Χρωμοσωματικές ανωμαλίες

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Χρωμοσωματικές ανωμαλίες"

Transcript

1 Χρωμοσωματικές ανωμαλίες

2 ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ 35

3 Τεχνικές χρώσεις των χρωμοσωμάτων Χρώση Giemsa: ζώνες ανά απλοειδική σειρά Καρυότυπος

4

5 Ιδεόγραμμα-Ονοματολογία

6 Διακριτική ικανότητα ~1-2Mb Ανάλυση FISH σε μεταφασικά χρωμοσώματα Ανιχνευτής για το χρωμόσωμα 20 Ανιχνευτής για τελομερές Ανάλυση FISH σε μεσοφασικά χρωμοσώματα (fiber FISH) Διακριτική ικανότητα ~0,1Mb, συχνά στη φυσική χαρτογράφηση

7 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν 4Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ τριπλοειδία Α) Γονιμοποίηση ωαρίου από 2 σπερματοζωάρια Β, Γ) Αποτυχία σε μία από τις μειωτικές διαιρέσεις ωρίμανσης γαμετών (συνήθως σπερματοζωαρίου) ΑΝΕΥΠΛΟΕΙΔΙΑ: -ΚΑΘΕ ΕΠΙΠΛΕΟΝ Ή ΛΙΓΟΤΕΡΟ ΧΡΩΜΟΣΩΜΑ ΑΠΟ ΤΟ ΦΥΣΙΟΛΟΓΙΚΟ ΑΡΙΘΜΟ 2Ν -Η ΠΡΟΣΘΗΚΗ 2n+1 (τρισωμία) Ή ΑΠΩΛΕΙΑ 2n-1 (μονοσωμία) ΧΡΩΜΟΣΩΜΑΤΟΣ -2n+1+1 διπλή τρισωμία -2n-2 νουλισωμία (λείπουν ομόλογα χρωμοσώματα)

8 ΜΕΙΩΣΗ Μείωση Ι Μείωση ΙΙ Γαμέτες N+1 Τρισωμικός ζυγώτης Γαμέτες N-1 Μονοσωμικός ζυγώτης Γαμέτες Γαμέτες N+1 N-1 Τρισωμικός Μονοσωμικός ζυγώτης ζυγώτης Πως μπορούμε να διακρίνουμε σε ποιο στάδιο (Ι ή ΙΙ) δεν έγινε αποχωρισμός?

9 Τρισωμίες αυτοσωμικών χρωμοσωμάτων Τρισωμία 21 (σύνδρομο Down) H πιο συχνή βιώσιμη τρισωμία αυτοσωμικού χρωμοσώματος 95%: χρωμόσωμα 21 x 3 Συχνότερη αιτία: Μη διαχωρισμός στη μητρική μείωση Ι 1 / 800 νεογνά, 1 / 300 νεογνά για μητέρες >35 ετών 47, ΧΧ (ή ΧΥ), +21 Δυσμορφία Διανοητική καθυστέρηση Καρδιοπάθεια Κίνδυνος λευχαιμίας Πρόωρη γήρανση Συμπτώματα Αlzheimer

10 1 / γεννήσεις Πρόωρος θάνατος Ηλικία μητέρας Τρισωμία 13 (σύνδρομο Patau) λαγόχειλο πολυδακτυλία

11 1 / 8000 γεννήσεις Πρόωρος θάνατος Ηλικία μητέρας Τρισωμία 18 (σύνδρομο Edwards) Ηλικία της μητέρας - τρισωμίες

12 Αριθμητικές χρωμοσωμικές ανωμαλίες των φυλετικών χρωμοσωμάτων Τα φυλετικά χρωμοσώματα Xρωμόσωμα Χ Xρωμόσωμα Υ Κατανομή γονιδίων στο Χ Κατανομή γονιδίων στο Υ Μέγεθος : 57 Μb Γονίδια : 40 ~250 νοσήματα συνδεδεμένα με το Χ και <20 με το Υ Μέγεθος : 155 Μb (6% του γονιδιώματος) Γονίδια : > 700

13 Τυχαία απενεργοποίηση του Χ Απενεργοποίηση κατά τα πρώτα στάδια της εμβρυικής ζωής (~3 μέρες μετά τη γονιμοποίηση, ολοκληρώνεται στα τέλη της πρώτης βδομάδας ανάπτυξης, κύτταρα)

14 Διαταραχές φυλετικών χρωμοσωμάτων Οι φαινότυποι που συνδέονται με τις χρωμοσωμικές ανωμαλίες των φυλετικών χρωμοσωμάτων δεν είναι τόσο σοβαροί όσο εκείνοι που συνδέονται με διαταραχές των αυτοσωμικών χρωμοσωμάτων, λόγω: - απενεργοποίησης Χ (στις περισσότερες περιπτώσεις ασθενών με δομικές ανωμαλίες του Χ, απενεργοποιείται το δομικά ανώμαλο X-όχι τυχαία απενεργοποίηση?) - μικρού αριθμού γονιδίων του Υ ΑΝΕΥΠΛΟΕΙΔΙΕΣ Σύνδρομο Turner (45, X) ~50% μωσαϊκά Συχνότητα: 1,5 / 100 συλλήψεις Γεννώνται 1/5000 κορίτσια Έλλειψη του Χ συνήθως λόγω μη αποχωρισμού κατά την σπερματογένεση Ενήλικα- στείρα Φυσιολογική ευφυΐα-συμπεριφορά Αυξημένη συχνότητα καρδιαγγειακώννεφρικών ανωμαλιών Θεραπεία (όχι πλήρης) με οιστρογόνα και αυξητική ορμόνη

15 Σύνδρομο Klinefelter (47, XXY) Συχνότητα: 1/1000 γεννήσεις αγοριών (συνήθως στείρα) Μωσαϊκοί (15%) καρυότυποι με συμπτώματα του συνδρόμου Προκύπτουν από μειωτικό μη αποχωρισμό των φυλετικών χρωμοσωμάτων του πατέρα (κατά 40%) και της μητέρας (60%) Απενεργοποίηση του ενός Χ Μαθησιακά προβλήματα Τρισωμία X: 47, ΧΧΧ Συχνότητα: 1/1000 γεννήσεις κοριτσιών Μη αποχωρισμός των φυλετικών χρωμοσωμάτων της μητέρας Φαινοτυπικά χαρακτηριστικά μέσα στα φυσιολογικά όρια, χαμηλό IQ. Σύνδρομο 47, ΧΥΥ Συχνότητα: 1/1000 γεννήσεις αγοριών. Γόνιμα άτομα με φυσιολογικούς απόγονους Μη αποχωρισμός των φυλετικών χρωμοσωμάτων στην δεύτερη μειωτική διαίρεση του πατέρα Ίσως συσχετίζεται προβλήματα συμπεριφοράς ΠΟΛΥΣΩΜΙΕΣ: 48, ΧΧΧΥ και 49,ΧΧΧΧΥ, 46,ΧΧΧΧ και 49,ΧΧΧΧΧ λίγες περιπτώσεις με σοβαρή αναπτυξιακή και διανοητική καθυστέρηση

16 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται η φυσιολογική γενετική πληροφορία) Μη ισοζυγισμένες Είναι ή Σταθερές (μεταβιβάζονται κατά τις κυτταρικές διαιρέσεις) Ασταθείς Απαραίτητο 1 κεντρομερές & 2 τελομερή Συναντώνται ή Σε όλα τα κύτταρα ενός ατόμου Σε μορφή μωσαϊκού

17 ΧΡΩΜΟΣΩΜΙΚΑ ΕΛΛΕΙΜΜΑΤΑ & διπλασιασμοί Τελικό έλλειμμα Ενδιάμεσο έλλειμμα Άνισος επιχιασμός Σε περιοχές με επαναλαμβανόμενο DNA Κατά την πρόφαση της μείωσης Ι Φαινοτυπικό αποτέλεσμα? Βιωσιμότητα Ημιζυγωτία / Ψευδουπεροχή

18 Σύνδρομα ελλειμμάτων αυτοσωμικών χρωμοσωμάτων Σύνδρομο κλάματος γαλής (5p-) (cri-du-chat) ~ 1/ % των παιδιών με διανοητική καθυστέρηση Σποραδικές περιπτώσεις ή από γονείς-φορείς μεταθέσεων Ο φαινότυπος εξαρτάται από το μέγεθος του ελλείμματος Χαρακτηριστικό προσωπείο Μη φυσιολογική ανάπτυξη του λάρυγγα στα έμβρυα Αναπνευστικά προβλήματα Συνήθως με φυσιολογική διάρκεια ζωής Κρίσιμη περιοχή : 5p15 Σύνδρομο Down (μικρό ποσοστό περιπτώσεων) Μερική τρισωμία (μπορεί να μην είναι ανιχνεύσιμη κυτταρογενετικά) 21q22.2 q22.3 = η κρίσιμη περιοχή για το σύνδρομο ( γονίδια)

19 Ταυτοποίηση μικροελλειμμάτων με FISH Ανιχνευτής για την περιοχή 22q11.2 Ανιχνευτής-control για το χρωμόσωμα 22

20

21 Σύνδρομα DiGeorge VCF (velocardiofacial) 1/4000 γεννήσεις Σύνδρομα απλοανεπάρκειας Έλλειμμα ~ 30 γονιδίων Καρδιακές ανωμαλίες Δυσμορφίες Μαθησιακές δυσκολίες Ποια γονίδια ευθύνονται?

22 CGH Comparative Genomic Hybridization Case Control

23 ΔΟΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΠΟΥ ΑΦΟΡΟΥΝ ΠΕΡΙΣΣΟΤΕΡΑ ΧΡΩΜΟΣΩΜΑTA ΙΣΟΖΥΓΙΣΜΕΝΗ ΜΕΤΑΘΕΣΗ (ολόκληρη η γενετική πληροφορία, κίνδυνος κατά τον σχηματισμό των γαμετών) O πιο συχνός τύπος δομικής ανωμαλίας χρωμοσωμάτων (1 / 500 νεογνά) Αμοιβαία (ανταλλαγή υλικού) Κατά Robertson μεταξύ ακροκεντρικών χρωμοσωμάτων (13, 14, 15, 21, 22) Ένθεση προσθήκη υλικού σε μη ομόλογο χρωμόσωμα 4% του συνδρόμου Down: 46, XX, -14, + t (14q21q) και είναι απόγονοι φορέων μετάθεσης κατά Robertson Από φορείς 21q21q: παιδιά με σύνδρομο Down (1%) (ισοχρωμόσωμα ή κατά Robertson?)

24 ΓΑΜΕΤΕΣ Φορέας αμοιβαίας μετάθεσης Σύναψη στη μείωση α δ γ β α γ δ β Διαχωρισμός Εναλλασσόμενος (α+β / γ+δ) Παρακείμενος-1 (α+δ / γ+β) Παρακείμενος-2 (α+γ / δ+β) Φυσιολ. Ισοζυγ. Μη Ισοζυγ. Μη Ισοζυγ.

25 Συντομογραφίες

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

Χρωμοσωμικές ανωμαλίες

Χρωμοσωμικές ανωμαλίες Χρωμοσωμικές ανωμαλίες Τα φυλετικά χρωμοσώματα Xρωμόσωμα Χ Xρωμόσωμα Υ Κατανομή γονιδίων στο Χ Κατανομή γονιδίων στο Υ Μέγεθος : 57 Μb Γονίδια : 40 ~250 νοσήματα συνδεδεμένα με το Χ και

Διαβάστε περισσότερα

ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ

ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Σύνδροµο Down Το σύνδροµο Down είναι µια γενετική ανωµαλία ου εριλαµβάνει συνδυασµό χαρακτηριστικών, ό ως νευµατική καθυστέρηση, συγκεκριµένα χαρακτηριστικά ροσώ ου και συχνά καρδιακά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Μείωση-Βιολογία Κατεύθυνσης

Μείωση-Βιολογία Κατεύθυνσης κύτταρο -γυναίκας 1η μειωτική διαίρεση-αποχωρισμός ομολόγων 2η μειωτική διαίρεση-αποχωρισμός αδελφών Γαμέτης-3 Γαμέτης-4 Χ.Κ.ΦΙΡΦΙΡΗΣ-ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΟΠΤΙΚΗ-ΠΑΠΑΝΑΣΤΑΣΙΟΥ 101 Σελίδα 1 κύτταρο -άνδρα 1η

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr)

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Μίτωση - Μείωση Γαµετογένεση και Αναπαραγωγή Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Σήµερα... Ορολογία Κυτταρικός κύκλος Μίτωση Μείωση Γαµετογένεση Βιολογικοί κύκλοι ΗΓενετική είναι ο κλάδος της Βιολογίας

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΕΣ ΚΑΙ ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΥΣ

ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΕΣ ΚΑΙ ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΥΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ ΜΕΛΕΤΗ ΧΡΩΜΟΣΩΜΑΤΙΚΩΝ ΑΝΩΜΑΛΙΩΝ ΜΕ ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΕΣ

Διαβάστε περισσότερα

Εργασία στη Βιολογία

Εργασία στη Βιολογία Εργασία στη Βιολογία Τι είναι το χρωμόσωμα? Το χρωμόσωμα είναι μια οργανωμένη δομή DNA και πρωτεϊνών που βρίσκεται στα κύτταρα. Είναι ένα μοναδικό κομμάτι DNA που περιλαμβάνει πολλά γονίδια και άλλες ακολουθίες

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ «ΣΥΜΒΟΛΗ ΣΤΗ ΜΟΡΙΑΚΗ ΠΡΟΓΕΝΝΗΤΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΧΡΗΣΗ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΕΛ. ΦΡΥΣΙΡΑ Επ. Καθηγήτρια Κλινικής Γενετικής ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΓΕΝΕΤΙΚΗΣ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙ ΩΝ «Η ΑΓΙΑ ΣΟΦΙΑ» ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ.ε. ΚΑΝΑΒΑΚΗΣ ΣΥΓΓΕΝΕΙΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Μελέτη χρωμοσωμικών ανωμαλιών κατά τον προγεννητικό έλεγχο. Κλασσική κυτταρογενετική ανάλυση vs array-cgh

Μελέτη χρωμοσωμικών ανωμαλιών κατά τον προγεννητικό έλεγχο. Κλασσική κυτταρογενετική ανάλυση vs array-cgh Μελέτη χρωμοσωμικών ανωμαλιών κατά τον προγεννητικό έλεγχο. Κλασσική κυτταρογενετική ανάλυση vs array-cgh Μανωλάκος Μανώλης, ErCLG, PhD Ειδικότητα Γενετικής Ιατρικής Διευθυντής Εργαστηρίου Γενετικής Access

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος

Μάθημα Ουρολογίας. Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μάθημα Ουρολογίας Ανωμαλίες σεξουαλικής Διαφοροποίησης Καλοήθεις Παθήσεις Γεννητικού Συστήματος Μανώλης Μαυρομανωλάκης Διευθυντής ΕΣΥ Ουρολογική Κλινική Πα.Γ.Ν.Η Ηράκλειο 2011 Ανωμαλίες Σεξουαλικής Διαφοροποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας Α. Κοτσίνας Επικ. Καθηγητής Τι είναι οι συγγενείς ανωμαλίες Ανατομικές ανωμαλίες οι οποίες υπάρχουν ήδη από

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα

ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΤΗΝ ΜΕΘΟΔΟΛΟΓΙΑ ΤΟΥ ΣΥΓΚΡΙΤΙΚΟΥ ΓΟΝΙΔΙΩΜΑΤΙΚΟΥ ΥΒΡΙΔΙΣΜΟΥ (CGH)

ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΤΗΝ ΜΕΘΟΔΟΛΟΓΙΑ ΤΟΥ ΣΥΓΚΡΙΤΙΚΟΥ ΓΟΝΙΔΙΩΜΑΤΙΚΟΥ ΥΒΡΙΔΙΣΜΟΥ (CGH) ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Πρόγραμμα Μεταπτυχιακών Σπουδών Στις Εφαρμογές Βασικών Ιατρικών Επιστημών ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ

Διαβάστε περισσότερα

Έκφραση της γενετικής πληροφορίας

Έκφραση της γενετικής πληροφορίας Η ροή της γενετικής πληροφορίας Έκφραση της γενετικής πληροφορίας To DNA ενός οργανισμού είναι ο μοριακός «σκληρός δίσκος» που περιέχει αποθηκευμένες ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα;

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα; ΑΝΑΠΑΡΑΓΩΓΙΚΟ 1. (α) Τι αντιπροσωπεύουν οι αριθμοί 1-6 στο σχήμα; (β) Εξηγήστε τι είναι τα ωοθυλάκια και ποιος είναι ο ρόλος τους. (γ) Σε ποιο μέρος του γεννητικού συστήματος της γυναίκας αρχίζει η ανάπτυξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Προεμφυτευτική Γενετική Διάγνωση Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Στάδια Προεμφυτευτικής Γενετικής Διάγνωσης (P.G.D) Διέγερση ωοθηκών για την ωρίμανση μεγάλου αριθμού (ει δυνατόν ) ωοθυλακίων

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ Δομή και λειτουργία του αναπαραγωγικού συστήματος 1. Να ονομάσετε τις αριθμημένες δομές του παρακάτω σχήματος. Βλέπε εικ. 12.1 της σ. 219 του βιβλίου του μαθητή. 2. Να ενώσετε

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα