ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ"

Transcript

1 ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ

2 Σύνδροµο Down Το σύνδροµο Down είναι µια γενετική ανωµαλία ου εριλαµβάνει συνδυασµό χαρακτηριστικών, ό ως νευµατική καθυστέρηση, συγκεκριµένα χαρακτηριστικά ροσώ ου και συχνά καρδιακά ροβλήµατα, ροβλήµατα στην όραση και την ακοή, αυξηµένες µολύνσεις και άλλα ροβλήµατα υγείας. Το σύνδροµο Down είναι α ό τις ιο κοινές γενετικές ανωµαλίες ε ηρεάζοντας 1 στα µωρά. Στις ερισσότερες ερι τώσεις το σύνδροµο Down οφείλεται στην αρουσία ενός ε ι λέον χρωµοσώµατος 21. Ενώ φυσιολογικά το ωάριο και το σ ερµατοζωάριο εριέχουν α ό 23 χρωµοσώµατα, µη διαχωρισµός των χρωµοσωµάτων κατά τη δηµιουργία ενός α ό τους δυο γαµέτες και γονιµο οίηση αυτού µε έναν φυσιολογικό γαµέτη θα οδηγήσει στη γέννηση αιδιού µε ένα ε ι λέον 21 χρωµόσωµα. Ο µη διαχωρισµός των χρωµοσωµάτων είναι ένα τυχαίο γεγονός κατά τη δηµιουργία των γαµετών ενώ και οι δυο γονείς είναι φυσιολογικοί. Ο κίνδυνος γέννησης ενός αιδιού µε σύνδροµο Down αυξάνει µε την ηλικία της µητέρας α ό 1/1250 για µια γυναίκα ηλικίας 25 χρονών σε 1/100 για µια γυναίκα ηλικίας 40 ετών. (καρυότυ ος). Συνήθως, ο γιατρός ροτείνει αµνιο αρακέντηση σε ερί τωση ου υ άρχουν ενδείξεις α ό τις εξετάσεις αίµατος τη 16 η εβδοµάδα της κύησης ή σε ερί τωση ου το ζευγάρι έχει ένα ακόµη αιδί µε νευµατική καθυστέρηση ή άλλη γενετική ανωµαλία. εν υ άρχει θερα εία για το σύνδροµο Down ούτε ρόληψη, διότι το σύνδροµο είναι α οτέλεσµα ενός τυχαίου γεγονότος ου συµβαίνει κατά τη δηµιουργία των γαµετών στον άνδρα ή τη γυναίκα.

3 Σύνδροµο Turner Το σύνδροµο Τurner είναι µια γενετική ανωµαλία ου σχετίζεται µε την έλλειψη ενός φυλετικού χρωµοσώµατος σε θηλυκά άτοµα. Φυσιολογικά, ο άνθρω ος έχει 46 χρωµοσώµατα, α ό τα ο οία τα 44 είναι ίδια σε θηλυκά και αρσενικά άτοµα ενώ τα θηλυκά έχουν ένα ζεύγος φυλετικών χρωµοσωµάτων ΧΧ και τα αρσενικά ένα ζεύγος φυλετικών χρωµοσωµάτων ΧΥ. Τα κορίτσια µε σύνδροµο Τurner έχουν ένα φυλετικό χρωµόσωµα Χ. Περί ου 1 στα 2000 κορίτσια γεννιούνται µε σύνδροµο Τurner. Τα κορίτσια µε σύνδροµο Τurner έχουν µόνο 1 φυσιολογικό Χ χρωµόσωµα, ενώ το δεύτερο χρωµόσωµα είτε λεί ει είτε είναι µη φυσιολογικό. Το Χ χρωµόσωµα χάνεται τυχαία κατά τη δηµιουργία του ωαρίου ή του σ ερµατοζωαρίου στους γονείς ή κατά τα ρώτα στάδια ανά τυξης του εµβρύου µετά τη σύλληψη. Μερικά κορίτσια µε σύνδροµο Τurner έχουν ένα φυσιολογικό και ένα µη φυσιολογικό Χ χρωµόσωµα, το ο οίο έχει κληρονοµηθεί α ό τον ένα γονέα ή έχει συµβεί κά οιο λάθος κατά τη δηµιουργία του ωαρίου ή του σ ερµατοζωαρίου. Σ άνια, µόνο µερικά α ό τα κύτταρα του µωρού έχουν ένα Χ χρωµόσωµα, ενώ τα άλλα κύτταρα έχουν φυσιολογικά 2 Χ χρωµοσώµατα. Η κατάσταση αυτή ονοµάζεται µωσαϊκισµός. Τα κορίτσια µε µωσαϊκισµό έχουν κά οια α ό τα χαρακτηριστικά του συνδρόµου Τurner. (καρυότυ ος). Σε µερικές ερι τώσεις τα χαρακτηριστικά του συνδρόµου είναι εµφανή α ό τη γέννηση του κοριτσιού, αλλά συνήθως αυτά εκδηλώνονται έντονα κατά τη διάρκεια της εφηβείας, ό ου δεν εµφανίζονται τα δευτερογενή χαρακτηριστικά του φύλου. Τα κορίτσια µε σύνδροµο Turner είναι στείρα. Το φυλετικό χρωµόσωµα ου λεί ει στα κορίτσια µε σύνδροµο Τurner δεν µ ορεί να ε ιδιορθωθεί. Ωστόσο υ άρχουν κά οιες θερα είες διαθέσιµες. Τα κορίτσια αίρνουν αυξητική ορµόνη για να αυξήσουν το ύψος τους, καθώς και οιστρογόνα και ρογεστερόνη για να βελτιώσουν τα θηλυκά τους χαρακτηριστικά. Τα κορίτσια αυτά είναι στείρα, κάτι το ο οίο δεν µ ορεί να θερα ευτεί.

4 Σύνδροµο Klinefelter Το σύνδροµο Klinefelter οφείλεται στην αρουσία ενός ε ι λέον Χ χρωµοσώµατος στα αρσενικά άτοµα. Περί ου 1 στα 500 αγόρια έχουν σύνδροµο Klinefelter. Τα αγόρια µε σύνδροµο Klinefelter έχουν 1 Υ και 2 Χ φυλετικά χρωµοσώµατα αντί για 1 ζεύγος ΧΥ φυλετικών χρωµοσωµάτων. Το ε ι λέον χρωµόσωµα κερδίζεται κατά τη διάρκεια της δηµιουργίας του ωαρίου ή του σ ερµατοζωαρίου στους γονείς ή κατά τα ρώτα στάδια ανά τυξης του εµβρύου µετά τη σύλληψη και δεν µ ορεί να χαθεί µετά. Το γεγονός είναι τυχαίο και οι γονείς δεν έκαναν κάτι για να το ροκαλέσουν ούτε µ ορούσαν να κάνουν κάτι για να το α οτρέψουν. (καρυότυ ος). Τα νεογέννητα αιδιά µε σύνδροµο Klinefelter µοιάζουν µε τα υ όλοι α αιδιά, αλλά κατά τη διάρκεια της αιδικής ηλικία ψηλώνουν ερισσότερο, δεν έχουν καλή ανά τυξη των γεννητικών οργάνων και δεν αράγουν φυσιολογική τεστοστερόνη. Στην εφηβεία µ ορεί να εµφανίσουν στήθος και λιγότερη τριχοφυΐα. Τα άτοµα µε σύνδροµο Klinefelter είναι στείρα. Το ε ι λέον φυλετικό χρωµόσωµα ου υ άρχει στα αγόρια µε σύνδροµο Klinefelter δεν µ ορεί να ε ιδιορθωθεί. Ωστόσο υ άρχουν κά οιες θερα είες διαθέσιµες. Η χορήγηση τεστοστερόνης µ ορεί να βοηθήσει στην εµφάνιση ιο ανδρικών χαρακτηριστικών. Η στειρότητα δεν µ ορεί να θερα ευτεί.

5 Σύνδροµο ΧΧΧ Το σύνδροµο ΧΧΧ είναι µια γενετική ανωµαλία ου σχετίζεται µε την ύ αρξη ενός ε ι λέον φυλετικού χρωµοσώµατος Χ σε θηλυκά άτοµα. Περί ου 1 στα κορίτσια γεννιούνται µε σύνδροµο ΧΧΧ. Τα κορίτσια µε σύνδροµο ΧΧΧ έχουν 3Χ φυλετικά χρωµοσώµατα αντί για 2Χ ου είναι το φυσιολογικό. Το ε ι λέον Χ χρωµόσωµα κερδίζεται τυχαία κατά τη δηµιουργία του ωαρίου ή του σ ερµατοζωαρίου στους γονείς ή κατά τα ρώτα στάδια ανά τυξης του εµβρύου µετά τη σύλληψη. (καρυότυ ος). Τα νεογέννητα κορίτσια µε σύνδροµο ΧΧΧ µοιάζουν µε τα άλλα κορίτσια. Συνήθως, τα κορίτσια µε το σύνδροµο γίνονται ψηλότερα α ό τα άλλα κορίτσια της ηλικίας τους. Τα κορίτσια µε σύνδροµο ΧΧΧ είναι συνήθως γόνιµα. Το φυλετικό χρωµόσωµα ου υ άρχει ε ι λέον στα κορίτσια µε σύνδροµο ΧΧΧ δεν µ ορεί να εξαλειφθεί.

6 Σύνδροµο XYY Το σύνδροµο XYY οφείλεται στην αρουσία ενός ε ι λέον Y χρωµοσώµατος στα αρσενικά άτοµα. Περί ου 1 στα 1000 αγόρια έχουν σύνδροµο XYY. Τα αγόρια µε το σύνδροµο έχουν 1 X και 2 Y φυλετικά χρωµοσώµατα αντί για 1 ζεύγος ΧΥ φυλετικών χρωµοσωµάτων. Το ε ι λέον χρωµόσωµα κερδίζεται κατά τη διάρκεια της δηµιουργίας του ωαρίου ή του σ ερµατοζωαρίου στους γονείς ή κατά τα ρώτα στάδια ανά τυξης του εµβρύου µετά τη σύλληψη και δεν µ ορεί να χαθεί µετά. Το γεγονός είναι τυχαίο και οι γονείς δεν έκαναν κάτι για να το ροκαλέσουν ούτε µ ορούσαν να κάνουν κάτι για να το α οτρέψουν. (καρυότυ ος). Τα νεογέννητα αιδιά µε σύνδροµο ΧΥΥ µοιάζουν µε τα υ όλοι α αιδιά, αλλά κατά τη διάρκεια της αιδικής ηλικία ψηλώνουν ερισσότερο. Κατά τα άλλα η σωµατική τους ανά τυξη και η ανά τυξη των γεννητικών οργάνων είναι κανονική. Τα αιδιά µε σύνδροµο ΧΥΥ µ ορεί να εµφανίσουν λίγο χαµηλότερο δείκτη νοηµοσύνης και µαθησιακά ροβλήµατα. Το ε ι λέον φυλετικό χρωµόσωµα ου υ άρχει στα αγόρια µε σύνδροµο ΧΥΥ δεν µ ορεί να ε ιδιορθωθεί. Αν υ άρχουν µαθησιακές δυσκολίες, αυτές µ ορούν να ξε εραστούν µε κατάλληλη θερα εία.

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

Χρωμοσωματικές ανωμαλίες

Χρωμοσωματικές ανωμαλίες Χρωμοσωματικές ανωμαλίες ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Εργασία στη Βιολογία

Εργασία στη Βιολογία Εργασία στη Βιολογία Τι είναι το χρωμόσωμα? Το χρωμόσωμα είναι μια οργανωμένη δομή DNA και πρωτεϊνών που βρίσκεται στα κύτταρα. Είναι ένα μοναδικό κομμάτι DNA που περιλαμβάνει πολλά γονίδια και άλλες ακολουθίες

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΠΡΟΣΑΡΜΟΓΗ ΤΩΝ ΠΑΙ ΙΩΝ ΣΤΟ ΠΑΙ ΙΚΟ ΣΤΑΘΜΟ

ΠΡΟΣΑΡΜΟΓΗ ΤΩΝ ΠΑΙ ΙΩΝ ΣΤΟ ΠΑΙ ΙΚΟ ΣΤΑΘΜΟ ΠΡΟΣΑΡΜΟΓΗ ΤΩΝ ΠΑΙ ΙΩΝ ΣΤΟ ΠΑΙ ΙΚΟ ΣΤΑΘΜΟ Η ρώτη µέρα του αιδιού στον αιδικό σταθµό ή το νη ιαγωγείο συνε άγεται συνήθως τον ρώτο α οχωρισµό του α ό τα ρόσω α φροντίδας και κυρίως τη µητέρα και συχνά σηµαδεύεται

Διαβάστε περισσότερα

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μάθημα Ουρολογίας Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μανώλης Μαυρομανωλάκης Διευθυντής ΕΣΥ Ουρολογική Κλινική Πα.Γ.Ν.Η Ηράκλειο 2011 Ανωμαλίες Σεξουαλικής Διαφοροποίησης

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος του Θήλεος ΠΑΡΟΥΣΙΑΣΕΙΣ ΜΑΘΗΜΑΤΩΝ ΟΙΚΟΝΟΜΟΠΟΥΛΟΣ ΙΩΑΝΝΗΣ Προσοχή: Οι παρουσιάσεις μαθημάτων αποτελούν βοήθημα παρακολούθησης των παραδόσεων

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Η ΘΡΟΜΒΟΦΙΛΊΑ ΕΊΝΑΙ ΕΠΙΚΊΝΔΥΝΗ ΓΙΑ ΕΣΆΣ ΚΑΙ ΓΙΑ ΤΟ ΈΜΒΡΥΟ ΣΑΣ

Η ΘΡΟΜΒΟΦΙΛΊΑ ΕΊΝΑΙ ΕΠΙΚΊΝΔΥΝΗ ΓΙΑ ΕΣΆΣ ΚΑΙ ΓΙΑ ΤΟ ΈΜΒΡΥΟ ΣΑΣ Η ΘΡΟΜΒΟΦΙΛΊΑ ΕΊΝΑΙ ΕΠΙΚΊΝΔΥΝΗ ΓΙΑ ΕΣΆΣ ΚΑΙ ΓΙΑ ΤΟ ΈΜΒΡΥΟ ΣΑΣ Alexander Kofinas, MD Director Associate Professor Clinical Obstetrics and Gynecology Cornell University, College of Medicine www.kofinasperinatal.org

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ

ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ 2007-8 www.cyprusbiology.com 1 ΕΝΟΤΗΤΑ Α. ΠΩΣ ΑΡΧΙΖΕΙ Η ΖΩΗ ιαιώνιση των ειδών 1. Ποια είναι τα µέρη του σπερµατοζωαρίου; 2. Να συµπληρώσετε τις ενδείξεις του πιο κάτω σχήµατος

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

Νοητική υστέρηση. είναι η κατάσταση που χαρακτηρίζεται από. σημαντικά υποβαθμισμένη νοητική λειτουργία (κάτω από το μέσο όρο), που εμφανίζεται κατά

Νοητική υστέρηση. είναι η κατάσταση που χαρακτηρίζεται από. σημαντικά υποβαθμισμένη νοητική λειτουργία (κάτω από το μέσο όρο), που εμφανίζεται κατά ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ Τμήμα Επιστήμης Φυσικής Αγωγής και Αθλητισμού Β έτος Σοφία Μπάτσιου Μάρτιος 2012 Να κατανοήσετε το πρόβλημα της νοητικής υστέρησης, τα χαρακτηριστικά των μαθητών με νοητική

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Μείωση-Βιολογία Κατεύθυνσης

Μείωση-Βιολογία Κατεύθυνσης κύτταρο -γυναίκας 1η μειωτική διαίρεση-αποχωρισμός ομολόγων 2η μειωτική διαίρεση-αποχωρισμός αδελφών Γαμέτης-3 Γαμέτης-4 Χ.Κ.ΦΙΡΦΙΡΗΣ-ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΟΠΤΙΚΗ-ΠΑΠΑΝΑΣΤΑΣΙΟΥ 101 Σελίδα 1 κύτταρο -άνδρα 1η

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1.

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1. Ενημερωτικό Δελτίο Τεύχος 1 Δεκέμβριος 2007 Εργαστήριο Κλινικής Βιοχημείας και Εργαστηριακής Ιατρικής Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ Δομή και λειτουργία του αναπαραγωγικού συστήματος 1. Να ονομάσετε τις αριθμημένες δομές του παρακάτω σχήματος. Βλέπε εικ. 12.1 της σ. 219 του βιβλίου του μαθητή. 2. Να ενώσετε

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΕΛ. ΦΡΥΣΙΡΑ Επ. Καθηγήτρια Κλινικής Γενετικής ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΓΕΝΕΤΙΚΗΣ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙ ΩΝ «Η ΑΓΙΑ ΣΟΦΙΑ» ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ.ε. ΚΑΝΑΒΑΚΗΣ ΣΥΓΓΕΝΕΙΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ειγµατοληψία Χοριακών Λαχνών (CVS)

ειγµατοληψία Χοριακών Λαχνών (CVS) 12 ειγµατοληψία Χοριακών Λαχνών (CVS) Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιήθηκε από φυλλάδια που εκδόθηκαν από τα νοσοκοµεία Guy s και St Thomas στο Λονδίνο,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819 e-mail: hmesogiaki@ippokratio.gr

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΑΡΑΔΙΠΠΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ. Χρόνος: 2 ώρες Ημερομηνία: 13 Ιουνίου 2012

ΓΥΜΝΑΣΙΟ ΑΡΑΔΙΠΠΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ. Χρόνος: 2 ώρες Ημερομηνία: 13 Ιουνίου 2012 ΓΥΜΝΑΣΙΟ ΑΡΑΔΙΠΠΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ ΜΑΘΗΜΑ: ΦΥΣΙΟΓΝΩΣΤΙΚΑ ΤΑΞΗ: Α ΓΥΜΝΑΣΙΟΥ Χρόνος: 2 ώρες Ημερομηνία: 13 Ιουνίου 2012 ΒΑΘΜΟΣ:. Υπογραφή:... Ονοματεπώνυμο:.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

Φυλοσύνδετη κληρονοµικότητα. Π. Πάσχου, PhD

Φυλοσύνδετη κληρονοµικότητα. Π. Πάσχου, PhD Φυλοσύνδετη κληρονοµικότητα Π. Πάσχου, PhD Thomas Hunt Morgan Βραβείο Nobel 1933 στην κατηγορία Φυσιολογία ή Ιατρική. Του δόθηκε για τα αποτελέσµατά της έρευνάς του στο πανεπιστήµιο Columbia, η οποία ξεκίνησε

Διαβάστε περισσότερα

Μη επεμβατικός Προγεννητικός έλεγχος

Μη επεμβατικός Προγεννητικός έλεγχος Μη επεμβατικός Προγεννητικός έλεγχος Α. Κολιαλέξη, Βιοπαθολόγος PhD Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Μη επεμβατικός ΠΕ από cffdna στο πλάσμα εγκύου Ελεύθερο Εμβρυϊκό DNA στη μητρική κυκλοφορία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 Μάθηµα: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και ώρα εξέτασης: ευτέρα, 5 Ιουνίου 2006 7.30 π.µ.

Διαβάστε περισσότερα

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ)

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) 1. Στις αλεπούδες το ασηµόµαυρο χρώµα του τριχώµατος καθορίζεται από ένα υπολειπόµενο αλληλόµορφο

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα