Βιοπληροφορική Γονιδιακή Τεχνολογία

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιοπληροφορική Γονιδιακή Τεχνολογία"


1 Βιοπληροφορική Γονιδιακή Τεχνολογία

2 Η δομή του DNA Αποτελείται από 2 πολυνουκλεοτιδικές αλυσίδες σε διπλή έλικα που διατάσσονται αντιπαράλληλα Κάθε αλυσίδα αποτελείται από 4 είδη νουκλεοτιδίων (A=αδενίνη, T=θυμίνη, C=κυτοσίνη, G=γουανίνη) Τα νουκλεοτίδια αποτελούνται από μια πεντόζη με την οποία συνδέονται μία ή περισσότερες φωσφορικές ομάδες και μια αζωτούχο βάση Στην περίπτωση του DNA η πεντόζη είναι η δεοξυριβόζη (δεοξυριβονουκλεϊκό οξύ) Δεσμοί υδρογόνου σχηματίζονται μόνο μεταξύ των βάσεων αδενίνηςθυμίνης (A-T) και γουανίνης-κυτοσίνης (G-C) Κάθε κλώνος DNA περιέχει μια αλληλουχία νουκλεοτιδίων που είναι ακριβώς συμπληρωματική (complementary) προς την αλληλουχία των νουκλεοτιδίων του άλλου κλώνου

3 Η δομή του DNA

4 Το Κεντρικό Δόγμα της Μοριακής Βιολογίας

5 Διαφορές του RNA από το DNA τα νουκλεοτίδια του είναι ριβονουκλεοτίδια, δηλαδή περιέχουν το σάκχαρο ριβόζη (απ όπου και η ονομασία ριβονουκλεϊνικό οξύ) αντί του σακχάρου δεοξυριβόζη όπως και το DNA, περιέχει τις βάσεις αδενίνη (Α), γουανίνη (G) και κυτοσίνη (C), αλλά αντί για θυμίνη (Τ) περιέχει ουρακίλη (U). Η U, όπως και η Τ, ζευγαρώνει (με δεσμούς υδρογόνου) με την Α. To DNA πάντοτε βρίσκεται στα κύτταρα υπό μορφή δίκλωνης έλικας, ενώ τo RNA είναι μονόκλωνο.

6 Κάθε ομάδα τριών διαδοχικών νουκλεοτιδίων του RNA αποκαλείται κωδικόνιο (codon) και κάθε κωδικόνιο καθορίζει ένα αμινοξύ Οι κανόνες με τους οποίους η αλληλουχία των νουκλεοτιδίων ενός γονιδίου, μέσω του mrna, μεταφράζεται στην αλληλουχία των αμινοξέων μιας πρωτεΐνης συλλογικά αναφέρονται ως γενετικός κώδικας (genetic code)

7 Ο γενετικός κώδικας

8 Καρυότυπος ανθρώπου

9 Η οργάνωση των γονιδίων σε ένα ανθρώπινο χρωμόσωμα

10 Τα γονίδια εντοπίζονται στο DNA σε οποιοδήποτε προσανατολισμό Ο προσανατολισμός του γονιδίου καθορίζει ποιος κλώνος DNA κωδικοποιεί για το mrna.

11 Τυπικό γονίδιο

12 Μέσα μεγέθη εξονίων και ιντρονίων στα ανθρώπινα γονίδια γονίδιο μέγεθος (kb) αριθμός εξονίων μέσο μέγεθος εξονίων (bp) μέσο μέγεθος ιντρονίων (bp) trna Ινσουλίνη globin Τάξη I HLA Αλβουμίνη ,100 Τάξη VII κολλαγόνο Συμπληρωματικό C3 Φαινυλαλανίνη ,500 υδροξυλάση Παράγοντας VIII ,100 CFTR ,100 Δυστροφίνη ,000

13 Και τα εξώνια και τα ιντρόνια αντιγράφονται στο RNA. Τα ιντρόνια στη συνέχεια ματίζονται πριν το mrna είναι έτοιμο για τη μετάφραση

14 Κλωνοποίηση Η ουσία της γενετικής μηχανικής έγκειται στην παρασκευή μεγάλων αριθμών ίδιων μορίων DNA προερχομένων από ένα γονίδιο (κλωνοποίηση). Αυτό επιτυγχάνεται με την εισαγωγή της ακολουθίας ενός γονιδίου σε ένα μεταφορέα (vector) που μπορεί να είναι ένα πλασμίδιο ή ένας βακτηριοφάγος. Το εισερχόμενο DNA θα αντιγραφεί μαζί με το DNA του μεταφορέα. Το κατασκευασμένο πλασμίδιο (vector) DNA εισάγεται σε ένα βακτήριο με μια διαδικασία που λέγεται μετασχηματισμός. Το επόμενο βήμα είναι η επιλογή των βακτηρίων που έχουν ενσωματώσει ένα αντίγραφο του πλασμιδίου. Αυτό επιτυγχάνεται μέσα από ένα γονίδιο του πλασμιδίου που κωδικοποιεί για αντοχή στα αντιβιοτικά, με αποτέλεσμα κάθε βακτήριο που έχει ενσωματώσει το πλασμίδιο να είναι ανθεκτικό στο συγκεκριμένο αντιβιοτικό

15 Διαδικασία για την κλωνοποίηση ενός τμήματος DNA σε ένα πλασμιδιακό μεταφορέα Βακτηριακό χρωμόσωμα Πλασμιδιακός μεταφορέας Τμήμα DNA για κλωνοποίηση Μετασχηματισμένα E. coli κύτταρα επιβιώνουν Κύτταρα που δεν έχουν ενσωματώσει το πλασμίδιο πεθαίνουν στα πιάτα αμπικιλλίνης Καλλιέργεια σε πιάτα με άγαρ που περιέχουν αμπικιλλίνη Ανεξάρτητη αντιγραφή πλασμιδίου Πολλαπλασιασμός κυττάρων Κατασκευασμένο πλασμίδο Αποικία από κύτταρα κάθε ένα από τα οποία περιλαμβάνει αντίγραφα του ίδιου ανασυνδυασμένου πλασμιδίου

16 Η ενζυμική μέθοδος ανάλυσης του DNA (sequencing)


18 Η αλυσιδωτή αντίδραση πολυμεράσης (PCR)

19 Εφαρμογές της PCR 1. Ιατρική διάγνωση γενετικών ασθενειών Προσδιορισμός μεταλλάξεων σε αλληλόμορφα γονίδια Διάγνωση της παρουσίας μολυσματικών συστατικών Επιδημιολογικές μελέτες 2. Ιατροδικαστικές εφαρμογές Τεστ πατρότητας Καταχώρηση του DNA για προσδιορισμό του ατόμου Εγκληματολογικές έρευνες 3. Χειρισμός του DNA για πειράματα γενετικής μηχανικής 4. Προσδιορισμός της αλληλουχίας του DNA 5. Απομόνωση καινούριων γονιδίων 6. Ανθρωπολογικές μελέτες Γενετική πληθυσμών Μελέτες μετανάστευσης 7. Εξελικτικές σχέσεις

20 Βιοπληροφορική Η επιστήμη που γεννάται και αναπτύσσεται από τη σύγκλιση της Βιοτεχνολογίας και της Πληροφορικής και στοχεύει στο σχεδιασμό εργαλείων λογισμικού (software tools), με σκοπό τη διευκόλυνση και την επιτάχυνση της βιολογικής της ιατρικής και της φαρμακευτικής έρευνας

21 Εφαρμογές της βιοπληροφορικής Ανεύρεση λειτουργίας πρωτεϊνών, ανεύρεση αλληλεπιδράσεων πρωτεϊνών μεταξύ τους, κατανόηση της πολυπλοκότητας των βιολογικών συστημάτων Η σύγκριση του γονιδιώματος διαφόρων ειδών επιτρέπει την εξαγωγή πολύτιμων συμπερασμάτων σχετικά με τις εξελικτικές σχέσεις των οργανισμών μεταξύ τους Προσπάθεια αντιμετώπισης διαφόρων ασθενειών με την ανάπτυξη νέων διαγνωστικών μέτρων και θεραπευτικών μεθόδων Γονιδιακή θεραπεία Γενετική τροποποίηση φυτών και ζώων

22 Η χρήση των εργαλείων της Πληροφορικής µπορεί να επιλύσει αρκετά υπολογιστικά προβλήµατα που προκύπτουν όπως: ιασύνδεση της γονιδιακής ακολουθίας Οι σύγχρονες µέθοδοι ανάγνωσης της ακολουθίας του DNA βασίζονται στη σταδιακή ανάγνωση τµηµάτων (fragments) από το υπό µελέτη µόριο, που µπορεί να φθάνει και τις χιλιάδες βάσεις αµινοξέων. Η διαδικασία επανασύνδεσης υπόκειται σε σφάλµατα και αποτελεί µια πολύτιµη αλλά ταυτόχρονα πολύπλοκη διαδικασία. Σύγκριση ακολουθιών Υπάρχει µια βασική αρχή η οποία θέλει τις ακολουθίες του DNA και των πρωτεϊνών που µοιάζουν να εµφανίζουν παρόµοια λειτουργία. Αυτό ισχύει και στην περίπτωση που οι ακολουθίες αυτές προέρχονται από διαφορετικά είδη. Για αυτό το λόγο το πρώτο βήµα στην αναγνώριση της δράσης µιας ακολουθίας είναι η σύγκριση της µε άλλες για να εξερευνήσουµε πιθανές οµοιότητες στη δοµή.

23 Κατηγοριοποίηση των πρωτεϊνών Οι πρωτεΐνες κατηγοριοποιούνται σε οικογένειες µε παρόµοια δοµή και λειτουργία. Με αυτό τον τρόπο µπορούµε να γνωρίζουµε τη συµπεριφορά και την τρισδιάστατη δοµή τους. Εξαγωγή πληροφοριών από γονιδιακές ακολουθίες Η µελέτη γονιδιακών ακολουθιών µπορεί να βοηθήσει στην εξαγωγή χρήσιµων αποτελεσµάτων γύρω από τη συµπεριφορά και τη βιολογική δράση των γονιδίων (εµπλοκή σε συγκεκριµένες ανωµαλίες, όµοια συµπεριφορά σε θεραπευτικές αγωγές κ.ά) Η πολύπλοκη φύση των γονιδίων κάνει πολύ δύσκολη την όλη διαδικασία. Αναπαράσταση των κυττάρων ως µεταγραφικών δικτύων Ένα ζωντανό κύτταρο µπορεί να χαρακτηριστεί ως µια αλληλεπίδραση διαφορετικών κυτταρικών διαδικασιών. Αυτό µπορεί να µοντελοποιηθεί ως ένα δυναµικό σύστηµα µε συγκεκριµένες εισόδους (π.χ: φάρµακα, λαµβανόµενα σήµατα από γειτονικά κύτταρα ή τον ανθρώπινο οργανισµό) και πιθανές καταστάσεις.

24 Οι στόχοι της Βιοπληροφορικής µπορούν να ταξινοµηθούν σε 3 οµάδες Α) η Βιοπληροφορική επιτρέπει την αποδοτική οργάνωση των δεδοµένων ώστε να είναι δυνατή η αποθήκευση, ανάκτηση και ενηµέρωσή τους. Β) περιλαµβάνει τα εργαλεία που επιτρέπουν την ανάλυση των βιολογικών δεδοµένων. Για παράδειγµα έχοντας ακολουθιοποιήσει µια πρωτεΐνη, οι επιστήµονες ενδιαφέρονται να τη συγκρίνουν µε ήδη γνωστές και ταυτοποιηµένες ακολουθίες. Αυτή η διαδικασία απαιτεί τη χρήση πολύπλοκων εργαλείων όπως τα προγράµµατα FASTA και PSI- BLAST, που επιτρέπουν την ανακάλυψη και αναζήτηση κοινών τµηµάτων σε βιολογικές ακολουθίες. Γ) Τέλος η Βιοπληροφορική θέτει ως στόχο την ανάπτυξη εργαλείων που επιτρέπουν την ερµηνεία των αποτελεσµάτων βιολογικής σηµασίας.

25 Ομαδοποίηση των τύπων των δεδομένων που αναλύει η Βιοπληροφορική - Εφαρμογές Πηγή εδοµένων Ακολουθίες DNA Ακολουθίες Πρωτεϊνών Μέγεθος εδοµένων 13.5 εκατ. Ακολουθίες (14.5 δις. Βάσεις) ακολουθίες (~300 αµινοξέα για καθεµιά) Εφαρµογές Βιοπληροφορικής Αναγνώριση εξονίων και ιντρονίων ιαχωρισµός coding & non-coding περιοχών Αλγόριθµοι σύγκρισης ακολουθιών Ανακάλυψη σηµαντικών µοτίβων οµές Μακροµορίων Γονιδιώµατα Εκφράσεις Γονιδίων δοµές (~1000 ατοµικές συντεταγµένες η καθεμία) 300 πλήρη γονιδιώµατα (1.6 εκατ-3 δις βάσεις το καθένα) ~20 µετρήσεις σηµείων για ~ 6000 γονίδια Καθορισµός ευτερεύουσας δοµής Αλγόριθµοι τρισδιάστατης προσάραξης μακρομορίων και γεωμετρικού ταιριάσματος πρωτεϊνών Φυλογενετική Ανάλυση Αντιστοίχηση γονιδίων σε αρρώστιες Σύγκριση εκφράσεων γονιδίων Αντιστοίχηση εκφράσεων γονιδίων σε ακολουθιακά, δοµικά και βιοχηµικά δεδομένα

26 Ανάλυση ακολουθιών βιολογικών δεδομένων- Προγράμματα Στις ακολουθίες του DNA παρατηρούνται περιοδικές επαναλήψεις συµβολοσειρών-µοτίβα (ως µοτίβο µπορούµε να ορίσουµε ένα σύνολο χαρακτήρων που εµφανίζεται παραπάνω από µια φορά σε µια ακολουθία). Δύο κατηγορίες προβλημάτων α) ακριβή επανάληψη µοτίβων και β) προσεγγιστική επανάληψη µοτίβων Μια συχνά χρησιµοποιούµενη τεχνική για τη σύγκριση βιολογικών ακολουθιών είναι η διάταξη/ ευθυγράµµισή τους και η σύγκρισή τους ανά σύµβολο (alignment). Ουσιαστικά όλες οι μέθοδοι αναζήτησης βάσεων δεδομένων έχουν βασιστεί στα μέτρα της τοπικής ομοιότητας ακολουθίας.

27 Οι αλγόριθμοι BLAST Οι αλγόριθμοι BLAST (Basic Local Alignment Search Tools) αρχίζουν με μια μήτρα βαθμολογίας ομοιότητας για όλα τα πιθανά ζευγάρια των υπολειμμάτων. Οι ταυτότητες και οι συντηρητικές αντικαταστάσεις έχουν θετική βαθμολογία, ενώ οι απίθανες αντικαταστάσεις έχουν αρνητική βαθμολογία. Για τις συγκρίσεις αλληλουχίας DNA, οι ταυτότητες σημειώνονται ως +5 και οι αποτυχημένοι συνδυασμοί ως 4. Άλλα αποτελέσματα είναι βέβαια επίσης δυνατά. Δύο αλληλουχίες s1, s2 θεωρούνται ότι είναι 1 PAM μακριά εάν μια σειρά αποδεκτών μεταλλάξεων έχει μετασχηματίσει το s1 σε s2 με έναν μέσο όρο 1 a.p.m (αποδεκτή μετάλλαξη σημείου) για κάθε 100 αμινοξέα. Λαμβάνοντας υπόψη αυτούς τους κανόνες ένα μέγιστο ζευγάρι τμήματος (MSP) καθορίζεται να είναι τα υψηλότερα ζευγάρια βαθμολογίας ίδιων τμημάτων μήκους που επιλέγονται από 2 ακολουθίες.

28 Πρόγραμμα BLASTP Ερωτώμενη αλληλουχία Πρωτεΐνη (αμφότερες αλυσίδες) Αλληλουχία βάσης δεδομένων Πρωτεΐνη BLASTN Νουκλεοτίδιο Νουκλεοτίδιο Σχόλια Προεπιλεγέμενο αποτέλεσμα Κάλυψη πολυπλοκότητας με επιλογή φίλτρων Παράμετροι που βελτιστοποιούνται για την ταχύτητα και όχι για την ευαισθησία BLASTX Νουκλεοτίδιο (μετάφραση έξι πλαισίων) Πρωτεΐνη Πολύ χρήσιμη για προκαταρκτικά δεδομένα. Εννέα διαφορετικοί γενετικοί κώδικες TBLASTN Πρωτεΐνη Νουκλεοτίδιο (μετάφραση έξι πλαισίων) Βασική για έρευνα πρωτεϊνικών ερωτήσεων σχετικά με το dbest. Συχνά χρήσιμη για την εύρεση μη τεκμηριωμένων ORFs

29 Ευθυγράμμιση αλληλουχιών με τη χρήση των αλγορίθμων BLAST >gb BE BE BARC 5BOV Bos taurus cdna 5'. Length = 369 Score = 272 bits (137), Expect = 4e -71 Identities = 258/297 (86%), Gaps = 1/297 (0%) Strand = Plus / Plus Query: 17 aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76 Sbjct: 1 aggatccaacgtcgctgcggctacccttaaccact -cgcagaccccccgcagccatggcc 59 Query: 77 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136 Sbjct: 60 agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119 Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196 Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179 Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256 Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239 Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313 Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296

30 Εύρεση περιοχών ομοιότητας μιας πρωτεΐνης στα διάφορα είδη με τη χρήση των αλγορίθμων BLAST

31 Έρευνα ομολογίας και περιοχών- Εύρεση γονιδίων Ένα πλήρες μήκος ή μια μερική αλληλουχία DNA σε ένα ανθρώπινο γονίδιο μπορεί να εισαχθεί σε ένα πρόγραμμα που την συγκρίνει με όλες τις άλλες αλληλουχίες που αποθηκεύονται στις ηλεκτρονικές βάσεις δεδομένων αλληλουχίας. Η έρευνα στις μεγάλες βάσεις δεδομένων παρέχει συχνά την πρώτη ένδειξη λειτουργίας μιας αλληλουχίας όπως στην περίπτωση της κανονικής λειτουργίας του γονιδίου (NF2) της νευροϊνωμάτωσης τύπου 2. Η έρευνα ομολογίας στις βάσεις δεδομένων που χρησιμοποιούν την πρόσφατα καθιερωμένη NF2 αλληλουχία DNA προσδιόρισε τις σχετικές ακολουθίες, ειδικότερα εκείνες των moesin, ezrin και radixin. Αυτές οι πρωτεΐνες ήταν γνωστό ότι ενεργούν ως δομικές συνδέσεις μεταξύ των πρωτεϊνών μεμβρανών κυττάρων και των ενδιάμεσων πρωτεϊνών ινών, παρέχοντας με αυτόν τον τρόπο μερικές αρχικές ενδείξεις στη λειτουργία του προϊόντος γονιδίων NF2.

32 Τα περισσότερα από τα πρώτα στοιχεία αλληλουχίας λήφθηκαν από μιτοχονδριακά ή βακτηριακά γονιδιώματα Σε καθαρή στατιστική βάση, ένα ανοικτό πλαίσιο ανάγνωσης (ORF, open reading frame) μακρύτερο από 300 bp αναμένεται να εμφανιστεί τυχαία κάθε 36 Kb σε μια ενιαία αλυσίδα DNA (με %A = %C= %G = %T = 25). Πραγματικές πρωτεΐνες αντιστοιχούν κατά μέσον όρο σε ένα 1000 bp ORF. Ένας απλός αλγόριθμος που διατηρεί την πιo μακροχρόνια επικάλυψη ORFs και εφαρμόζοντας ένα κατώτατο όριο μεγέθους θα ανιχνεύσει ήδη τα περισσότερα πραγματικά γονίδια με καλή εξειδίκευση. Περιπλοκότερες μέθοδοι απαιτούνται για να εντοπίσουν μικρά γονίδια, να ερμηνεύσουν τις μερικές ακολουθίες που περιέχουν ελλιπή ORFs, αμετάφραστες περιοχές ή να επικρατήσουν της αλληλουχίας λαθών.

33 Προγράμματα ηλεκτρονικού υπολογιστή χρησιμοποιούνται για την ανεύρεση γονιδίων

34 Τα διάφορα προγράμματα συνδυάζουν την επιλογή όλων των μεγαλύτερων από 50 bp ORF την ταξινόμηση υποψηφίων εξονίων σύμφωνα με το εξαμερές μέτρο κωδικοποίησης τη σάρωση υποψηφίων εξονίων για ομοιότητα με αλληλουχίες πρωτεϊνών σε βάσεις δεδομένων την ανεύρεση εξονίων με αναζήτηση ομοιότητας την πρόβλεψη πλήρων δομών γονιδίων τη γραμμική διακρίνουσα ανάλυση τα δέντρα απόφασης το δυναμικό προγραμματισμό τα μοντέλα Markov

35 Τέσσερις ομάδες γονιδίων 1) γνωστά γονίδια, δηλαδή εκείνα που είναι ίδια με το γνωστό ανθρώπινο συμπληρωματικό DNA ή πρωτεϊνική αλληλουχία 2) νέα γονίδια, που είναι εκείνα που έχουν ένα ανοικτό πλαίσιο ανάγνωσης (ORF) είναι ίδια με τα ανθρώπινα ESTs ή/και έχουν ομολογίες με γνωστά γονίδια ή πρωτεΐνες 3) putative (πιθανά) γονίδια, τα οποία έχουν ίδιες αλληλουχίεs με τα ανθρώπινα ESTs αλλά χωρίς ORF και 4) ψευδογονίδια, δηλαδή αλληλουχίες ομόλογες με γνωστά γονίδια και πρωτεΐνες αλλά με αποδιοργανωμένο ORF ORF.


37 Όνομα κλώνου Τύπος Μέγεθος G+C (%) Ισοχώρος Επαναλήψεις (%) Γονίδια Πυκνότητα γονιδίου ba489k8 BAC H1/H ba69l16 BAC L2/H ba288g3 BAC H dj336k20 PAC L2/H dj126e20 PAC H dj303a1 PAC L1/L dj501e16 PAC L1/L ba328k6 BAC L1/L ba320h2 BAC L1/L ba12i14 BAC L1/L dj103m22 PAC L1/L dj90o12 PAC L1/L ba648n19 BAC L1/L dj398a12 PAC L1/L dj359l13 PAC L1/L ba380l24 BAC L1/L ba339a7 BAC L1/L dj290i10 PAC H ba BAC H1/H ba421m1 BAC L2/H ba417m14 BAC L2/H ba637o19 BAC L1/L

38 Expression profile Homology ΓΟΝΙ ΔΙΟ Coding (bp) Γονιδιακό ς (Kb) Nο εξο νίω ν Πρ οσα νατ ολισμό ς Εγκ έφα λος Κα ρδι ά Νε φρό Συκ ώτι Πνε ύμο νας Κα ρδι ά M. mus cul us R.n orve gicu s D.m ela nog aste r C.el ega ns A.th alia na RREB P SSR D MSL D TKL P + + DSP P


40 PAC/BAC Μήκος(bp) SINEs LINE LTR % Alu MIRs AluS/J BA489K8 22, Ø BA69L16 167, BA288G3 128, DJ336K20 52, DJ119C5 152, DJ126E20 117, DJ303A1 104, DJ501E16 56, DJ503N11 94, BA339A7 164, DJ290I10 180, BA360O19 87, BA421M1 155, DJ417M14 144, BA , Sum 3,150,

41 Άνθρωπος Ποντικός ΓΟΝΙΔΙΟ Κωδικοποίηση (bp) Γονιδιακό (Kb) Νο εξονίων Προσαν/ λισμός Κωδικοποίηση (bp) Γονιδιακό (Kb) Νο εξονίων Προσαν /λισμός RREB P P SSR D D DSP P P BMP P P TFAP D D GCNT P P MAK D D GCMB D D

42 Πρόγραμμα Τύπος πρόβλεψης Ευαισθησία (νουκλεοτίδιο) Ευαισθησία (εξόνιο) Εξειδίκευση (νουκλεοτίδιο) Ελλείποντα εξόνια Λανθασμένα εξόνια FGENEH Δομή γονιδίου Genie Δομή γονιδίου GenLang Δομή γονιδίου GENSCAN Δομή γονιδίου GRAIL II Εσωτερικά Εξόνια GRAIL II/GAP Δομή γονιδίου HEXON Εσωτερικά Εξόνια MORGAN Δομή γονιδίου MZEF Εσωτερικά Εξόνια SorFind Εσωτερικά εξόνια VEIL Δομή γονιδίου



45 Βάσεις δεδομένων και πρόσβαση Η σημαντικότερη απαίτηση για την έρευνα βάσεων δεδομένων είναι μια περιεκτική, σύγχρονα ενημερωμένη βάση δεδομένων. Η GenBank (http://www.ncbi.nlm.nih.gov/) χρησιμοποιείται ευρύτατα, και οι καθημερινές αναπροσαρμογές είναι διαθέσιμες για μεταφόρτωση ή άμεση έρευνα με τις υπηρεσίες ηλεκτρονικού ταχυδρομείου και δικτύων. Η NCBI διατηρεί δύο περίπου συλλογές αλληλουχίας χωρίς πλεονασμό (NRDB), μια για τις πρωτεΐνες και μια για τα νουκλεϊνικά οξέα. Σήμερα υπάρχουν πάνω από εκατό από τις διαφορετικές βάσεις δεδομένων που προσεγγίζονται εύκολα μέσω του διαδικτύου που δίνουν όλα τα είδη των διαφορετικών πολύτιμων πληροφοριών. Όλα τα προγράμματα που περιγράφονται ανωτέρω μπορούν να χρησιμοποιηθούν για να αναλύσουν τα στοιχεία και να τα συνδυάσουν σε μια οπτική παρουσίαση ως NIX (προσδιορισμός νουκλεοτιδίου X)

46 Οι πιο γνωστές βάσεις δεδομένων ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΠΕΡΙΓΡΑΦΗ Η πιο ευρέως χρησιμοποιούμενη βάση δεδομένων η οποία περιέχει πληροφορίες για όλα τα γονίδια, τους απλούς πολυνουκλεοτιδικούς πολυμορφισμούς (SNPs), τις συγγένειες μεταξύ των ειδών ενώ διαθέτει και μηχανές αναζήτησης ομοιότητας της ερωτώμενης ακολουθίας Λεπτομερής περιγραφή των γονιδίων καθώς και χρωμοσωμικών ανωμαλιών (προσθήκες, εξαλείψεις, μετατοπίσεις) καθώς και χάρτες του ανθρώπινου γονδιώματος Κατάλογος ΟΜΙΜ όλων των ανθρώπινων γονιδίων και των γενετικών διαταραχών Σχολιασμός και περιγραφή όλων των γονιδίων και αναφορά στους δείκτες και την ακριβή θέση του γονιδίου στο χρωμόσωμα Βάση δεδομένων για πρωτεϊνες Διάφορα υπολογιστικά προγράμματα για ανάλυση των μοτίβων και των χαρακτηριστικών των ακολουθιών Λεπτομερή αρχεία με όλες τις δημοσιεύσεις των επιστημονικών περιοδικών και δυνατότητα συσχετισμού των γονιδίων και των ιδιοτήτων τους με την Genbank Επιδημιολογικές πληροφορίες για κάθε γονίδιο και πολυμορφισμό και συσχέτισή τους με γνωστές νόσους







53 Γονιδιακή τεχνολογία η µετάλλαξη των γονιδίων ευθύνεται για ένα σύνολο ασθενειών όπως ο καρκίνος ο διαβήτης, οι παθήσεις του κεντρικού νευρικού συστήματος κ.ά. Η κατανόηση του τρόπου µε τον οποίο τα γονίδια επηρεάζουν τις ασθένειες και η κατανόηση των λειτουργιών των πρωτεϊνών, που τα γονίδια κωδικοποιούν, µπορεί να βοηθήσει στην ανάπτυξη θεραπείας που στοχεύει στον περιορισµό και τη βελτίωση ελαττωµατικών γονιδίων το ανθρώπινο γονιδίωμα αποτελείται από 46 χρωμοσώματα και περίπου μοναδικά γονίδια.

54 Με τη γενετική μηχανική μεταφέρονται τμήματα DNA ενός κυττάρου, που ρυθμίζουν ορισμένους επιθυμητούς χαρακτήρες, σε ένα άλλο κύτταρο, όπου ενσωματώνονται στο γενετικό του υλικό παράγεται ένα καινούργιο τεχνητό μόριο, το ανασυνδυασμένο DNA οι τεχνικές ανασυνδυασμένου DNA χρησιμοποιούνται στην κλωνοποίηση γονιδίων στη γενετική τροποποίηση των οργανισμών και γενικά για την ανάπτυξη ποικίλων τεχνικών της Μοριακής Βιολογίας

55 Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA στη θεραπεία πολλών σοβαρών γενετικών ασθενειών όπως διάφοροι τύποι καρκίνου δίνει τη δυνατότητα προσθήκης νέων γονιδίων απευθείας στον οργανισμό

56 Οι μεταλλάξεις είναι υπεύθυνες για την αλλαγή στο γενετικό υλικό και κατ επέκταση την εμφάνιση πολλών νόσων Είδη Μεταλλάξεων σωματικές (somatic mutations) Βρίσκονται σε ένα συγκεκριμένο ιστό κληρονομικές - γαμετικές (germ-line mutations) Βρίσκονται σε όλους τους ιστούς

57 Κυρίαρχα γονίδια Στις κυρίαρχες γενετικές παθήσεις ο ένας γονέας είναι φορέας παθογόνου μετάλλαξης στο ένα αλληλόμορφο το οποίο κυριαρχεί στο άλλο. Κάθε παιδί στην οικογένεια έχει 50% πιθανότητες να κληρονομήσει το παθολογικό αλληλόμορφο και την ασθένεια Υποτελή γονίδια Και οι δύο γονείς (υγιείς) είναι φορείς είναι φορείς μιας παθογόνου μετάλλαξης. Κάθε παιδί έχει 25% πιθανότητες να κληρονομήσει και τα δύο παθολογικά αλληλόμορφα με αποτέλεσμα να νοσήσει. Συνήθως έχουμε την παρουσία κάποιας κληρονομικής μετάλλαξης σε ένα ογκοκασταλτικό γονίδιο ή ογκογονίδιο όπως BRCA1, BRCA2, p53, MEN1, RET, P16, APC, MLH1, MSH2 κλπ. Πρέπει να απωλεστεί και το φυσιολογικό αλληλομόρφο, οπότε έχουμε απώλεια ετεροζυγωτίας - LOH

58 Σύνδρομο καρκίνου μαστού H γενετική ανάλυση για τα γονίδια BRCA1 & BRCA2 σε οικογένειες με ιστορικό καρκίνου μαστού/ωοθηκών ξεκίνησε το σε ερευνητικά πλαίσια Από το 2000 προσφέρεται ως εξέταση ρουτίνας σχεδόν σε όλες τις χώρες της Ευρώπης, την Αμερική, τον Καναδά, την Αυστραλία και το Ισραήλ Ο γενετικός έλεγχος έχει σώσει χιλιάδες ζωές

59 Κατανομή των μεταλλάξεων στα γονίδια BRCA1 & BRCA2 που έχουν χαρακτηριστεί σε ελληνικές οικογένειες με ιστορικό καρκίνου μαστού/ωοθηκών. Γαλάζιοι κύκλοι αναπαριστούν οικογένειες με καρκίνο του μαστού και ωοθηκών και μαύροι κύκλοι μόνο με καρκίνο του μαστού

60 Γονίδια που εμπλέκονται στους σημαντικότερους τύπους καρκίνου Τύπος Καρκίνου Κληρονομήσιμες Μεταλλάξεις Σωματικές Αλλοιώσεις Καρκίνος πνεύμονα - Μεταλλάξεις p53, KRAS, CDKN2A Εγκέφαλος - Μεταλλάξεις p53, CDKN2A, PTEN Καρκίνος ήπατος - Μεταλλάξεις p53, CTNNB1 Καρκίνος παγκρέατος - KRAS, TP53, CDKN2A Καρκίνος μαστού και ωοθηκών BRCA1, BRCA2 -

61 Γονίδια που ευθύνονται για συνηθισμένες νόσους Νόσος Γονίδιο Διαβήτης 1 PTPN22, PEP, LYP Λευχαιμία RBM15, SPEM Νόσος του Parkinson PARK10 Καρκίνος προστάτη PRCA1 Νεφρωσικό σύνδρομο PDCN

62 Γονίδια που ευθύνονται για συνηθισμένες νόσους Νόσος Γονίδιο Καρκίνος παγκρέατος CDKN2A Αναιμία Fanconi XRCC9 Άσθμα CCL11 Σχιζοφρένεια DTNBP1 Γλαύκωμα GLC3B

63 Η βιοπληροφορική βοηθάει στην ανεύρεση όλων των γονιδίων με αναζήτηση στις κατάλληλες βάσεις δεδομένων και πιο συγκεκριμένα: Η GeneCards (http://bioinformatics.weizmann.ac.il/cards/) είναι η βάση δεδομένων των ανθρώπινων γονιδίων, των προϊόντων τους και της συμμετοχής στις ασθένειες Η GeneTests (http://geneclinics.org/) είναι μια ιατρική πηγή πληροφοριών γενετικής που αναπτύσσεται για τους ιατρούς και τους ερευνητές Η ανθρώπινη βάση δεδομένων μεταλλαγής γονιδίων (http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html είναι η ανθρώπινη βάση δεδομένων που περιλαμβάνει τους διάφορους τύπους μεταλλαγών μέσα στις περιοχές κωδικοποίησης των ανθρώπινων πυρηνικών γονιδίων, προκαλώντας την κληρονομούμενη ασθένεια Η OMIM είναι η μεντελική κληρονομικότητα στον άνθρωπο και ο κατάλογος των ανθρώπινων γονιδίων και των γενετικών αναταραχών με το περιγραφικό κείμενο Η Prospectr μπορεί να χρησιμοποιηθεί για να εμπλουτίσει τους καταλόγους γονιδίων που βρίσκονται σε έναν πιθανό γεωμετρικό τόπο ασθενειών.

64 Μικροσυστοιχείες: Νέα τεχνολογία μοριακής βιολογίας στη χειρουργική Οι μικροσυστοιχείες είναι μικροσκοπικές σειρές ακινητοποιημένων νουκλεϊνικών οξέων. Επιτρέπουν την ανίχνευση αλλοιώσεων χιλιάδων γονιδίων ταυτόχρονα Μπορούν να χρησιμοποιηθούν στη διάγνωση, πρόγνωση και ανταπόκριση στη χημειοθεραπεία στην ογκολογία Μπορούν να προβλέψουν την τοξικότητα σε διάφορα χημειοθεραπευτικά


66 Φαρμακευτικές εφαρμογές Ευφυή Συστήματα Παροχής Φαρμάκων Τα υπάρχοντα συστήματα παροχής φαρμάκων έχουν πολλά μειονεκτήματα και προκαλούν πολλά προβλήματα. Οι ουσίες δεν εστιάζουν τη δράση τους στην περιοχή ενδιαφέροντος αλλά τείνουν να κατανέμονται σε όλο το σώμα χάνοντας αρκετή από την αποτελεσματικότητά τους. Κατασκευάζονται έξυπνα χάπια τα οποία αποτελούνται από μια γυάλινη κάψουλα η οποία περιέχει το φάρμακο και από ηλεκτρονικό και μηχανικό σύστημα υπεύθυνο για τον έλεγχο της δοσολογίας. Μετά την κατάποσή της από τον ασθενή, η κάψουλα κατευθύνεται στο σημείο θεραπείας μέσο ενός συστήματος αισθητήρων, ελευθερώνει το φάρμακο και εγκαταλείπει το σώμα μέσο της φυσικής οδού. Εφαρμογή της νανοτεχνολογίας με στόχο την παροχή φαρμάκων, βασιζόμενη στην χρήση των νανοσωματιδίων, τα οποία εμπεριέχουν μόρια του φαρμάκου με σκοπό την εναπόθεσή τους στο όργανο-στόχο. Τα νανοσωματίδια είναι αδρανή και δεν ερεθίζουν το ανοσοποιητικό σύστημα, έχοντας έτσι ακόμα μεγαλύτερη αποτελεσματικότητα.

67 Ανάλυση πρωτεϊνών Η δοµή µιας πρωτεΐνης αποτελεί το κλειδί για τη βιολογική της λειτουργία. Η ενεργός περιοχή (active site) της πρωτεΐνης χαρακτηρίζεται από γεωµετρικά και φυσικοχηµικά χαρακτηριστικά που είναι σχεδόν συµπληρωµατικά ενός άλλου µορίου, του υποστρώµατος. Αυτή η διαδικασία πρόσδεσης υποδοχέα (ενεργού κέντρου) και υποστρώµατος καλείται προσάραξη (docking). Η βιοπληροφορική χρησιμοποιείται για να ελέγξει τον µεγάλο αριθµό πιθανών στεροδιαµορφώσεων και να µειώσει την υπολογιστική πολυπλοκότητα των πειραµάτων που πρέπει να πραγµατοποιηθούν.

68 Η σχεδίαση φαρμάκου με τη βοήθεια ηλεκτρονικού υπολογιστή περιλαμβάνει Την ανακάλυψη νέων φαρμακοφόρων μορίων από αναζήτηση σε βάσεις χημικών πληροφοριών με τη χρήση προγραμμάτων βιοπληροφορικής Τη βελτιστοποίηση των φαρμακοφόρων μορίων με σκοπό την ελαχιστοποίηση των παρενεργειών Τη σχεδίαση εκ νέου μορίων που μπορούν να προσδένονται σε συγκεκριμένους υποδοχείς για να λειτουργούν ως ανταγωνιστές ή αναστολείς Την τρισδιάστατη αναπαράσταση των φαρμακοφόρων μορίων και τη μελέτη των φυσικοχημικών τους ιδιοτήτων

69 ΜΕΤΑΦΟΡΕΙΣ ΦΑΡΜΑΚΩΝ ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΗΝ ΧΕΙΡΟΥΡΓΙΚΗ Η γονιδιακή θεραπεία στη χειρουργική περιλαμβάνει: Τη συλλογή κατάλληλων κυττάρων από ασθενείς Την τροποποίησή τους Την επιστροφή των κυττάρων αυτών σε μια συγκεκριμένη περιοχή του σώματος των ασθενών. Μόλις το γονίδιο βρεθεί στη σωστή θέση, παράγει ένα σήμα που υποκινεί τη διαδικασία επούλωσης του ασθενή (π.χ. την ανάπτυξη οστίτη ιστού) Η τεχνική αυτή ανοίγει νέους ορίζοντες στην επούλωση μυοσκελετικών ιστών όπως μυών, συνδέσμων και χόνδρων

70 Με τη χρήση της γενετικής και της βιοϊατρικής πληροφορικής έχουν ανακαλυφτεί αρκετά γονίδια που ευθύνονται για την παραγωγή οστίτη ιστού Τελευταία βρέθηκε και γονίδιο που ευθύνεται για την εμφάνιση της σκολίωσης (CHD7) Με τη χρήση των εργαλείων της βιοπληροφορικής, των μικροσυστοιχειών και την ανάλυση των πρωτεϊνών που τα διάφορα γονίδια κωδικοποιούν, μπορούν να βρεθούν καινούρια γονίδια και να σχεδιαστεί μια εξατομικευμένη φαρμακευτική αντιμετώπιση

71 Μελλοντικές εφαρμογές Ανάπτυξη ρομποτικών συστημάτων στην υπολογιστικά καθοδηγούμενη χειρουργική Αποκρυπτογράφηση του γενετικού κώδικα για τον εντοπισμό μεταλλάξεων οι οποίες συμβάλλουν στη νόσο θα οδηγήσει στην κατασκευή αποτελεσματικών φαρμάκων Κατασκευή <έξυπνων> εμφυτευμάτων τα οποία όχι μόνο θα μεταφέρουν ένα φάρμακο στην κατάλληλη θέση αλλά θα είναι και σε θέση ανιχνεύοντας το μικροπεριβάλλον να <γνωρίζουν> πότε θα απελευθερώσουν το φορτίο το οποίο θα μεταφέρουν, είτε πρόκειται για φάρμακο είτε για ορμόνη Χρήση του πυριτίου για ορθοπεδικούς σκοπούς και πιο συγκεκριμένα για τη δημιουργία και μόνιμων τμημάτων οστών τα οποία θα χρησιμοποιούνται για την αντικατάσταση σπασμένων οστών γηραιών ασθενών.



ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα


ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... ΚΕΦΑΛΑΙΟ 8 ο ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...10 1 ΚΕΦΑΛΑΙΟ 8 ο I. Εφαρµογές της βιοτεχνολογίας

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα