Βιοπληροφορική Γονιδιακή Τεχνολογία

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιοπληροφορική Γονιδιακή Τεχνολογία"

Transcript

1 Βιοπληροφορική Γονιδιακή Τεχνολογία

2 Η δομή του DNA Αποτελείται από 2 πολυνουκλεοτιδικές αλυσίδες σε διπλή έλικα που διατάσσονται αντιπαράλληλα Κάθε αλυσίδα αποτελείται από 4 είδη νουκλεοτιδίων (A=αδενίνη, T=θυμίνη, C=κυτοσίνη, G=γουανίνη) Τα νουκλεοτίδια αποτελούνται από μια πεντόζη με την οποία συνδέονται μία ή περισσότερες φωσφορικές ομάδες και μια αζωτούχο βάση Στην περίπτωση του DNA η πεντόζη είναι η δεοξυριβόζη (δεοξυριβονουκλεϊκό οξύ) Δεσμοί υδρογόνου σχηματίζονται μόνο μεταξύ των βάσεων αδενίνηςθυμίνης (A-T) και γουανίνης-κυτοσίνης (G-C) Κάθε κλώνος DNA περιέχει μια αλληλουχία νουκλεοτιδίων που είναι ακριβώς συμπληρωματική (complementary) προς την αλληλουχία των νουκλεοτιδίων του άλλου κλώνου

3 Η δομή του DNA

4 Το Κεντρικό Δόγμα της Μοριακής Βιολογίας

5 Διαφορές του RNA από το DNA τα νουκλεοτίδια του είναι ριβονουκλεοτίδια, δηλαδή περιέχουν το σάκχαρο ριβόζη (απ όπου και η ονομασία ριβονουκλεϊνικό οξύ) αντί του σακχάρου δεοξυριβόζη όπως και το DNA, περιέχει τις βάσεις αδενίνη (Α), γουανίνη (G) και κυτοσίνη (C), αλλά αντί για θυμίνη (Τ) περιέχει ουρακίλη (U). Η U, όπως και η Τ, ζευγαρώνει (με δεσμούς υδρογόνου) με την Α. To DNA πάντοτε βρίσκεται στα κύτταρα υπό μορφή δίκλωνης έλικας, ενώ τo RNA είναι μονόκλωνο.

6 Κάθε ομάδα τριών διαδοχικών νουκλεοτιδίων του RNA αποκαλείται κωδικόνιο (codon) και κάθε κωδικόνιο καθορίζει ένα αμινοξύ Οι κανόνες με τους οποίους η αλληλουχία των νουκλεοτιδίων ενός γονιδίου, μέσω του mrna, μεταφράζεται στην αλληλουχία των αμινοξέων μιας πρωτεΐνης συλλογικά αναφέρονται ως γενετικός κώδικας (genetic code)

7 Ο γενετικός κώδικας

8 Καρυότυπος ανθρώπου

9 Η οργάνωση των γονιδίων σε ένα ανθρώπινο χρωμόσωμα

10 Τα γονίδια εντοπίζονται στο DNA σε οποιοδήποτε προσανατολισμό Ο προσανατολισμός του γονιδίου καθορίζει ποιος κλώνος DNA κωδικοποιεί για το mrna.

11 Τυπικό γονίδιο

12 Μέσα μεγέθη εξονίων και ιντρονίων στα ανθρώπινα γονίδια γονίδιο μέγεθος (kb) αριθμός εξονίων μέσο μέγεθος εξονίων (bp) μέσο μέγεθος ιντρονίων (bp) trna Ινσουλίνη globin Τάξη I HLA Αλβουμίνη ,100 Τάξη VII κολλαγόνο Συμπληρωματικό C3 Φαινυλαλανίνη ,500 υδροξυλάση Παράγοντας VIII ,100 CFTR ,100 Δυστροφίνη ,000

13 Και τα εξώνια και τα ιντρόνια αντιγράφονται στο RNA. Τα ιντρόνια στη συνέχεια ματίζονται πριν το mrna είναι έτοιμο για τη μετάφραση

14 Κλωνοποίηση Η ουσία της γενετικής μηχανικής έγκειται στην παρασκευή μεγάλων αριθμών ίδιων μορίων DNA προερχομένων από ένα γονίδιο (κλωνοποίηση). Αυτό επιτυγχάνεται με την εισαγωγή της ακολουθίας ενός γονιδίου σε ένα μεταφορέα (vector) που μπορεί να είναι ένα πλασμίδιο ή ένας βακτηριοφάγος. Το εισερχόμενο DNA θα αντιγραφεί μαζί με το DNA του μεταφορέα. Το κατασκευασμένο πλασμίδιο (vector) DNA εισάγεται σε ένα βακτήριο με μια διαδικασία που λέγεται μετασχηματισμός. Το επόμενο βήμα είναι η επιλογή των βακτηρίων που έχουν ενσωματώσει ένα αντίγραφο του πλασμιδίου. Αυτό επιτυγχάνεται μέσα από ένα γονίδιο του πλασμιδίου που κωδικοποιεί για αντοχή στα αντιβιοτικά, με αποτέλεσμα κάθε βακτήριο που έχει ενσωματώσει το πλασμίδιο να είναι ανθεκτικό στο συγκεκριμένο αντιβιοτικό

15 Διαδικασία για την κλωνοποίηση ενός τμήματος DNA σε ένα πλασμιδιακό μεταφορέα Βακτηριακό χρωμόσωμα Πλασμιδιακός μεταφορέας Τμήμα DNA για κλωνοποίηση Μετασχηματισμένα E. coli κύτταρα επιβιώνουν Κύτταρα που δεν έχουν ενσωματώσει το πλασμίδιο πεθαίνουν στα πιάτα αμπικιλλίνης Καλλιέργεια σε πιάτα με άγαρ που περιέχουν αμπικιλλίνη Ανεξάρτητη αντιγραφή πλασμιδίου Πολλαπλασιασμός κυττάρων Κατασκευασμένο πλασμίδο Αποικία από κύτταρα κάθε ένα από τα οποία περιλαμβάνει αντίγραφα του ίδιου ανασυνδυασμένου πλασμιδίου

16 Η ενζυμική μέθοδος ανάλυσης του DNA (sequencing)

17

18 Η αλυσιδωτή αντίδραση πολυμεράσης (PCR)

19 Εφαρμογές της PCR 1. Ιατρική διάγνωση γενετικών ασθενειών Προσδιορισμός μεταλλάξεων σε αλληλόμορφα γονίδια Διάγνωση της παρουσίας μολυσματικών συστατικών Επιδημιολογικές μελέτες 2. Ιατροδικαστικές εφαρμογές Τεστ πατρότητας Καταχώρηση του DNA για προσδιορισμό του ατόμου Εγκληματολογικές έρευνες 3. Χειρισμός του DNA για πειράματα γενετικής μηχανικής 4. Προσδιορισμός της αλληλουχίας του DNA 5. Απομόνωση καινούριων γονιδίων 6. Ανθρωπολογικές μελέτες Γενετική πληθυσμών Μελέτες μετανάστευσης 7. Εξελικτικές σχέσεις

20 Βιοπληροφορική Η επιστήμη που γεννάται και αναπτύσσεται από τη σύγκλιση της Βιοτεχνολογίας και της Πληροφορικής και στοχεύει στο σχεδιασμό εργαλείων λογισμικού (software tools), με σκοπό τη διευκόλυνση και την επιτάχυνση της βιολογικής της ιατρικής και της φαρμακευτικής έρευνας

21 Εφαρμογές της βιοπληροφορικής Ανεύρεση λειτουργίας πρωτεϊνών, ανεύρεση αλληλεπιδράσεων πρωτεϊνών μεταξύ τους, κατανόηση της πολυπλοκότητας των βιολογικών συστημάτων Η σύγκριση του γονιδιώματος διαφόρων ειδών επιτρέπει την εξαγωγή πολύτιμων συμπερασμάτων σχετικά με τις εξελικτικές σχέσεις των οργανισμών μεταξύ τους Προσπάθεια αντιμετώπισης διαφόρων ασθενειών με την ανάπτυξη νέων διαγνωστικών μέτρων και θεραπευτικών μεθόδων Γονιδιακή θεραπεία Γενετική τροποποίηση φυτών και ζώων

22 Η χρήση των εργαλείων της Πληροφορικής µπορεί να επιλύσει αρκετά υπολογιστικά προβλήµατα που προκύπτουν όπως: ιασύνδεση της γονιδιακής ακολουθίας Οι σύγχρονες µέθοδοι ανάγνωσης της ακολουθίας του DNA βασίζονται στη σταδιακή ανάγνωση τµηµάτων (fragments) από το υπό µελέτη µόριο, που µπορεί να φθάνει και τις χιλιάδες βάσεις αµινοξέων. Η διαδικασία επανασύνδεσης υπόκειται σε σφάλµατα και αποτελεί µια πολύτιµη αλλά ταυτόχρονα πολύπλοκη διαδικασία. Σύγκριση ακολουθιών Υπάρχει µια βασική αρχή η οποία θέλει τις ακολουθίες του DNA και των πρωτεϊνών που µοιάζουν να εµφανίζουν παρόµοια λειτουργία. Αυτό ισχύει και στην περίπτωση που οι ακολουθίες αυτές προέρχονται από διαφορετικά είδη. Για αυτό το λόγο το πρώτο βήµα στην αναγνώριση της δράσης µιας ακολουθίας είναι η σύγκριση της µε άλλες για να εξερευνήσουµε πιθανές οµοιότητες στη δοµή.

23 Κατηγοριοποίηση των πρωτεϊνών Οι πρωτεΐνες κατηγοριοποιούνται σε οικογένειες µε παρόµοια δοµή και λειτουργία. Με αυτό τον τρόπο µπορούµε να γνωρίζουµε τη συµπεριφορά και την τρισδιάστατη δοµή τους. Εξαγωγή πληροφοριών από γονιδιακές ακολουθίες Η µελέτη γονιδιακών ακολουθιών µπορεί να βοηθήσει στην εξαγωγή χρήσιµων αποτελεσµάτων γύρω από τη συµπεριφορά και τη βιολογική δράση των γονιδίων (εµπλοκή σε συγκεκριµένες ανωµαλίες, όµοια συµπεριφορά σε θεραπευτικές αγωγές κ.ά) Η πολύπλοκη φύση των γονιδίων κάνει πολύ δύσκολη την όλη διαδικασία. Αναπαράσταση των κυττάρων ως µεταγραφικών δικτύων Ένα ζωντανό κύτταρο µπορεί να χαρακτηριστεί ως µια αλληλεπίδραση διαφορετικών κυτταρικών διαδικασιών. Αυτό µπορεί να µοντελοποιηθεί ως ένα δυναµικό σύστηµα µε συγκεκριµένες εισόδους (π.χ: φάρµακα, λαµβανόµενα σήµατα από γειτονικά κύτταρα ή τον ανθρώπινο οργανισµό) και πιθανές καταστάσεις.

24 Οι στόχοι της Βιοπληροφορικής µπορούν να ταξινοµηθούν σε 3 οµάδες Α) η Βιοπληροφορική επιτρέπει την αποδοτική οργάνωση των δεδοµένων ώστε να είναι δυνατή η αποθήκευση, ανάκτηση και ενηµέρωσή τους. Β) περιλαµβάνει τα εργαλεία που επιτρέπουν την ανάλυση των βιολογικών δεδοµένων. Για παράδειγµα έχοντας ακολουθιοποιήσει µια πρωτεΐνη, οι επιστήµονες ενδιαφέρονται να τη συγκρίνουν µε ήδη γνωστές και ταυτοποιηµένες ακολουθίες. Αυτή η διαδικασία απαιτεί τη χρήση πολύπλοκων εργαλείων όπως τα προγράµµατα FASTA και PSI- BLAST, που επιτρέπουν την ανακάλυψη και αναζήτηση κοινών τµηµάτων σε βιολογικές ακολουθίες. Γ) Τέλος η Βιοπληροφορική θέτει ως στόχο την ανάπτυξη εργαλείων που επιτρέπουν την ερµηνεία των αποτελεσµάτων βιολογικής σηµασίας.

25 Ομαδοποίηση των τύπων των δεδομένων που αναλύει η Βιοπληροφορική - Εφαρμογές Πηγή εδοµένων Ακολουθίες DNA Ακολουθίες Πρωτεϊνών Μέγεθος εδοµένων 13.5 εκατ. Ακολουθίες (14.5 δις. Βάσεις) ακολουθίες (~300 αµινοξέα για καθεµιά) Εφαρµογές Βιοπληροφορικής Αναγνώριση εξονίων και ιντρονίων ιαχωρισµός coding & non-coding περιοχών Αλγόριθµοι σύγκρισης ακολουθιών Ανακάλυψη σηµαντικών µοτίβων οµές Μακροµορίων Γονιδιώµατα Εκφράσεις Γονιδίων δοµές (~1000 ατοµικές συντεταγµένες η καθεμία) 300 πλήρη γονιδιώµατα (1.6 εκατ-3 δις βάσεις το καθένα) ~20 µετρήσεις σηµείων για ~ 6000 γονίδια Καθορισµός ευτερεύουσας δοµής Αλγόριθµοι τρισδιάστατης προσάραξης μακρομορίων και γεωμετρικού ταιριάσματος πρωτεϊνών Φυλογενετική Ανάλυση Αντιστοίχηση γονιδίων σε αρρώστιες Σύγκριση εκφράσεων γονιδίων Αντιστοίχηση εκφράσεων γονιδίων σε ακολουθιακά, δοµικά και βιοχηµικά δεδομένα

26 Ανάλυση ακολουθιών βιολογικών δεδομένων- Προγράμματα Στις ακολουθίες του DNA παρατηρούνται περιοδικές επαναλήψεις συµβολοσειρών-µοτίβα (ως µοτίβο µπορούµε να ορίσουµε ένα σύνολο χαρακτήρων που εµφανίζεται παραπάνω από µια φορά σε µια ακολουθία). Δύο κατηγορίες προβλημάτων α) ακριβή επανάληψη µοτίβων και β) προσεγγιστική επανάληψη µοτίβων Μια συχνά χρησιµοποιούµενη τεχνική για τη σύγκριση βιολογικών ακολουθιών είναι η διάταξη/ ευθυγράµµισή τους και η σύγκρισή τους ανά σύµβολο (alignment). Ουσιαστικά όλες οι μέθοδοι αναζήτησης βάσεων δεδομένων έχουν βασιστεί στα μέτρα της τοπικής ομοιότητας ακολουθίας.

27 Οι αλγόριθμοι BLAST Οι αλγόριθμοι BLAST (Basic Local Alignment Search Tools) αρχίζουν με μια μήτρα βαθμολογίας ομοιότητας για όλα τα πιθανά ζευγάρια των υπολειμμάτων. Οι ταυτότητες και οι συντηρητικές αντικαταστάσεις έχουν θετική βαθμολογία, ενώ οι απίθανες αντικαταστάσεις έχουν αρνητική βαθμολογία. Για τις συγκρίσεις αλληλουχίας DNA, οι ταυτότητες σημειώνονται ως +5 και οι αποτυχημένοι συνδυασμοί ως 4. Άλλα αποτελέσματα είναι βέβαια επίσης δυνατά. Δύο αλληλουχίες s1, s2 θεωρούνται ότι είναι 1 PAM μακριά εάν μια σειρά αποδεκτών μεταλλάξεων έχει μετασχηματίσει το s1 σε s2 με έναν μέσο όρο 1 a.p.m (αποδεκτή μετάλλαξη σημείου) για κάθε 100 αμινοξέα. Λαμβάνοντας υπόψη αυτούς τους κανόνες ένα μέγιστο ζευγάρι τμήματος (MSP) καθορίζεται να είναι τα υψηλότερα ζευγάρια βαθμολογίας ίδιων τμημάτων μήκους που επιλέγονται από 2 ακολουθίες.

28 Πρόγραμμα BLASTP Ερωτώμενη αλληλουχία Πρωτεΐνη (αμφότερες αλυσίδες) Αλληλουχία βάσης δεδομένων Πρωτεΐνη BLASTN Νουκλεοτίδιο Νουκλεοτίδιο Σχόλια Προεπιλεγέμενο αποτέλεσμα Κάλυψη πολυπλοκότητας με επιλογή φίλτρων Παράμετροι που βελτιστοποιούνται για την ταχύτητα και όχι για την ευαισθησία BLASTX Νουκλεοτίδιο (μετάφραση έξι πλαισίων) Πρωτεΐνη Πολύ χρήσιμη για προκαταρκτικά δεδομένα. Εννέα διαφορετικοί γενετικοί κώδικες TBLASTN Πρωτεΐνη Νουκλεοτίδιο (μετάφραση έξι πλαισίων) Βασική για έρευνα πρωτεϊνικών ερωτήσεων σχετικά με το dbest. Συχνά χρήσιμη για την εύρεση μη τεκμηριωμένων ORFs

29 Ευθυγράμμιση αλληλουχιών με τη χρήση των αλγορίθμων BLAST >gb BE BE BARC 5BOV Bos taurus cdna 5'. Length = 369 Score = 272 bits (137), Expect = 4e -71 Identities = 258/297 (86%), Gaps = 1/297 (0%) Strand = Plus / Plus Query: 17 aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76 Sbjct: 1 aggatccaacgtcgctgcggctacccttaaccact -cgcagaccccccgcagccatggcc 59 Query: 77 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136 Sbjct: 60 agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119 Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196 Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179 Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256 Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239 Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313 Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296

30 Εύρεση περιοχών ομοιότητας μιας πρωτεΐνης στα διάφορα είδη με τη χρήση των αλγορίθμων BLAST

31 Έρευνα ομολογίας και περιοχών- Εύρεση γονιδίων Ένα πλήρες μήκος ή μια μερική αλληλουχία DNA σε ένα ανθρώπινο γονίδιο μπορεί να εισαχθεί σε ένα πρόγραμμα που την συγκρίνει με όλες τις άλλες αλληλουχίες που αποθηκεύονται στις ηλεκτρονικές βάσεις δεδομένων αλληλουχίας. Η έρευνα στις μεγάλες βάσεις δεδομένων παρέχει συχνά την πρώτη ένδειξη λειτουργίας μιας αλληλουχίας όπως στην περίπτωση της κανονικής λειτουργίας του γονιδίου (NF2) της νευροϊνωμάτωσης τύπου 2. Η έρευνα ομολογίας στις βάσεις δεδομένων που χρησιμοποιούν την πρόσφατα καθιερωμένη NF2 αλληλουχία DNA προσδιόρισε τις σχετικές ακολουθίες, ειδικότερα εκείνες των moesin, ezrin και radixin. Αυτές οι πρωτεΐνες ήταν γνωστό ότι ενεργούν ως δομικές συνδέσεις μεταξύ των πρωτεϊνών μεμβρανών κυττάρων και των ενδιάμεσων πρωτεϊνών ινών, παρέχοντας με αυτόν τον τρόπο μερικές αρχικές ενδείξεις στη λειτουργία του προϊόντος γονιδίων NF2.

32 Τα περισσότερα από τα πρώτα στοιχεία αλληλουχίας λήφθηκαν από μιτοχονδριακά ή βακτηριακά γονιδιώματα Σε καθαρή στατιστική βάση, ένα ανοικτό πλαίσιο ανάγνωσης (ORF, open reading frame) μακρύτερο από 300 bp αναμένεται να εμφανιστεί τυχαία κάθε 36 Kb σε μια ενιαία αλυσίδα DNA (με %A = %C= %G = %T = 25). Πραγματικές πρωτεΐνες αντιστοιχούν κατά μέσον όρο σε ένα 1000 bp ORF. Ένας απλός αλγόριθμος που διατηρεί την πιo μακροχρόνια επικάλυψη ORFs και εφαρμόζοντας ένα κατώτατο όριο μεγέθους θα ανιχνεύσει ήδη τα περισσότερα πραγματικά γονίδια με καλή εξειδίκευση. Περιπλοκότερες μέθοδοι απαιτούνται για να εντοπίσουν μικρά γονίδια, να ερμηνεύσουν τις μερικές ακολουθίες που περιέχουν ελλιπή ORFs, αμετάφραστες περιοχές ή να επικρατήσουν της αλληλουχίας λαθών.

33 Προγράμματα ηλεκτρονικού υπολογιστή χρησιμοποιούνται για την ανεύρεση γονιδίων

34 Τα διάφορα προγράμματα συνδυάζουν την επιλογή όλων των μεγαλύτερων από 50 bp ORF την ταξινόμηση υποψηφίων εξονίων σύμφωνα με το εξαμερές μέτρο κωδικοποίησης τη σάρωση υποψηφίων εξονίων για ομοιότητα με αλληλουχίες πρωτεϊνών σε βάσεις δεδομένων την ανεύρεση εξονίων με αναζήτηση ομοιότητας την πρόβλεψη πλήρων δομών γονιδίων τη γραμμική διακρίνουσα ανάλυση τα δέντρα απόφασης το δυναμικό προγραμματισμό τα μοντέλα Markov

35 Τέσσερις ομάδες γονιδίων 1) γνωστά γονίδια, δηλαδή εκείνα που είναι ίδια με το γνωστό ανθρώπινο συμπληρωματικό DNA ή πρωτεϊνική αλληλουχία 2) νέα γονίδια, που είναι εκείνα που έχουν ένα ανοικτό πλαίσιο ανάγνωσης (ORF) είναι ίδια με τα ανθρώπινα ESTs ή/και έχουν ομολογίες με γνωστά γονίδια ή πρωτεΐνες 3) putative (πιθανά) γονίδια, τα οποία έχουν ίδιες αλληλουχίεs με τα ανθρώπινα ESTs αλλά χωρίς ORF και 4) ψευδογονίδια, δηλαδή αλληλουχίες ομόλογες με γνωστά γονίδια και πρωτεΐνες αλλά με αποδιοργανωμένο ORF ORF.

36

37 Όνομα κλώνου Τύπος Μέγεθος G+C (%) Ισοχώρος Επαναλήψεις (%) Γονίδια Πυκνότητα γονιδίου ba489k8 BAC H1/H ba69l16 BAC L2/H ba288g3 BAC H dj336k20 PAC L2/H dj126e20 PAC H dj303a1 PAC L1/L dj501e16 PAC L1/L ba328k6 BAC L1/L ba320h2 BAC L1/L ba12i14 BAC L1/L dj103m22 PAC L1/L dj90o12 PAC L1/L ba648n19 BAC L1/L dj398a12 PAC L1/L dj359l13 PAC L1/L ba380l24 BAC L1/L ba339a7 BAC L1/L dj290i10 PAC H ba BAC H1/H ba421m1 BAC L2/H ba417m14 BAC L2/H ba637o19 BAC L1/L

38 Expression profile Homology ΓΟΝΙ ΔΙΟ Coding (bp) Γονιδιακό ς (Kb) Nο εξο νίω ν Πρ οσα νατ ολισμό ς Εγκ έφα λος Κα ρδι ά Νε φρό Συκ ώτι Πνε ύμο νας Κα ρδι ά M. mus cul us R.n orve gicu s D.m ela nog aste r C.el ega ns A.th alia na RREB P SSR D MSL D TKL P + + DSP P

39

40 PAC/BAC Μήκος(bp) SINEs LINE LTR % Alu MIRs AluS/J BA489K8 22, Ø BA69L16 167, BA288G3 128, DJ336K20 52, DJ119C5 152, DJ126E20 117, DJ303A1 104, DJ501E16 56, DJ503N11 94, BA339A7 164, DJ290I10 180, BA360O19 87, BA421M1 155, DJ417M14 144, BA , Sum 3,150,

41 Άνθρωπος Ποντικός ΓΟΝΙΔΙΟ Κωδικοποίηση (bp) Γονιδιακό (Kb) Νο εξονίων Προσαν/ λισμός Κωδικοποίηση (bp) Γονιδιακό (Kb) Νο εξονίων Προσαν /λισμός RREB P P SSR D D DSP P P BMP P P TFAP D D GCNT P P MAK D D GCMB D D

42 Πρόγραμμα Τύπος πρόβλεψης Ευαισθησία (νουκλεοτίδιο) Ευαισθησία (εξόνιο) Εξειδίκευση (νουκλεοτίδιο) Ελλείποντα εξόνια Λανθασμένα εξόνια FGENEH Δομή γονιδίου Genie Δομή γονιδίου GenLang Δομή γονιδίου GENSCAN Δομή γονιδίου GRAIL II Εσωτερικά Εξόνια GRAIL II/GAP Δομή γονιδίου HEXON Εσωτερικά Εξόνια MORGAN Δομή γονιδίου MZEF Εσωτερικά Εξόνια SorFind Εσωτερικά εξόνια VEIL Δομή γονιδίου

43

44

45 Βάσεις δεδομένων και πρόσβαση Η σημαντικότερη απαίτηση για την έρευνα βάσεων δεδομένων είναι μια περιεκτική, σύγχρονα ενημερωμένη βάση δεδομένων. Η GenBank (http://www.ncbi.nlm.nih.gov/) χρησιμοποιείται ευρύτατα, και οι καθημερινές αναπροσαρμογές είναι διαθέσιμες για μεταφόρτωση ή άμεση έρευνα με τις υπηρεσίες ηλεκτρονικού ταχυδρομείου και δικτύων. Η NCBI διατηρεί δύο περίπου συλλογές αλληλουχίας χωρίς πλεονασμό (NRDB), μια για τις πρωτεΐνες και μια για τα νουκλεϊνικά οξέα. Σήμερα υπάρχουν πάνω από εκατό από τις διαφορετικές βάσεις δεδομένων που προσεγγίζονται εύκολα μέσω του διαδικτύου που δίνουν όλα τα είδη των διαφορετικών πολύτιμων πληροφοριών. Όλα τα προγράμματα που περιγράφονται ανωτέρω μπορούν να χρησιμοποιηθούν για να αναλύσουν τα στοιχεία και να τα συνδυάσουν σε μια οπτική παρουσίαση ως NIX (προσδιορισμός νουκλεοτιδίου X)

46 Οι πιο γνωστές βάσεις δεδομένων ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΠΕΡΙΓΡΑΦΗ Η πιο ευρέως χρησιμοποιούμενη βάση δεδομένων η οποία περιέχει πληροφορίες για όλα τα γονίδια, τους απλούς πολυνουκλεοτιδικούς πολυμορφισμούς (SNPs), τις συγγένειες μεταξύ των ειδών ενώ διαθέτει και μηχανές αναζήτησης ομοιότητας της ερωτώμενης ακολουθίας Λεπτομερής περιγραφή των γονιδίων καθώς και χρωμοσωμικών ανωμαλιών (προσθήκες, εξαλείψεις, μετατοπίσεις) καθώς και χάρτες του ανθρώπινου γονδιώματος Κατάλογος ΟΜΙΜ όλων των ανθρώπινων γονιδίων και των γενετικών διαταραχών Σχολιασμός και περιγραφή όλων των γονιδίων και αναφορά στους δείκτες και την ακριβή θέση του γονιδίου στο χρωμόσωμα Βάση δεδομένων για πρωτεϊνες Διάφορα υπολογιστικά προγράμματα για ανάλυση των μοτίβων και των χαρακτηριστικών των ακολουθιών Λεπτομερή αρχεία με όλες τις δημοσιεύσεις των επιστημονικών περιοδικών και δυνατότητα συσχετισμού των γονιδίων και των ιδιοτήτων τους με την Genbank Επιδημιολογικές πληροφορίες για κάθε γονίδιο και πολυμορφισμό και συσχέτισή τους με γνωστές νόσους

47 NCBI

48

49

50

51

52

53 Γονιδιακή τεχνολογία η µετάλλαξη των γονιδίων ευθύνεται για ένα σύνολο ασθενειών όπως ο καρκίνος ο διαβήτης, οι παθήσεις του κεντρικού νευρικού συστήματος κ.ά. Η κατανόηση του τρόπου µε τον οποίο τα γονίδια επηρεάζουν τις ασθένειες και η κατανόηση των λειτουργιών των πρωτεϊνών, που τα γονίδια κωδικοποιούν, µπορεί να βοηθήσει στην ανάπτυξη θεραπείας που στοχεύει στον περιορισµό και τη βελτίωση ελαττωµατικών γονιδίων το ανθρώπινο γονιδίωμα αποτελείται από 46 χρωμοσώματα και περίπου μοναδικά γονίδια.

54 Με τη γενετική μηχανική μεταφέρονται τμήματα DNA ενός κυττάρου, που ρυθμίζουν ορισμένους επιθυμητούς χαρακτήρες, σε ένα άλλο κύτταρο, όπου ενσωματώνονται στο γενετικό του υλικό παράγεται ένα καινούργιο τεχνητό μόριο, το ανασυνδυασμένο DNA οι τεχνικές ανασυνδυασμένου DNA χρησιμοποιούνται στην κλωνοποίηση γονιδίων στη γενετική τροποποίηση των οργανισμών και γενικά για την ανάπτυξη ποικίλων τεχνικών της Μοριακής Βιολογίας

55 Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA στη θεραπεία πολλών σοβαρών γενετικών ασθενειών όπως διάφοροι τύποι καρκίνου δίνει τη δυνατότητα προσθήκης νέων γονιδίων απευθείας στον οργανισμό

56 Οι μεταλλάξεις είναι υπεύθυνες για την αλλαγή στο γενετικό υλικό και κατ επέκταση την εμφάνιση πολλών νόσων Είδη Μεταλλάξεων σωματικές (somatic mutations) Βρίσκονται σε ένα συγκεκριμένο ιστό κληρονομικές - γαμετικές (germ-line mutations) Βρίσκονται σε όλους τους ιστούς

57 Κυρίαρχα γονίδια Στις κυρίαρχες γενετικές παθήσεις ο ένας γονέας είναι φορέας παθογόνου μετάλλαξης στο ένα αλληλόμορφο το οποίο κυριαρχεί στο άλλο. Κάθε παιδί στην οικογένεια έχει 50% πιθανότητες να κληρονομήσει το παθολογικό αλληλόμορφο και την ασθένεια Υποτελή γονίδια Και οι δύο γονείς (υγιείς) είναι φορείς είναι φορείς μιας παθογόνου μετάλλαξης. Κάθε παιδί έχει 25% πιθανότητες να κληρονομήσει και τα δύο παθολογικά αλληλόμορφα με αποτέλεσμα να νοσήσει. Συνήθως έχουμε την παρουσία κάποιας κληρονομικής μετάλλαξης σε ένα ογκοκασταλτικό γονίδιο ή ογκογονίδιο όπως BRCA1, BRCA2, p53, MEN1, RET, P16, APC, MLH1, MSH2 κλπ. Πρέπει να απωλεστεί και το φυσιολογικό αλληλομόρφο, οπότε έχουμε απώλεια ετεροζυγωτίας - LOH

58 Σύνδρομο καρκίνου μαστού H γενετική ανάλυση για τα γονίδια BRCA1 & BRCA2 σε οικογένειες με ιστορικό καρκίνου μαστού/ωοθηκών ξεκίνησε το σε ερευνητικά πλαίσια Από το 2000 προσφέρεται ως εξέταση ρουτίνας σχεδόν σε όλες τις χώρες της Ευρώπης, την Αμερική, τον Καναδά, την Αυστραλία και το Ισραήλ Ο γενετικός έλεγχος έχει σώσει χιλιάδες ζωές

59 Κατανομή των μεταλλάξεων στα γονίδια BRCA1 & BRCA2 που έχουν χαρακτηριστεί σε ελληνικές οικογένειες με ιστορικό καρκίνου μαστού/ωοθηκών. Γαλάζιοι κύκλοι αναπαριστούν οικογένειες με καρκίνο του μαστού και ωοθηκών και μαύροι κύκλοι μόνο με καρκίνο του μαστού

60 Γονίδια που εμπλέκονται στους σημαντικότερους τύπους καρκίνου Τύπος Καρκίνου Κληρονομήσιμες Μεταλλάξεις Σωματικές Αλλοιώσεις Καρκίνος πνεύμονα - Μεταλλάξεις p53, KRAS, CDKN2A Εγκέφαλος - Μεταλλάξεις p53, CDKN2A, PTEN Καρκίνος ήπατος - Μεταλλάξεις p53, CTNNB1 Καρκίνος παγκρέατος - KRAS, TP53, CDKN2A Καρκίνος μαστού και ωοθηκών BRCA1, BRCA2 -

61 Γονίδια που ευθύνονται για συνηθισμένες νόσους Νόσος Γονίδιο Διαβήτης 1 PTPN22, PEP, LYP Λευχαιμία RBM15, SPEM Νόσος του Parkinson PARK10 Καρκίνος προστάτη PRCA1 Νεφρωσικό σύνδρομο PDCN

62 Γονίδια που ευθύνονται για συνηθισμένες νόσους Νόσος Γονίδιο Καρκίνος παγκρέατος CDKN2A Αναιμία Fanconi XRCC9 Άσθμα CCL11 Σχιζοφρένεια DTNBP1 Γλαύκωμα GLC3B

63 Η βιοπληροφορική βοηθάει στην ανεύρεση όλων των γονιδίων με αναζήτηση στις κατάλληλες βάσεις δεδομένων και πιο συγκεκριμένα: Η GeneCards (http://bioinformatics.weizmann.ac.il/cards/) είναι η βάση δεδομένων των ανθρώπινων γονιδίων, των προϊόντων τους και της συμμετοχής στις ασθένειες Η GeneTests (http://geneclinics.org/) είναι μια ιατρική πηγή πληροφοριών γενετικής που αναπτύσσεται για τους ιατρούς και τους ερευνητές Η ανθρώπινη βάση δεδομένων μεταλλαγής γονιδίων (http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html είναι η ανθρώπινη βάση δεδομένων που περιλαμβάνει τους διάφορους τύπους μεταλλαγών μέσα στις περιοχές κωδικοποίησης των ανθρώπινων πυρηνικών γονιδίων, προκαλώντας την κληρονομούμενη ασθένεια Η OMIM είναι η μεντελική κληρονομικότητα στον άνθρωπο και ο κατάλογος των ανθρώπινων γονιδίων και των γενετικών αναταραχών με το περιγραφικό κείμενο Η Prospectr μπορεί να χρησιμοποιηθεί για να εμπλουτίσει τους καταλόγους γονιδίων που βρίσκονται σε έναν πιθανό γεωμετρικό τόπο ασθενειών.

64 Μικροσυστοιχείες: Νέα τεχνολογία μοριακής βιολογίας στη χειρουργική Οι μικροσυστοιχείες είναι μικροσκοπικές σειρές ακινητοποιημένων νουκλεϊνικών οξέων. Επιτρέπουν την ανίχνευση αλλοιώσεων χιλιάδων γονιδίων ταυτόχρονα Μπορούν να χρησιμοποιηθούν στη διάγνωση, πρόγνωση και ανταπόκριση στη χημειοθεραπεία στην ογκολογία Μπορούν να προβλέψουν την τοξικότητα σε διάφορα χημειοθεραπευτικά

65

66 Φαρμακευτικές εφαρμογές Ευφυή Συστήματα Παροχής Φαρμάκων Τα υπάρχοντα συστήματα παροχής φαρμάκων έχουν πολλά μειονεκτήματα και προκαλούν πολλά προβλήματα. Οι ουσίες δεν εστιάζουν τη δράση τους στην περιοχή ενδιαφέροντος αλλά τείνουν να κατανέμονται σε όλο το σώμα χάνοντας αρκετή από την αποτελεσματικότητά τους. Κατασκευάζονται έξυπνα χάπια τα οποία αποτελούνται από μια γυάλινη κάψουλα η οποία περιέχει το φάρμακο και από ηλεκτρονικό και μηχανικό σύστημα υπεύθυνο για τον έλεγχο της δοσολογίας. Μετά την κατάποσή της από τον ασθενή, η κάψουλα κατευθύνεται στο σημείο θεραπείας μέσο ενός συστήματος αισθητήρων, ελευθερώνει το φάρμακο και εγκαταλείπει το σώμα μέσο της φυσικής οδού. Εφαρμογή της νανοτεχνολογίας με στόχο την παροχή φαρμάκων, βασιζόμενη στην χρήση των νανοσωματιδίων, τα οποία εμπεριέχουν μόρια του φαρμάκου με σκοπό την εναπόθεσή τους στο όργανο-στόχο. Τα νανοσωματίδια είναι αδρανή και δεν ερεθίζουν το ανοσοποιητικό σύστημα, έχοντας έτσι ακόμα μεγαλύτερη αποτελεσματικότητα.

67 Ανάλυση πρωτεϊνών Η δοµή µιας πρωτεΐνης αποτελεί το κλειδί για τη βιολογική της λειτουργία. Η ενεργός περιοχή (active site) της πρωτεΐνης χαρακτηρίζεται από γεωµετρικά και φυσικοχηµικά χαρακτηριστικά που είναι σχεδόν συµπληρωµατικά ενός άλλου µορίου, του υποστρώµατος. Αυτή η διαδικασία πρόσδεσης υποδοχέα (ενεργού κέντρου) και υποστρώµατος καλείται προσάραξη (docking). Η βιοπληροφορική χρησιμοποιείται για να ελέγξει τον µεγάλο αριθµό πιθανών στεροδιαµορφώσεων και να µειώσει την υπολογιστική πολυπλοκότητα των πειραµάτων που πρέπει να πραγµατοποιηθούν.

68 Η σχεδίαση φαρμάκου με τη βοήθεια ηλεκτρονικού υπολογιστή περιλαμβάνει Την ανακάλυψη νέων φαρμακοφόρων μορίων από αναζήτηση σε βάσεις χημικών πληροφοριών με τη χρήση προγραμμάτων βιοπληροφορικής Τη βελτιστοποίηση των φαρμακοφόρων μορίων με σκοπό την ελαχιστοποίηση των παρενεργειών Τη σχεδίαση εκ νέου μορίων που μπορούν να προσδένονται σε συγκεκριμένους υποδοχείς για να λειτουργούν ως ανταγωνιστές ή αναστολείς Την τρισδιάστατη αναπαράσταση των φαρμακοφόρων μορίων και τη μελέτη των φυσικοχημικών τους ιδιοτήτων

69 ΜΕΤΑΦΟΡΕΙΣ ΦΑΡΜΑΚΩΝ ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ ΣΤΗΝ ΧΕΙΡΟΥΡΓΙΚΗ Η γονιδιακή θεραπεία στη χειρουργική περιλαμβάνει: Τη συλλογή κατάλληλων κυττάρων από ασθενείς Την τροποποίησή τους Την επιστροφή των κυττάρων αυτών σε μια συγκεκριμένη περιοχή του σώματος των ασθενών. Μόλις το γονίδιο βρεθεί στη σωστή θέση, παράγει ένα σήμα που υποκινεί τη διαδικασία επούλωσης του ασθενή (π.χ. την ανάπτυξη οστίτη ιστού) Η τεχνική αυτή ανοίγει νέους ορίζοντες στην επούλωση μυοσκελετικών ιστών όπως μυών, συνδέσμων και χόνδρων

70 Με τη χρήση της γενετικής και της βιοϊατρικής πληροφορικής έχουν ανακαλυφτεί αρκετά γονίδια που ευθύνονται για την παραγωγή οστίτη ιστού Τελευταία βρέθηκε και γονίδιο που ευθύνεται για την εμφάνιση της σκολίωσης (CHD7) Με τη χρήση των εργαλείων της βιοπληροφορικής, των μικροσυστοιχειών και την ανάλυση των πρωτεϊνών που τα διάφορα γονίδια κωδικοποιούν, μπορούν να βρεθούν καινούρια γονίδια και να σχεδιαστεί μια εξατομικευμένη φαρμακευτική αντιμετώπιση

71 Μελλοντικές εφαρμογές Ανάπτυξη ρομποτικών συστημάτων στην υπολογιστικά καθοδηγούμενη χειρουργική Αποκρυπτογράφηση του γενετικού κώδικα για τον εντοπισμό μεταλλάξεων οι οποίες συμβάλλουν στη νόσο θα οδηγήσει στην κατασκευή αποτελεσματικών φαρμάκων Κατασκευή <έξυπνων> εμφυτευμάτων τα οποία όχι μόνο θα μεταφέρουν ένα φάρμακο στην κατάλληλη θέση αλλά θα είναι και σε θέση ανιχνεύοντας το μικροπεριβάλλον να <γνωρίζουν> πότε θα απελευθερώσουν το φορτίο το οποίο θα μεταφέρουν, είτε πρόκειται για φάρμακο είτε για ορμόνη Χρήση του πυριτίου για ορθοπεδικούς σκοπούς και πιο συγκεκριμένα για τη δημιουργία και μόνιμων τμημάτων οστών τα οποία θα χρησιμοποιούνται για την αντικατάσταση σπασμένων οστών γηραιών ασθενών.

72

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Περιβαλλοντικά Καρκινογόνα Κυρίως τρεις τύποι: Χηµικά (µόλυνση, κάπνισµα, αµίαντος) Φυσικά (ιονίζουσα ακτινοβολία, µή- ιονίζουσα???) Βιολογικά (ιοί π.χ.. HPV) Καρκίνος παχέος εντέρου ΓΕΝΕΤΙΚΟΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ Α. Εισαγωγικά Στοιχεία Βιολογίας 1. DNA (Δεοξυριβονουκλεϊκό Οξύ) Φορέας γενετικής πληροφορίας Το DNA είναι ένα επίμηκες μόριο

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

Μια ενημέρωση για ασθενείς και παρόχους φροντίδας

Μια ενημέρωση για ασθενείς και παρόχους φροντίδας Μια ενημέρωση για ασθενείς και παρόχους φροντίδας Τι είναι το FoundationOne ; Το FoundationOne είναι μια εξέταση που ανιχνεύει γενωμικές μεταβολές (π.χ. μεταλλάξεις) που είναι γνωστό ότι σχετίζονται με

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΟΜΑΔΑ Λ Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Τι είναι η βιοπληροφορική; Αποκαλείται ο επιστημονικός κλάδος ο οποίος προέκυψε από

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ.

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ. 1 Γενικά Ο καρκίνος προκαλείται από αλλαγές στα υλικά του σώματος μας που ονομάζονται «γονίδια». Πρόκειται για τις μονάδες πληροφοριών σε κάθε κύτταρο του σώματός μας. Τα γονίδια υπαγορεύουν στπν οργανισμό

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική»

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Μεταπτυχιακή Διατριβή Τίτλος Διατριβής Ονοματεπώνυμο Φοιτητή Πατρώνυμο Αριθμός Μητρώου Επιβλέπων ΑΝΑΓΝΩΡΙΣΗ ΜΟΡΙΑΚΩΝ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015 Ορισμοί-Κατάταξη-Ιστολογία Δ Ροντογιάννη Νευροενδοκρινή νεοπλάσματα Ταξινόμηση Βιολογικοί δείκτες Μοριακή Παθολογία Νευροενδοκρινή νεοπλάσματα Ταξινόμηση

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Η Τεχνολογία στην Ιατρική

Η Τεχνολογία στην Ιατρική Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: Η Τεχνολογία στην Ιατρική Τμήμα: ΗΥ: Ομάδα: Β2 pc27

Διαβάστε περισσότερα

Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση

Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση Γενετική Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση Δρ Aleksandra Norek Βοηθός Τμήμα Ιατρικής Γενετικής Ινστιτούτο Υγείας Μητέρας και Παιδιού Βαρσοβία, Πολωνία Το μέσο προσδόκιμο

Διαβάστε περισσότερα

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU)

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) μπορεί να ορισθεί ως μια σπάνια μεταβολική διαταραχή

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα