί χρησιμοποιούνται για το σχεδιασμό δύο συνθετικών ολιγονουκλεοτιδίων το καθένα από τα οποία θα είναι συμπληρωματικό με την αλληλουχία ενός κλώνου της δίκλωνης έλικας του DNA στα δύο αντίθετα άκρα της επιλεγμένης περιοχής. Τα συγκεκριμένα ολιγονουκλεοτίδια λειτουργούν ως εκκινητές για in vitro σύνθεση DNA (διεκπεραιώνεται από μια DNA πολυμεράση) και καθορίζουν το τμήμα του DNA που θα πολλαπλασιαστεί Βιοπληροφορική Η ολοκλήρωση της αλληλοuχίας του ανθρώπινου γονιδιώματος επιτεύχθηκε τον Απρίλιο, του Αυτή η ολοκλήρωση είχε μια σημαντική επίδραση στον τρόπο με τον οποίο η βιολογική και βιοϊατρική έρευνα πραγματοποιείται. Η αλληλοuχία μας έχει δώσει τις πληροφορίες για τα ανθρώπινα στοιχεία παραλλαγής ακολουθίας, τα πρότυπα στοιχεία ακολουθίας οργανισμών, και τις πληροφορίες για τη δομή και τη λειτουργία γονιδίων. Ο όγκος των σημερινών δεδομένων που παράγονται στο χώρο της Μοριακής Βιολογίας και πρέπει να αναλυθούν και να επεξεργαστούν, καθιστά απαραίτητη τη συνεργασία, σε πολλούς τομείς, με την επιστήμη της Πληροφορικής. Ο επιστημονικός χώρος της ένωσης αυτών των πεδίων ονομάζεται διεθνώς Βιοπληροφορική (Bioinformatics). Η Βιοπληροφορική μπορεί να οριστεί ως: "η εφαρμογή υπολογιστικών τεχνικών και μεθόδων στην προσπάθεια κατανόησης και οργάνωσης των δεδομένων και πληροφοριών που σχετίζονται με τα βιολογικά μακρομόρια". H ανάλυση ακολουθιών του DNA, η μοριακή μοντελοποίηση βιολογικών μορίων, ο σχεδιασμός φαρμάκων με τη βοήθεια ηλεκτρονικών υπολογιστών, η πρόβλεψη των πρωτεϊνικών δομών, oι ταχύτερες μέθοδοι αποθήκευσης, διαχείρισης και ανάκτησης 29

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα