Χρωμοσωματικές ανωμαλίες

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Χρωμοσωματικές ανωμαλίες"


1 Χρωμοσωματικές ανωμαλίες


3 Τεχνικές χρώσεις των χρωμοσωμάτων Χρώση Giemsa: ζώνες ανά απλοειδική σειρά Καρυότυπος


5 Ιδεόγραμμα-Ονοματολογία

6 Διακριτική ικανότητα ~1-2Mb Ανάλυση FISH σε μεταφασικά χρωμοσώματα Ανιχνευτής για το χρωμόσωμα 20 Ανιχνευτής για τελομερές Ανάλυση FISH σε μεσοφασικά χρωμοσώματα (fiber FISH) Διακριτική ικανότητα ~0,1Mb, συχνά στη φυσική χαρτογράφηση

7 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν 4Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ τριπλοειδία Α) Γονιμοποίηση ωαρίου από 2 σπερματοζωάρια Β, Γ) Αποτυχία σε μία από τις μειωτικές διαιρέσεις ωρίμανσης γαμετών (συνήθως σπερματοζωαρίου) ΑΝΕΥΠΛΟΕΙΔΙΑ: -ΚΑΘΕ ΕΠΙΠΛΕΟΝ Ή ΛΙΓΟΤΕΡΟ ΧΡΩΜΟΣΩΜΑ ΑΠΟ ΤΟ ΦΥΣΙΟΛΟΓΙΚΟ ΑΡΙΘΜΟ 2Ν -Η ΠΡΟΣΘΗΚΗ 2n+1 (τρισωμία) Ή ΑΠΩΛΕΙΑ 2n-1 (μονοσωμία) ΧΡΩΜΟΣΩΜΑΤΟΣ -2n+1+1 διπλή τρισωμία -2n-2 νουλισωμία (λείπουν ομόλογα χρωμοσώματα)

8 ΜΕΙΩΣΗ Μείωση Ι Μείωση ΙΙ Γαμέτες N+1 Τρισωμικός ζυγώτης Γαμέτες N-1 Μονοσωμικός ζυγώτης Γαμέτες Γαμέτες N+1 N-1 Τρισωμικός Μονοσωμικός ζυγώτης ζυγώτης Πως μπορούμε να διακρίνουμε σε ποιο στάδιο (Ι ή ΙΙ) δεν έγινε αποχωρισμός?

9 Τρισωμίες αυτοσωμικών χρωμοσωμάτων Τρισωμία 21 (σύνδρομο Down) H πιο συχνή βιώσιμη τρισωμία αυτοσωμικού χρωμοσώματος 95%: χρωμόσωμα 21 x 3 Συχνότερη αιτία: Μη διαχωρισμός στη μητρική μείωση Ι 1 / 800 νεογνά, 1 / 300 νεογνά για μητέρες >35 ετών 47, ΧΧ (ή ΧΥ), +21 Δυσμορφία Διανοητική καθυστέρηση Καρδιοπάθεια Κίνδυνος λευχαιμίας Πρόωρη γήρανση Συμπτώματα Αlzheimer

10 1 / γεννήσεις Πρόωρος θάνατος Ηλικία μητέρας Τρισωμία 13 (σύνδρομο Patau) λαγόχειλο πολυδακτυλία

11 1 / 8000 γεννήσεις Πρόωρος θάνατος Ηλικία μητέρας Τρισωμία 18 (σύνδρομο Edwards) Ηλικία της μητέρας - τρισωμίες

12 Αριθμητικές χρωμοσωμικές ανωμαλίες των φυλετικών χρωμοσωμάτων Τα φυλετικά χρωμοσώματα Xρωμόσωμα Χ Xρωμόσωμα Υ Κατανομή γονιδίων στο Χ Κατανομή γονιδίων στο Υ Μέγεθος : 57 Μb Γονίδια : 40 ~250 νοσήματα συνδεδεμένα με το Χ και <20 με το Υ Μέγεθος : 155 Μb (6% του γονιδιώματος) Γονίδια : > 700

13 Τυχαία απενεργοποίηση του Χ Απενεργοποίηση κατά τα πρώτα στάδια της εμβρυικής ζωής (~3 μέρες μετά τη γονιμοποίηση, ολοκληρώνεται στα τέλη της πρώτης βδομάδας ανάπτυξης, κύτταρα)

14 Διαταραχές φυλετικών χρωμοσωμάτων Οι φαινότυποι που συνδέονται με τις χρωμοσωμικές ανωμαλίες των φυλετικών χρωμοσωμάτων δεν είναι τόσο σοβαροί όσο εκείνοι που συνδέονται με διαταραχές των αυτοσωμικών χρωμοσωμάτων, λόγω: - απενεργοποίησης Χ (στις περισσότερες περιπτώσεις ασθενών με δομικές ανωμαλίες του Χ, απενεργοποιείται το δομικά ανώμαλο X-όχι τυχαία απενεργοποίηση?) - μικρού αριθμού γονιδίων του Υ ΑΝΕΥΠΛΟΕΙΔΙΕΣ Σύνδρομο Turner (45, X) ~50% μωσαϊκά Συχνότητα: 1,5 / 100 συλλήψεις Γεννώνται 1/5000 κορίτσια Έλλειψη του Χ συνήθως λόγω μη αποχωρισμού κατά την σπερματογένεση Ενήλικα- στείρα Φυσιολογική ευφυΐα-συμπεριφορά Αυξημένη συχνότητα καρδιαγγειακώννεφρικών ανωμαλιών Θεραπεία (όχι πλήρης) με οιστρογόνα και αυξητική ορμόνη

15 Σύνδρομο Klinefelter (47, XXY) Συχνότητα: 1/1000 γεννήσεις αγοριών (συνήθως στείρα) Μωσαϊκοί (15%) καρυότυποι με συμπτώματα του συνδρόμου Προκύπτουν από μειωτικό μη αποχωρισμό των φυλετικών χρωμοσωμάτων του πατέρα (κατά 40%) και της μητέρας (60%) Απενεργοποίηση του ενός Χ Μαθησιακά προβλήματα Τρισωμία X: 47, ΧΧΧ Συχνότητα: 1/1000 γεννήσεις κοριτσιών Μη αποχωρισμός των φυλετικών χρωμοσωμάτων της μητέρας Φαινοτυπικά χαρακτηριστικά μέσα στα φυσιολογικά όρια, χαμηλό IQ. Σύνδρομο 47, ΧΥΥ Συχνότητα: 1/1000 γεννήσεις αγοριών. Γόνιμα άτομα με φυσιολογικούς απόγονους Μη αποχωρισμός των φυλετικών χρωμοσωμάτων στην δεύτερη μειωτική διαίρεση του πατέρα Ίσως συσχετίζεται προβλήματα συμπεριφοράς ΠΟΛΥΣΩΜΙΕΣ: 48, ΧΧΧΥ και 49,ΧΧΧΧΥ, 46,ΧΧΧΧ και 49,ΧΧΧΧΧ λίγες περιπτώσεις με σοβαρή αναπτυξιακή και διανοητική καθυστέρηση

16 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται η φυσιολογική γενετική πληροφορία) Μη ισοζυγισμένες Είναι ή Σταθερές (μεταβιβάζονται κατά τις κυτταρικές διαιρέσεις) Ασταθείς Απαραίτητο 1 κεντρομερές & 2 τελομερή Συναντώνται ή Σε όλα τα κύτταρα ενός ατόμου Σε μορφή μωσαϊκού

17 ΧΡΩΜΟΣΩΜΙΚΑ ΕΛΛΕΙΜΜΑΤΑ & διπλασιασμοί Τελικό έλλειμμα Ενδιάμεσο έλλειμμα Άνισος επιχιασμός Σε περιοχές με επαναλαμβανόμενο DNA Κατά την πρόφαση της μείωσης Ι Φαινοτυπικό αποτέλεσμα? Βιωσιμότητα Ημιζυγωτία / Ψευδουπεροχή

18 Σύνδρομα ελλειμμάτων αυτοσωμικών χρωμοσωμάτων Σύνδρομο κλάματος γαλής (5p-) (cri-du-chat) ~ 1/ % των παιδιών με διανοητική καθυστέρηση Σποραδικές περιπτώσεις ή από γονείς-φορείς μεταθέσεων Ο φαινότυπος εξαρτάται από το μέγεθος του ελλείμματος Χαρακτηριστικό προσωπείο Μη φυσιολογική ανάπτυξη του λάρυγγα στα έμβρυα Αναπνευστικά προβλήματα Συνήθως με φυσιολογική διάρκεια ζωής Κρίσιμη περιοχή : 5p15 Σύνδρομο Down (μικρό ποσοστό περιπτώσεων) Μερική τρισωμία (μπορεί να μην είναι ανιχνεύσιμη κυτταρογενετικά) 21q22.2 q22.3 = η κρίσιμη περιοχή για το σύνδρομο ( γονίδια)

19 Ταυτοποίηση μικροελλειμμάτων με FISH Ανιχνευτής για την περιοχή 22q11.2 Ανιχνευτής-control για το χρωμόσωμα 22


21 Σύνδρομα DiGeorge VCF (velocardiofacial) 1/4000 γεννήσεις Σύνδρομα απλοανεπάρκειας Έλλειμμα ~ 30 γονιδίων Καρδιακές ανωμαλίες Δυσμορφίες Μαθησιακές δυσκολίες Ποια γονίδια ευθύνονται?

22 CGH Comparative Genomic Hybridization Case Control

23 ΔΟΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΠΟΥ ΑΦΟΡΟΥΝ ΠΕΡΙΣΣΟΤΕΡΑ ΧΡΩΜΟΣΩΜΑTA ΙΣΟΖΥΓΙΣΜΕΝΗ ΜΕΤΑΘΕΣΗ (ολόκληρη η γενετική πληροφορία, κίνδυνος κατά τον σχηματισμό των γαμετών) O πιο συχνός τύπος δομικής ανωμαλίας χρωμοσωμάτων (1 / 500 νεογνά) Αμοιβαία (ανταλλαγή υλικού) Κατά Robertson μεταξύ ακροκεντρικών χρωμοσωμάτων (13, 14, 15, 21, 22) Ένθεση προσθήκη υλικού σε μη ομόλογο χρωμόσωμα 4% του συνδρόμου Down: 46, XX, -14, + t (14q21q) και είναι απόγονοι φορέων μετάθεσης κατά Robertson Από φορείς 21q21q: παιδιά με σύνδρομο Down (1%) (ισοχρωμόσωμα ή κατά Robertson?)

24 ΓΑΜΕΤΕΣ Φορέας αμοιβαίας μετάθεσης Σύναψη στη μείωση α δ γ β α γ δ β Διαχωρισμός Εναλλασσόμενος (α+β / γ+δ) Παρακείμενος-1 (α+δ / γ+β) Παρακείμενος-2 (α+γ / δ+β) Φυσιολ. Ισοζυγ. Μη Ισοζυγ. Μη Ισοζυγ.

25 Συντομογραφίες



Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Χρωμοσωμικές ανωμαλίες Τα φυλετικά

Διαβάστε περισσότερα


ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

Χρωμοσωμικές ανωμαλίες

Χρωμοσωμικές ανωμαλίες Χρωμοσωμικές ανωμαλίες Τα φυλετικά χρωμοσώματα Xρωμόσωμα Χ Xρωμόσωμα Υ Κατανομή γονιδίων στο Χ Κατανομή γονιδίων στο Υ Μέγεθος : 57 Μb Γονίδια : 40 ~250 νοσήματα συνδεδεμένα με το Χ και

Διαβάστε περισσότερα

Κεφάλαιο 6 (Ιατρική Γενετική) Διαταραχές των αυτοσωμικών & φυλετικών χρωμοσωμάτων. Εκτοπία φακών. Σύνδρομο Marfan

Κεφάλαιο 6 (Ιατρική Γενετική) Διαταραχές των αυτοσωμικών & φυλετικών χρωμοσωμάτων. Εκτοπία φακών. Σύνδρομο Marfan Κεφάλαιο 6 (Ιατρική Γενετική) Διαταραχές των αυτοσωμικών & φυλετικών χρωμοσωμάτων Εκτοπία φακών. Σύνδρομο Marfan Διαταραχές των αυτοσωμικών χρωμοσωμάτων Υπάρχουν μόνο 3 προσδιορισμένες χρωμοσωμικές διαταραχές

Διαβάστε περισσότερα

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Θεωρητικό Υπόβαθρο Καρυότυπος Καρυότυπος είναι η απεικόνιση των μεταφασικών χρωμοσωμάτων ενός οργανισμού κατά ελαττούμενο μέγεθος, όπου φαίνονται

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα


ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Σύνδροµο Down Το σύνδροµο Down είναι µια γενετική ανωµαλία ου εριλαµβάνει συνδυασµό χαρακτηριστικών, ό ως νευµατική καθυστέρηση, συγκεκριµένα χαρακτηριστικά ροσώ ου και συχνά καρδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα


ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

Χρωμοσώματα & κυτταροδιαιρέσεις

Χρωμοσώματα & κυτταροδιαιρέσεις Δασική Γενετική Χρωμοσώματα & κυτταροδιαιρέσεις Χειμερινό εξάμηνο 2014-2015 Σύνοψη Το DNA αναπαράγεται, εκφράζεται και μεταλλάσσεται Το DNA είναι οργανωμένα σε χρωμοσώματα Τα ευκαρυωτικά γενώματα έχουν

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

FISH (Fluerescence In Situ Hybridisation)

FISH (Fluerescence In Situ Hybridisation) FISH (Fluerescence In Situ Hybridisation) Ενδείξεις 1) Σε περιπτώσεις με συγκεκριμένο φαινότυπο στις οποίες δεν αναγνωρίζεται με την κλασική κυτταρογενετική ανίχνευση χρωμοσωμικών ανωμαλιών. 2) Σε περιπτώσεις

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

Μείωση-Βιολογία Κατεύθυνσης

Μείωση-Βιολογία Κατεύθυνσης κύτταρο -γυναίκας 1η μειωτική διαίρεση-αποχωρισμός ομολόγων 2η μειωτική διαίρεση-αποχωρισμός αδελφών Γαμέτης-3 Γαμέτης-4 Χ.Κ.ΦΙΡΦΙΡΗΣ-ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΟΠΤΙΚΗ-ΠΑΠΑΝΑΣΤΑΣΙΟΥ 101 Σελίδα 1 κύτταρο -άνδρα 1η

Διαβάστε περισσότερα


cytogenetics ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗ cytogenetics ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗ Δομη χρωμοσωμάτων Χρωμοσωμικες ανωμαλίες (chromosomal abnormalities)- παραδειγματα Καρυότυποι (φυσιολογικοί-παθολογικοί) Χρωμοσωμικες ανωμαλίες και κλινικες καταστασεις Οι

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved Κεφάλαιο 5 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Μια ανασκόπηση ΓΕΝΕΤΙΚΗ Cardinalis cardinalis Cardinalis sinuatus 2011 Utopia Publishing, All rights reserved

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα


ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr)

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Μίτωση - Μείωση Γαµετογένεση και Αναπαραγωγή Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Σήµερα... Ορολογία Κυτταρικός κύκλος Μίτωση Μείωση Γαµετογένεση Βιολογικοί κύκλοι ΗΓενετική είναι ο κλάδος της Βιολογίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα


ΑΛΕΞΙΑ ΜΙΧΑΛΟΠΟΥΛΟΥ Α.Μ Πτυχιακή εργασία ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΙΩΑΝΝΙΝΑ 2011 ΑΛΕΞΙΑ ΜΙΧΑΛΟΠΟΥΛΟΥ Α.Μ.10159 Πτυχιακή εργασία ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΙΩΑΝΝΙΝΑ 2011 Σύνδρομο Down ή αλλιώς Τρισωμία 21 ή Τρισωμία G είναι η περιγραφή μια ανωμαλίας, που περικλείει ένα σύνολο χαρακτηριστικών,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Εργασία στη Βιολογία

Εργασία στη Βιολογία Εργασία στη Βιολογία Τι είναι το χρωμόσωμα? Το χρωμόσωμα είναι μια οργανωμένη δομή DNA και πρωτεϊνών που βρίσκεται στα κύτταρα. Είναι ένα μοναδικό κομμάτι DNA που περιλαμβάνει πολλά γονίδια και άλλες ακολουθίες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κύτταρα πολυκύτταρων οργανισμών

Κύτταρα πολυκύτταρων οργανισμών Μίτωση - Μείωση Τα ευκαρυωτικά κύτταρα διαιρούνται με δύο τρόπους: τη μίτωση και τη μείωση. Η Μίτωση είναι ο τύπος της κυτταρικής διαίρεσης που από ένα πατρικό κύτταρο καταλήγει σε δύο γενετικά πανομοιότυπα

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Παρουσιάσεις Power Point με υλικό από: Campbell και Reece (2010) ΒΙΟΛΟΓΙΑ τόμος Ι, 1

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης

Βιολογία Θετικής Κατεύθυνσης ΘΕΜΑ Α Α1. β. Α2. γ. Α3. α. Α4. δ. Α5. γ. Θέμα Β Β1. 1. α 2. β 3. β 4. α 5. α 6. α 7. β 8. β Βιολογία Θετικής Κατεύθυνσης 22-5-2015 Β2. Σχολικό βιβλίο σελ:36-37 «κατά την έναρξη... σύμπλοκο έναρξης πρωτεϊνοσύνθεσης.»

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Α1. Η α Α2. Η γ Α3. Η α Α4. Η δ Α5. Η γ Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β


Διαβάστε περισσότερα


ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗ: ΑΝΑΛΥΣΗ ΚΑΡΥΟΤΥΠΟΥ ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗ: ΑΝΑΛΥΣΗ ΚΑΡΥΟΤΥΠΟΥ Σκοπός Στην άσκηση αυτή καλείσαι να επιστρατεύσεις την παρατηρητικότητα και τις γνώσεις σου, για να βγάλεις τη δική σου διάγνωση σχετικά µε µια σειρά από καρυότυπους

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΜΕΤΑΛΛΑΞΕΙΣ. Βαρυπάτη Αθηνά Φυσικός


Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ Τι σχέση έχουν η μονογονική αναπαραγωγή Κυτταρική διαίρεση η ανάπτυξη η αμφιγονική αναπαραγωγή η αντικατάσταση των κυττάρων Η σημασία της μίτωσης Η μίτωση ευνοεί την κυτταρική

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής. Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής. Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων Όλοι έχουμε αναρωτηθεί κάποια στιγμή Γιατί μοιάζουμε με τους

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Να επιλέξετε τη σωστή απάντηση: 1. Σιωπηλή μετάλλαξη λόγω αντικατάστασης βάσης δε μπορεί να επιτευχθεί στο κωδικόνιο που κωδικοποιεί: α. τη βαλίνη γ. τη μεθειονίνη

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ. Ενότητα 2 η : Η χρωμοσωματική βάση της κληρονομικότητας. Πηνελόπη Μαυραγάνη-Τσιπίδου Τμήμα Βιολογίας ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

ΓΕΝΕΤΙΚΗ. Ενότητα 2 η : Η χρωμοσωματική βάση της κληρονομικότητας. Πηνελόπη Μαυραγάνη-Τσιπίδου Τμήμα Βιολογίας ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΓΕΝΕΤΙΚΗ Ενότητα 2 η : Η χρωμοσωματική βάση της κληρονομικότητας Πηνελόπη Μαυραγάνη-Τσιπίδου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα