Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 στους γονείς μου, που ήταν πάντα εκεί 2

3 Δεν μπορείς να ανακαλύψεις νέους ωκεανούς αν δεν έχεις το κουράγιο να χάσεις την ακτή από τα μάτια σου.. Πλάτωνας ( π.Χ.) αρχαίος Έλληνας φιλόσοφος 3

4 ΠΕΡΙΕΧΟΜΕΝΑ Περιεχόμενα 4 Πρόλογος- Ευχαριστίες....8 Περίληψη...10 ΚΕΦΑΛΑΙΟ 1 ο ΦΥΣΙΟΛΟΓΙΑ ΑΡΘΡΩΣΕΩΝ 1.1 Εισαγωγή Αρθρώσεις Άρθρωση ισχίου Οστό Γενικότερες λειτουργίες οστού Χημική σύσταση οστού Δομή οστού Χόνδρος Γενικότερες λειτουργίες χόνδρου Χημική σύσταση χόνδρου Δομή χόνδρου ΚΕΦΑΛΑΙΟ 2 ο ΠΑΘΟΛΟΓΙΑ ΧΟΝΔΡΟΥ 2.1 Εισαγωγή Οστεοαρθρίτιδα Επιδημιολογία Τύποι και κλινικά συμπτώματα

5 2.2.3 Αίτια οστεοαρθρίτιδας Αντιμετώπιση οστεοαρθρίτιδας Παθογένεση οστεοαρθρίτιδας Τεχνικές διάγνωσης της οστεοαρθρίτιδας Κλινική εξέταση Αρθροσκόπηση Μέθοδοι απεικόνησης Ιστοπαθολογικές αναλύσεις Μειονεκτήματα συμβατικών τεχνικών για τη διάγνωση της οστεοαρθρίτιδας Δονητικές τεχνικές στη διάγνωση ασθενειών οστού και χόνδρου Πλεονεκτήματα φασματοσκοπίας Raman έναντι των συμβατικών τεχνικών για τη διάγνωση της οστεοαρθρίτιδας Σκοπός πειραμάτων...72 ΚΕΦΑΛΑΙΟ 3 ο ΘΕΩΡΙΑ RAMAN 3.1 Εισαγωγή Φασματοσκοπία Raman Θεωρητικό υπόβαθρο Μαθηματική προσέγγιση Οργανολογία...80 ΠΕΙΡΑΜΑΤΙΚΟ ΜΕΡΟΣ ΚΕΦΑΛΑΙΟ 4 ο 4.1 Συλλογή και προετοιμασία δειγμάτων Λήψη φασμάτων Επεξεργασία φασμάτων Λογισμικό διαχωρισμού κορυφών

6 ΚΕΦΑΛΑΙΟ 5 ο Ιστολογική εξέταση δειγμάτων...93 ΑΠΟΤΕΛΕΣΜΑΤΑ ΚΕΦΑΛΑΙΟ 6 Ο 6.1 Διάκριση υποχόνδρινου οστού και αρθρικού χόνδρου Φάσματα στην περιοχή του αρθρικού χόνδρου και του υποχ. οστού Σύγκριση φασμάτων αρθρικού χόνδρου και υποχόνδρινου οστού Περιοχή προλινών Περιοχή φωσφορικών βιοαπατίτη Περιοχή ανθρακικών βιοαπατίτη Περιοχή αμιδίου ΙΙΙ Περιοχή cm Περιοχή αμιδίου Ι Φάσματα Raman σε ασθενείς περιοχές της οστεοαρθριτικής κεφαλής Χαρτογράφηση τομής κεφαλής μηριαίου οστού με τη χρήση μικροσκοπίας Raman Χαρτογράφηση υγιούς περιοχής Χαρτογράφηση ασθενούς περιοχής Ειδικές περιπτώσεις Ασβεστίτης Νέο οστό Σύνοψη αποτελεσμάτων χαρτογράφησης Ποσοτική ανάλυση οστού Υπολογισμός παραμέτρων φασμάτων Raman Ποσοτική ανάλυση υγιών περιοχών Ποσοτική ανάλυση ασθενών περιοχών Ποσοτική ανάλυση υπόλοιπων περιοχών

7 ΚΕΦΑΛΑΙΟ 7 Ο ΣΥΜΠΕΡΑΣΜΑΤΑ..177 Βιβλιογραφία Παράρτημα Ι Παράρτημα ΙΙ Παράρτημα ΙΙΙ Βιογραφικό Σημείωμα

8 Πρόλογος- Ευχαριστίες Η παρούσα διατριβή εκπονήθηκε στο εργαστήριο Ενόργανης Ανάλυσης του τμήματος Φαρμακευτικής του Πανεπιστημίου Πατρών από το Σεπτέμβριο του 2010 έως το Μάρτιο του 2013 κάτω από την επίβλεψη της κ. Μαλβίνας Όρκουλα. Η ολοκλήρωσή της όμως δεν θα ήταν δυνατή χωρίς τη συνεισφορά κάποιων ανθρώπων που οφείλω να αναφέρω. Καταρχήν θα ήθελα να ευχαριστήσω την κ. Μαλβίνα Όρκουλα για το χρόνο και την προσπάθεια που διέθεσε για τη συνεργασία μας πάνω σε μια εργασία που ουσιαστικά χτίστηκε από το μηδέν. Εκτιμώ τόσο την επιστημονική της καθοδήγηση, όσο και την εμπιστοσύνη που έδειξε στο πρόσωπό μου τα τελευταία τρία χρόνια. Οι συμβουλές της υπήρξαν καίριες σε κάθε μου βήμα και το ανθρώπινο ενδιαφέρον της υπήρξε αδιαμφισβήτητο. Η συνεχής επιμονή, υπομονή αλλά και σκληρή εργασία της για τη διεξαγωγή μιας επιστημονικά άρτιας εργασίας ήταν αυτή που οδήγησε στη διεκπεραίωση της συγκεκριμένης διατριβής. Χωρίς τη συμμετοχή της τίποτα από τα παραπάνω δεν θα ήταν εφικτό. Στη συνέχεια θα ήθελα να ευχαριστήσω το κ. Χρίστο Κοντογιάννη για την πολύτιμη βοήθεια και στήριξή του ως διευθυντής του εργαστηρίου Ενόργανης Ανάλυσης. Η συνεισφορά του στη συγκεκριμένη εργασία ήταν ιδιαιτέρως σημαντική και τον ευχαριστώ για το χρόνο που διέθεσε. Η μακροχρόνια εμπειρία του και οι συμβουλές του αποδείχθηκαν ανεκτίμητες όχι μόνο λόγω του περιεχομένου τους, αλλά και γιατί προέρχονταν από ένα άτομο που συνδυάζει την ιδιότητα του επιστήμονα με αυτή της ακεραιότητας του χαρακτήρα. Θα ήταν παράλειψη να μην εκφράσω τις ευχαριστίες μου και στον κ. Διονύσιο Παπαχρήστου, επίκουρο καθηγητή στο εργαστήριο Ανατομίας του τμήματος Ιατρικής του Πανεπιστημίου Πατρών, τόσο για τη βοήθειά του με την ιστολογική ανάλυση των δειγμάτων, όσο και για τις στοχευμένες επισημάνσεις του στα πλάισια της διατριβής μου. Ευχαριστώ και τον κ. Παναγιώτη Μέγα, καθηγητή ορθοπαιδικής και τραυματολογίας του Ιατρικού τμήματος του Πανεπιστημίου Πατρών, για την πρόσβαση που μου παρείχε στα 8

9 δείγματα οστεοαρθριτικής κεφαλής μηριαίου οστού, απαραίτητα για τη διεκπεραίωση της ερευνητικής μου εργασίας. Πρέπει επίσης να ευχαριστήσω το Πρόγραμμα Βασικής Έρευνας του Πανεπιστημίου Πατρών Κ. Καραθεοδωρή (Κωδικός Έργου: C.914) για τη σημαντική οικονομική ενίσχυση που μου παρείχε κατά τη διάρκεια των μεταπτυχιακών σπουδών μου. Ένα τεράστιο ευχαριστώ θα ήθελα επίσης να απευθύνω σε όλα τα παιδιά από το εργαστήριο Ενόργανης Ανάλυσης και κυρίως στους Γιάννη, Σοφία, Ελένη, Γιούλη και Γωγώ, τους οποίους γνώρισα ως συναδέλφους και αποχαιρέτησα ως φίλους. Τους ευχαριστώ για την κάθε ημέρα που ήταν δίπλα μου εντός και εκτός εργαστηρίου και πάντα γεμάτοι υπομονή, ενθουσιασμό αλλά και πλήρη υποστήριξη. Ο καθένας με το δικό του τρόπο έκανε αυτό το ταξίδι να μοιάζει λιγότερο κουραστικό και σίγουρα περισσότερο διασκεδαστικό. Τους εκτιμώ ιδιαίτερα ως συνεργάτες αλλά και ως ανθρώπους. Θα ήθελα επίσης να ευχαριστήσω τους Γιάννη, Ελένη, Αργύρη, Δήμητρα, Βασίλη και άλλα άτομα που δεν ανήκουν στο άμεσο εργασιακό μου περιβάλλον, αλλά που ήταν δίπλα μου όλα αυτά τα χρόνια με την πλήρη υποστήριξή τους για αυτό που κάνω, γεγονός που το εκτιμώ βαθύτατα. Τέλος, οφείλω ένα πολύ μεγάλο ευχαριστώ στην οικογένειά μου. Τους ευχαριστώ για την αδιάκοπη και γενναιόδωρη στήριξη, υπομονή και ανοχή τους, με τον κάθε δυνατό τρόπο, όλα αυτά τα χρόνια. Χωρίς αυτούς τίποτα από όλα αυτά δεν θα ήταν εφικτό για μένα. Η αγάπη μου γι αυτούς είναι και θα είναι πάντα δεδομένη. Βαρδάκη Μάρθα Φαρμακοποιός 9

10 Περίληψη Η οστεοαρθρίτιδα αποτελεί μια συχνά εμφανιζόμενη εκφυλιστική ασθένεια. Εντοπίζεται κυρίως στις μεγάλες αρθρώσεις (πχ ισχύο και γόνατο) και χαρακτηρίζεται από προοδευτική φθορά του αρθρικού χόνδρου. Στην παρούσα εργασία έγινε χαρτογράφηση του υγιούς και του οστεοαρθριτικού τμήματος ανθρώπινης κεφαλής μηριαίου οστού η οποία αφαιρέθηκε κατά τη διάρκεια αρθροπλαστικής επέμβασης. Η τεχνική που χρησιμοποιήθηκε ήταν η φασματοσκοπία micro-raman η οποία παρέχει πληροφορίες που αφορούν στις δονήσεις μορίων. Συγκεκριμένα έγινε δυνατή η ανάπτυξη μεθοδολογίας για τη διαφοροποίηση κολλαγόνου Ι (οστό) και κολλαγόνου ΙΙ (χόνδρος) εξετάζοντας τις φασματικές περιοχές της προλίνης και υδροξυπρολίνης, κάμψεων CH 2, CH 3 και των αμιδίων Ι και ΙΙΙ. Επίσης η μελέτη των δονήσεων των φωσφορικών ιόντων και των ανθρακικών υποκατασταστατών τους έκανε δυνατή τη διαφοροποίηση του βιοαπατίτη του οστού από τον ασβεστοποιημένο χόνδρο. Η ανάλυση των δεδομένων έδειξε την απουσία αρθρικού χόνδρου στο κέντρο της κεφαλής, που υφίσταται το μέγιστο φορτίο, και την πλήρη αποκάλυψη του υποχόνδρινου οστού. Την εικόνα αυτή διαδέχονται, καθώς κινούμαστε περιμετρικά προς τα άκρα, περιοχές όπου κυριαρχεί ασβεστοποιημένος χόνδρος ή και συνύπαρξη οστού και χόνδρου σαν ένα ενδιάμεσο στάδιο οστεοαρθρίτιδας. Υγιείς περιοχές με εμφανές στρώμα αρθρικού χόνδρου δεν εντοπίζονται παρά μόνο πολύ μακριά από το κέντρο της κεφαλής του μηριαίου οστού. Η χαρτογράφηση περιοχών εσωτερικά, στην επιφάνεια μιας τομής, έδειξε μια σχετικά απότομη μετάβαση από το χόνδρο στο υποχόνδρινο οστό στις υγιείς περιοχές, εικόνα που συνάδει με τα όσα είναι γνωστά για τη δομή της άρθρωσης. Αντίθετα, οι οστεοαρθριτικές περιοχές χαρακτηρίζονταν από την απουσία των φασματικών περιοχών του κολλαγόνου τύπου ΙΙ (χόνδρος) στα εξωτερικά στρώματα αλλά και τη συνύπαρξη των δύο τύπων κολλαγόνου Ι και ΙΙ (οστού και χόνδρου) ή την παρουσία ασβεστοποιημένου κολλαγόνου ΙΙ σε διαδοχικές ζώνες και σε βάθος αρκετών χιλιοστών σε αρκετές περιπτώσεις προς το εσωτερικό της τομής. 10

11 Τα φασματοσκοπικά αποτελέσματα, τέλος, επιβεβαιώθηκαν από ιστολογική εξέταση με χρώση safranin O της κάθε χαρτογραφημένης περιοχής στην εξεταζόμενη τομή οστεοαρθριτικής κεφαλής μηριαίου οστού. 11

12 Abstract Osteoarthritis is a very common degenerative disease, characterized by gradual degeneration of the articular cartilage and mainly affecting knees and hip joints. In the present work, a human osteoarthritic femoral head, removed during replacement surgery, was used for the mapping of its healthy and osteoarthritic areas. Laser Raman microscopy, a technique that provides information on molecules vibrations, was employed for the study. The development of a methodology for the distinction between collagen I (bone) and collagen II (cartilage) was accomplished through the study of proline, hydroxyproline, CH 2, CH 3 bending and amide I and III bands. On the other hand, the study of phosphate and carbonate substituents made the distinction between bone bioapatite and calcified cartilage feasible. Data analysis revealed the absence of articular cartilage and the full exposure of subchondral bone in the middle of the outer surface of femoral head section, where maximum friction due to movement is observed. Moving perimetrically from the middle of the outer surface to the rims of the section, areas of calcified cartilage and coexistence of bone and cartilage are observed, possibly as an intermediate disease stage. Healthy areas with distinct layer of articular cartilage are located only on the extreme rims of the section. Mapping of areas in depth of the femoral head section, revealed a relatively abrupt transition from cartilage to subchondral bone in healthy areas, which is consistent with our knowledge about joint structure. On the contrary, osteoarthritic areas were characterized by the absence of collagen II (cartilage) characteristic bands on the outer layers and in the same time by the coexistence of collagen I and II (bone and cartilage) or the presence of calcified collagen II through successive layers in some millimeters depth towards the interior of the femoral head section. Finally, spectroscopic results were confirmed by histological examination and Safranin O histochemical staining of each area mapped of the human femoral head section. 12

13 ΚΕΦΑΛΑΙΟ 1 ΦΥΣΙΟΛΟΓΙΑ ΑΡΘΡΩΣΕΩΝ 1.1 Εισαγωγή Οι αρθρώσεις αποτελούν σημαντικά στοιχεία του ανθρώπινου σκελετού και σχηματίζονται στα σημεία όπου οι επιφάνειες δύο ή περισσότερων οστών έρχονται σε επαφή μεταξύ τους. Εξυπηρετούν την κίνηση και την ευκαμψία του ανθρώπινου σώματος, ενώ το εύρος της κίνησης μεταξύ των συνδεόμενων οστών καθορίζει τη λειτουργία και το ρόλο της άρθρωσης. Για παράδειγμα, σε αρθρώσεις όπως αυτές του κρανίου δεν επιτρέπεται καμία κινητικότητα, ενώ σε άλλες όπως αυτές των άκρων υπάρχει μεγάλη ελευθερία κίνησης. Στην επίτευξη της κίνησης, της στήριξης και της ευκαμψίας που προσφέρουν οι αρθρώσεις στους οργανισμούς, συνεισφέρει ο συνδιασμός δύο τύπων συνδετικού ιστού στην περιοχή της άρθρωσης: του χόνδρου και του οστού. Καθένας από αυτούς διαθέτει σημαντικές λειτουργίες οι οποίες συντελούν μεταξύ άλλων και στη φυσιολογική λειτουργία των αρθρώσεων. Τα οστά είναι υπεύθυνα, μεταξύ άλλων, για την κίνηση, αφού μαζί με τους σκελετικούς μύες, τους τένοντες, τους συνδέσμους και τις αρθρώσεις λειτουργούν ομαδικά για να παράγουν και να διαβιβάσουν δυνάμεις. Έτσι, γίνεται δυνατή η κίνηση στο χώρο για τα επιμέρους μέρη ή και για ολόκληρο το σώμα. Μία ακόμα σημαντική λειτουργία των οστών είναι ότι προστατεύουν και υποστηρίζουν τα πολυάριθμα όργανα που υπάρχουν στον ανθρώπινο οργανισμό. Με τον τρόπο αυτό το κρανίο προστατεύει τον εγκέφαλο, ενώ τα πλευρά προστατεύουν τους πνεύμονες και την καρδιά. Ο χόνδρος από την άλλη μεριά, εξασφαλίζει προστασία στα μηχανικά φορτία που ασκούνται στην άρθρωση, και επιπλεόν εξασφαλίζει τη μεταφορά και κατανομή φορτίων καθώς και στην ελαχιστοποίηση της τριβής μεταξύ των αρθρικών επιφανειών. Η θέση του στο ανθρώπινο σώμα είναι πολύ σημαντική. Συγκεκριμένα, περιβάλλει τα άκρα των οστών των αρθρώσεων, τα οποία για το λόγο αυτό δεν έρχονται σε άμεση επαφή μεταξύ 13

14 τους. Η θέση του αυτή εξυπηρετεί όχι μόνο στην απορρόφηση των κραδασμών κατά την κίνηση, αλλά και στην προστασία των οστών της άρθρωσης από τη φθορά. Παρακάτω θα περιγραφούν τόσο ο ρόλος και η δομή των αρθρώσεων, όσο και αυτός του οστού και του χόνδρου που αποτελούν τις κύριες δομικές μονάδες τους. 1.2 Αρθρώσεις Στο ανθρώπινο σώμα υπάρχουν περίπου 400 διαφορετικές αρθρώσεις οι οποίες κατηγοριοποιούνται ανάλογα με τη λειτουργία τους (εύρος κίνησης) ή τη δομή τους. Ως προς τη λειτουργία τους, οι αρθρώσεις μπορούν να διακριθούν σε: α) αρθρώσεις με μηδαμινό εύρος κίνησης- τα οστά συγκρατούνται μεταξύ τους με ινώδη ιστό έτσι ώστε να είναι πλήρως ακίνητα (πχ. οστά κρανίου) β) αρθρώσεις με μικρό εύρος κίνησης- τα οστά συγκρατούνται μεταξύ τους με τη βοήθεια χόνδρου ο οποίος επιτρέπει κίνηση σε μικρό βαθμό (πχ. σπόνδυλοι) γ) αρθρώσεις με μεγάλο εύρος κίνησης- επιτρέπουν τη μεγαλύτερη ελευθερία κίνησης (πχ. αρθρώσεις ισχίου και γονάτου) Οι αρθρώσεις αποτελούνται τις εξής ανατομικές δομές: σύνδεσμος, αρθρικος θύλακας, περιόστεο, οστό, αρθρικός χόνδρος, αρθρικός υμένας, αρθρική κοιλότητα. Η δομή μιας τυπικής άρθρωσης φαίνεται στην παρακάτω εικόνα. 14

15 Εικόνα 1.1: Η τυπική δομή μιας άρθρωσης. Το περιόστεο αποτελείται από πυκνό συνδετικό ιστό και περιβάλλει το οστό στα σημεία όπου απουσιάζει ο αρθρικός χόνδρος. O αρθρικός υμένας είναι ένας χαλαρός συνδετικός ιστός ο οποίος περιβάλλει εσωτερικά την κοιλότητα της άρθρωσης και του αρθρικού θύλακα ενώ είναι παράλληλα υπεύθυνος για την παραγωγή του αρθρικού υγρού και την παγίδευσή του μέσα στην αρθρική κοιλότητα. Το αρθρικό υγρό είναι ένα φυσιολογικά διαυγές, άχρωμο, ινώδες και ιδιαίτερα παχύρευστο υγρό, εξού και το όνομά του (syn ovium> με αυγό). Βρίσκεται στο εσωτερικό της αρθρικής κοιλότητας, αποτελείται κυρίως από υαλουρονικό οξύ και νερό αλλά και μεγάλου μoριακού βάρους αλυσίδες γλυκοζαμινογλυκανών. Το αρθρικό υγρό είναι υπεύθυνο για τη λίπανση της άρθρωσης, τη μεταφορά θρεπτικών συστατικών, την απομάκρυνση μεταβολικών προϊόντων αλλά και μικροβίων. 15

16 Οι αρθρικοί θύλακες είναι κυστοειδείς δομές που υπάρχουν σε ορισμένες αρθρώσεις. Η λειτουργία τους συνοψίζεται στη μείωση της μηχανικής τριβής μεταξύ δύο γειτονικών δομών (πχ. οστό και σύνδεσμος) κατά την κίνηση. Οι δομές του υποχόνδρινου οστού και του αρθρικού χόνδρου θα αναφερθούν πολύ αναλυτικότερα στη συνέχεια του κεφαλαίου. Οι σύνδεσμοι αποτελούνται από πυκνό συνδετικό ιστό και συνδέουν τα οστά μεταξύ τους, βοηθώντας στη σταθεροποίηση της άρθρωσης. Σύνδεσμοι, μυς και τένοντες εξασφαλίζουν τη σταθερότητα της άρθρωσης Άρθρωση ισχίου Μία από τις σημαντικότερες αρθρώσεις του ανθρώπινου σώματος είναι η άρθρωση ισχίου στην οποία το μηριαίο οστό συντάσσεται με τα τρία οστά που συνιστούν την πύελο: το λαγόνιο, το ισχιακό και το ηβικό οστό. Συγκεκριμένα, το μηριαίο οστό αρθρώνεται με την κοτύλη του οστού της λεκάνης για να σχηματίσει την άρθρωση ισχίου, όπως φαίνεται στην εικόνα παρακάτω. 16

17 Εικόνα 1.2: Σχηματική αναπαράσταση της άρθρωσης του ισχίου. Το μηριαίο οστό αποτελεί το ισχυρότερο και το μεγαλύτερο σε μήκος οστό του σκελετού του ανθρώπινου σώματος. Στην όρθια στάση δεν είναι εντελώς κάθετο αλλά αποκτά σταδιακά μία κλίση προς το κατώτερο μέρος του, έτσι ώστε να προσεγγίζει το δεύτερο μηριαίο οστό του σκελετού στο κατώτερο σημείο του. Ο βαθμός της κλίσης αυτής ποικίλλει σε διαφορετικά άτομα και είναι μεγαλύτερη στις γυναίκες παρά στους άντρες λόγω του μεγαλύτερου πλάτους λεκάνης. Το μηριαίο οστό όπως και τα υπόλοιπα επιμήκη οστά διαχωρίζεται στο κυρίως σώμα και στα δύο άκρα. Στο άνω πέρας του μηριαίου οστού υπάρχει η κεφαλή (caput femoris), ο αυχένας (collum femoris), ο μείζων και ο ελάσσσων τροχαντήρας (trochanter major and minor). Παράλληλα, η δομή του οστού δεν είναι ομοιόμορφη σε όλες τις περιοχές του μηριαίου οστού, αφού αλλού παρουσιάζεται συμπαγής και αλλού σπογγώδης δομή, όπως φαίνεται και στην εικόνα παρακάτω. 17

18 Εικόνα 1.3: Ορισμένα από τα ανατομικά χαρακτηριστικά του μηριαίου οστού. Η κεφαλή του μηριαίου οστού είναι αυτή η οποία αρθρώνεται με την κοτύλη του οστού της λεκάνης στην άρθρωση του ισχίου. Έχει σχήμα σφαιρικό και σχηματίζει πολύ περισσότερα από ένα απλό ημισφαίριο. Η επιφάνειά της είναι λεία και καλύπτεται ολόκληρη από χόνδρο στη φυσιολογική της κατάσταση, εκτός από ένα ωοειδές βαθούλωμα, το βόθρο της κεφαλής (fovea capitis femoris). 18

19 Εικόνα 1.4: Άνω άκρο του δεξί μηριαίου οστού σε άποψη από πίσω προς τα εμπρός. Ο αρθρικός χόνδρος διατηρείται ολισθηρός λόγω των χημικών/ιστολογικών χαρακτηριστικών του αλλά και εξαιτίας του αρθρικού υγρού που παράγεται από την αρθρική μεμβράνη, όπως έχει ήδη αναφερθεί. 1.3 Οστό Γενικότερες λειτουργίες οστού Τα οστά είναι κάποια από τα πιο σημαντικά στοιχεία μιας άρθρωσης. Το ανθρώπινο σκελετικό σύστημα αποτελείται από 206 οστά τα οποία επιτελούν πολυάριθμες ζωτικές για τον ανθρώπινο οργανισμό λειτουργίες. Τα οστά είναι υπεύθυνα για την υποστήριξη των ιστών και των μυών, καθώς είναι τα μόνα άκαμπτα υλικά που υπάρχουν στο σώμα. Είναι αυτά τα οποία δίνουν σχήμα στο σώμα και παρέχουν σημεία σύνδεσης για διάφορους μαλακούς ιστούς του οργανισμού. 19

20 Επιπλέον, τα οστά προσφέρουν προστασία στους πιο ζωτικούς ιστούς και στα πιο λειτουργικά όργανα του ανθρώπινου σώματος. Με αυτό τον τρόπο, το κρανίο προστατεύει τον εγκέφαλο, οι σπόνδυλοι προστατεύουν το νωτιαίο μυελό, η πύελος τα αναπαραγωγικά όργανα, ενώ ο θωρακικός κλωβός την καρδιά και τους πνεύμονες. Ένας από τους πιο σημαντικούς ρόλους των οστών και η εξασφάλιση της κίνησης του σώματος. Είναι γνωστό ότι τα οστά λειτουργούν ως μοχλοί και υπομόχλια κατά την κίνηση και παρέχουν θέσεις πρόσφυσης για τους μυς. Με τη βοήθεια των μυών, των αρθρώσεων αλλά και τη συμμετοχή των οστών σε αυτές επιτυγχάνεται η κίνηση του ανθρώπινου σώματος. Τα οστά όμως εκτός από το μηχανικό ρόλο που έχουν αναλάβει στην υποστήριξη της κίνησης, επιτελούν και άλλες εξίσου σημαντικές λειτουργίες στον ανθρώπινο οργανισμό, όπως αυτή της διαδικασίας της αιμοποίησης μέσω του μυελού των οστών [1], της αποθήκευσης σημαντικών στοιχείων (ανόργανων συστατικών, αυξητικών παραγόντων, κλπ) για τον οργανισμό, της ενδοκρινικής ρύθμισης της ινσουλίνης [2], του ελέγχου του μεταβολισμού φωσφόρου και οστεοκαλσίνης, καθώς και ενός βοηθητικού ρόλου στη διατήρηση της οξεοβασικής ισορροπίας του αίματος. Τέλος, πρέπει να σημειωθεί ο ρόλος των οστών ως ένας από τους σημαντικότερους μηχανοϋποδοχείς του ανθρώπινου σώματος Χημική σύσταση οστού Το οστό ως προς τη σύστασή του αποτελείται από το οργανικό και το ανόργανο τμήμα. Το ζωντανό οστό περιέχει 10-20% κ.ό. νερό. Από την ξηρή μάζα που απομένει περίπου το 60-70% κ.ό. είναι ανόργανη φάση ενώ το υπόλοιπο 20-30% κ.ό. αποτελεί την οργανική. Παρόλο που η περιεκτικότητα του οστού σε νερό είναι μικρότερη σε σχέση με την υπόλοιπη μάζα του, η σημαντικότητά του δεν πρέπει να υποτιμάται επειδή συνεισφέρει στη συνολική αντοχή του οστού [3]. 20

21 Ανόργανο τμήμα οστού Ο βασικός δομικός λίθος της ανόργανης φάσης του οστού είναι ένα μη στοιχειομετρικό χημικό και δομικό ανάλογο του υδροξυαπατίτη (HA), ενός από τα μέλη της μεγάλης οικογένειας των απατιτών, το οποίο oνομάζεται βιοαπατίτης (BAP). Ο βιοαπατίτης παρόλο που έχει γενικό χημικό τύπο Ca 10 (PO 4 ) 6 (OH) 2, δεν βρίσκεται πάντα στο οστό υπό τη μορφή αυτή καθώς είναι πολύ συνήθεις οι αντικαταστάσεις που λαμβάνουν χώρα στο μόριό του. Αυτές περιλαμβάνουν συνήθως αντικατάσταση της ομάδας των φωσφορικών ιόντων (PO 3-4 ) με ανθρακικά ιόντα (CO 2-3 ) και την ομάδα των υδροξυλίων (ΟΗ - ) με ανιόντα φθορίου ή χλωρίου. Η μη σταθερή δομή του βιοαπατίτη καθιστά δύσκολη την ταυτοποίηση της χημικής του δομής. Ο βιοαπατίτης μπορεί να θεωρηθεί ότι αποτελεί εξ ολοκλήρου το ανόργανο τμήμα του οστού, ενώ γνωρίζουμε πια ότι υπάρχει σε αυτό υπό τη μορφή κρυστάλλων. Οι κρύσταλλοι του βιοαπατίτη έχουν πεπλατυσμένο σχήμα, το πάχος τους είναι εξαιρετικά μικρό ενώ η διάμετρός τους κυμαίνεται μεταξύ 30 και 200nm με βάση μετρήσεις μικροσκοπίου ατομικών δυνάμεων [4]. Εικόνα 1.5: Δομή κρυστάλλου υδροξυαπατίτη 21

22 Οργανικό τμήμα οστού Το οργανικό τμήμα του οστού σχηματίζεται από ίνες κολλαγόνου τύπου Ι σε ποσοστό 98% ενώ το υπόλοιπο 2% αποτελείται από κύτταρα (οστεοβλάστες, οστεοκλάστες και οστεοκύτταρα) και μυελό καθώς και από μη κολλαγονούχες πρωτεΐνες. Έχει εξακριβωθεί η παρουσία περισσότερων από διακόσιες μη κολλαγονούχες πρωτεΐνες (NCPs) (όπως η οστεοκαλσίνη) [5, 6]. Οι συγκεκριμένες πρωτεϊνες μπορεί να είναι λιγότερο σημαντικές για τις μηχανικές ιδιότητες του οστού αλλά είναι ζωτικής σημασίας για το σχηματισμό και τη δομή του. Η οικογένεια του κολλαγόνου και οι διαφορετικοί τύποι κολλαγόνου Το κολλαγόνο, το οποίο θα μας απασχολήσει σε μεγάλο βαθμό στη συνέχεια, είναι η πιο άφθονη πρωτεΐνη στο ζωϊκό βασίλειο και ένα από τα βασικότερα συστατικά τόσο του οστού όσο και του χόνδρου. Αποτελεί το ένα τρίτο των πρωτεϊνών του ανθρώπινου οργανισμού και είναι η μεγαλύτερη οικογένεια πρωτεϊνών του συνδετικού ιστού και της εξωκυττάριας ουσίας. Η οικογένεια του κολλαγόνου έχει πολυάριθμες φυσιολογικές λειτουργίες και περιλαμβάνει 28 διαφορετικούς τύπους κολλαγόνων στον άνθρωπο oι οποίοι συντίθενται από 46 διαφορετικές πολυπεπτιδικές αλυσίδες [7, 8]. Οι τύποι που συναντώνται συχνότερα είναι το κολλαγόνο τύπου Ι, ΙΙ και ΙΙΙ οι οποίοι κυριαρχούν επί του συνόλου σε ποσοστό 80-90%, με το κολλαγόνου τύπου Ι να αποτελεί την πιο άφθονη πρωτείνη στο σώμα [9]. Οι διαφορετικοί αυτοί τύποι κολλαγόνου πραγματοποιούν εξειδικευμένες λειτουργίες σε διάφορους ιστούς και διαθέτουν διαφορετικούς τρόπους οργάνωσης. Η τριπλή έλικα του κολλαγόνου Παρά τη μεγάλη δομική ποικιλομορφία που υπάρχει ανάμεσα στους διαφορετικούς τύπους κολλαγόνου, όλα τα μέλη της οικογένειας κολλαγόνου έχουν ένα κοινό χαρακτηριστικό: η βασική τους δομική μονάδα είναι μία τριπλή δεξιόστροφη έλικα, η οποία αποτελείται από τρεις πολυπεπτιδικές α-αλυσίδες. Αυτή μπορεί να αποτελείται από τρεις όμοιες αλυσίδες (ομοτριμερή) όπως στα κολλαγόνα τύπου II, III, VII, VIII και X ή 22

23 από δύο ή τρεις ευδιάκριτους τύπους αλυσίδων (ετεροτριμερή) όπως στα κολλαγόνα τύπου Ι, IV, V, VI, IX και XI [10]. Τόσο η τριπλή έλικα του κολλαγόνου όσο και η δομική της μονάδα (α-έλικα), φαίνονται στις παρακάτω εικόνες. Εικόνα 1.6: Μοντέλο α-έλικας κολλαγόνου 23

24 Εικόνα 1.7: Η τριπλή έλικα του κολλαγόνου. Η τριπλή έλικα του κολλαγόνου έχει μήκος 300nm και διάμετρο 1.5nm ενώ οι τρεις α- αλυσίδες από τις οποίες αποτελείται, βρίσκονται δεξιοστρόφως υπερελικομένες γύρω από έναν κεντρικό άξονα ώστε να σχηματίζεται μία τριπλή έλικα. Κάθε μία από τις τρεις α-αλυσίδες σχηματίζει από μόνη της μια αριστερόστροφη έλικα με βήμα 18 αμινοξέων ανά στροφή [11], ενώ αποτελείται από περίπου 1050 αμινοξέα. Μία δομική προϋπόθεση για τη συναρμολόγηση της τριπλής έλικας του κολλαγόνου αποτελεί η ύπαρξη της γλυκίνης, του μικρότερου αμινοξέος, σε κάθε τρίτη θέση των πολυπεπτιδικών α-αλυσίδων. Ο λόγος της μεγάλης συχνότητας παρουσίας της γλυκίνης στην αλληλουχία των αμινοξέων είναι ότι η πλευρική ομάδα της γλυκίνης διαθέτει ένα άτομο υδρογόνου το οποίο είναι το μόνο που μπορεί να χωρέσει στο κέντρο της τριπλής έλικας του κολλαγόνου. Έτσι, οι α-αλυσίδες συναθροίζονται γύρω από τον κεντρικό άξονα της τριπλής έλικας με τέτοιο τρόπο ώστε όλα τα αμινοξέα της γλυκίνης να βρίσκονται 24

25 τοποθετημένα στο κέντρο της τριπλής έλικας. Αντίθετα, τα υπόλοιπα αμινοξέα με τις περισσότερο ογκώδεις πλευρικές ομάδες καταλαμβάνουν τις εξωτερικές θέσεις. Ως αποτέλεσμα μπορούμε να διαπιστώσουμε την ύπαρξη της επαναλαμβανόμενης αλληλουχίας (Gly-X-Y)(n) στην πολυπεπτιδική αλυσίδα, με τις θέσεις X και Y να καταλαμβάνονται συχνά από τα αμινοξέα της προλίνης και της υδροξυπρολίνης. Έτσι, το ίδιο το κολλαγόνο συχνά χαρακτηρίζεται από το τριπεπτίδιο Gly-Pro-Hyp [12] με τη γλυκίνη να αποτελεί το ένα τρίτο όλων των αμινοξέων του μορίου [13]. Πρέπει να σημειωθεί ότι το επαναλαμβανόμενο μοτίβο Gly-Pro-Hyp κυριαρχεί στους συνηθέστερους τύπους κολλαγόνου που σχετίζονται με το σχηματισμό ινιδίων (κολλαγόνο τύπου Ι, ΙΙ, ΙΙΙ). Καθένας από τους υπόλοιπους τύπους κολλαγόνου μπορεί να έχει διαφορετική οργάνωση και αλληλουχία αμινοξέων. Για τη σταθεροποίηση της τριπλής έλικας του κολλαγόνου στο χώρο, υπεύθυνοι είναι οι δεσμοί υδρογόνου οι οποίοι συνδέουν τον πεπτιδικό δεσμό ΝΗ μίας γλυκίνης με μία πεπτιδική καρβονυλική ομάδα σε ένα γειτονικό πολυπεπτίδιο και βοηθούν στη συγκράτηση των τριών αλυσίδων μαζί. Το περιεχόμενο της έλικας σε 4-υδροξυπρολίνη θεωρείται σημαντικό για το σχηματισμό ενδομοριακών δεσμών υδρογόνου και για τη σταθερότητα του σχηματισμού της τριπλής έλικας. Για το λόγο αυτό συχνά όταν το αμινοξύ της προλίνης ενσωματωθεί στη θέση Y στην αλυσίδα του κολλαγόνου υφίσταται κάποια μετα-μεταφραστική τροποποίηση και μετατρέπεται σε υδροξυπρολίνη, η παρουσία της οποίας σταθεροποιεί ακόμα περισσότερο την τριπλή έλικα [14]. Εκτός όμως από τους δεσμούς αυτούς τα μόρια του νερού φαίνεται να αλληλεπιδρούν με τις πλευρικές ομάδες των αμινοξέων της έλικας, δημιουργώντας δεσμούς υδρογόνου ανάμεσα σε πολικές πλευρικές και πλευρικές ομάδες και τον κορμό της έλικας [15]. Η σταθερή γωνία του δεσμού C-N της προλίνης ή της υδροξυ-προλίνης δίνει τη δυνατότητα σε καθεμία πολυπεπτιδική αλυσίδα να αναδιπλώνεται μέσα στην έλικα έτσι ώστε και οι τρεις αλυσίδες να περιστρέφονται ταυτόχρονα για να σχηματίσουν την τριπλή έλικα. Ταυτόχρονα, η απόσταση των 14Å που υπάρχει ανάμεσα στις τρεις αλυσίδες της έλικας πληρούται με μόρια νερού. 25

26 Η τριπλή έλικα που σχηματίζεται τελικά στο μόριο του κολλαγόνου μπορεί να πάρει τη μορφή μιας ευθείας ή λυγισμένης ράβδου ενώ παράλληλα έχει την ιδιότητα να προσκολλάται σε διάφορες υπερμοριακές δομές και να προσδένεται σε μόρια όπως υποκαταστάτες, υποδοχείς, πρωτεάσες, πρωτεϊνες της εξωκυττάριας ουσίας, γλυκοζαμινογλυκάνες (GAGs), νουκλεϊκά οξέα και λίπίδια. Έτσι, η τριτοταγής δομή του κολλαγόνου είναι πολύ σημαντική για κυτταρικές λειτουργίες όπως η προσκόλληση και η ενεργοποίηση της εξωκυττάριας μήτρας αλλά και για ενζυματικές λειτουργίες όπως η υδροξυλίωση των αμινοξέων λυσίνης και προλίνης του κολλαγόνου [16]. Βιοσύνθεση κολλαγόνου Η βιοσύνθεση του κολλαγόνου αρχίζει με τη μεταγραφή των γονιδίων στο εσωτερικό του πυρήνα και συνεχίζεται με τη μετάφραση του αντίστοιχου mrna σε μόρια προπροκολλαγόνου τα οποία στη συνέχεια υπόκεινται σε διάφορες μετα-μεταφραστικές τροποποιήσεις, όπως υδροξυλίωση προλινών και λυσινών. Στις μετα-μεταφραστικές τροποποιήσεις που συμβαίνουν συμμετέχουν 8 διαφορετικά μετα-μεταφραστικά ενώ είναι απαραίτητη και η παρουσία βιταμίνης C [17]. Από τις παραπάνω τροποποιήσεις προκύπτουν οι τρεις α-αλυσίδες του προκολλαγόνου. Ακολουθεί ο σχηματισμός της τριπλής έλικας, ο οποίος επιτυγχάνεται με την ευθυγράμμιση των C-τελικών άκρων των τριών α-αλυσίδων και στη συνέχεια των Ν- τελικών άκρων τους. Μετά το σχηματισμό των μορίων της τριπλής έλικας, αυτά πακετάρονται στο σύστημα Golgi σε κυστίδια και εκκρίνονται στην εξωκυττάρια ουσία. Τα τριμερή του προκολλαγόνου υφίστανται την κατάλληλη επεξεργασία ανάλογα με τον τύπο του κολλαγόνου. Τα άκρα των προπεπτιδίων αποκόπτονται με τη βοήθεια δύο ειδικών πρωτεασών. Στη συνέχεια, κάτω από την επίδραση υδροφοβικών και ηλεκτροστατικών αλληλεπιδράσεων, τα μονομερή του κολλαγόνου (μικροϊνίδια) συναθροίζονται αυθόρμητα σε ινίδια μεγαλύτερου μεγέθους. 26

27 Εικόνα 1.8: Βιοσύνθεση κολλαγόνου που συμμετέχει στο σχηματισμό ινιδίων Oι σταυροδεσμοί της τριπλής έλικας του κολλαγόνου Όπως η τριπλή έλικα σταθεροποιείται με τους δεσμούς υδρογόνου που αναπτύσσονται ανάμεσα στα αμινοξέα της, έτσι και τα ινίδια του κολλαγόνου σταθεροποιούνται με το σχηματισμό δεσμών μεταξύ των μονομερών του κολλαγόνου (μικροϊνίδια). Οι δεσμοί αυτοί ονομάζονται σταυροδεσμοί και εντοπίστηκαν για πρώτη φορά από τον J.P. Orgel και τους συνεργάτες του οι οποίοι ανακάλυψαν ότι τα γειτονικά τελοπεπτίδια μέσα σε ένα μονομερές κολλαγόνου συνδέονται ομοιοπολικά με σταυροδεσμούς για να σχηματίσουν ινίδια κολλαγόνου [18]. Ο ενδομοριακός σχηματισμός των σταυροδεσμών του κολλαγόνου δρομολογείται από την ενζυματική οξειδωτική απαμίνωση των ε-αμινομάδων σε συγκεκριμένους πεπτιδικούς δεσμούς αμινοξέων λυσίνης/ υδροξυπρολίνης στις περιοχές τελοπεπτιδίων του μορίου. Έτσι, οι αντιδραστικές αλδεϋδες που παράγονται (Lys ald ή Hyl ald ) υπόκεινται σε μία σειρά 27

28 αντιδράσεων συμπύκνωσης για να σχηματίσουν δισθενείς (πχ. DHLNL), τρισθενείς (πχ. Pyr) και τετρασθενείς σταυροδεσμούς περιλαμβάνοντας την τοποθέτηση αμινοξέων της λυσίνης, υδροξυλυσίνης ή ιστιδίνης σε γειτονικά μόρια [19, 20]. Οι πλευρικές αλληλεπιδράσεις των ελίκων του κολλαγόνου σταθεροποιούνται μέσω ενός σταυροδεσμού ανάμεσα σε δύο αμινοξέα των πλευρικών ομάδων. Οι σταυροδεσμοί μπορεί να έχουν αναπτυχθεί μέσα στο ίδιο μικροϊνίδιο ή ανάμεσα σε διαφορετικά. Η ανάπτυξη σταυροδεσμών προσδίδει στα ινίδια του κολλαγόνου δύναμη και σταθερότητα αλλά μέχρι ένα συγκεκριμένο επίπεδο. Σχηματισμός σταυροδεσμών σε υπερβολικό βαθμό οδηγεί σε εύθραυστες ίνες κολλαγόνου [21] και αποτελεί χαρατηριστικό της γήρανσης. Εικόνα 1.9: Το εξωκυττάριο ένζυμο της λυσιλικής οξειδάσης καταλύει το σχηματισμό αλδεϋδομάδων. 28

29 Η δημιουργία των μοριακών σταυροδεσμών είναι μια προϋπόθεση για τη διατήρηση των φυσικών και μηχανικών ιδιοτήτων των ινιδίων του κολλαγόνου και του σχηματισμού ενός σταθερού δικτύου κολλαγόνου. Το κολλαγόνο στα οστά Οι τύποι κολλαγόνου που υπάρχουν στα οστά είναι το κολλαγόνο τύπου Ι και V, με κατά πολύ επικρατέστερο το κολλαγόνο τύπου Ι. Και οι δύο αυτοί τύποι σχετίζονται με το σχηματισμό ινιδίων. H τριπλή έλικα στο κολλαγόνο τύπου Ι σχηματίζεται από δύο πολυπεπτιδικές αλυσίδες μία τύπου α 1 και μία τύπου α 2. Αντίθετα, το κολλαγόνο τύπου V σχηματίζεται από τρεις διαφορετικές α αλυσίδες, α 1, α 2 και α 3. Ο ρόλος του κολλαγόνου τύπου Ι στο οστό θα αναλυθεί εκτενώς παρακάτω, ενώ αυτός του κολλαγόνου τύπου V δεν είναι ακόμα αρκετά καλά διευκρινισμένος. Είναι πάντως γνωστό από τη βιβλιογραφία μέχρι σήμερα ότι η αλληλεπίδραση των δύο τύπων καθορίζει τη διάμετρο των ινιδίων κολλαγόνου κατά το σχηματισμό τους [22] συνεισφέροντας έτσι στη διαμόρφωση του δομικού σκελετού του οστού. Τα μόρια κολλαγόνου τύπου Ι σχηματίζουν ινίδια κολλαγόνου στην εξωκυττάρια μήτρα τα οποία με τη σειρά τους δομούν το οστό και όλους τους υπόλοιπους ιστούς ινώδους μορφής, εκτός από το χόνδρο. Τα ινίδια που σχηματίζονται έχουν 300nm μήκος και 67nm διάμετρο [23]. Η διαμόρφωσή τους στο χώρο περιλαμβάνει την κατά μήκος τοποθέτηση του ενός δίπλα στο άλλο σε απόσταση 67nm και το σχηματισμό μιας σχεδόν εξαγωνικής μονάδας με διάμετρο nm. Τα μονομερή του κολλαγόνου Ι, όπως έχει αναφερθεί και παραπάνω για την ευρύτερη οικογένεια του κολλαγόνου, πακετάρονται με τέτοιο τρόπο ώστε να σχηματίζονται υπερελικομένα, δεξιόστροφα μικροϊνίδια τα οποία αλληλεπιδρούν μεταξύ τους οδηγώντας στη δημιουργία της σπειροειδούς δομής της ώριμης ίνας του κολλαγόνου [24]. 29

30 Εικόνα 1.10: Συνθετική ίνα κολλαγόνου Ι σε ηλεκτονικό μικροσκόπιο. Είναι εμφανής η D- περιοδικότητα της ίνας με απόσταση μεταξύ των μικροϊνιδίων D= 17.9 nm. Στο φυσικό κολλαγόνο τύπου Ι είναι D= 67nm. Εικόνα 1.11: Δομή κολλαγόνου στο οστό. 30

31 1.3.3 Δομή οστού Τα οστά αποτελούνται από τον οστίτη ιστό ο οποίος είναι ο μεγαλύτερος συνδετικός ιστός που υπάρχει στο ανθρώπινο σώμα. Η σύνθεση του οστίτη ιστού περιλαμβάνει μεσοκυττάρια ουσία και οστεοκύτταρα τα οποία βρίσκονται στις κοιλότητές της. Η μεσοκυττάρια ουσία αποτελείται από οργανικά αλλά και ανόργανα συστατικά, στα οποία κυριαρχούν το κολλαγόνο τύπου Ι και ο βιοαπατίτης, όπως αναφέρθηκε και στο προηγούμενο υποκεφάλαιο. Ανάλογα με τη μορφολογία του οστίτη ιστού, ο συνδιασμός των παραπάνω μορίων προσδίδει στο οστό διαφορετική οργάνωση, η οποία εμφανίζεται σε δύο μορφές: το συμπαγές οστό (cortical bone) και το σπογγώδες οστό (trabecular ή cancellous ή spongy bone). Για να κατανοήσουμε όμως τη δομή του οστού πρέπει πρώτα να αναφερθούμε στο σχηματισμό των οστών, μια διαδικασία γνωστή και ως οστεογένεση. Οστεογένεση Η οστεογένεση είναι μία πολυσταδιακή και όχι πλήρως αποσαφηνισμένη διαδικασία κατά την οποία το αρχέγονο «οστικό» το οποίο αποτελείται από αρχέγονα μεσεγχυματικά κύτταρα αντικαθίστανται σταδιακά από ώριμο οστίτη ιστό. Υπάρχουν δύο τύποι οστεογένεσης: η υμενογενής και η ενδοχόνδρια. Ωστόσο, υπάρχει και ένα ακόμα στάδιο που λαμβάνει χώρα τόσο στην υμενογενή όσο και στν ενδοχόνδρια οστεογένεση και στο οποίο οφείλουμε να αναφερθούμε εκτενέστερα. Τόσο οι ίνες κολλαγόνου τύπου Ι όσο και ο βιοαπατίτης αποτελούν βασικά συστατικά του οστού τα οποία συνδυάζονται με μία ιδιαίτερη διαδικασία για να προσλάβουν ασβέστιο και να σχηματίσουν το βασικό δομικό λίθο του επιπέδου οργάνωσης του οστού. Η διαδικασία αυτή ονομάζεται ασβεστοποίηση. Η ασβεστοποίηση λαμβάνει χώρα μέσα στα ινίδια του κολλαγόνου όπου και σχηματίζονται οι πρώτοι κρύσταλλοι βιοαπατίτη. Οι πρωτοσχηματιζόμενοι κρύσταλλοι βρίσκονται αρχικά περιορισμένοι στο όπου σχηματίζονται. Έτσι, κατά τα πρώιμα στάδια της ασβεστοποίησης η μήτρα του κολλαγόνου περιορίζει την ανάπτυξη των κρυστάλλων 31

32 και διατηρεί τους κρυστάλλους ξεχωριστά των έναν από τον άλλον τουλάχιστον κατά μήκος του ινιδίου. Οι κρύσταλλοι συνεχίζουν να αναπτύσσονται, συμπιέζοντας τα μόρια των τριπλών ελίκων και τελικά ενώνονται για να σχηματίσουν εκτεταμένα φύλλα. Έτσι, το οργανικό τμήμα του οστού μέσω της ασβεστοποίησής του σχηματίζει ένα είδος συμπλέγματος με την ανόργανη φάση, όπου οι κρύσταλλοι του υδροξυαπατίτη βρίσκονται ενσωματωμένοι σε συγκεκριμένη διάταξη στη μήτρα του κολλαγόνου. Το συγκεκριμένο επίπεδο δομής δημιουργείται από ασβεστοποίηση των ινών του κολλαγόνου με εναπόθεση κρυστάλλων του απατίτη μέσα στις ίνες του. Η χωροταξική αυτή συσχέτιση της μήτρας του ινώδους κολλαγόνου και των μικρών κρυστάλλων υδροξυαπατίτη, δηλαδή της οργανικής και της ανόργανης φάσης του οστού αντίστοιχα, προσδίδει στο οστό τόσο τις μηχανικές του ιδιότητες όσο και την αναδιαμορφωτική του ικανότητα. Στην παρακάτω εικόνα απεικονίζονται τα στάδια ενός μηχανισμού ασβεστοποίησης στο περιβάλλον του οστού που έχει προταθεί πρόσφατα από ερευνητική ομάδα η οποία πραγματοποίησε προσομοίωση της συγκεκριμένης διαδικασίας σε ελεγχόμενο περιβάλλον και παρατήρησή της με ηλεκτρονική μικροσκοπία [25]. 32

33 Εικόνα 1.12: a. Συσσωματώματα φωσφορικού ασβεστίου (πράσινο) σχηματίζουν συμπλέγματα με το αδρανές πολυμερές (πορτοκαλί γραμμή), και αυτά με τη σειρά τους σταθερά ανόργανα σταγονίδια b. Τα ανόργανα σταγονίδια προσδένονται σε μια συγκεκριμένη περιοχή των ινών κολλαγόνου και εισέρχονται στο ινίδιο. c. Στο εσωτερικό του κολλαγόνου, το ανόργανο τμήμα υγρής φάσης διαχέεται στο εσωτερικό του ινιδίου και στερεοποιείται σε μια άμορφη φάση (μαύρο) d. Τελικά, κατευθυνόμενη από το κολλαγόνο, η άμορφη ανόργανη φάση μετατρέπεται σε προσανατολισμένους κρυστάλλους απατίτη (κίτρινο). 33

34 Εικόνα 1.13: Ασβεστοποιημένη ίνα κολλαγόνου σε τένοντα γαλοπούλας. Εικόνα από ηλεκτρονικό μικροσκόπιο. Μορφολογικοί τύποι οστίτη οστού και οργάνωσή τους Όπως αναφέρθηκε και παραπάνω, υπάρχουν δύο μορφές του οστίτη οστού: ο συμπαγής (cortical ή compact bone) και ο σπογγώδης (trabecular ή cancellous ή spongy bone). Οι δύο αυτοί τύποι είναι βιολογικά και χημικά ταυτόσημοι, διαφέρουν όμως κατά πολύ στην οργάνωση τους, στο βαθμό πορώδους, στην ανάπτυξη, στην αρχιτεκτονική, στη λειτουργία, στην απόσταση από το μυελό των οστών, στην παροχή αίματος, στην ταχύτητα του χρόνου ανακατασκευής και στο μέγεθος των μεταβολών που εξαρτώνται από την ηλικία [26, 27]. 34

35 Εικόνα 1.14: Φωτογραφία τομής πάχους 8mm από αφυδατωμένο άκρο μηριαίου οστού. Η κεφαλή και ο τροχαντήρας καλύπτονται από ένα λεπτό περίβλημα ενώ ο άξονας από ένα παχύ κύλινδρο συμπαγούς οστού. Μεγέθυνση 0.5 Το συμπαγές οστό αποτελεί το 80% της μάζας του οστού στον ενήλικο ανθρώπινο σκελετό και καταλαμβάνει πολύ μικρότερο εμβαδόν επιφάνειας σε σχέση με το σπογγώδες οστό λόγω του μικρού πορώδους του που κυμαίνεται μεταξύ 5% και 10%. Σχηματίζει το εξωτερικό τοίχωμα όλων των οστών το οποίο περιβάλλει την κεντρική κοιλότητα του μυελού και είναι υπεύθυνο σε μεγάλο βαθμό για τη στήριξη και προστασία που προσφέρει ο σκελετός. Έτσι, το μεγαλύτερο μέρος του συμπαγούς οστού βρίσκεται στον άξονα των επιμήκων οστών του σκελετού. Εκτός όμως από το εξωτερικό κέλυφος γύρω από το σπογγώδες οστό, το συμπαγές οστό εντοπίζεται επίσης και στο τέλος των αρθρώσεων και της σπονδυλικής στήλης. Η βασική δομική μονάδα του συμπαγούς οστού στην ιεραρχική δομή των επτά επιπέδων που έχει προταθεί από τον Weiner για το οστό [5] είναι ο οστεώνας. Η ιεραρχία αυτή περιγράφεται στην παρακάτω εικόνα. 35

36 Εικόνα 1.15: Τα επτά επίπεδα ιεραρχίας της δομής του συμπαγούς οστού [28] Στη βάση της ιεραρχίας βρίσκονται τα αμινοξέα τα οποία συνθέτουν το τροποκολλαγόνο που μετατρέπεται στη συνέχεια σε κολλαγόνο. Τα μικροσκοπικά πετάλια του υδροξυαπατίτη (ΗΑ) προσανατολισμένα και ευθυγραμμισμένα με τις ίνες κολλαγόνου, οι οποίες είναι στοιβαγμένες σε παράλληλη διάταξη αποτελούν οστικό πετάλιο. Το κάθε πετάλιο έχει πάχος μερικά μικρόμετρα και αποτελείται από ίνες κολλαγόνου. Πάνω σε καθεμία από τις ίνες κολλαγόνου που αποτελούν ένα οστικό πέταλο βρίσκονται 36

37 κρύσταλλοι υδροξυαπατίτη σε συμμετρική διάταξη, όπως φαίνεται και στο παρακάτω σχήμα. Εικόνα 1.16: Απεικόνιση ενός οστεώνα και μίας ίνας κολλαγόνου ενός οστικού πετάλου του οστεώνα. Το πετάλιο είναι διατεταγμένο ομόκεντρα γύρω από τα αιμοφόρα αγγεία σχηματίζοντας τους οστεώνες. Εικόνα 1.17: Ιεραρχική δομή ανθρώπινου συμπαγούς οστού. 37

38 Ο οστεώνας ή Αβερσειανό σύστημα πήρε το όνομά του από τον John Harves ο οποίος ανακάλυψε τα οστικά πετάλια το Σήμερα, ο ορισμός του οστεώνα ή Αβερσειανό σύστημα περιλαμβάνει κυκλικά δαχτυλίδια πεταλίων (ομόκεντρα πετάλια) τα οποία περιβάλλουν κατά μήκος ένα αγγειακό κανάλι. Τα κανάλια είναι διασυνδεδεμένα μέσω εγκάρσιων καναλιών Volkmann τα οποία σχηματίζουν ένα διακλαδιζόμενο δίκτυο. Όπως αναφέρθηκε και παραπάνω, στο κέντρο των οστεώνων υπάρχει ένας Αβερσειανός σωλήνας που περιέχει υπάρχουν αιμοφόρα αγγεία, λεμφαγγεία, νεύρα και χαλαρός συνδετικός ιστός που συνεχίζει μέσα στο μυελό των οστών και στο περιόστεο. Τα αιμοφόρα αγγεία όλων των οστεώνων καταλήγουν στην ενδομυελική κοιλότητα. Γύρω από το εξωτερικό πέταλο του κάθε οστεώνα βρίσκεται η θεμέλια γραμμή (cement line) η οποία δεν περιέχει κολλαγόνο και αποτελεί το ασθενέστερο συστατικό του συμπαγούς οστού. Έχει πάχος 1-2μm και αποτελείται από ασβεστοποιημένη μήτρα ελλιπή σε ίνες κολλαγόνου. Επιπλέον, ανάμεσα στους οστεώνες υπάρχουν οστεοκύτταρα. Εικόνα 1.18: Εγκάρσια τομή του φλοιώδους οστού. 38

39 Εικόνα 1.19: Διάγραμμα μίας τομής ενός επιμήκους οστικού άξονα που περιέχει ιστολογικές λεπτομέρειες ενός συμπαγούς οστού. Εικόνα 1.20: Ιστολογική απεικόνιση εγκάρσιας τομής συμπαγούς οστού όπου φαίνεται ο οστεώνας με τα Αβερσειανά κανάλια. Είναι επίσης εμφανή τα ενδιάμεσα πετάλια ανάμεσα στους οστεώνες. 39

40 Εικόνα 1.21: Το κυλινδρικό μοτίβο του οστεώνα σε ένα ανθρώπινο οστό. Εικόνα από ηλεκτρονικό μικροσκόπιο σάρωσης (SEM). Εικόνα 1.22: Ιεραρχική δομή ανθρώπινου συμπαγούς οστού. 40

41 Το σπογγώδες οστό αποτελεί το 20% της συνολικής οστικής μάζας και εντοπίζεται στο εσωτερικό των επιμήκων οστών, στους σπονδύλους και σε επίπεδα οστά όπως το λαγόνιο. Το σπογγώδες οστό χαρακτηρίζεται από μεγαλύτερο πορώδες σε σχέση με το συμπαγές το οποίο κυμαίνεται από 50% έως 90%. Η βασική μονάδα του σπογγώδους οστού είναι οι δοκίδες (trabeculae). Παράλληλα, η ανοιχτή σαν κηρήθρα δομή του εμφανίζει κοιλότητες, τις μυελοκυψέλες (εικ.1.25) και αποτελείται από οστεοκύτταρα και από μεσοκυττάρια ουσία. Στα νεαρά άτομα μέσα στις μυελοκυψέλες επικρατεί ο ερυθρός μυελός των οστών, που είναι αιμοποιητικό όργανο. Ο ερυθρός μυελός αντικαθίσταται σταδιακά από τον φαιό μυελό που αποτελείται κυρίως από λιποκύτταρα. Εικόνα 1.23: Φωτογραφία μία τομής του κνημιαίου οστού που απεικονίζει το συμπαγές και το σπογγώδες οστό. Το σπογγώδες οστό αποτελείται από κάθετες δοκιδώδεις πλάκες με οπές και ένα δίκτυο σπογγώδων ράβδων. Στα ζωντανά δείγματα ο μυελός των οστών καταλαμβάνει τα διαστήματα ανάμεσα στις δοκίδες. Μεγέθυνση

42 1.4 Χόνδρος Γενικότερες λειτουργίες χόνδρου Στην επιφάνεια των αρθρώσεων στα άκρα των επιμήκων οστών, το περίβλημα του υποχόνδρινου οστού καλύπτεται από ένα λεπτό στρώμα εξειδικευμένου υάλινου χόνδρου ο οποίος ονομάζεται αρθρικός χόνδρος. Φυσιολογικά υπάρχουν τρία είδη χόνδρου: ο υαλοειδής, ο ελαστικός και ο ινώδης. Ο υαλοειδής χόνδρος είναι στιλπνός, ομαλός, λείος, άνευρος και ανάγγειος ιστός που καλύπτει τις αρθρικές επιφάνειες των οστών. Το πάχος του κυμαίνεται μεταξύ 2 και 6mm ανάλογα με την άρθρωση και τη θέση του, ενώ λόγω της απουσίας αγγείων στην κύρια μάζα του τροφοδοτείται με τα θρεπτικά συστατικά που χρειάζεται από το αρθρικό υγρό. Ο αρθρικός χόνδρος διαθέτει μεγάλη αντοχή στη φθορά αλλά ταυτόχρονα πολύ μικρή ικανότητα αναγέννησης και επιδιόρθωσης των βλαβών του Χημική σύσταση χόνδρου Ο υαλώδης χόνδρος είναι ένας κολλαγονούχος ιστός αποτελούμενος από πολύ μεγάλα μόρια πρωτεϊνών-πολυσακχαριτών τα οποία σχηματίζουν ένα τζελ όπου βρίσκονται διάσπαρτες οι ίνες του κολλαγόνου. Τα χονδροκύτταρα αντιπροσωπεύουν το 5% του όγκου του υαλώδους χόνδρου και αποτελούν το μοναδικό κυτταρικό συστατικό του ενήλικου υαλοειδούς χόνδρου. Θεωρούνται τελικώς διαφοροποιημένα κύτταρα, ενώ διατηρούν τη μήτρα του χόνδρου υπό συνθήκες χαμηλών επιπέδων αναγέννησης. Ο ρόλος τους είναι πολύ σημαντικός γιατί προάγουν μέχρι ένα σημείο την αυθόρμητη επιδιόρθωση μετά από κάποια βλάβη του χόνδρου. Τα χονδροκύτταρα περιβάλλονται από την εξωκυττάρια θεμέλια ουσία (ΕΘΟ). Το δίκτυο της ΕΘΟ περιέχει μεγάλο ποσοστό νερού και αποτλεί το 90% της ξηρής μάζας του ιστού εξωκυττάριας μήτρας περιέχει μεγάλο ποσοστό νερού και αποτελεί το 90% της ξηρής μάζας του ιστού. Η ΕΘΟ του αρθρικού χόνδρου αποτελείται από τρεις κύριες κατηγορίες πρωτεϊνών: 42

43 κολλαγονούχες πρωτεϊνες (με κυριότερο το κολλαγόνου τύπου ΙΙ), μεγάλα συσσωματώματα πρωτεογλυκανών (με κυριότερη την αγκρεκάνη), μικρότερες σε μέγεθος πρωτεογλυκάνες και μη κολλαγονούχες πρωτεϊνες [29, 30]. Κολλαγονούχες πρωτεϊνες Από το συνολικό κολλαγόνο που υπάρχει στον αρθρικό χόνδρο, το κολλαγόνο τύπου ΙΙ αποτελεί το 90-95% και συντίθεται από τα χονδροκύτταρα. Το κολλαγόνο τύπου ΙΙ ακολουθεί σε γενικές γραμμές ακολουθεί τη δομή της γενικότερης οικογένειας του κολλαγόνου, παρουσιάζοντας μεγάλες ομοιότητες με το κολλαγόνο τύπου Ι. Έτσι λοιπόν, κάθε μόριο κολλαγόνου τύπου ΙΙ αποτελείται από τρεις πολυπεπτιδικές α-αλυσίδες οι οποίες σχηματίζουν μία τριπλή έλικα στο χώρο. Η διαφορά του από το κολλαγόνο τύπου Ι είναι ότι ενώ αυτό αποτελείται από δύο α 1 και μία α 2 πολυπεπτιδικές αλυσίδες, το κολλαγόνο τύπου ΙΙ αποτελείται από τρεις πανομοιότυπες α 1 -αλυσίδες. Η καθεμία από αυτές, όπως και στο κολλαγόνο Ι, αποτελείται από περίπου 1000 αμινοξέα η καθεμία και συνδέονται με ομοιοπολικούς δεσμούς στα μη ελικομένα άκρα τους (τελοπεπτίδια) [31]. Επιπλέον, η τριπλή έλικα του κολλαγόνου τύπου ΙΙ διαθέτει περισσότερα αμινοξέα υδροξυλυσίνης ανά αλυσίδα (24 ανά 1000) σε σχέση με το κολλαγόνο τύπου Ι (4 ανά 1000) [32]. Οι ίνες μορίων τριπλής έλικας του κολλαγόνου τύπου ΙΙ χαρακτηρίζονται από ένα μεγάλο αριθμό σταυροδεσμών και με τη σειρά τους σχηματίζουν ινίδια τα οποία δομούν το χόνδρο. Ωστόσο η δομή των ινιδίων είναι λίγο διαφορετική σε σχέση με τη δομή των ινιδίων του κολλαγόνου Ι του οστού. Η διάμετρός τους είναι μικρότερη και ο προσανατολισμός τους τυχαίος στην παχύρρευστη μήτρα πρωτεογλυκανών του χόνδρου. Επιπλέον, τα ινίδια κολλαγόνου τύπου ΙΙ στο χόνδρο έχουν ετεροτυπική δομή μικροϊνιδίων, δηλαδή στην εξωτερική επιφάνεια του ινιδίου υπάρχουν δέκα μικροϊνίδια με ίση απόσταση μεταξύ τους ενώ στο εσωτερικό του ινιδίου τα μικροϊνίδια αυτά είναι τέσσερα σε αριθμό [33]. Τα άκαμπτα αυτά μακρομόρια προσδίδουν δύναμη και συμπιεστότητα στη μήτρα και της επιτρέπουν να αντέχει σε μεγάλες αλλοιώσεις σχήματος. Η ιδιότητα αυτή του χόνδρου είναι υπεύθυνη για την απορρόφηση κραδασμών 43

44 στις αρθρώσεις. Ο δεύτερος σημαντικότερος σε περιεκτικότητα τύπος κολλαγόνου που περιέχεται στην εξωκυττάρια μήτρα του χόνδρου είναι το κολλαγόνο τύπου IX το οποίο αντιπροσωπεύει το 10% του συνολικού κολλαγόνου στο χόνδρο του εμβρύου, αλλά μόνο το 1-2% στον ενήλικο χόνδρο [34, 35]. Ο τύπος ΙΧ έχει αποδειχθεί ότι προσδένεται ανά τακτά διαστήματα στα ινίδια κολλαγόνου τύπου ΙΙ αλλά μικρότερης διαμέτρου [36] όπως και στη θειϊκή χονδροϊτίνη [37]. Άλλοι τύποι κολλαγόνου που βρίσκονται σε μικρή ποσότητα στο χόνδρο είναι οι VI, XI, XII και XIV. Οι ίνες του κολλαγόνου τύπου ΙΙ αλληλεπιδρούν με τους τύπους IX και XI, ενισχύοντας τη σταθεροποίησή του. Εικόνα 1.24: Αλληλεπίδραση κολλαγόνου τύπου ΙΙ και ΙΧ στο ν αρθρικό χόνδρο. Πρωτεογλυκάνες Το δεύτερο σημαντικότερο συστατικό του αρθρικού υάλινου χόνδρου είναι οι μικρές και μεγάλες πρωτεογλυκάνες που υπάρχουν στην ΕΘΟ. Οι πρωτεογλυκάνες είναι μόρια που αποτελούνται από μία πρωτεΐνη-πυρήνα ομοιοπολικά συνδεδεμένη με αλυσίδες γλυκοζαμινογλυκανών (GAGs). 44

45 Εικόνα 1.25: Γενική δομή πρωτεογλυκανών Οι πρωτεογλυκάνες που υπάρχουν στο χόνδρο βοηθάνε στη διατήρηση της δομής του [38], στην ομαλή λειτουργία του, αλληλεπιδρούν με τις ίνες κολλαγόνου και δημιουργούν ένα λειτουργικό δίκτυο στο εσωτερικό του. Επιπλέον, προσδίδουν στον ιστό υδροφιλικότητα και την απαραίτητη οσμωτική πίεση για να αντέξει μεγάλα φορτία. Η αγκρεκάνη είναι μία από τις κυριότερες πρωτεογλυκάνες που υπάρχουν στον αρθρικό χόνδρο. Η πρωτεογλυκάνη αυτή είναι αρκετά υδρόφιλη με μοριακό βάρος περίπου 230kDa και είναι υπεύθυνη για την αντίσταση του χόνδρου στη συμπίεση και ακαμψία. Μετά την έκκρισή της η αγκρεκάνη συναρμολογείται σε μία υπερμοριακή δομή στην οποία περίπου 50 μονομερή προσδένονται σε ένα νημάτιο μίας άλλης πρωτεογλυκάνης, του υαλουρονικού [39]. Από τα σημαντικότερα όμως μόρια που προσδένονται στην αγκρεκάνη είναι η θειϊκή χονδροϊτίνη (CS), μία θειωμένη γλυκοζαμινογλυκάνη η οποία αποτελείται από μία αλυσίδα εναλλασσόμενων σακχάρων (Ν-ακετυλογαλακτοζαμίνη και γλυκουρονικό οξύ). Η αλυσίδα του μορίου μπορεί να αποτελείται έως και από 100 μονάδες σακχάρων καθένα από τα οποία μπορεί να θειωθεί σε διάφορες θέσεις. 45

46 Εικόνα 1.26: Χημικός τύπος θειϊκής χονδροϊτίνης ενός μονομερούς της αλυσίδας της θειϊκής χονδροϊτίνη. Για την 4-θειϊκή χονδροϊτίνη, όπου: R 1 = H, R 2 = SO 3 H, R 3 = H Για την 6-θειϊκή χονδροϊτίνη: R 1 = SO 3 H; R 2, R 3 = H Η θειϊκή χονδροϊτίνη, ως γλυκοζαμινογλυκάνη, μπορεί να αποτελέσει τμήμα διάφορων πρωτεογλυκανών. Στο εσωτερικό του χόνδρου οι φορτισμένες θειομάδες της θειϊκής χονδροϊτίνης βρίσκονται πολύ κοντά η μία στην άλλη δημιουργώντας ηλεκτροστατική άπωση η οποία είναι υπεύθυνη για το μεγαλύτερο μέρος της αντίστασης του αρθρικού χόνδρου στη συμπίεση κατά τη λειτουργία των αρθρώσεων [40]. Για το λόγο αυτό, η συμμετοχή της θειϊκής χονδροϊτίνης στη δομή της αγκρεκάνης την καθιστά υπεύθυνη για τη διατήρηση της δομικής ακεραιότητας του αρθρικού χόνδρου 46

47 Εικόνα 1.27: Δομή συσσωματώματος αγκρεκάνης στο χόνδρο. Το σύνολο των πρωτεογλυκανών της μήτρας του αρθρικού χόνδρου περιλαμβάνει επίσης και την οικογένεια των SLRPs (small leucine- rich proteoglycans- μικρές 47

48 πρωτεογλυκάνες πλούσιες σε λευκίνη) οι οποίες διακρίνονται σε τρεις ομάδες, με τα μέλη της καθεμίας από αυτές να εντοπίζονται στον αρθρικό χόνδρο. Η τάξη Ι περιλαμβάνει τη ντεκορίνη και τη διγλυκάνη, οι οποίες συνεισφέρουν στη σταθερή πυκνότητα φορτίου και προσδένουν αυξητικούς παράγοντες όπως ο TGFβ (transforming growth factor) [41]. Η τάξη ΙΙ της οικογένειας των SLRPs που εκφράζονται στο χόνδρο περιλαμβάνουν την ινομοδουλίνη, τη λουμικάνη, την πρωτεϊνη που είναι γνωστή ως PRELP και τη CHAD (chondroadherin). Από αυτές, η ινομοδουλίνη φέρει την ιδιότητα να επενδύει την επιφάνεια των ινών κολλαγόνου και έτσι να ρυθμίζει τη διάμετρο των ινών. Η τάξη ΙΙΙ των SLRPs που εκφράζονται στο χόνδρο περιλαμβάνει την επιφυκάνη (ή PG- Lb) η οποία είναι μία θειϊκή πρωτεογλυκάνη δερματάνης [42]. Μία ακόμα πρωτεογλυκάνη μικρού μοριακού βάρους που υπάρχει στο χόνδρο είναι η θεϊκή πρωτεογλυκάνη ηπαράνης της βασικής μεμβράνης (HSPG) ή περλεκάνη η οποία αποτελείται από πέντε μεγάλες πρωτεϊνικές μονάδες [43, 44]. Τα χονδροκύτταρα εκφράζουν επίσης πρωτεογλυκάνες της κυτταρικής επιφάνειας, τις συνδεκάνες. Από αυτές η συνδεκάνη-3 εκφράζεται για σύντομο χρονικό διάστημα και μόνο στα πρώιμα στάδια της χονδρογένεσης [45-48]. Άλλες πρωτεϊνες του χόνδρου που έχουν ανακαλυφθεί τα τελευταία χρόνια είναι η ολιγομερική πρωτεΐνη μήτρας του χόνδρου και η γλυκοπρωτείνη 39, γνωστή και ως YKL- 40 [49]. 48

49 Εικόνα 1.28: Οι πρωτεογλυκάνες και οι κολλαγονούχες και μη πρωτεΐνες αλληλεπιδρούν μεταξύ τους προσδίδοντας στον ιστό του αρθρικού χόνδρου αντοχή στη συμπίεση και στον εφελκυσμό Δομή χόνδρου Όπως αναφέρθηκε και προηγουμένως, ο αρθρικός υάλινος χόνδρος στη φυσιολογική του κατάσταση αποτελείται από ένα εκτενές ενυδατωμένο δίκτυο όπου βρίσκεται ενσωματωμένος ένας μικρός αριθμός ειδικών κυττάρων, τα χονδροκύτταρα. Βρίσκεται οργανωμένος σε τρεις στοιβάδες, οι οποίες παρουσιάζουν διαφορετική κυτταρική μορφολογία και κατανομή [50], την επιφανειακή, την ενδιάμεση και τη βαθύτερη. Όσο προχωράμε προς το εσωτερικό της άρθρωσης και μετά το πέρας του χόνδρου συναντάμε 49

50 διαδοχικά τα στρώματα του ασβεστοποιημένου χόνδρου, του υποχόνδρινου οστού και τέλος του σπογγώδους οστού. Στοιβάδες του αρθρικού υάλινου χόνδρου Η επιφανειακή ζώνη αποτελεί μία λεία και ολισθηρή επιφάνεια η οποία είναι επίσης γνωστή και ως εφαπτομενική ζώνη και αποτελεί περίπου το 10-20% του συνολικού πάχους του αρθρικού χόνδρου. Διαθέτει τη μεγαλύτερη περιεκτικότητα σε κολλαγόνο σε σχέση με τις άλλες ζώνες. Οι ίνες κολλαγόνου σε αυτή τη ζώνη είναι πυκνά πακεταρισμένες ενώ η διάταξή τους στον αρθρικό χόνδρο είναι παράλληλη [51]. Η επιφανειακή ζώνη έχει το μικρότερο μέτρο ελαστικότητας και αποικοδομείται περίπου 25 φορές πιο γρήγορα από την ενδιάμεση στοιβάδα. Τα χονδροκύτταρα στη ζώνη αυτή είναι επιμήκη ως προς την ιστολογική τους εμφάνιση, εκφράζουν κατά προτίμηση πρωτεΐνες που διαθέτουν λιπαντικές και προστατευτική λειτουργίες και εκκρίνουν σχετικά μικρό αριθμό πρωτεογλυκανών [52]. Η ενδιάμεση στοιβάδα περιλαμβάνει το 40-60% του συνολικού όγκου του αρθρικού χόνδρου. Η ζώνη αυτή διαθέτει μεγαλύτερο μέτρο ελαστικότητας και λιγότερο οργανωμένη διάταξη των ινών του κολλαγόνου. Οι ίνες κολλαγόνου που υπάρχουν στην ενδιάμεση στοιβάδα έχουν μεγαλύτερο πάχος, βρίσκονται πακεταρισμένες σε διάταξη με μικρότερη πυκνότητα και πλαγίως ως προς την επιφάνεια. Το σχήμα των χονδροκυττάρων στη ζώνη αυτή είναι περισσότερο σφαιρικό σε σχέση με τα κύτταρα στην επιφανειακή στοιβάδα. Η βαθύτερη ζώνη αποτελεί το 30% του συνολικού χόνδρου, ενώ οι ίνες κολλαγόνου που βρίσκονται εδώ έχουν μεγάλη διάμετρο και βρίσκονται προσανατολισμένες κάθετα ως προς την επιφάνεια του χόνδρου. Η συγκεκριμένη στοιβάδα χαρακτηρίζεται από υψηλή περιεκτικότητα σε πρωτεογλυκάνες και χαμηλή σε νερό, ενώ παράλληλα διαθέτει τη μεγαλύτερη ελαστικότητα. Τα χονδροκύτταρά της βρίσκονται σε διάταξη παράλληλη με τις ίνες κολλαγόνου. Ο ασβεστοποιημένος χόνδρος περιλαμβάνει μικρά κύτταρα σε μία μήτρα χόνδρου με διάστικτα άλατα απατίτη [51]. 50

51 Εικόνα 1.29: Απεικόνιση φυσιολογικού αρθρικού χόνδρου. Η εξωτερική του επιφάνεια είναι λεία, ενώ η ΕΘΟ και τα χονδροκύτταρα βρίσκονται οργανωμένα σε επιφανειακές, ενδιάμεσες και βαθύτερες ζώνες. 51

52 Εικόνα 1.30: Οργάνωση ινών κολλαγόνου στις διαφορετικές ζώνες του αρθρικού ενήλικου χόνδρου. 52

53 ΚΕΦΑΛΑΙΟ 2 ΠΑΘΟΛΟΓΙΑ ΧΟΝΔΡΟΥ 2.1 Εισαγωγή Η πιο απλή διάκριση βλαβών του χόνδρου περιλαμβάνει την ταξινόμηση τους σε τραυματικές και εκφυλιστικές. Οι τραυματικές βλάβες προκαλούνται από κάκωση της άρθρωσης και παρατηρούνται σε κάθε ηλικία, ενώ οι εκφυλιστικές οφείλονται σε προοδευτική φθορά από παρατεταμένη χρήση και εντοπίζονται συνήθως, αλλά όχι αποκλειστικά, σε μεγαλύτερες ηλικίες. Οι βλάβες του αρθρικού χόνδρου διακρίνονται επίσης σε επιφανειακές, μερικού πάχους, ολικού πάχους και σε βλάβες που περιλαμβάνουν τη συμμετοχή του υποχόνδρινου οστού. Η εκφύλιση του αρθρικού χόνδρου που μπορεί να οδηγήσει σε κάποιου βαθμού απώλειά του ονομάζεται οστεοαρθρίτιδα. Υπάρχουν διάφορες ασθένειες που μπορούν να επηρεάσουν το χόνδρο. Κάποιες από αυτές είναι η υποτροπιάζουσα πολυχονδρίτιδα, η χονδρομαλύκυνση επιγονατίδας, η αχονδροπλασία, η πλευροχονδρίτιδα, η σπονδυλική κήλη δίσκου, η νευροπαθητική αρθροπάθεια και η εναπόθεση κρυστάλλων διϋδρικού πυροφωσφορικού ασβεστίου. Ιδιαίτερο βάρος ωστόσο θα δοθεί στην οστεοαρθρίτιδα. 2.2 Οστεοαρθρίτιδα Επιδημιολογία Η οστεοαρθρίτιδα είναι μια χρόνια ρευματική πάθηση αλλά και η συχνότερη ασθένεια που σχετίζεται με το χόνδρο. Είναι υπεύθυνη σε μεγάλο βαθμό τόσο για τη νοσηρότητα των ηλικιωμένων όσο και για σημαντικό ποσοστό των ετήσιων ιατρικών εξόδων των 53

54 ανεπτυγμένων χωρών. Κάθε χρόνο περίπου το 80% των ασθενών άνω των 75 ετών εμφανίζουν κλινικά συμπτώματα οστεοαρθρίτιδας. Χαρακτηριστικά στις ΗΠΑ, το κόστος σε όλη τη διάρκεια ζωής ενός ατόμου που πάσχει από οστεοαρθρίτιδα στο γόνατο είναι περίπου $60,000 αν ο ασθενής προχωρήσει τελικά σε ολική αρθροπλαστική [53]. Αλλά και στην Ελλάδα η οστεοαρθρίτιδα είναι το τρίτο κατά σειρά αίτιο μακροχρόνιας λειτουργικής ανικανότητας. Λόγω της συχνότητάς της προκαλεί σημαντικές επιπτώσεις στο κοινωνικό σύνολο αλλά και στην εθνική οικονομία της χώρας. Εικόνα 2.1: Παθήσεις που ευθύνονται για μακροχρόνια λειτουργική ανικανότητα των Ελλήνων. Η οστεοαρθρίτιδα βρίσκεται τρίτη στη σειρά κατάταξης Τύποι και κλινικά συμπτώματα Ως προς τον τύπο της, η οστεοαρθρίτιδα μπορεί να είναι πρωτοπαθής λόγω ηλικίας και κληρονομικότητας ή δευτεροπαθής, ως αποτέλεσμα κάποιας ενδροκρινικής, φλεγμονώδους, μεταβολικής ή αναπτυξιακής διαταραχής [54]. Μπορεί να εμφανιστεί σε οποιαδήποτε άρθρωση, αλλά πιο συχνά παρουσιάζεται στις μεγάλες αρθρώσεις (πχ. 54

55 ισχύο και γόνατο), οι οποίες δέχονται τα μεγαλύτερα μηχανικά φορτία. Τα κλινικά συμπτώματα των ασθενών που πάσχουν από οστεοαρθρίτιδα περιλαμβάνουν πόνο στις αρθρώσεις, δυσκαμψία της άρθρωσης, διόγκωση αλλά και παραμόρφωση σε προχωρημένο στάδιο. Λιγότερο συχνά εμφανίζεται συνοδός μυϊκή ατροφία Αίτια οστεοαρθρίτιδας Η οστεοαρθρίτιδα είναι κατά κανόνα εκφυλιστική νόσος. Προκαλείται από τραυματισμούς ή/και μικροτραυματισμούς, αυξημένα μηχανικά φορτία σε αρθρώσεις (καθημερινός τρόπος ζωής, επαγγελματικές συνήθειες, παχυσαρκία), από το γήρας, από μεταβολικές διαταραχές (πχ. μεταβολικό σύνδρομο) και ως αποτέλεσμα γενετικής προδιάθεσης μία εκφυλιστική νόσος που αποτελεί συνέπεια ηλικιακών μεταβολών, γενετικής προδιάθεσης [55, 56] Αντιμετώπιση οστεοαρθρίτιδας Όπως αναφέρθηκε και παραπάνω ο ενήλικος χόνδρος έχει ελάχιστη ικανότητα αυτοεπιδιόρθωσης. Οι σύγχρονες μέθοδοι για την αντιμετώπιση της βλάβης του χόνδρου επικεντρώνονται στην ανακούφιση του πόνου και της φλεγμονής και έχουν περιορισμένη μακροπρόθεσμη επιτυχία. Γενικά, η θεραπευτική αντιμετώπιση της συμπτωματικής οστεοαρθρίτιδας διακρίνεται σε μη φαρμακευτική (απώλεια βάρους, φυσικοθεραπεία, υποστηρικτικές συσκευές), φαρμακευτική (NSAIDs, γλυκοκορτικοειδή) και χειρουργική (αρθροσκόπηση, χονδροπλαστική, μεταμόσχευση χονδροκυττάρων, ολική αρθροπλαστική, κλπ). 55

56 2.2.5 Παθογένεση οστεοαρθρίτιδας Βιοχημικές μεταβολές Τα τελευταία χρόνια έχει γίνει σημαντική ερευνητική εργασία γύρω από την οστεοαρθρίτιδα με σκοπό την αποσαφήνιση των βιοχημικών μεταβολών που παρατηρούνται στον αρθρικό χόνδρο κατά την εξέλιξη της νόσου. Σε γενικές γραμμές, οι μηχανισμοί αυτοί περιλαμβάνουν: α) απώλεια πρωτεογλυκανών από την εξωκυττάρια μήτρα (Εικόνα 2.2) β) ρήξη του ινώδους δικτύου του κολλαγόνου με κατάτμηση του κολλαγόνου τύπου ΙΙ γ) μεταπλασία και απώλεια χονδροκυττάρων Είναι πλέον σαφές ότι στα πρώτα στάδια της οστεοαρθρίτιδας, οι πρωτεογλυκάνες ντεκορίνη, διγλυκάνη, αγκρεκάνη και το περιεχόμενό τους αυξάνεται στα βαθύτερα στρώματα του αρθρικού χόνδρου, ίσως ως αντιστάθμισμα της απώλειάς τους από τα επιφανειακά στρώματα [57]. Από την άλλη πλευρά, η αποικοδόμησή τους στα ανώτερα στρώματα οδηγεί σε αύξηση της διαπερατότητας της συμπαγούς μήτρας των χονδροκυττάρων, μείωση της υδραυλικής πίεσης στα πρώιμα στάδια της νόσου [58-60] και άρα ακαμψίας του ιστού. 56

57 Εικόνα 2.2: Απώλεια πρωτεογλυκανών κατά την εξέλιξη της οστεοαρθρίτιδας. Χρώση σαφρανίνης Ο σε υγιή αρθρικό χόνδρο (Α) όπου οι πρωτεογλυκάνες έχουν χρωματιστεί σε όλες τις ζώνες του χόνδρου (κόκκινο χρώμα) και (Β) σε οστεοαρθριτικό χόνδρο όπου παρατηρείται ελαττωμένη χρώση στην επιφανειακή στοιβάδα λόγω απώλειας πρωτεογλυκανών. Επιπλέον στην απώλεια και αναδιάταξη των πρωτεογλυκανών, κατά τα πρώιμα στάδια της οστεοαρθρίτιδας παρατηρείται απώλεια του δικτύου του κολλαγόνου τύπου ΙΙ και αποδιάταξη του ίδιου του μορίου [61] από κολλαγενάσες [62, 63]. Στο σημείο αυτό, ο οργανισμός ξεκινάει μια αυθόρμητη προσπάθεια επιδιόρθωσης της βλάβης. Έτσι, σε απόκριση στον τραυματισμό ή στους φλεγμονώδεις παράγοντες (κυρίως στην IL-1), τα χονδροκύτταρα υπόκεινται σε κυτταρικό διαχωρισμό (αύξηση κλώνων) και γίνονται μεταβολικά ενεργά, ενώ η εξωκυττάρια θεμέλια ουσία τους παράγει μεγάλες ποσότητες κολλαγόνου τύπου ΙΙ [64], μεταλλοπρωτεϊνασών και πρωτεογλυκανών. Όλες αυτές οι ενέργειες αποτελούν μια πρώιμη προσπάθεια επιδιόρθωσης της βλάβης. Ωστόσο, τα νεοσυντιθέμενα αυτά μόρια καταστρέφονται [63, 65], ενώ παράλληλα τα ίδια τα χονδροκύτταρα εκκρίνουν ένζυμα που εξυπηρετούν στην αποικοδόμηση της εξωκυττάριας μήτρας. Η αυθόρμητη προσπάθεια ανάκτησης της φυσιολογικής δομής του 57

58 χόνδρου έχει αποτύχει. Κυτταρικοί μηχανισμοί αποικοδόμησης του χόνδρου Η οικογένεια των πρωτεολυτικών ενζύμων που είναι υπεύθυνη για την πέψη της μήτρας του οστεοαρθριτικού χόνδρου είναι οι μεταλλοπρωτεϊνάσες μήτρας (MMPs). Μέχρι σήμερα έχουν εντοπιστεί 27 MMPs αλλά τέσσερις είναι αυτές που εμπλέκονται στην αποικοδόμηση του αρθρικού χόνδρου και αυτές είναι: η MMP-1 (μεμβρανικού τύπου), MMP-8, MMP-13 και MMP-14 [62, 66-68]. Μάλιστα η έκφραση της ΜΜΡ-13 στον οστεοαρθριτικό χόνδρο και η ικανότητά της να αποικοδομεί τόσο αποτελεσματικά το κολλαγόνο τύπου ΙΙ αποδεικνύει τον τόσο σημαντικό ρόλο του συγκεκριμένου ενζύμου [66, 69]. Αντίθετα, η MMP-1 φαίνεται να εμπλέκεται περισσότερο στην αποικοδόμηση του νεοσυντιθέμενου κολλαγόνου [63]. Γενικά, η δραστικότητα των κολλαγενασών φαίνεται να αυξάνεται σημαντικά στα τελευταία στάδια της οστεοαρθρίτιδας [62]. Ωστόσο, δεν είναι ξεκάθαρο ακόμα τι είναι αυτό που οδηγεί σε υπερέκφραση των αποικοδομητικών ενζύμων στη νόσο της οστεοαρθρίτιδας. Πρόσφατες μελέτες έχουν αποδείξει ότι το μηχανικό φορτίο είναι δυνατόν να έχει επιδράσεις στη βιωσιμότητα των χονδροκυττάρων και στην αποικοδόμηση της μήτρας και μάλιστα τα αποτελέσματα αυτά φαίνεται να είναι εντονότερα στην επιφανειακή ζώνη του αρθρικού χόνδρου [70, 71]. Ιστολογικά χαρακτηριστικά οστεοαρθριτικών περιοχών Το πρώτο χαρακτηριστικό εκφυλισμού του αρθρικού χόνδρου στη νόσο της οστεοαρθρίτιδας είναι ο ινιδισμός του χόνδρου ως αποτέλεσμα της καταστροφής των ινιδίων κολλαγόνου[72]. Όπως περιγράφτηκε και στο προηγούμενο υποκεφάλαιο, στα πρώιμα στάδια και κατά την απόπειρα αποκατάστασής του ο χόνδρος έχει μεγαλύτερο πάχος από ότι το φυσιολογικό λόγω της αυξημένης συσσώρευσης πρωτεογλυκανών. Ωστόσο κατά την εξέλιξη της ασθένειας η αρθρική επιφάνεια λεπταίνει, ο χόνδρος γίνεται πιο μαλακός, η 58

59 συνοχή της επιφάνειας υφίσταται ρήξη ενώ αναπτύσσονται κάθετες ρωγμές. Ο χόνδρος αποκτά μία εικόνα βελούδου και το γεγονός αυτό χαρακτηρίζεται ως ινιδισμός. Η συγκεκριμένη διαμόρφωση φαίνεται στην παρακάτω εικόνα. Εικόνα 2.4: Πρώιμα στάδια οστεοαρθρίτιδας a. Πολλαπλασιασμός των χονδροκυττάρων κατά μήκος των κάθετων προεξοχών του χόνδρου (ινιδισμός) b. Μετά από μικρό χρονικό διάστημα, μικρές σχισμές αρχίζουν να εμφανίζονται στην επιφάνεια του αρθρικού χόνδρου (ρωγμές). Αυτές μπορούν τελικά να αναπτυχθούν σε έλκη που διασχίζουν κατά μήκος ολόκληρο το χόνδρο. Ακόμα πιο μετά ο χόνδρος θα φθαρεί. Ο ινώδης χόνδρος είναι αποτέλεσμα της αποτυχημένης προσπάθειας του οργανισμού για επιδιόρθωση της βλάβης και συνεπώς έχει ελαττωμένη μηχανική αντοχή και ικανότητα αντιμετώπισης των αυξημένων μηχανικών φορτίων σε σχέση με το φυσιολογικό [73-75]. Είναι γνωστό πλέον ότι στον ινώδη χόνδρο αρχίζει να παράγεται κολλαγόνο τύπου Ι το οποίο φυσιολογικά παράγεται στο δέρμα και στα οστά, σε αντίθεση με το κολλαγόνο τύπου ΙΙ το οποίο εμφανίζεται στον υγιή υάλινο αρθρικό χόνδρο. Έχει αποδειχθεί πειραματικά ότι ο φυσιολογικός ανθρώπινος αρθρικός χόνδρος συνθέτει μόνο έναν τύπο πολυπεπτιδικής αλυσίδας (α1). Αντίθετα, ο οστεοαρθριτικός χόνδρος συνθέτει μία επιπλέον πολυπεπτιδική αλυσίδα (α2) [76]. Έχει προταθεί επίσης ότι το κολλαγόνο τύπου Ι παράγεται στον ινώδη χόνδρο σε απόκριση στις βλάβες του υποχόνδρινου οστού [77]. 59

60 Άλλες δομικές μεταβολές που αναπτύσσονται στο χόνδρο μακροσκοπικά κατά την εξέλιξη της οστεοαρθρίτιδας περιλαμβάνουν χονδρομαλάκυνση και διαβρωτικές αλλοιώσεις [78]. Οι βλάβες αυτές μπορεί να είναι επιφανειακές ή βαθύτερες, ενώ τελικά κορυφώνονται με απώλεια του χόνδρου και σκλήρυνση του οστού. Οι αρχικά μικρές βλάβες σταδιακά αυξάνονται τόσο σε πλάτος όσο και σε μήκος με αποτέλεσμα το ολικό πάχος του στρώματος του αρθρικού χόνδρου τελικά να μειώνεται [54, 79, 80]. Οι δομικές αυτές μεταβολές αντικατοπτρίζονται στα αποτελέσματα μιας ιστολογικής εξέτασης όπου είναι εμφανείς οι σχισμές στην επιφάνεια του χόνδρου, η απώλεια στοιβάδων του, η κυτταρική νέκρωση, ο πολλαπλασιασμός των χονδροκυττάρων και ο διπλασιασμός του διαχωριστικού ορίου μεταξύ αρθρικού χόνδρου και υποχόνδρινου οστού [81] (εικόνα 2.2, 2.5). Στις ιστολογικές απεικονίσεις είναι φανερό ότι η ζώνη που επηρεάζεται πρώτη στη νόσο της οστεοαρθρίτιδας είναι η επιφανειακή. Εικόνα 2.5: Μικροφωτογραφία από φωτονικό μικροσκόπιο που απεικονίζει (α) πρώιμου και (β) προχωρημένου σταδίου οστεοαρθρίτιδας (χρώση αιματοξυλίνης-ηωσίνης, μεγέθυνση 10 ). Στο προχωρημένο στάδιο οστεοαρθρίτιδας είναι εμφανής η καταστραφή του αρθρικού χόνδρου με το σχηματισμό σχισμών, απώλειας πρωτεογλυκανών και με πολλαπλασιασμό των χονδροκυττάρων [82]. 60

61 Όσον αφορά στο οστό πρέπει να σημειωθεί ότι κατά τη σταδιακή φθορά του αρθρικού χόνδρου υφίσταται και αυτό με τη σειρά του μεταβολές. Η υποχόνδρια επιφάνειά του αναδιαμορφώνεται, υφίσταται μικροκατάγματα, παχύνεται και στο τέλος καταστρέφεται σχηματίζοντας υποχόνδριες κύστες [54]. Λόγω παθολογικής κατανομής των μηχανικών φορτίων ιδιαίτερα στην περιφέρεια της άρθρωσης, ορισμένες φορές παρατηρείται ανώμαλη οστεοποίηση με αποτέλεσμα τη δημιουργία οστεόφυτων. Όλα τα παραπάνω μορφολογικά χαρακτηριστικά που εμφανίζονται στα διαφορετικά στάδια της οστεοαρθρίτιδας δεν μπορούν να εκτιμηθούν αντικειμενικά και να ποσοτικοποιηθούν ασφαλώς παρά μόνο με την επεμβατική διαδικασία της ιστολογικής εξέτασης δείγματος από την άρθρωση του ασθενή Τεχνικές διάγνωσης της οστεοαρθρίτιδας Η διάγνωση της οστεοαρθρίτιδας στη σύγχρονη κλινική πράξη περιλαμβάνει καταγραφή του ιστορικού, κλινική εξέταση και τεχνικές ραδιογραφικής απεικόνισης [83, 84]. Οι συγκεκριμένες μέθοδοι αν και δεν είναι αρκετά ευαίσθητες ώστε να ανιχνεύσουν πρώιμα στάδια αποικοδόμησης του αρθρικού χόνδρου, συνεχίζουν να χρησιμοποιούντα και παρουσιάζονται συνοπτικά παρακάτω Κλινική εξέταση Στην κλινική εξέταση ο ιατρός καλείται να αξιολογήσει τα συμπτώματα του ασθενούς επιβεβαιώνοντας έτσι την ύπαρξη ή όχι οστεοαρθρίτιδας. Κατά τη διάρκεια της εξέτασης, ο ιατρός θα αξιολογήσει τα επίπεδα πόνου, το εύρος κίνησης της άρθρωσης, τη μυϊκή δύναμη της προσβεβλημένης περιοχής καθώς και σημεία φλεγμονής, ευαισθησία και 61

62 οστεόφυτα στην άρθρωση. Φυσικά η κλινική εξέταση αποτελεί μια πολύ υποκειμενική μέθοδο διάγνωσης καθώς τα πρώιμα στάδια της νόσου σε καμία περίπτωση δεν μπορούν να εντοπιστούν Αρθροσκόπηση Η αρθροσκόπηση είναι η μόνη ελάχιστα επεμβατική μέθοδος σε χρήση που επιτρέπει άμεση επισκόπηση του αρθρικού χόνδρου και γι' αυτό συχνά χρησιμοποιείται ως χρυσή τομή για την εξακρίβωση και την εκτίμηση του σταδίου των ασθενειών του αρθρικού χόνδρου. Κατά την αρθροσκόπηση το εσωτερικό της άρθρωσης εξετάζεται με τη χρήση ενός αρθροσκόπιου, ενός είδους ενδοσκόπιου το οποίο εισέρχεται στην άρθρωση μέσω μιας μικρής τομής. Το αρθροσκόπιο στο οποίο βρίσκεται προσαρτημένο μια κάμερα καθιστά δυνατό τον εντοπισμό και την επιτόπου επιδιόρθωση κακώσεων του χόνδρου. Ο ασθενής συνήθως υπόκειται σε ολική αναισθησία, ενώ ο χειρούργος με τη χρήση της κάμερας παρατηρεί στην οθόνη το εσωτερικό της άρθρωσης. Στο γόνατο ανοίγονται δύο μικρές οπές, μία για το αρθροσκόπιο και μία για τα χειρουργικά όργανα που χρησιμοποιούνται στην κοιλότητα της άρθρωσης, όπως φαίνεται και στην παρακάτω εικόνα. 62

63 Εικόνα 2.6: Το αρθροσκόπιο είναι όργανο στο οποίο βρίσκεται προσαρτημένη μία μικρή κάμερα και μια πηγή ακτινοβολίας. Η αρθροσκόπηση μπορεί να χρησιμοποιηθεί τόσο για τη διάγνωση όσο και για την αντιμετώπιση της οστεοαρθρίτιδας. Ωστόσο και οι δύο διαδικασίες ενέχουν σημαντικά μειονεκτήματα. Κατά τη χρήση της ως μοναδικό διαγνωστικό εργαλείο υπόκειται σε πολλούς περιορισμούς λόγω του υψηλού κόστους, της επεμβατικής φύσης του αλλά και 63

64 σχετικών πιθανών επιπλοκών που σχετίζονται με το χειρουργείο. Ένα ακόμα μειονέκτημα της αρθροσκοπικής εξέτασης είναι ότι παρέχει πληροφορίες για τη συνοχή της αρθρικής επιφάνειας αλλά χωρίς να προσδιορίζει το μέγεθος της μείωσης του πάχους του χόνδρου. Για τον καθορισμό του τελευταίου είναι συνήθως απαραίτητη η συμπληρωματική χρήση μιας τεχνικής απεικόνισης επιπλέον Μέθοδοι απεικόνισης Ακτίνες Χ Γενικά, οι ακτίνες Χ είναι χρήσιμες για τη μελέτη της παθολογίας στο σκελετικό σύστημα όπως επίσης και κάποιων ασθενειών στο μαλακό ιστό. Ωστόσο, παρέχουν τη δυνατότητα απεικόνισης μόνο των ανόργανων συστατικών του οστού, με αποτέλεσμα να μην μπορεί να απεικονιστεί ο χόνδρος. Έτσι, στην περίπτωση της οστεοαρθρίτιδας οι απλές ακτίνες Χ δείχνουν μόνο τη βλάβη του χόνδρου όταν αυτή σχετίζεται με τραυματισμό του υποχόνδρινου οστού και έτσι είναι λογικό μικρές βλάβες να μην μπορούν να εντοπιστούν. Το γεγονός αυτό σε συνδυασμό με την υποκειμενική εκτίμηση του παρατηρητή καθιστά τις ακτίνες Χ λιγότερο ευαίσθητη από αντίστοιχες επεμβατικές τεχνικές. Παρόλα τα μειονεκτήματά τους και τη βλαβερή ιονίζουσα ακτινοβολία που χρησιμοποιείται κατά την έκθεση, οι ακτίνες Χ συνεχίζουν να χρησιμοποιούνται ως διαγνωστικό εργαλείο στην οστεοαρθρίτιδα λόγω του χαμηλού κόστους της εξέτασης, της ύπαρξης εξοπλισμού σε όλα σχεδόν τα νοσοκομεία και ιατρικά κέντρα και έτσι την αυξημένη προσβασιμότητα της τεχνικής. 64

65 Εικόνα 2.7: Α) Πρόσθια- οπίσθια ακτινογραφίες ασθενή με αμφίπλευρη μεσαίου βαθμού οστεοαρθρίτιδα γονάτου που παρουσιάζει στένωση αρθρικού διάκενου και σχηματισμό οστεόφυτων. Η στένωση του αρθρικού διάκενου είναι μεγαλύτερη στο δεξί γόνατο (τόξο) σε σύγκριση με το αριστερό. B) Μεγέθυνση της δεξιάς άρθρωσης του γονάτου. Το βέλος υποδεικνύει μεσαίου βαθμού στένωση αρθρικού διάκενου. Ο σχηματισμός οστεόφυτων είναι εμφανής στο μηριαίο και στο κνημιαίο οστό. Μαγνητική Τομογραφία (ΜRI) Η μαγνητική τομογραφία κάνει χρήση της αντίθεσης φωτεινότητας στην εικόνα ώστε να δώσει έμφαση σε διαφορετικούς τύπους ιστών. Στη συγκεκριμένη μέθοδο μπορούν να απεικονιστούν τόσο ανόργανα όσο και οργανικά συστατικά. Η μαγνητική τομογραφία (ΜRI) είναι η μόνη μη επεμβατική μέθοδος που χρησιμοποιείται σήμερα με την οποία είναι δυνατή η λήψη πληροφοριών για την κατάσταση του αρθρικού χόνδρου. Σε σύγκριση με τις ακτίνες Χ ή την αξονική τομογραφία, το MRI έχει μεγαλύτερη ευαισθησία στην αξιολόγηση της έκτασης και της σοβαρότητας των μεταβολών του αρθρικού χόνδρου στην οστεοαρθρίτιδα [85] καθώς δίνει πληροφορίες για κακώσεις στον αρθρικό χόνδρο, το υποχόνδρινο οστό, πιθανή ύπαρξη οιδήματος αλλά και θραυσμάτων χόνδρου ή οστού στην άρθρωση. 65

66 Κάποια από τα προβλήματα που ενέχει η διάγνωση με MRI είναι η πιθανή υποτίμηση του μεγέθους της δυσμορφίας του χόνδρου [86] αλλά και η αδυναμία ανίχνευσης πρώιμων σταδίων της οστεοαρθρίτιδας [87]. Εικόνα 2.8: Απεικόνιση άρθρωσης με μαγνητική τομογραφία. Στην εικόνα σημειώνονται σημεία απώλειας αρθρικού χόνδρου, αλλά και εμφάνισης οστεόφυτων. Άλλες μέθοδοι απεικόνισης Κάποιες άλλες μέθοδοι απεικόνισης που δεν χρησιμοποιούνται πλέον στην κλινική πράξη αλλά έχουν αναφερθεί στη βιβλιογραφία και θα μπορούσαν ίσως να συνεισφέρουν στη διάγνωση της οστεοαρθρίτιδας είναι η ραδιονουκλεϊδική απεικόνιση, η αρθρογραφία, αξονική τομογραφία, τομογραφία οπτικής συνοχής και οι υπέρηχοι. Η ραδιονουκλεϊδική απεικόνιση έχει χρησιμοποιηθεί με μερική επιτυχία για να 66

67 καθορίσει την παρουσία της φλεγμονής στην άρθρωση. Η τεχνική χρησιμοποιεί μειωμένα ποσά ακτινοβολίας συγκριτικά με τις συμβατικές ραδιογραφικές τεχνικές, ενώ το κόστος της είναι μικρότερο. Ωστόσο, η χρήση της στην εκτίμηση της εξέλιξης της ίδιας της νόσου είναι περιορισμένη. Η τεχνική της αρθρογραφίας αρθρώσεων έχει χρησιμοποιηθεί για την ανάδειξη εσωτερικών διαταραχών και ανωμαλιών στην αρθρική επιφάνεια. Συνδυασμένη με ακτίνες Χ ή αξονική τομογραφία μπορεί να χρησιμοποιηθεί για την εκτίμηση της επιφάνειας του χόνδρου [88] αλλά δεν προσφέρει πληροφορίες για τον μαλακό ιστό. Πλέον έχει αντικατασταθεί σε μεγάλο βαθμό από τη μαγνητική τομογραφία (MRI). Η χρήση της αξονικής τομογραφίας (CT) στην απεικόνιση του αρθρικού χόνδρου είναι περιορισμένη. Τα πλεονεκτήματα που προσφέρει έναντι της απλής ακτινογραφίας είναι ελάχιστα και περιορίζονται κυρίως στην περισσότερο λεπτομερή απεικόνιση. Αντίθετα, η ποσότητα ακτινοβολίας ακτίνων Χ είναι πολύ μεγαλύτερη από μια ακτινογραφία γεγονός που αποτρέπει τη χρήση της για την παρακολούθηση της εξέλιξης της νόσου. Η τομογραφία οπτικής συνοχής (OCT) καταγράφει υπερηχογραφήματα εγκάρσιων διατομών υπέρυθρης ακτινοβολίας προβάλλοντας με τον τρόπο αυτό εικόνες αρθρικού χόνδρου σχεδόν πραγματικού χρόνου [89]. Η OCT μπορεί να παρέχει ποσοτική πληροφορία για την κατάσταση του αρθρικού χόνδρου κατά την εξέλιξη της νόσου ενώ έχει αποδειχθεί ότι είναι ευαίσθητη και στις δομικές μεταβολές του κολλαγόνου [90]. Όσον αφορά στην τεχνική των υπερήχων, έχει αποδειχθεί ότι υπέρηχοι υψηλής συχνότητας μπορούν να απεικονίσουν αρθρικό χόνδρο και να παρέχουν πληροφορίες τόσο για την ακεραιότητα του χόνδρου [91] όσο και για το πάχος του [92] Ιστοπαθολογικές αναλύσεις Οι ιστοπαθολογικές αναλύσεις δεν αποτελούν συνήθη τρόπο διάγνωσης της οστεοαρθρίτιδας. Συνήθως πραγματοποιούνται σε περίπτωση που κρίνεται απαραίτητη η 67

68 επεμβατική μέθοδος της βιοψίας. Η ιστοπαθολογική αξιολόγηση είναι ο πιο άμεσος τρόπος για την εκτίμηση των μεταβολών στη μορφολογία του οστεοαρθριτικού χόνδρου. H ανάπτυξη νέων ανοσοϊστοχημικών τεχνικών έχει καταστήσει δυνατή την κατηγοριοποίηση των μεταβολών αυτών. Για πολλά χρόνια για την εκτίμηση της ποιότητας του χόνδρου και του ελέγχου της εξέλιξης της οστεοαρθρίτιδας σε ανθρώπινες μελέτες, γινόταν χρήση του συστήματος ταξινόμησης HHGS (histological/ histochemical grading system) το οποίο περιγράφτηκε από τον Mankin [93]. Το βασικότερο μειονέκτημα των ιστοπαθολογικών αναλύσεων έγκεται στην επεμβατική φύση της μεθόδου. Επίσης, η χρήση των ιστοπαθολογικών αναλύσεων ως μέσο διάγνωσης και παρακολούθησης της εξέλιξης της οστεοαρθρίτιδας προκαλεί βλάβη του ιστού λόγω της επαναλαμβανόμενης αφαίρεσης δειγμάτων για ιστολογική βιοψία. Οι ιστοπαθολογικές αναλύσεις είναι η μόνη τεχνική που χρησιμοποιείται στη σύγχρονη κλινική πράξη που μπορεί να αποκαλύψει τις δομικές μεταβολές κατά την εξέλιξη της οστεοαρθρίτιδας. Είναι επομένως εμφανής η ανάγκη ύπαρξης νέων τεχνικών που θα μπορούσαν να βελτιώσουν σημαντικά την ποιότητα διάγνωσης της οστεοαρθρίτιδας στο μέλλον. 2.3 Μειονεκτήματα συμβατικών τεχνικών για τη διάγνωση της οστεοαρθρίτιδας Οι περισσότερες από τις παραπάνω τεχνικές διάγνωσης της οστεοαρθρίτιδας έχουν κάποιο περισσότερο ή λιγότερο σοβαρό μειονέκτημα στην εφαρμογή τους. Έτσι, είτε ενέχουν κινδύνους λόγω της επεμβατικής τους φύσης, όπως η αρθροσκόπηση, είτε είναι επιβλαβείς για την υγεία του ανθρώπου, όπως για παράδειγμα οι ακτίνες Χ οι οποίες χρησιμοποιούν μήκος κύματος που αλληλεπιδρά με το ανθρώπινο DNA και το αλλοιώνει [94]. Εκτός όμως από τα μειονεκτήματα που εμφανίζουν, οι σύγχρονες διαγνωστικές μέθοδοι της οστεοαρθρίτιδας συνήθως δεν έχουν τη δυνατότητα να καταγράψουν με ασφάλεια τα πρώιμα στάδια της νόσου. Οι δομικές μεταβολές που λαμβάνουν χώρα κατά την εξέλιξη 68

69 της νόσου γίνονται ανιχνεύσιμες όταν η ΟΑ είναι προχωρημένη [95-97]. Εκτός από την αδυναμία των σύγχρονων τεχνικών διάγνωσης της οστεοαρθρίτιδας να προσφέρουν επαρκείς πληροφορίες για τη διάγνωση των πρώιμων σταδίων της ασθένειας, πρέπει επιπλέον να σημειωθεί το γεγονός ότι δεν δίνουν καμία πληροφορία σε μοριακό επίπεδο. Έτσι, οι χημικές μεταβολές που λαμβάνουν χώρα κατά την εξέλιξη της νόσου δεν μπορούν να εκτιμηθούν ούτε ποιοτικά αλλά ούτε και ποσοτικά. Ακόμα και η πολλά υποσχόμενη για πρόωρη ανίχνευση της οστεοαρθρίτιδας μέθοδος της απεικόνισης μαγνητικού συντονισμού (MRI) [98], παρόλο που μπορεί να φανεί χρήσιμο στη διάγνωση της νόσου με την εκτίμηση του πάχους του χόνδρου γύρω από την άρθρωση, αδυνατεί στο να προσφέρει ποιοτική πληροφορία για πιθανές αλλοιώσεις στη χημική σύσταση του αρθρικού χόνδρου. Το MRI αντιμετωπίζει επιπλέον το πρόβλημα της χαμηλής ευκρίνιας. Αυτό εμποδίζει τον έλεγχο της αποικοδόμησης του χόνδρου σε επίπεδο μικροδομής [99]. Τέλος, οι ιστοπαθολογικές αναλύσεις σπάνια χρησιμοποιούνται ως μέσο πρώιμης διάγνωσης της νόσου, τόσο λόγω της επεμβατικές τους φύσης, όσο και λόγω του τραυματισμού του αρθρικού χόνδρου που προκαλείται από την επαναλαμβανόμενη αφαίρεση τμημάτων χόνδρου για ιστολογική ανάλυση. 2.4 Δονητικές τεχνικές στη διάγνωση ασθενειών οστού και χόνδρου Η φασματοσκοπία Raman και υπερύθρου είναι δύο δονητικές τεχνικές που έχουν τη δυνατότητα να παρέχουν σημαντική χημική ποιοτική και ποσοτική πληροφορία για το εκάστοτε δείγμα. Οι τεχνικές αυτές έχουν χρησιμοποιηθεί κατά καιρούς από διάφορες ερευνητικές ομάδες για τη μελέτη ασθενειών οστού και χόνδρου. Η φασματοσκοπία IR έχει χρησιμοποιηθεί για τη συγκριτική ανάλυση της βιοχημικής σύστασης του αρθρικού υγρού ασθενών με διάφορες μορφές αρθροπάθειας [100]. Τα δεδομένα που προκύπτουν από τη φασματοσκοπία IR αποτελούν το μοριακό αποτύπωμα του αρθρικού υγρού, με τις σχετικές εντάσεις των κορυφών στο φάσμα υπερύθρου να αντιπροσωπεύουν τις συγκεντρώσεις των κυριότερων βιομορίων που περιέχονται στο 69

70 υγρό. Έτσι, οι μεταβολές στη σύσταση του αρθρικού υγρού, έχουν ως αποτέλεσμα αλλαγές στο αποτύπωμα που λαμβάνεται μέσω της φασματοσκοπίας IR. Εκτός από τη μελέτη του αρθρικού υγρού, η φασματοσκοπία IR έχει επίσης χρησιμοποιηθεί από διαφορετικές ερευνητικές ομάδες τόσο σε ex vivo [101] όσο και σε in vivo [102] μελέτη οστεοαρθριτικών αρθρώσεων. Και στις δύο περιπτώσεις ωστόσο η τεχνική αδυνατούσε να εντοπίσει με ακρίβεια το στάδιο της νόσου, δηλαδή το πόσο σοβαρές ή όχι ήταν οι αλλοιώσεις στο στρώμα του αρθρικού χόνδρου. Επιπλέον, η ύπαρξη υγρασίας στους ιστούς αποτελεί πολύ σημαντικό πρόβλημα κατά την ανάλυση με τη χρήση φασματοσκοπίας υπερύθρου και αυτός είναι ένας από τους βασικούς λόγους για τους οποίους η συγκεκριμένη τεχνική δεν χρησιμοποιήθηκε για τη μελέτη των δειγμάτων μας. Η φασματοσκοπία Raman είναι μία τεχνική που στηρίζεται στην ανελαστική σκέδαση και είναι ικανή να παρέχει πληροφορίες για τις βιοχημικές και βιομοριακές δομές των δειγμάτων. Έχει ήδη αποδειχθεί ότι αποτελεί ένα χρήσιμο μέσο για το χαρακτηρισμό βιομοριακών μεταβολών που σχετίζονται με ασθένειες [103]. Η φασματοσκοπία Raman έχει χρησιμοποιηθεί για τη μελέτη αρθρικού υγρού από οστεοαρθριτικούς ασθενείς [104], στη μελέτη του αρθρικού χόνδρου και του υποχόνδρινου οστού των αρθρώσεων [105], αλλά και στη μελέτη της δομής πρωτεογλυκανών και γλυκοζαμινογλυκανών (GAGs) [106], μεταβολών στον προσανατολισμό των ινών κολλαγόνου τένοντα [107] και ελαττωματικές ίνες κολλαγόνου από οφθαλμό [108]. Προσπάθειες της εφαρμογής της φασματοσκοπίας Raman έχουν γίνει και στη μελέτη της οστεοαρθρίτιδας από τους K. Esmonde-White et al. για τη μελέτη των μεταβολών στη βιοχημική σύσταση του αρθρικού υγρού αλλά και του ιστού της άρθρωσης γονάτων σε οστεοαρθριτικούς ασθενείς [104], χωρίς όμως να είναι δυνατή η διάκριση μεταξύ των διαφορετικών σταδίων της νόσου. Έρευνες έχουν πραγματοποιηθεί επίσης για τη μελέτη των μεταβολών στη χημική σύσταση του υποχόνδρινου οστού διαγονιδιακών ποντικιών στα πρώιμα στάδια της οστεοαρθρίτιδας [109], αλλά και σε ανθρώπινες οστεροαρθριτικές κεφαλές μηριαίου οστού [110] όπου ανιχνεύθηκε διαφορά στη σύσταση του 70

71 υποχόνδρινου οστού μεταξύ οστεοαρθριτικών και υγιών αρθρώσεων. Άλλη σημαντική προσπάθεια της μελέτης των πρώιμων βιομοριακών μεταβολών που λαμβάνουν χώρα κατά τη νόσο της οστεοαρθρίτιδας αλλά αποκλειστικά στον αρθρικό χόνδρο και μάλιστα με τη χρήση πολωμένης φασματοσκοπίας Raman έγινε από τους N.S.J. Lim et al σε δείγματα αρθρικού χόνδρου χοίρων [111]. Πράγματι, η παραπάνω μελέτη έδειξε ότι στα δείγματα που είχαν υποστεί πιέσεις ώστε να προσομοιάζουν αντίστοιχα οστεοαρθριτικά, υπήρξαν σημαντικές βιοχημικές μεταβολές οι οποίες δεν ήταν μάλιστα εμφανείς κατά την ιστολογική εξέταση των δειγμάτων. Παραλλαγές της φασματοσκοπίας Raman έχουν επίσης εφαρμοστεί στη λήψη φάσματος του οστού πάνω από το δέρμα μέχρι και σε 2-3cm βάθος [105, ]. Οι διατάξεις αυτές παρόλο που βρίσκονται ακόμα σε πειραματικό στάδιο είναι εξαιρετικά ελπιδοφόρες για την επίτευξη της μη επεμβατικής διάγνωσης ασθενειών του οστού κα του χόνδρου στο μέλλον και την εφαρμογή της στην κλινική πράξη Πλεονεκτήματα φασματοσκοπίας Raman έναντι των συμβατικών τεχνικών για τη διάγνωση της οστεοαρθρίτιδας Στην περίπτωση της οστεοαρθρίτιδας, όπως αναφέρθηκε και παραπάνω, η αρχική ρήξη του χόνδρου σε πρώιμο στάδιο λαμβάνει χώρα σε χημικό επίπεδο χωρίς είναι εμφανής κάποια μεταβολή στη δομή της επιφάνειας του αρθρικού χόνδρου [116]. Η καταστροφή του χόνδρου αρχίζει με ρήξη των ινών του κολλαγόνου στα επιφανειακά και στα μεσαία στρώματα, απώλεια πρωτεογλυκανών και τελικά θάνατο των χονδροκυττάρων [117, 118]. Ωστόσο, οι χημικές μεταβολές στα πρώιμα στάδια της νόσου δεν μπορούν να ανιχνευθούν με ακρίβεια με τις σύγχρονες κλινικές τεχνικές και για το λόγο αυτό φαίνεται πως είναι έντονη η ανάγκη για μια νέα διαγνωστική μέθοδο η οποία θα καλύπτει τα παραπάνω κενά στη διάγνωση των ασθενειών που σχετίζονται με τις βλάβες στον αρθρικό χόνδρο. Μια μεθόδος δηλαδή που θα παρέχει ταυτόχρονα ποιοτική και ποσοτική χημική πληροφορία για το σημείο που επιθυμούμε, καθιστώντας δυνατή τη διάγνωση της ασθένειας από τα πρώτα κιόλας στάδια, και επιπλέον θα είναι αβλαβής και ανώδυνη για 71

72 τον ασθενή. Η φασματοσκοπία Raman αποτελεί μια τεχνική με τα παραπάνω πλεονεκτήματα και λόγω της χημικής ποιοτικής και ποσοτικής πληροφορίας που προσφέρει θα μπορούσε ίσως να οδηγήσει σε έγκαιρη αναγνώριση δομικών βλαβών στον αρθρικό χόνδρο και έτσι να συνεισφέρει στην έγκαιρη παρέμβαση, πρόληψη και έλεγχο της εξέλιξης της ασθένειας. Με τον τρόπο αυτό οι άμεσες παρεμβατικές στρατηγικές που συνιστούν την πρόληψη, καθώς και η προστασία της άρθρωσης θα μπορούσαν να επιβραδύνουν ή να ανακουφίσουν τα συμπτώματα και δυνητικά ίσως να καθυστερήσουν την εξέλιξη της πάθησης του χόνδρου [119]. 2.5 Σκοπός πειραμάτων Παρά τις μελέτες που έχουν διεξαχθεί για τη μελέτη της οστεοαρθρίτιδας με τη χρήση φασματοσκοπίας Raman, δεν φαίνεται να έχει διασαφηνιστεί με ακρίβεια η μεταβολή της χημικής σύστασης στον αρθρικό χόνδρο και στο υποχόνδρινο οστό κατά την εξέλιξη της νόσου. Το κενό αυτό επιχειρεί να καλύψει ο συγκεκριμένος κύκλος πειραμάτων με τη χαρτογράφηση μιας τομής οστεοαρθριτικής κεφαλής μηριαίου οστού. Με τον τρόπο αυτό γίνεται εφικτός όχι απλά ο φασματοσκοπικός διαχωρισμός αρθρικού χόνδρου από υποχόνδρινο οστό, αλλά και η μελέτη τους σε βάθος της τομής της κεφαλής, τόσο σε υγιείς όσο και σε ασθενείς περιοχές. Επιπλέον, έγινε μελέτη των ενδιάμεσων σταδίων της νόσου στις διάφορες περιοχές χαρτογράφησης, ώστε να διασαφηνιστεί καλύτερα η εξέλιξη της νόσου. 72

73 ΚΕΦΑΛΑΙΟ 3 Θεωρία Raman 3.1 Εισαγωγή Για την επίτευξη του παραπάνω στόχου των πειραμάτων χρησιμοποιήθηκε η τεχνική της μικροσκοπίας Raman. Στο συγκεκριμένο κεφάλαιο θα γίνει ανάλυση του θεωρητικού υποβάθρου της τεχνικής αυτής. 3.2 Φασματοσκοπία Raman Η φασματοσκοπία Raman είναι μία δονητική τεχνική η οποία στηρίζεται στο ομώνυμο φαινόμενο Raman. Το 1921 ο ινδός φυσικός C.V. Raman προβληματίστηκε όταν κατά τη διάρκεια ενός ταξιδιού στην Ευρώπη παρατήρησε το μπλε χρώμα της θάλασσας και των παγετώνων κάτω από το φως του ήλιου. Έκτοτε, η περιέργειά του τον παρακίνησε στην εκτέλεση πολλών πειραμάτων σχετικά με τη σκέδαση του φωτός από το νερό, τα οποία τον οδήγησαν στην επιστημονική εξήγηση για το γαλάζιο χρώμα της θάλασσας και του ουρανού. Επτά χρόνια αργότερα (1928) και με τη χρήση ελάχιστου εξοπλισμού ανακαλύπτει το φαινόμενο που πήρε το όνομά του (Raman), ενώ το 1930 η ανακάλυψή του αυτή θα τιμηθεί με το πρώτο βραβείο Νόμπελ στον τομέα της Φυσικής που δόθηκε ποτέ σε Ασιάτη Θεωρητικό Υπόβαθρο Όταν φως και γενικά ηλεκτρομαγνητική ακτινοβολία προσπέσει σε μία επιφάνεια, η προσπίπτουσα ακτινοβολία θα σκεδαστεί προς τυχαίες κατευθύνσεις. Το μεγαλύτερο ποσοστό της ακτινοβολίας σκεδάζεται ελαστικά, δηλαδή διατηρώντας το ίδιο μήκος κύματος και επομένως την ίδια ενέργεια. Ο Raman ωστόσο ανακάλυψε ότι ένα πολύ μικρό ποσοστό της ακτινοβολίας (περίπου 0.001%) σκεδάζεται ανελαστικά, δηλαδή με διαφορετικό μήκος κύματος από αυτό της προσπίπτουσας ακτινοβολίας. Η διαφορά στο μήκος κύματος και άρα στη συχνότητα της ανελαστικής και της ελαστικής σκέδασης εξαρτάται από τη χημική δομή του μορίου που σκεδάζει την ακτινοβολία και για το λόγο 73

74 αυτό μπορεί να προσφέρει πολλές χρήσιμες πληροφορίες για το εκάστοτε δείγμα. Ποιος είναι όμως ο μοριακός μηχανισμός σκέδασης Raman και γιατί παρατηρείται αυτή η διαφορά συχνότητας ανάμεσα στη σκεδαζόμενη και στην προσπίπτουσα ακτινοβολία; Η θεωρία της σκέδασης Raman, σήμερα έχει κατανοηθεί καλά και αποδεικνύει ότι το φαινόμενο προκαλείται λόγω κβάντωσης των δονητικών επιπέδων. Αυτό σημαίνει πως η ηλεκτρομαγνητική ακτινοβολία αλληλεπιδρά με το μόριο υπό τη μορφή φωτονίων, δηλαδή πακέτων ενέργειας, με αποτέλεσμα αυτά είτε να χαθούν ολόκληρα είτε να προσληφθούν ολόκληρα από το μόριο. Στην περίπτωση που η ενέργεια της ακτινοβολίας είναι τόση ώστε να μην ευνοηθεί η μετάπτωση σε κάποιο ηλεκτρονιακό ή δονητικό επίπεδο, το μόριο μπορεί να αποκτήσει οποιαδήποτε τιμή ενέργειας από ένα άπειρο πλήθος τιμών ή εικονικών καταστάσεων (virtual states). Οι ασταθείς αυτές ηλεκτρονιακές καταστάσεις βρίσκονται μεταξύ της θεμελιώδους κατάστασης και της πρώτης διεγερμένης ηλεκτρονιακής και φαίνονται στο πάνω μέρος του σχήματος

75 Εικόνα 3.1: Ενεργειακές μεταπτώσεις ενός μορίου κατά το φαινόμενο Raman Μία εικονική κατάσταση έχει ενέργεια μικρότερη από μία πραγματική ηλεκτρονιακή μετάπτωση, ενώ η διέγερση και η αποδιέγερση συμβαίνουν σχεδόν ταυτόχρονα. Κατά την αποδιέγερση στη θεμελιώδη ενεργειακή κατάσταση, υπάρχουν τρία ενδεχόμενα που μπορούν να συμβούν. Στην πλειοψηφία των περιπτώσεων, το μόριο επιστρέφει στο ενεργειακό επίπεδο όπου βρισκόταν και πριν τη διέγερση. Στην περίπτωση αυτή η σκέδαση είναι ελαστική, δηλαδή τόσο η προσπίπτουσα όσο και η σκεδαζόμενη ακτινοβολία έχουν το ίδιο μήκος κύματος. Αυτός ο τύπος σκέδασης ονομάζεται Rayleigh και απεικονίζεται από το πρώτο ζεύγος βελών του σχήματος. Ωστόσο, υπάρχει και μια πολύ μικρή πιθανότητα ( %), η προσπίπτουσα 75

76 ακτινοβολία να σκεδαστεί ανελαστικά και έτσι το μόριο να μην επιστρέψει στο αρχικό του θεμελιώδες ενεργειακό επίπεδο, αλλά σε ένα από τα διεγερμένα δονητικά επίπεδα. Η περίπτωση αυτή αντιπροσωπεύει τη σκέδαση Raman. Η σκέδαση Rayleigh έχει σημαντικά μεγαλύτερη πιθανότητα να συμβεί από τη σκέδαση Raman, επειδή είναι πιθανότερη η μεταφορά ενέργειας σε μόρια που βρίσκονται στη θεμελιώδη κατάσταση και η επανεκπομπή της λόγω της επαναφοράς αυτών των μορίων στη θεμελιώδη κατάσταση. Στη σκέδαση Raman η σκεδαζόμενη ακτινοβολία είτε θα έχει μικρότερη είτε μεγαλύτερη ενέργεια από την αρχική προσπίπτουσα. Στην πρώτη περίπτωση μόλις η ακτινοβολία προσπέσει πάνω στο μόριο, αυτό θα διεγερθεί σε μία εικονική ασταθή κατάσταση και αμέσως μετά θα αποδιεγερθεί σε ένα δονητικό επίπεδο της θεμελιώδους ηλεκτρονιακής κατάστασης, του οποίου όμως η ενέργεια είναι μεγαλύτερη από αυτή του ενεργειακού επιπέδου όπου βρισκόταν το μόριο πριν την ακτινοβόληση. Έτσι, η σκεδαζόμενη ακτινοβολία θα έχει μικρότερη ενέργεια και άρα συχνότητα από την αρχική προσπίπτουσα. Αυτός ο τύπος σκέδασης ονομάζεται σκέδαση Stokes και απεικονίζεται από το δεύτερο ζεύγος βελών του σχήματος. Στην δεύτερη περίπτωση ανελαστικής σκέδασης, το μόριο το οποίο θα συναντήσει το φωτόνιο, τυχαίνει να βρίσκεται στο πρώτο δονητικό επίπεδο της θεμελιώδους ηλεκτρονιακής κατάστασης. Σε θερμοκρασία δωματίου το κλάσμα των μορίων στην κατάσταση αυτή είναι πολύ μικρό. Αφού το μόριο διεγερθεί στην ασταθή εικονική κατάσταση, μεταπίπτει σε δονητικό επίπεδο της θεμελειώδους ηλεκτρονιακής κατάστασης, το οποίο βρίσκεται χαμηλότερα ενεργειακά σε σχέση με το αρχικό δονητικό επίπεδο. Αυτό έχει ως αποτέλεσμα η σκεδαζόμενη ακτινοβολία να έχει μεγαλύτερη ενέργεια και άρα συχνότητα από την αρχική προσπίπτουσα. Ο συγκεκριμένος τύπος σκέδασης ονομάζεται σκέδαση anti- Stokes. Συνήθως η σκέδαση Stokes έχει περισσότερες πιθανότητες να συμβεί από τη σκέδαση anti- Stokes και αυτό γιατί όπως προαναφέρθηκε, η αρχική κατάσταση από την οποία ξεκινάει το μόριο στη σκέδαση Stokes είναι πολύ πιο πιθανή σε σχέση με αυτή στη σκέδαση anti- Stokes. Ωστόσο, ο λόγος των εντάσεων Stokes και anti- Stokes αυξάνει με την αύξηση της θερμοκρασίας επειδή, κάτω από τις συνθήκες αυτές, ένα μεγαλύτερο 76

77 τμήμα μορίων θα βρίσκεται στην πρώτη δονητική διεγερμένη κατάσταση. Γι αυτό και στην ανάπτυξη της φασματοσκοπίας Raman εκμεταλλευόμαστε την πρώτη σκέδαση, στην οποία η ενεργειακή διαφορά μεταξύ του αρχικού και του τελικού δονητικού επιπέδου της θεμελιώδους ηλεκτρονιακής κατάστασης όταν στο μόριο προσπέσει ακτινοβολία συγκεκριμένου μήκους κύματος (μετατόπιση Raman) είναι χαρακτηριστική του μορίου. Έτσι, οι διαφορετικοί τύποι δόνησης ενός μορίου μπορούν να ταυτοποιηθούν αναγνωρίζοντας τις μετατοπίσεις Raman στο φάσμα της ανελαστικά σκεδαζόμενης ακτινοβολίας του. Το γεγονός αυτό αξιοποιείται από τη φασματοσκοπία Raman για την απόκτηση χρήσιμων πληροφοριών για τη χημική σύσταση του δείγματος. Με τον τρόπο αυτό ένα μεγάλο εύρος ουσιών (άλατα, οργανικά μόρια, υγρά, αέρια) μπορούν να ταυτοποιηθούν άμεσα από το φάσμα Raman τους. Ωστόσο, πρέπει να σημειωθεί ότι η σκέδαση Raman παρατηρείται κυρίως σε ομοιοπολικούς δεσμούς και πολύ ασθενώς σε ιονικούς. Αυτό συμβαίνει επειδή ο δεσμός πρέπει να εμφανίζει πολωσιμότητα (polarizability). Ως πολωσιμότητα ορίζεται η ευκολία με την οποία μπορεί να παραμορφωθεί ο εξωτερικός ηλεκτρονικός φλοιός του ατόμου ή μορίου υπό την επίδραση ενός ηλεκτρικού πεδίου. Η πολωσιμότητα εξαρτάται από το πόσο ισχυρά έλκονται τα ηλεκτρόνια από τον πυρήνα και είναι διαφορετική σε κάθε τύπο δόνησης. Για παράδειγμα, στη συμμετρική έκταση η ισχύς της πρόσδεσης του ηλεκτρονίου στην ελάχιστη και στη μέγιστη διαπυρηνική απόσταση διαφέρει. Έτσι κατά τη διάρκεια της δόνησης η πολωσιμότητα μεταβάλλεται και ο συγκεκριμένος τύπος δόνησης είναι ενεργός στο Raman. Αντίθετα, στην ασύμμετρη έκταση τα ηλεκτρόνια είναι ευκολότερα πολώσιμα κατά την επέκταση του δεσμού αλλά λιγότερο πολώσιμα κατά τη συμπίεσή του. Το αποτέλεσμα είναι να μην υπάρχει συνολική μεταβολή της πολωσιμότητας και έτσι ο συγκεκριμένος τύπος δόνησης να είναι ανενεργός στο Raman. 77

78 Υπάρχουν δύο βασικές μορφές δονήσεων: Δονήσεις τάσης (stretching): Χαρακτηρίζεται από μια συνεχή μεταβολή των αποστάσεων μεταξύ των ατόμων κατά μήκος του άξονα του δεσμού τους. Τα άτομα δηλαδή του δεσμού διαδοχικά πλησιάζουν και απομακρύνονται μεταξύ τους. Δονήσεις κάμψης (bending): Χαρακτηρίζεται από αλλαγή στη γωνία μεταξύ δύο δεσμών και μπορεί να είναι τεσσάρων ειδών: ψαλιδοειδής (scissoring), λικνιζόμενη (rocking), παλλόμενη (wagging) ή συστρεφόμενη (twisting). Τα διάφορα είδη δονήσεων απεικονίζονται στο παρακάτω σχήμα. Εικόνα 3.2: Βασικές μορφές δονήσεων 78

79 3.2.2 Μαθηματική προσέγγιση Έστω μια δέσμη ακτινοβολίας με συχνότητα v ο η οποία προσπίπτει σε ένα διάλυμα αναλύτη. Το ηλεκτρικό πεδίο Ε αυτής της ακτινοβολίας μπορεί να περιγραφεί από την εξίσωση: E E cos( v t) (3.1) o o όπου Ε ο το πλάτος του κύματος της έντασης. Όταν το ηλεκτρικό πεδίο της ακτινοβολίας αλληλεπιδρά με το ηλεκτρονιακό νέφος ενός δεσμού του αναλύτη, επάγει δημιουργία διπολικής ροπής m στον δεσμό, η οποία διπολική ροπή από τη σχέση: m ae ae cos( v t) (3.2) o o όπου α είναι μια σταθερά αναλογίας, που ονομάζεται πολωσιμότητα (polarizability) του δεσμού. Η πολωσιμότητα όπως αναφέρθηκε και παραπάνω αποτελεί μέτρο της δυνατότητας παραμόρφωσης του δεσμού υπό την επίδραση ηλεκτρικού πεδίου. Για να είναι ένα μόριο ενεργό κατά Raman, η πολωσιμότητα α ενός δεσμού αποτελεί συνάρτηση της απόστασης των πυρήνων σύμφωνα με την παρακάτω εξίσωση: a a ao ( r req ) (3.3) r όπου α 0 είναι η πολωσιμότητα στη διαπυρηνική απόσταση r eq ισορροπίας και r η απόσταση σε οποιαδήποτε στιγμή. Η μεταβολή στη διαπυρηνική απόσταση ποικίλλει ανάλογα με τη συχνότητα δόνησης του δεσμού ν ν με βάση την εξίσωση: r r cos(2 ) eq rm t (3.4) όπου r m είναι η μέγιστη διαπυρηνική απόσταση σε σχέση με τη θέση ισορροπίας. Αντικαθιστώντας την εξίσωση (3.3) στην (3.4) προκύπτει: a a ao rmcos(2 t) (3.5) r Στην συνέχεια μπορούμε να εξάγουμε μια σχέση για την επαγόμενη διπολική ροπή αντικαθιστώντας την τελευταία εξίσωση στην εξίσωση (3.2): 79

80 a m aoeo cos(2 vot) Eorm cos(2 t) cos(2 t) r Με εφαρμογή της τριγωνομετρικής ταυτότητας: cos( x y) cos( x y) cos xcos y 2 προκύπτει η σχέση που δίνει την πολωσιμότητα: (3.6) m a E 1 a 1 a o o cos(2 v t ) o orm cos[2 ( ) t] rm cos(2 ( ) t] 2 E r 2 r (3.7) Ο πρώτος όρος της εξίσωσης αντιπροσωπεύει τη σκέδαση Rayleigh, η οποία πραγματοποιείται στη συχνότητα διέγερσης ν ο. Ο δεύτερος και ο τρίτος όρος της εξίσωσης αντιστοιχούν στις συχνότητες Stokes (ν ο -ν ν ) και anti-stokes (ν ο +ν ν ). Η συχνότητα διέγερσης ν ν έχει διαμορφωθεί από τη συχνότητα δόνησης του δεσμού. Είναι σημαντικό επίσης να τονίσουμε ότι η σκέδαση Raman απαιτεί η πολωσιμότητα ενός δεσμού να εξαρτάται από την απόσταση, δηλαδή το a / r πρέπει να είναι μεγαλύτερο του μηδέν για να εμφανισθούν γραμμές Raman [120] Οργανολογία Μετά την ανακάλυψη της σκέδασης Raman, η επιστημονική κοινότητα επωφελήθηκε άμεσα από τις νέες γνώσεις πάνω στο φαινόμενο και έτσι η φασματοσκοπία Raman άρχισε να βρίσκει εφαρμογή ήδη από το Ωστόσο, μέχρι τις αρχές της δεκαετίας του 80, τα φασματόμετρα Raman ήταν παρόμοια στο σχεδιασμό και περιελάμβαναν τα ίδια τμήματα με τα κλασσικά όργανα διασποράς υπεριώδους/ ορατού. Τα περισσότερα σύγχρονα φασματόμετρα Raman είναι είτε όργανα μετασχηματισμού Fourier, είτε φασματόμετρα διασποράς, που βασίζονται σε ανιχνευτές σύζευξης φορτίου (CCD). Και τα δύο είδη αποτελούνται από τρία τμήματα: μία πηγή μονοχρωματικής ακτινοβολίας (laser), ένα σύστημα για την ακτινοβόληση του δείγματος και ένα κατάλληλο φασματόμετρο. Στις παρούσες πειραματικές μετρήσεις χρησιμοποιήσαμε 80

81 φασματόμετρο διασποράς το οποίο θα περιγραφεί παρακάτω. Οργανολογία micro- Raman: Στη μικροσκοπία Raman η καταγραφή των φασμάτων γίνεται με τη χρήση ενός φασματόμετρου διασποράς Raman συζευγμένο με μικροσκόπιο. Η διάταξη ενός φασματομέτρου Raman διασποράς περιλαμβάνει ένα μικροσκόπιο, ένα λέιζερ διέγερσης, ένα μονοχρωμάτορα και ένα οπτικά ευαίσθητο ανιχνευτή, όπως έναν ανιχνευτή σύζευξης φορτίου (CCD) ή ένα σωλήνα φωτοπολλαπλασιαστή (PMT). Εικόνα 3.3: Σχηματική αναπαράσταση ενός φασματομέτρου Raman συζευγμένο με μικροσκόπιο [121] 81

82 Όπως αναφέρθηκε και παραπάνω, η φασματοσκοπία Raman βασίζεται στο φαινόμενο της ανελαστικής σκέδασης της ακτινοβολίας λόγω των μεταβολών στην πολωσιμότητα του ηλεκτρονιακού νέφους στο μόριο και στον υπολογισμό των μοριακών του δονήσεων. Το δείγμα ακτινοβολείται με μονοχρωματική ακτινοβολία (λέιζερ), ενώ για την παρατήρηση του φάσματος Raman στα φασματόμετρα διασποράς είναι απαραίτητος ο διαχωρισμός της σκεδαζόμενης ακτινοβολίας που συλλέγεται στα επιμέρους μήκη κύματος. Αυτό επιτυγχάνεται εστιάζοντας τη σκεδαζόμενη ακτινοβολία Raman σε ένα φράγμα περίθλασης, το οποίο διαχωρίζει τη δέσμη στα συστατικά μήκη κύματός της. Αυτά με τη σειρά τους κατευθύνονται πάνω σε έναν ανιχνευτή σύζευξης φορτίου (CCD) κατασκευασμένο από πυρίτιο. Η διάταξη ενός απλού φασματόμετρου διασποράς παρατίθεται στο παρακάτω διάγραμμα. Αυτό αποτελείται από μία πηγή μονοχρωματικής ακτινοβολίας λέιζερ, η οποία εστιάζεται στο δείγμα μέσω ενός φακού, και ένα σύστημα φίλτρου από το οποίο διέρχεται η εκπεμπόμενη ακτινοβολία Raman. Στο φίλτρο αυτό, το μεγαλύτερο ποσοστό της σκεδαζόμενης ακτινοβολίας Rayleigh απορρίπτεται. Η ακτινοβολία που εξέρχεται από το φίλτρο μεταφέρεται στη σχισμή του ανιχνευτή CCD μέσω του φράγματος περίθλασης, όπως φαίνεται στο παρακάτω σχήμα. 82

83 Εικόνα 3.4: Απλοποιημένο διάγραμμα φασματόμετρου Raman διασποράς. Το φράγμα περίθλασης είναι απαραίτητο στοιχείο ενός φασματομέτρου διασποράς για το λόγο ότι το φάσμα δεν μπορεί να καταγραφεί αν η σκεδαζόμενη από το δείγμα ακτινοβολία δεν αναλυθεί στα επιμέρους μήκη κύματος. Ένα φράγμα περίθλασης αποτελείται από πολλές ισαπέχουσες γραμμές/εγκοπές που σκεδάζει την ακτινοβολία και μαζί με το γενικότερο σχεδιασμό του φασματομέτρου καθορίζει την ανάλυση του οργάνου. Όσο μεγαλύτερος είναι ο αριθμός των γραμμών ανά μονάδα επιφανείας του φράγματος περίθλασης, τόσο μεγαλύτερη η γωνία διασποράς και τελικά η ανάλυση φάσματος που επιτυγχάνεται. Ο ανιχνευτής CCD είναι ένα από τα δύο είδη ανιχνευτή που μπορεί να χρησιμοποιηθεί σε μια διάταξη μικροσκοπίας Raman. Ο σωλήνας φωτοπολλαπλασιαστή αποτελεί το δεύτερο είδος ανιχνευτή. Ο ανιχνευτής τύπου CCD (charge-coupled device), ή αλλιώς συζευγμένου φορτίου χρησιμοποιείται ευρέως στα φασματόμετρα Raman λόγω της υψηλής του ευαισθησίας που τον καθιστά κατάλληλο για την ανάλυση του ασθενούς σήματος του φαινομένου. Οι ανιχνευτές τύπου CCD αποτελούνται μία πολύ μικρή πλάκα πάνω στην οποία βρίσκονται 83

Ερειστικό Σύστημα. Γεωργιάδου Ελευθερία και Μηλιάδου Αθανασία.

Ερειστικό Σύστημα. Γεωργιάδου Ελευθερία και Μηλιάδου Αθανασία. Ερειστικό Σύστημα Μια εργασία στο μάθημα της Βιολογίας από της μαθήτριες Γεωργιάδου Ελευθερία και Μηλιάδου Αθανασία. Υπεύθυνη Καθηγήτρια: Ζαρφτζιάν Μαριλένα Περιεχόμενα: Εισαγωγή Οστά Σύσταση του οστίτη

Διαβάστε περισσότερα

Οστίτης Ιστός Dr. med. Λουκάς Κωνσταντίνου Ορθοπεδικός Χειρουργός Στήριξη Κίνηση Οστά εξειδικευµένος στηρικτικός-συνδετικός ιστός χαρακτηριστικά: σκληρήσύστασηκαι ακαµψία, λόγω παρουσίαςαλάτων ασβεστίουστην

Διαβάστε περισσότερα

Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας

Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας Οστίτης Ιστός Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας λ ί Οστά εξειδικευμένος στηρικτικός-συνδετικός ιστός χαρακτηριστικά: σκληρή σύσταση και ακαμψία, λόγω παρουσίας αλάτων ασβεστίου στην

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΨΗ ΚΕΦΑΛΑΙΩΝ 1-7-8 ΕΠΑΝΑΛΗΨΗ ΚΕΦΑΛΑΙΩΝ 1-7-8 Α. ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ 1. Στον ανθρώπινο οργανισµό a) όλα τα κύτταρα έχουν το ίδιο σχήµα και την ίδια λειτουργία b) υπάρχουν κύτταρα µε το ίδιο σχήµα και την ίδια λειτουργία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού Εργαστήριο Ιατρικής Φυσικής Φυσική του Σκελετού Τα οστά πραγματοποιούν τουλάχιστον έξι λειτουργίες στο ανθρώπινο σώμα: 1. Υποστήριξη 2. Κίνηση 3. Προστασία διαφόρων οργάνων 4. Αποθήκευση χημικών ουσιών

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ Hράκλειο, εκέμβριος 2011 ΤΥΠΟΙ ΙΣΤΩΝ 1. Eπιθηλιακός Πολυεδρικά κύτταρα που είναι πάρα πολύ στενά συνδεδεμένα και φέρουν ελάχιστη μεσοκυττάρια ουσία 2. Συνδετικός Κύτταρα

Διαβάστε περισσότερα

Χόνδρος Αρθρώσεις. Σοφία Χαβάκη Επικ. Καθηγήτρια Εργαστήριο Ιστολογίας-Εμβρυολογίας

Χόνδρος Αρθρώσεις. Σοφία Χαβάκη Επικ. Καθηγήτρια Εργαστήριο Ιστολογίας-Εμβρυολογίας Χόνδρος Αρθρώσεις Σοφία Χαβάκη Επικ. Καθηγήτρια Εργαστήριο Ιστολογίας-Εμβρυολογίας Χόνδρος συνδετικός-στηρικτικός ιστός συμπαγής αλλά εύκαμπτος Λειτουργίες Χόνδρου υποστήριξη μαλακών ιστών απορρόφηση κραδασμών

Διαβάστε περισσότερα

Βλάβες του Αρθρικού Χόνδρου του Γόνατος: Διάγνωση και Αντιμετώπιση

Βλάβες του Αρθρικού Χόνδρου του Γόνατος: Διάγνωση και Αντιμετώπιση Βλάβες του Αρθρικού Χόνδρου του Γόνατος: Διάγνωση και Αντιμετώπιση Τι είναι ο αρθρικός χόνδρος; Ο αρθρικός χόνδρος είναι ένας στιλπνός, ομαλός, λείος και ανάγγειος ιστός που καλύπτει τις αρθρικές επιφάνειες

Διαβάστε περισσότερα

Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη

Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη Κεφάλαιο 1 Εισαγωγή στη βιολογική μηχανική Κεφάλαιο 2 Εκβιομηχανική των οστών Οι διαφάνειες που ακολουθούν Η ΑΝΑΤΟΜΙΚΗ ΘΕΣΗ ΤΟΥ ΑΝΘΡΩΠΟΥ Για να περιγράψουμε τα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Bλάβες αρθρικού χόνδρου και σύγχρονες θεραπείες - Ο Δρόμος για την Θεραπεία Δευτέρα, 02 Ιούλιος :04

Bλάβες αρθρικού χόνδρου και σύγχρονες θεραπείες - Ο Δρόμος για την Θεραπεία Δευτέρα, 02 Ιούλιος :04 Γράφει: Δρ. Νικόλαος Πισκοπάκης MD, PhD, Ορθοπεδικός Χειρουργός, Δ/ντής Ορθοπεδικής Κλινικής Αθλητικών Κακώσεων Ιατρικού Κέντρου Αθηνών, Πρόεδρος Ελληνικής Αρθροσκοπικής Εταιρείας (ΕΑΕ) Τι είναι ο αρθρικός

Διαβάστε περισσότερα

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Β-1 Οι συμπαγείς, σφαιροειδείς πρωτεΐνες Είναι ευδιάλυτες στο νερό Έχουν σφαιρικό σχήμα Έχουν τα περισσότερα πολικά αμινοξέα στην εξωτερική

Διαβάστε περισσότερα

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis imperfecta Μενδελικό Νόσημα Συχνότητα στον πληθυσμό: 1:20.000 80-95% αυτοσωμικό επικρατές 10-15% αυτοσωμικό

Διαβάστε περισσότερα

Πανεπιστημιο Θεσσαλιας Ιατρικη Σχολη

Πανεπιστημιο Θεσσαλιας Ιατρικη Σχολη Εισαγωγη στην Ορθοπαιδικη Κωνσταντινος Ν. ΜΑΛΙΖΟΣ Πανεπιστημιο Θεσσαλιας Ιατρικη Σχολη Εισαγωγη στην Ορθοπαιδικη Ορθοπαιδικη ή Ορθοπεδικη «παιδο-ορθωτικη» (Γ. Μπαμπινιωτης) Πανεπιστημιο Θεσσαλιας Ιατρικη

Διαβάστε περισσότερα


1. ΑΠΟ ΤΟ ΚΥΤΤΑΡΟ ΣΤΟΝ ΟΡΓΑΝΙΣΜΟ ΚΕΦΑΛΑΙΟ 1 1. ΑΠΟ ΤΟ ΚΥΤΤΑΡΟ ΣΤΟΝ ΟΡΓΑΝΙΣΜΟ ΚΥΤΤΑΡΑ ΚΑΙ ΙΣΤΟΙ Ο ανθρώπινος οργανισμός συνίσταται α- πό τρισεκατομμύρια κύτταρα. Τα κύτταρα αυτά εμφανίζουν σημαντική ποικιλομορφία, που αφορά το μέγεθος,

Διαβάστε περισσότερα

5.4 Το μυοσκελετικό σύστημα του ανθρώπου ΜΙΚΡΕΣ ΕΡΕΥΝΕΣ ΚΑΙ ΕΡΓΑΣΙΕΣ

5.4 Το μυοσκελετικό σύστημα του ανθρώπου ΜΙΚΡΕΣ ΕΡΕΥΝΕΣ ΚΑΙ ΕΡΓΑΣΙΕΣ 3. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει σωστά την πρόταση: Α. Η μέλισσα είναι έντομο που: α. έχει σπονδυλική στήλη β. μπορεί να κολυμπάει γ. πετάει με τη βοήθεια μεμβρανωδών

Διαβάστε περισσότερα

Ανθρώπινος Σκελετός. ñ Ανθεκτικότητα στην αποικοδόµηση. ñ Ιδανική πηγή πληροφοριών: προϊστορικά, ιστορικά, σύγχρονα

Ανθρώπινος Σκελετός. ñ Ανθεκτικότητα στην αποικοδόµηση. ñ Ιδανική πηγή πληροφοριών: προϊστορικά, ιστορικά, σύγχρονα Ανθρώπινος Σκελετός ñ Ανθεκτικότητα στην αποικοδόµηση ñ Ιδανική πηγή πληροφοριών: προϊστορικά, ιστορικά, σύγχρονα ñ Σκελετική ανατοµία: γονίδια + περιβάλλον ñ Ποικιλοµορφία: οντογένεση, φύλο, πληθυσµός,

Διαβάστε περισσότερα

Κινητικό σύστημα του ανθρώπου Μέρος Ι: Ερειστικό, μυϊκό και συνδεσμικό σύστημα. Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια

Κινητικό σύστημα του ανθρώπου Μέρος Ι: Ερειστικό, μυϊκό και συνδεσμικό σύστημα. Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια Κινητικό σύστημα του ανθρώπου Μέρος Ι: Ερειστικό, μυϊκό και συνδεσμικό σύστημα Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια Τα συστήματα του ανθρώπινου σώματος Αναπνευστικό σύστημα (αποτελείται

Διαβάστε περισσότερα


ΡΑΧΗ ΠΑΥΛΟΣ Γ. ΚΑΤΩΝΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΚΡΗΤΗΣ ΡΑΧΗ ΠΑΥΛΟΣ Γ. ΚΑΤΩΝΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΚΡΗΤΗΣ ΡΑΧΗ Αποτελεί τον μυοσκελετικό άξονα στήριξης του κορμού με κύριο οστικό στοιχείο τους σπονδύλους και την παράλληλη συμβολή

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα


«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα

Α Μέρος (από 2) Οστά του Κορμού (Σπονδυλική Στήλης, Θώρακα, Κρανίου)

Α Μέρος (από 2) Οστά του Κορμού (Σπονδυλική Στήλης, Θώρακα, Κρανίου) Α Μέρος (από 2) Οστά του Κορμού (Σπονδυλική Στήλης, Θώρακα, Κρανίου) 01/35 Το Ερειστικό Σύστημα αποτελείται από: 1. Τα Οστά 2. Τις Αρθρώσεις 3. Τους Συνδέσμους 02/35 ΟΣΤΑ ΤΟΥ ΣΚΕΛΕΤΟΥ Σύνολο: 285 οστά

Διαβάστε περισσότερα

Κινητικό σύστημα του ανθρώπου Σπονδυλική Στήλη

Κινητικό σύστημα του ανθρώπου Σπονδυλική Στήλη Κινητικό σύστημα του ανθρώπου Σπονδυλική Στήλη Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια Μπενέκα Νατάσσα Αναπλ. Καθηγήτρια ΤΕΦΑΑ ΔΠΘ . Σπονδυλική στήλη-περιγραφή οστών θωρακικού κλωβού και

Διαβάστε περισσότερα

Παθητικά στοιχεία. Οστά. Αρθρ. χόνδροι. Πολύπλοκη κατασκευή. Σύνδεσμοι τένοντες. Ενεργητικά στοιχεία. Ανομοιογενή βιολογικά υλικά.

Παθητικά στοιχεία. Οστά. Αρθρ. χόνδροι. Πολύπλοκη κατασκευή. Σύνδεσμοι τένοντες. Ενεργητικά στοιχεία. Ανομοιογενή βιολογικά υλικά. Κινησιοθεραπεία Ιδιότητες Υλικών 1 ΣΤΟΙΧΕΙΑ ΑΝΤΟΧΗΣ ΥΛΙΚΩΝ Ανθρώπινο σώμα Παθητικά στοιχεία Οστά Αρθρ. χόνδροι Πολύπλοκη κατασκευή Σύνδεσμοι τένοντες Ανομοιογενή βιολογικά υλικά Ενεργητικά στοιχεία Μύες

Διαβάστε περισσότερα

Είναι η σύνδεση δύο ή περισσότερων οστών με τη συμμετοχή ενός μαλακότερου ιστού

Είναι η σύνδεση δύο ή περισσότερων οστών με τη συμμετοχή ενός μαλακότερου ιστού Αρθρώσεις Είναι η σύνδεση δύο ή περισσότερων οστών με τη συμμετοχή ενός μαλακότερου ιστού Ανάλογα με το είδος αυτού του ιστού και τον τρόπο συμμετοχής του, καθορίζεται η κινητικότητα των οστών που συνδέονται.

Διαβάστε περισσότερα

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση.

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση. ΙΣΤΟΙ 1. Τα κύτταρα που αποτελούν τον οργανισµό µας, διακρίνονται σε διάφορους τύπους, παρά το γεγονός ότι όλα, τελικώς, προέρχονται από το ζυγωτό, δηλαδή το πρώτο κύτταρο µε το οποίο ξεκίνησε η ζωή µας.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 Από το κύτταρο στον οργανισμό

ΚΕΦΑΛΑΙΟ 1 Από το κύτταρο στον οργανισμό ΚΕΦΑΛΑΙΟ 1 Από το κύτταρο στον οργανισμό 1o ΔΙΑΓΩΝΙΣΜΑ - ΓΗ_Α_ΒΙΟ_0_11207, 2o ΔΙΑΓΩΝΙΣΜΑ - ΓΗ_Α_ΒΙΟ_0_11208 ΘΕΜΑ Δ Το ανθρώπινο σώμα, όπως και το σώμα κάθε πολυκύτταρου οργανισμού αποτελείται από πολλά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Στέφανος Πατεράκης (Φυσικ/τής)

Στέφανος Πατεράκης (Φυσικ/τής) ΜΥΣ Οι μύες είναι όργανα του ανθρωπίνου σώματος. Σχηματίζονται από μυϊκό ιστό. Μαζί με τους τένοντες συμβάλουν στην κίνηση των οστών. Είδη των μυών Ο μυς της καρδιάς, Οι λείοι, και Οι γραμμωτοί. Ο μυς

Διαβάστε περισσότερα

Βιοχημεία Τροφίμων Ι. Ενότητα 1 η Κρέας και ψάρι I (μέρος β) Όνομα καθηγητή: Έφη Τσακαλίδου. Τμήμα: Επιστήμης Τροφίμων & Διατροφής του Ανθρώπου

Βιοχημεία Τροφίμων Ι. Ενότητα 1 η Κρέας και ψάρι I (μέρος β) Όνομα καθηγητή: Έφη Τσακαλίδου. Τμήμα: Επιστήμης Τροφίμων & Διατροφής του Ανθρώπου Βιοχημεία Τροφίμων Ι Ενότητα 1 η Κρέας και ψάρι I (μέρος β) Όνομα καθηγητή: Έφη Τσακαλίδου Τμήμα: Επιστήμης Τροφίμων & Διατροφής του Ανθρώπου Στόχοι ενότητας Εισαγωγή στη σύσταση και τη διατροφική αξία

Διαβάστε περισσότερα

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Δημήτριος Τζεράνης, Ph.D. Εμβιομηχανική και Βιοϊατρική Τεχνολογία Τμήμα Μηχανολόγων Μηχανικών Ε.Μ.Π. Χειμερινό Εξάμηνο 2015 Περιεχόμενα Σύσταση των Ιστών Κύτταρα

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα


ΦΑΣΜΑΤΟΣΚΟΠΙΚΗ ΑΝΑΛΥΣΗ ΚΑΡΩΤΙΔΩΝ ΕΠΙΔΡΑΣΗ ΣΑΚΧΑΡΟΥ ΦΑΣΜΑΤΟΣΚΟΠΙΚΗ ΑΝΑΛΥΣΗ ΚΑΡΩΤΙΔΩΝ ΕΠΙΔΡΑΣΗ ΣΑΚΧΑΡΟΥ ΧΡΙΣΤΙΝΑ ΚΑΛΟΓΕΡΟΠΟΥΛΟΥ ΑΘΗΝΑ 2010 1 ΣΚΟΠΟΣ Η ανάλυση και μελέτη της μοριακής δομής των καρωτίδων αρτηριών με υπέρυθρη φασματοσκοπία. Η εξαγωγή συμπερασμάτων

Διαβάστε περισσότερα

Χόνδρος Οστίτης Ιστός. Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας

Χόνδρος Οστίτης Ιστός. Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας Χόνδρος Οστίτης Ιστός Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας-Εμβρυολογίας Χόνδρος συνδετικός-στηρικτικός ιστός συμπαγής αλλά εύκαμπτος υποστήριξη μαλακών ιστών εξασφάλιση oλισθηρής επιφάνειας για

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πυρήνες οστέωσης παιδικου σκελετου. Χρόνοι εμφάνισης.

Πυρήνες οστέωσης παιδικου σκελετου. Χρόνοι εμφάνισης. Πυρήνες οστέωσης παιδικου σκελετου. Χρόνοι εμφάνισης. Κωτούλα Αγορίτσα, Ιατρος ακτινολόγος, Επιμελήτρια Β Ακτινολογικό Εργαστήριο Νοσοκομείου Α.Ν.Θ. ΘΕΑΓΕΝΕΙΟ, Θεσ/νίκης Τα οστά σχηματίζονται με δύο τρόπους:

Διαβάστε περισσότερα

που φιλοξενεί τα όργανα του ανθρώπινου οργανισμού. Ένα υγειές σύστημα με ισχυρά οστά είναι απαραίτητο για την γενική υγεία και ποιότητα ζωής.

που φιλοξενεί τα όργανα του ανθρώπινου οργανισμού. Ένα υγειές σύστημα με ισχυρά οστά είναι απαραίτητο για την γενική υγεία και ποιότητα ζωής. ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΤΙΤΛΟΣ : ΟΙ ΠΑΘΗΣΕΙΣ ΤΩΝ ΟΣΤΩΝ ΚΑΙ ΤΑ ΑΙΤΙΑ ΠΟΥ ΤΙΣ ΠΡΟΚΑΛΟΥΝ! Εισαγωγή : Τα οστά είναι το σπίτι για να μείνουμε, είναι η στέγη που φιλοξενεί τα όργανα του ανθρώπινου οργανισμού. Ένα

Διαβάστε περισσότερα

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Πρωτοταγής δομή (αλληλουχία αμινοξέων) Δευτεροταγής δομή Η διάταξη της πεπτιδικής αλυσίδας στον χωρο αυτής καθ αυτής (χωρίς να ληφθούν υπ όψη οι ομάδες R) Τριτοταγής

Διαβάστε περισσότερα


ΣTHPIKTIKA KYTTAPA - EΞΩKYTTAPIA ΘEMEΛIA OYΣIA ΣTHPIKTIKA KYTTAPA - EΞΩKYTTAPIA ΘEMEΛIA OYΣIA µηχανική στήριξη Στηρικτικά κυτ. > παράγουν συστατικά εξωκυτ. θεµέλιας ουσίας για & οργάνωση τους χαρακτηριστικά τους > προέρχονται από το µεσέγχυµα παράγουν

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα


Κεφάλαιο 1 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΝΕΥΡΟΦΥΣΙΟΛΟΓΙΑΣ Κεφάλαιο 1 ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΝΕΥΡΟΦΥΣΙΟΛΟΓΙΑΣ 1.1. Εισαγωγή Ο ζωντανός οργανισµός έχει την ικανότητα να αντιδρά σε µεταβολές που συµβαίνουν στο περιβάλλον και στο εσωτερικό του. Οι µεταβολές αυτές ονοµάζονται

Διαβάστε περισσότερα


Ο ΣΚΕΛΕΤΟΣ ΤΗΣ ΣΠΟΝΔΥΛΙΚΗΣ ΣΤΗΛΗΣ Ο ΣΚΕΛΕΤΟΣ ΤΗΣ ΣΠΟΝΔΥΛΙΚΗΣ ΣΤΗΛΗΣ Αυχενικοί σπόνδυλοι 7 Θωρακικοί σπόνδυλοι 12 Οσφυϊκοί σπόνδυλοι 5 Ιερό οστό 5 συνοστεομένοι σπόνδυλοι Κόκκυγας Φυσιολογικά Κυρτώματα Σ.Σ. Η σπονδυλική στήλη δεν είναι

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ Hράκλειο, εκέμβριος 2011 ΤΥΠΟΙ ΙΣΤΩΝ 1. Eπιθηλιακός Πολυεδρικά κύτταρα που είναι πάρα πολύ στενά συνδεδεμένα και φέρουν ελάχιστη μεσοκυττάρια ουσία 2. Συνδετικός Κύτταρα

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική

Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική Μύες Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική κινητικότητα, την σπλαχνική κινητικότητα και τη κυκλοφορία

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

Κρανιακή Οστεοπαθητική

Κρανιακή Οστεοπαθητική Κρανιακή Οστεοπαθητική ΤΑ ΠΕΝΤΕ ΦΑΙΝΟΜΕΝΑ ΤΟΥ «ΠΡΩΤΟΓΕΝΗ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΜΗΧΑΝΙΣΜΟΥ» ΣΥΜΦΩΝΑ ΜΕ ΤΟΝ Dr. Sutherland Ο Dr. Sutherland (1873 1954), πατέρας της Κρανιακής Οστεοπαθητικής, παρατήρησε την λειτουργία

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Κατάταξη 2. Λειτουργίες 1. Πεπτιδικές ορμόνες 3. Πεπτιδικός δεσμός 1. Χαρακτηριστικά

Διαβάστε περισσότερα

Η Αρθροσκόπηση της Ποδοκνημικής Άρθρωσης

Η Αρθροσκόπηση της Ποδοκνημικής Άρθρωσης Η Αρθροσκόπηση της Ποδοκνημικής Άρθρωσης Ανατομική της Ποδοκνημικής Άρθρωσης Η ποδοκνημική άρθρωση είναι η άρθρωση που σχηματίζεται στη θέση σύνδεσης τριών οστών: του κάτω άκρου της περόνης προς τα έξω

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οι πληροφορίες σ αυτό το φυλλάδιο σχεδιάστηκαν για να σας βοηθήσουν να καταλάβετε περισσότερα γύρω από την επέμβαση της ολικής αρθροπλαστικής του

Οι πληροφορίες σ αυτό το φυλλάδιο σχεδιάστηκαν για να σας βοηθήσουν να καταλάβετε περισσότερα γύρω από την επέμβαση της ολικής αρθροπλαστικής του Οι πληροφορίες σ αυτό το φυλλάδιο σχεδιάστηκαν για να σας βοηθήσουν να καταλάβετε περισσότερα γύρω από την επέμβαση της ολικής αρθροπλαστικής του γόνατος. Σκοπεύει να είναι ένας γενικός οδηγός. Φυσικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Κυκλοφορικό Σύστηµα. Σοφία Χαβάκη. Λέκτορας

Κυκλοφορικό Σύστηµα. Σοφία Χαβάκη. Λέκτορας Κυκλοφορικό Σύστηµα Σοφία Χαβάκη Λέκτορας Εργαστήριο Ιστολογίας Εβρυολογίας, Ιατρική Σχολή, ΕΚΠΑ Κυκλοφορικό Σύστηµα Αιµοφόροκυκλοφορικό σύστηµα Λεµφoφόροκυκλοφορικό σύστηµα Αιµοφόρο Κυκλοφορικό Σύστηµα

Διαβάστε περισσότερα

4.1 ΕΡΕΙΣΤΙΚΟ ΣΥΣΤΗΜΑ. 4.1.1 Εισαγωγή. 4.1.2 Μορφολογία των οστών.

4.1 ΕΡΕΙΣΤΙΚΟ ΣΥΣΤΗΜΑ. 4.1.1 Εισαγωγή. 4.1.2 Μορφολογία των οστών. 4. ΣΤΗΡΙΞΗ 4.1 ΕΡΕΙΣΤΙΚΟ ΣΥΣΤΗΜΑ 4.1.1 Εισαγωγή Το ερειστικό σύστημα αποτελείται από τα οστά, που συνδέονται μεταξύ τους με διάφορα είδη κινητών αρθρώσεων, που επιτρέπουν την εκτέλεση ποικίλων κινήσεων

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ρευματολογία. Ψωριασική Αρθρίτιδα. Στέφανος Πατεράκης Φυσικοθεραπευτής, καθηγητής φυσ/πείας

Ρευματολογία. Ψωριασική Αρθρίτιδα. Στέφανος Πατεράκης Φυσικοθεραπευτής, καθηγητής φυσ/πείας Ρευματολογία Ψωριασική Αρθρίτιδα Στέφανος Πατεράκης Φυσικοθεραπευτής, καθηγητής φυσ/πείας Τι είναι η ψωριασική αρθρίτιδα; Η ψωριασική αρθρίτιδα είναι μια χρόνια φλεγμονώδης πάθηση που προσβάλλει τις αρθρώσεις

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΕΦΑΑ, Κομοτηνής. Λειτουργική ανατομική των κάτω άκρων - Ισχίο

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΕΦΑΑ, Κομοτηνής. Λειτουργική ανατομική των κάτω άκρων - Ισχίο ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΕΦΑΑ, Κομοτηνής Λειτουργική ανατομική των κάτω άκρων - Ισχίο Ανώνυμα οστά (συνένωση των λαγόνιο, ισχιακού και του ηβικού οστού) Ιερό οστό Άνω λαγόνια άκανθα Κάτω λαγόνια

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΗΛΕΚΤΡΙΚΑ ΣΗΜΑΤΑ ΑΠΟ ΤΟ ΣΩΜΑ (I) ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΦΥΣΙΚΗΣ ΗΛΕΚΤΡΙΚΑ ΣΗΜΑΤΑ ΑΠΟ ΤΟ ΣΩΜΑ (I) Γιάννης Τσούγκος ΓΕΝΙΚΑ:...πολλούς αιώνες πριν μελετηθεί επιστημονικά ο ηλεκτρισμός οι άνθρωποι γνώριζαν

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου Οργανική Χημεία Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου 1. Γενικά Δυνατότητα προσδιορισμού δομών με σαφήνεια χρησιμοποιώντας τεχνικές φασματοσκοπίας Φασματοσκοπία μαζών Μέγεθος, μοριακός τύπος

Διαβάστε περισσότερα

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου «ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ ΣΥΣΤΑΣΗ ΞΥΛΟΥ ΣΕ ΔΟΜΙΚΑ ΣΥΣΤΑΤΙΚΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΙΣΤΟΙ. Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια. Μπενέκα Νατάσσα Αναπλ. Καθηγήτρια ΤΕΦΑΑ ΔΠΘ

ΙΣΤΟΙ. Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια. Μπενέκα Νατάσσα Αναπλ. Καθηγήτρια ΤΕΦΑΑ ΔΠΘ ΙΣΤΟΙ Μάλλιου Βίβιαν Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Φυσικοθεραπεύτρια Μπενέκα Νατάσσα Αναπλ. Καθηγήτρια ΤΕΦΑΑ ΔΠΘ Ιστοί Οι ιστοί είναι σύνολο κυττάρων με την ίδια κατασκευή, μορφολογία και λειτουργία. Κάθε ιστός

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Θοδωρής Μπεχλιβάνης Αναστασία Συμεωνίδου Κατερίνα Παπά

Θοδωρής Μπεχλιβάνης Αναστασία Συμεωνίδου Κατερίνα Παπά Θοδωρής Μπεχλιβάνης Αναστασία Συμεωνίδου Κατερίνα Παπά έχει σχήμα πεπλατυσμένης σφαίρας Η διάμετρος, στον ενήλικα, είναι περίπου 2,5 cm Αποτελείται από τρεις χιτώνες, το σκληρό, το χοριοειδή και τον αμφιβληστροειδή.

Διαβάστε περισσότερα

Στοιχεία Φυσικοχηµείας και Βιοφυσικής

Στοιχεία Φυσικοχηµείας και Βιοφυσικής Στοιχεία Φυσικοχηµείας και Βιοφυσικής Β. Φαδούλογλου 2008 Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία

Διαβάστε περισσότερα

Γράφει: Τσαπακίδης Ιωάννης, Χειρουργός Ορθοπαιδικός

Γράφει: Τσαπακίδης Ιωάννης, Χειρουργός Ορθοπαιδικός Γράφει: Τσαπακίδης Ιωάννης, Χειρουργός Ορθοπαιδικός Η οστεοτομία είναι μια επέμβαση με την οποία ο χειρουργός διαχωρίζει το οστό (προκαλεί δηλαδή, τεχνικά κάταγμα). Στη συνέχεια επανατοποθετεί τα κομμάτια

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα