Πλατφόρμα «Αίσωπος» Εγχειρίδιο Χρήσης Πλατφόρμας. Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων. Έκδοση 2.1 Αθήνα, Ιούλιος 2015

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πλατφόρμα «Αίσωπος» Εγχειρίδιο Χρήσης Πλατφόρμας. Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων. Έκδοση 2.1 Αθήνα, Ιούλιος 2015"

Transcript

1 Σελίδα 1 από 152 Πλατφόρμα «Αίσωπος» Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων Εγχειρίδιο Χρήσης Πλατφόρμας Έκδοση 2.1 Αθήνα, Ιούλιος 2015

2 Σελίδα 2 από 152 Πίνακας Περιεχομένων ΜΕΡΟΣ Α ΟΔΗΓΟΣ ΔΗΜΙΟΥΡΓΙΑΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ... 5 ΒΗΜΑ 1 (Τίτλος)... 6 ΒΗΜΑ 2 (Εκπαιδευτικό Πρόβλημα)... 7 ΒΗΜΑ 3 (Διδακτικοί Στόχοι)... 8 ΒΗΜΑ 4 (Φάσεις Σεναρίου) ΠΕΡΙΒΑΛΛΟΝ ΕΠΕΞΕΡΓΑΣΙΑΣ ΚΑΙ ΟΡΙΣΤΙΚΗΣ ΥΠΟΒΟΛΗΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ ΤΑΥΤΟΤΗΤΑ ΣΕΝΑΡΙΟΥ ΣΤΟΧΟΘΕΣΙΑ ΣΕΝΑΡΙΟΥ ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΣΤΟΧΩΝ ΦΑΣΕΙΣ ΣΕΝΑΡΙΟΥ ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΦΑΣΕΩΝ ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΔΟΜΙΚΩΝ/ΔΙΑΔΡΑΣΤΙΚΩΝ ΣΤΟΙΧΕΙΩΝ ΚΑΤΑΣΤΑΣΗ ΣΕΝΑΡΙΟΥ ΟΡΙΣΤΙΚΗ ΥΠΟΒΟΛΗ ΣΕΝΑΡΙΟΥ ΠΡΟΕΠΙΣΚΟΠΗΣΗ ΣΕΝΑΡΙΟΥ ΜΕΡΟΣ Β ΕΙΣΑΓΩΓΗ ΗΧΟΣ ΕΙΚΟΝΑ ΚΕΙΜΕΝΟ ΕΙΣΑΓΩΓΗ ΑΠΟΣΠΑΣΜΑΤΟΣ ΚΩΔΙΚΑ ΕΙΣΑΓΩΓΗ ΜΑΘΗΜΑΤΙΚΗΣ ΣΥΝΑΡΤΗΣΗΣ ΕΙΚΟΝΑ ΜΕ ΔΙΑΔΡΑΣΤΙΚΑ ΣΗΜΕΙΑ ΕΡΩΤΗΣΗ ΑΝΤΙΣΤΟΙΧΙΣΗΣ ΕΡΩΤΗΣΗ ΕΠΙΛΟΓΗΣ ΛΕΞΕΩΝ ΕΡΩΤΗΣΗ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ ΕΡΩΤΗΣΗ ΣΥΜΠΛΗΡΩΣΗΣ ΚΕΝΩΝ... 72

3 Σελίδα 3 από ΕΚΦΡΑΣΕΙΣ ΤΥΠΟΥ ΣΩΣΤΟ / ΛΑΘΟΣ ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ ΕΞΩΤΕΡΙΚΟ ΠΕΡΙΕΧΟΜΕΝΟ ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ ΧΡΟΝΟΛΟΓΙΟ ΚΑΡΤΕΣ ΕΡΩΤΗΣΕΩΝ ΚΑΡΤΕΣ ΔΙΑΛΟΓΟΥ ΔΙΑΔΡΑΣΤΙΚΟ ΒΙΝΤΕΟ ΔΙΑΓΡΑΦΗ ΔΙΑΔΡΑΣΤΙΚΟΥ ΣΤΟΙΧΕΙΟΥ (ΕΝΤΟΣ ΤΟΥ ΔΕ ΔΙΑΔΡ. ΒΙΝΤΕΟ) ΔΙΑΔΡΑΣΤΙΚΕΣ ΕΝΕΡΓΕΣ ΠΕΡΙΟΧΕΣ ΔΙΑΔΡΑΣΤΙΚΗ ΠΑΡΟΥΣΙΑΣΗ

4 Σελίδα 4 από 152 ΜΕΡΟΣ Α

5 Σελίδα 5 από ΟΔΗΓΟΣ ΔΗΜΙΟΥΡΓΙΑΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ Προκειμένου να δημιουργήσουμε ένα νέο Ψηφιακό Σενάριο μεταβαίνουμε στην URL διεύθυνση και συνδεόμαστε χρησιμοποιώντας το Όνομα χρήστη και τον Κωδικό που αποκτήσαμε κατά τη διαδικασία εγγραφής μας (Εικόνα 1). Εικόνα 1 Το Ψηφιακό Σενάριο αποτελείται από τέσσερα βασικά μέρη: τον Τίτλο, το Εκπαιδευτικό Πρόβλημα, τους Διδακτικούς Στόχους και τις Φάσεις Σεναρίου. Η βασική δομή του Σεναρίου δημιουργείται με τη βοήθεια ενός οδηγού-wizard σε τέσσερα βήματα (εικόνες 2 έως 7). Παρακάτω παρουσιάζεται η δημιουργία ενός Σεναρίου με τη βοήθεια του οδηγού.

6 Σελίδα 6 από 152 ΒΗΜΑ 1 (Τίτλος) Στο πεδίο κειμένου Τίτλος Σεναρίου (Εικόνα 2) εισάγουμε τον τίτλο του Ψηφιακού Σεναρίου, για παράδειγμα «Ο Κούρος του Παλαικάστρου». Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 2

7 Σελίδα 7 από 152 ΒΗΜΑ 2 (Εκπαιδευτικό Πρόβλημα) Στο πεδίο κειμένου Εκπαιδευτικό Πρόβλημα (Εικόνα 3) περιγράφουμε το εκπαιδευτικό πρόβλημα που επιλύει το σενάριο μας, για παράδειγμα «Να γνωρίσουν οι μαθητές του Γυμνασίου Παλαικάστρου (Επαρχία Σητείας) το σπουδαιότερο εύρημα στη μινωική πόλη του Παλαικάστρου». Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 3

8 Σελίδα 8 από 152 ΒΗΜΑ 3 (Διδακτικοί Στόχοι) Στο πεδίο κειμένου Διδακτικοί Στόχοι (Εικόνα 4) εισάγουμε τους διδακτικούς στόχους που θα ικανοποιούνται από το σενάριο μας, για παράδειγμα «Να περιγράφουν συνοπτικά την ιστορία του Κούρου του Παλαικάστρου». Η εισαγωγή διδακτικού στόχου είναι προαιρετική, ενώ ο μέγιστος αριθμός διδακτικών στόχων είναι το πέντε (5). Εικόνα 4

9 Σελίδα 9 από 152 Πατώντας το κουμπί μπορούμε να προσθέσουμε νέο Διδακτικό Στόχο, ενώ πατώντας το κουμπί μπορούμε να αφαιρέσουμε κάποιο Διδακτικό Στόχο (Εικόνα 5). Υποχρεωτική είναι η προσθήκη τουλάχιστον ενός Διδακτικού Στόχου. Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 5

10 Σελίδα 10 από 152 ΒΗΜΑ 4 (Φάσεις Σεναρίου) Στο πεδίο κειμένου Φάσεις Σεναρίου (Εικόνα 6) εισάγουμε μία ή περισσότερες φάσεις για το σενάριό μας, για παράδειγμα «Βιβλιογραφική μελέτη του θέματος και συλλογή πληροφοριών». Εικόνα 6

11 Σελίδα 11 από 152 Πατώντας το κουμπί μπορούμε να προσθέσουμε νέα Φάση Σεναρίου, ενώ πατώντας το κουμπί μπορούμε να αφαιρέσουμε κάποια Φάση Σεναρίου (Εικόνα 7). Υποχρεωτική είναι η προσθήκη τουλάχιστον μίας Φάσης Σεναρίου. Στη συνέχεια πατάμε το κουμπί Ολοκλήρωση για την ολοκλήρωση του οδηγού. Εικόνα 7

12 2. ΠΕΡΙΒΑΛΛΟΝ ΕΠΕΞΕΡΓΑΣΙΑΣ ΚΑΙ ΟΡΙΣΤΙΚΗΣ ΥΠΟΒΟΛΗΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ Σελίδα 12 από 152 Μετά την ολοκλήρωση του οδηγού δημιουργίας νέου Ψηφιακού Σεναρίου μεταβαίνουμε αυτόματα στο ολοκληρωμένο περιβάλλον επεξεργασίας και οριστικής υποβολής του Ψηφιακού Σεναρίου (Εικόνα 8). Εικόνα 8 Το Περιβάλλον αποτελείται από μία λίστα επιλογών που βρίσκεται στο αριστερό μέρος της οθόνης (Εικόνα 9). Οι επιλογές είναι: Προεπισκόπηση σεναρίου Ταυτότητα σεναρίου Στοχοθεσία σεναρίου Φάσεις σεναρίου Κατάσταση σεναρίου Οριστική υποβολή σεναρίου Όταν ενεργοποιήσουμε μια από αυτές τις επιλογές, στο κύριο μέρος της οθόνης εμφανίζονται λεπτομέρειες για την επιλογή αυτή.

13 Σελίδα 13 από 152 Εικόνα 9

14 Σελίδα 14 από ΤΑΥΤΟΤΗΤΑ ΣΕΝΑΡΙΟΥ Στην ταυτότητα σεναρίου (Εικόνες 10 έως 22) διακρίνουμε τρεις επιλογές περιγραφής του σεναρίου, οι οποίες παρουσιάζονται υπό μορφή καρτελών: 1. Βασικές Πληροφορίες (Εικόνα 10). Από την καρτέλα αυτή μπορούμε να επεξεργαστούμε τον Τίτλο και το Εκπαιδευτικό Πρόβλημα του Σεναρίου, πεδία τα οποία προέκυψαν από το βήμα 1 και 2 του οδηγού δημιουργίας νέου σεναρίου. Εικόνα Επιπλέον Πληροφορίες. Από την καρτέλα αυτή μπορούμε: o να δώσουμε μια «Γενική περιγραφή περιεχομένου» του ψηφιακού σεναρίου (Εικόνα 11)

15 Σελίδα 15 από 152 Εικόνα 11 o να προσθέσουμε (Εικόνα 12) ή να αφαιρέσουμε (Εικόνα 13) την εικόνα που συνδέεται με το Σενάριό μας και εμφανίζεται στις προεπισκοπήσεις του (Εικόνα 14). Εικόνα 12 Εικόνα 13

16 Σελίδα 16 από 152 Εικόνα 14 o να ορίσουμε «Λέξεις κλειδιά που χαρακτηρίζουν τη θεματική του σεναρίου» (Εικόνα 15). Οι λέξεις αυτές θα χρησιμοποιηθούν ως κλειδιά για την αναζήτηση του Σεναρίου από τους εξωτερικούς χρήστες του συστήματος για τη δημιουργία Ψηφιακών Σεναρίων. o να ορίσουμε την «Υλικοτεχνική υποδομή» (Εικόνα 15) για την ολοκλήρωση του Σεναρίου, για παράδειγμα προβολικό μηχάνημα, Η/Υ, μέσα μεταφοράς κ.λπ.. o να ορίσουμε τον «Τυπικό χρόνο αλληλεπίδρασης με το εκπαιδευτικό σενάριο σε διδακτικές ώρες για δουλειά εντός του σχολείου» (Εικόνα 15). Ο μέγιστος χρόνος διάρκειας του Σεναρίου είναι οι τρεις (3) διδακτικές ώρες. o να δηλώσουμε, εφόσον υπάρχουν, «Πνευματικά δικαιώματα ή άλλους αντίστοιχους περιορισμούς» που θα διέπουν το Σενάριο (Εικόνα 15). o να ορίσουμε αν «Είναι το Σενάριο Διαθεματικό» (Εικόνα 15).

17 Σελίδα 17 από 152 Εικόνα 15 o να εντάξουμε το Σενάριό μας σε μία από τις προκαθορισμένες «Θεματικές Ταξινομίες» (Εικόνα 16). Εικόνα 16 Το πεδίο της θεματικής ταξινομίας είναι τύπου drop-down (επιλογή από αναπτυσσόμενο μενού), το οποίο μπορεί να έχει μέχρι και τρία επίπεδα. Ακολουθώντας τα παρακάτω βήματα: Επιλέγετε την επιθυμητή ταξινομία (έως τρία επίπεδα) [αριθμός 1 συνημμένης εικόνας] Επιλέγετε "Προσθήκη" κάνοντας κλικ στο κουμπί για να περαστεί η επιλεγμένη ταξινομία [αριθμός 2 συνημμένης εικόνας] Επιλέγετε "Αποθήκευση" κάνοντας κλικ στο κουμπί για να αποθηκευτεί το σύνολο των αλλαγών [αριθμός 3 συνημμένης εικόνας]

18 Σελίδα 18 από 152 Εικόνα 16α Οι ταξινομίες είναι ορισμένες από άλλο πρόγραμμα και δεν υπάρχει δυνατότητα αλλαγής. Σε περίπτωση που αδυνατείτε να εντοπίσετε επακριβώς την ταξινομία που αναζητάτε, πρέπει να επιλέξετε αυτήν που είναι νοητικά πιο κοντά στο επιθυμητό αντικείμενο. ΣΗΜΕΙΩΣΗ: Στην επιλογή: "Είναι το Σενάριο Διαθεματικό;", θα πρέπει να σημειώσετε «ΝΑΙ» μόνο αν το σενάριο ανήκει στο Γνωστικό Αντικείμενο: "Διαθεματική Ομάδα". Για παράδειγμα, αν υποθέσουμε ότι ένας εκπαιδευτικός που του έχει ανατεθεί το Γνωστικό Αντικείμενο: Καλλιτεχνική Παιδεία, επιθυμεί να δημιουργήσει Δειγματικό Σενάριο στην Γλυπτική τότε θα πρέπει: α) Στην επιλογή: Είναι το Σενάριο Διαθεματικό; - Να επιλέξει: "OXI" β) Στην Θεματική Ταξινομία - Να επιλέξει: Καλλιτεχνική Παιδεία -> Εικαστικά ->Γλυπτική ΚΑΙ ΟΧΙ Καλλιτεχνικά -> Γλυπτική o να ορίσουμε το «Εκτιμώμενο Επίπεδο Δυσκολίας» του Σεναρίου (Εικόνα 17) σε πεντάβαθμη κλίμακα (από πολύ εύκολο έως πολύ δύσκολο). Εικόνα 17

19 Σελίδα 19 από 152 Για να ολοκληρώσουμε την επεξεργασία της καρτέλας Επιπλέον Πληροφορίες πατάμε το κουμπί Αποθήκευση (Εικόνα 17). 3. Πρόσθετες Επιλογές (Εικόνα 18). Εικόνα 18 Από την καρτέλα αυτή μπορούμε: o να ορίσουμε τον «Τύπο διαδραστικότητας» (Εικόνα 19) μεταξύ των επιλογών Ενεργός μάθηση, Παθητική μάθηση και Συνδυασμός παθητικής και ενεργητικής μάθησης. Εικόνα 19 o να ορίσουμε το «Επίπεδο διαδραστικότητας» (Εικόνα 20) μεταξύ των επιλογών χαμηλό, μεσαίο, υψηλό, πολύ υψηλό.

20 Σελίδα 20 από 152 Εικόνα 20 o να ορίσουμε την «Προτεινόμενη ηλικιακή ομάδα του τελικού χρήστη» (Εικόνα 21) Εικόνα 21 o να ορίσουμε την «Εκπαιδευτική βαθμίδα που απευθύνεται το σενάριο» (Εικόνα 22) Εικόνα 22 Για να ολοκληρώσουμε την επεξεργασία της καρτέλας Πρόσθετες Επιλογές πατάμε το κουμπί Αποθήκευση (Εικόνα 18).

21 Σελίδα 21 από ΣΤΟΧΟΘΕΣΙΑ ΣΕΝΑΡΙΟΥ Στη Στοχοθεσία Σεναρίου εμφανίζονται οι Διδακτικοί Στόχοι που προέκυψαν από το βήμα 3 του οδηγού δημιουργίας νέου σεναρίου (Εικόνα 23). Υπενθυμίζουμε ότι οι Διδακτικοί Στόχοι είναι προαιρετικοί και μπορούμε να προσθέσουμε έως πέντε (5). Εικόνα 23 Μας δίνεται η δυνατότητα Επεξεργασίας κάθε Διδακτικού Στόχου (Εικόνα 24), διορθώνοντας το κείμενο του και πατώντας Αποθήκευση. Εικόνα 24 Μπορούμε να αλλάξουμε τη σειρά των διδακτικών στόχων με την τεχνική της μεταφοράς και απόθεσης (drag and drop) (Εικόνα 25) και ακολούθως πατώντας Αποθήκευση. Εικόνα 25

22 Τέλος, μπορούμε να διαγράψουμε οποιονδήποτε διδακτικό στόχο. Πριν την οριστική διαγραφή, εμφανίζεται προειδοποιητικό μήνυμα (Εικόνα 26). Σελίδα 22 από 152 Εικόνα 26 ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΣΤΟΧΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των στόχων με τον ακόλουθο τρόπο: 1. Επιλέγουμε ΣΤΟΧΟΘΕΣΙΑ ΣΕΝΑΡΙΟΥ (Εικόνα 9). 2. Στον πίνακα με τους έως 5 στόχους που εμφανίζονται, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε στόχο (Εικόνα 25). 3. Επιλέγουμε το στόχο που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση (Εικόνα 25). 4. Για να ολοκληρωθεί η νέα κατάταξη των στόχων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 23).

23 Σελίδα 23 από ΦΑΣΕΙΣ ΣΕΝΑΡΙΟΥ Στις Φάσεις Σεναρίου εμφανίζονται οι Φάσεις που προέκυψαν από το βήμα 4 του οδηγού δημιουργίας νέου σεναρίου (Εικόνα 27). Μας δίνεται η δυνατότητα προσθήκης Νέας Φάσης Υλοποίησης, Επεξεργασίας και Διαγραφής της. Εικόνα 27 Επιλέγοντας το κουμπί Επεξεργασία εμφανίζονται τρεις καρτέλες ρυθμίσεων (Εικόνες 28 έως 32): 1. Βασικές Πληροφορίες (Εικόνα 28). Από την καρτέλα αυτή μπορούμε: o να επεξεργαστούμε τον Τίτλο Φάσης Σεναρίου. o να ορίσουμε τον Χώρο Διεξαγωγής της Φάσης, για παράδειγμα σχολική αίθουσα, εργαστήριο Πληροφορικής, Μουσείο Σητείας κ.λπ.. o να ορίσουμε τη Χρονική Διάρκεια της Φάσης σε λεπτά. Υπενθυμίζουμε ότι μέγιστος επιτρεπτός χρόνος υλοποίησης ολόκληρου του Σεναρίου είναι οι τρεις (3) διδακτικές ώρες, δηλαδή τρία σαρανταπεντάλεπτα. o να δώσουμε μία αναλυτική Περιγραφή της Φάσης του Σεναρίου. o να φορτώσουμε ένα Φύλλo Εργασίας υπό μορφή επεξεργάσιμου εγγράφου (.doc και.docx) ή/και υπολογιστικού φύλλου (xls και xlsx). Για να το επιτύχουμε αυτό πατάμε το κουμπί Αναζήτηση Αρχείου και επιλέγουμε το αρχείο μέσα από το σύστημα αρχείων του Η/Υ μας (τοπικούς δίσκους, εξωτερικούς δίσκους, CD και DVD rom κ.λπ.). Επίσης, μας δίνεται η δυνατότητα να προσθέσουμε κι άλλα φύλλα εργασίας (κουμπί +Προσθήκη 1 ακόμη αρχείου), καθώς και να αφαιρέσουμε (κουμπί Αφαίρεση) κάποιο από τα φύλλα εργασίας που έχουμε ήδη ανεβάσει (Εικόνα 29).

24 Σελίδα 24 από 152 Εικόνα 28 Εικόνα 29 Να σημειωθεί ότι όσα πεδία σημειώνονται με κόκκινο αστερίσκο (*) είναι υποχρεωτικά και η μη συμπλήρωσή τους θα ενεργοποιήσει προειδοποιητικό μήνυμα. Για να διατηρηθούν οι αλλαγές που κάναμε στην καρτέλα Βασικές Πληροφορίες θα πρέπει να πατήσουμε το κουμπί Αποθήκευση.

25 2. Εισαγωγή Διαδραστικών Εργαλείων. Επιλέγοντας αυτήν την καρτέλα αναδύεται ένα παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία (π.χ. Ήχος, Εικόνα, Κείμενο, Διαδραστικό Βίντεο) τα οποία μπορούμε να χρησιμοποιήσουμε για τη δημιουργία του Ψηφιακού Σεναρίου μας (Εικόνα 30). Αναλυτική περιγραφή των εργαλείων αυτών δίνεται στο «Εγχειρίδιο Εισαγωγής Διαδραστικών Εργαλείων». Σελίδα 25 από 152 Εικόνα Επεξεργασία Διαδραστικών Εργαλείων. Επιλέγοντας αυτήν την καρτέλα εμφανίζεται λίστα με τα Διαδραστικά Εργαλεία που έχουμε εισάγει (Εικόνα 31). Εικόνα 31 Επιλέγοντας το κουμπί Επεξεργασία που βρίσκεται δίπλα σε κάθε Εργαλείο, μπορούμε να επεξεργαστούμε τα αντίστοιχα πεδία Τίτλος, Διευκρίνιση και Σχόλιο (Εικόνα 32).

26 Σελίδα 26 από 152 Εικόνα 32 Τέλος, υποστηρίζεται η Διαγραφή των Εργαλείων και η μετακίνηση τους με την τεχνική της μεταφοράς και απόθεσης (drag and drop). Η πλοήγηση στις Φάσεις Σεναρίου και στις ρυθμίσεις αυτών, μπορεί εναλλακτικά να γίνει μέσω του πλαισίου ελέγχου στο αριστερό μέρος της οθόνης (Εικόνα 33). Εικόνα 33

27 Σελίδα 27 από 152 ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΦΑΣΕΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των φάσεων με τον ακόλουθο τρόπο: 1. Επιλέγουμε ΦΑΣΕΙΣ ΣΕΝΑΡΙΟΥ (Εικόνα 9). 2. Στον πίνακα με τις έως 5 φάσεις που εμφανίζονται, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε φάση (Εικόνα 27). 3. Επιλέγουμε τη φάση που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση. 4. Για να ολοκληρωθεί η νέα κατάταξη των φάσεων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 27). ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΔΟΜΙΚΩΝ/ΔΙΑΔΡΑΣΤΙΚΩΝ ΣΤΟΙΧΕΙΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των δομικών/διαδραστικών εργαλείων με τον ακόλουθο τρόπο: 1. Επιλέγουμε μία συγκεκριμένη Φάση (Εικόνα 33). 2. Από το υπο-μενού επιλέγουμε ΕΠΕΞΕΡΓΑΣΙΑ ΔΙΑΔΡΑΣΤΙΚΩΝ ΕΡΓΑΛΕΙΩΝ (Εικόνα 33). 3. Στον πίνακα με τα διαδραστικά στοιχεία που έχουμε αναθέσει στη συγκεκριμένη φάση, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε διαδραστικό στοιχείο (Εικόνα 31). 4. Επιλέγουμε το στοιχείο που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση. 5. Για να ολοκληρωθεί η νέα κατάταξη των διαδραστικών στοιχείων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 31).

28 Σελίδα 28 από ΚΑΤΑΣΤΑΣΗ ΣΕΝΑΡΙΟΥ ΟΡΙΣΤΙΚΗ ΥΠΟΒΟΛΗ ΣΕΝΑΡΙΟΥ Στην Κατάσταση Σεναρίου εμφανίζεται η κατάσταση (συμπληρωμένο ή ασυμπλήρωτο ) των υποχρεωτικών πεδίων του Σεναρίου (Εικόνα 34) καθώς και το ποσοστό συμπλήρωσης (π.χ. 57%). Εικόνα 34 Προϋπόθεση για την Οριστική Υποβολή Σεναρίου (Εικόνα 35) είναι η συμπλήρωση όλων των υποχρεωτικών πεδίων.

29 Σελίδα 29 από 152 Εικόνα 35 Σε αντίθετη περίπτωση θα εμφανιστεί προειδοποιητικό μήνυμα (Εικόνα 36). Εικόνα 36 ΠΡΟΣΟΧΗ: Μετά από την επιτυχή οριστική υποβολή ενός σεναρίου, το σενάριο κλειδώνει και δεν μπορεί να δεχθεί κανενός είδους επεξεργασία.

30 Σελίδα 30 από ΠΡΟΕΠΙΣΚΟΠΗΣΗ ΣΕΝΑΡΙΟΥ Ανά πάσα στιγμή μπορούμε να πατήσουμε το κουμπί Προεπισκόπηση Σεναρίου (Εικόνα 37) και να δούμε σύνοψη του Σεναρίου μας (Εικόνα 38, Εικόνα 39, Εικόνα 40) Εικόνα 37 Εικόνα 38

31 Σελίδα 31 από 152 Εικόνα 39 Εικόνα 40

32 Σελίδα 32 από 152 ΜΕΡΟΣ Β

33 Σελίδα 33 από 152 ΕΙΣΑΓΩΓΗ Σε αυτό το μέρος αναλύεται ο τρόπος χρήσης των διαθέσιμων Διαδραστικών Εργαλείων (ΔΕ), ώστε να σχεδιάσετε/αναπτύξετε τα σενάριά σας. Για κάθε ΔΕ προσφέρεται (στο πάνω μέρος της εκάστοτε οθόνης διαχείρισης) βοήθεια για τον τρόπο χρήσης. Υπάρχουν τρία κουμπιά υπό τον τίτλο Επιλογές Βοήθειας, όπως φαίνονται στην ακόλουθη εικόνα. Πατώντας το πρώτο κουμπί, ανοίγει νέο παράθυρο με πληροφορίες σχετικά με τον τρόπο χρήσης του συγκεκριμένου ΔΕ. Το δεύτερο κουμπί προσφέρει τη δυνατότητα να κατέβουν ( download ) οι οδηγίες χρήσης του συγκεκριμένου ΔΕ και οι συνολικές οδηγίες της πλατφόρμας, σε διαφορετικά αρχεία τύπου.pdf. Το τρίτο κουμπί προσφέρει υπερσυνδέσμους με παραδείγματα χρήσης του συγκεκριμένου ΔΕ. Σε ορισμένα ΔΕ (υψηλής σχετικά πολυπλοκότητας) υπάρχει κι ένα τέταρτο κουμπί, το οποίο εμπεριέχει τον τρόπο χρήσης του συγκεκριμένου ΔΕ αποτυπωμένο σε βίντεο ( screencast ).

34 Σελίδα 34 από ΗΧΟΣ 1) Για να εισάγουμε ένα αρχείο ήχου κάνουμε κλικ στο εικονίδιο του ήχου Όπου πηγαίνουμε στις επιλογές των αρχείων ήχου: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Με το κουμπί μας ανοίγει παράθυρο για να εισάγουμε το αρχείο μας:

35 Σελίδα 35 από 152 Από την επιλογή «Επιλέξτε αρχείο για μεταμόρφωση» εισάγουμε αρχείο που το έχουμε τοπικά στον υπολογιστή μας. Οι επιτρεπόμενοι τύποι αρχείων ήχου είναι mp3, wav ή ogg. Από την επιλογή «συμπληρώστε την θέση (URL) του αρχείου» μπορούμε να εισάγουμε αρχείο ήχου από μια διεύθυνση του διαδικτύου. Αν το αρχείο μας έχει δικαιώματα χρήσης κάνουμε κλικ στο κουμπί «Δικαιώματα χρήσης» και μας ανοίγει το παρακάτω παράθυρο Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό τον δημιουργό του. Στη Χρονολογία την χρονολογία που δημιουργήθηκε. Στην Πηγή από πού το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια, «Με άδεια/copyright» για αρχεία που απαιτούν άδεια ή το «-». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

36 Σελίδα 36 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

37 Σελίδα 37 από ΕΙΚΟΝΑ Για να εισάγουμε εικόνα κάνουμε κλικ στο εικονίδιο της εικόνας: Όπου πηγαίνουμε στις επιλογές των αρχείων εικόνας: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Με το κουμπί (Προσθήκη Αρχείου) μας ανοίγει παράθυρο για να εισάγουμε το επιθυμητό αρχείο εικόνας για εισαγωγή. Οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif.

38 Σελίδα 38 από 152 Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό το δημιουργό του. Στη Χρονολογία τη χρονολογία που δημιουργήθηκε. Στην Πηγή από πού το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια, «Με άδεια/copyright» για αρχεία που απαιτούν άδεια ή το «-». Στο πεδίο «Εναλλακτικό κείμενο» γράφουμε κάτι το οποίο θα εμφανιστεί όταν δεν μπορεί να φορτωθεί η εικόνα Στο πεδίο «Βοηθητικό κείμενο» γράφουμε κείμενο το οποίο εμφανίζεται όταν ο χρήστης τοποθετεί τον δείκτη του ποντικιού πάνω από την εικόνα. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

39 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 39 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

40 Σελίδα 40 από ΚΕΙΜΕΝΟ Για να εισάγουμε κείμενο κάνουμε κλικ στο εικονίδιο του κειμένου: Όπου πηγαίνουμε στις επιλογές του κειμένου: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Στο πεδίο «Κείμενο που θα φαίνεται» εισάγουμε το κείμενό μας Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

41 Σελίδα 41 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

42 Σελίδα 42 από 152 ΕΙΣΑΓΩΓΗ ΑΠΟΣΠΑΣΜΑΤΟΣ ΚΩΔΙΚΑ Επιλέγοντας το διαδραστικό εργαλείο Κείμενο δίνεται η δυνατότητα να προσθέσουμε απόσπασμα κώδικα προγραμματισμού. Η διαδικασία έχει ως ακολούθως: 1. Επιλογή διαδραστικού εργαλείου «Κείμενο» 2. Κλικ στο πλαίσιο «Κείμενο που θα φαίνεται» 3. Στη συνέχεια ανοίγει νέο παράθυρο, στο οποίο επιλέγουμε από την πάνω μπάρα το εικονίδιο «Εισαγωγή Αποσπάσματος Κώδικα» 4. Στη συνέχεια ανοίγει νέο παράθυρο με δύο επιλογές: α. Γλώσσα, β. Περιεχόμενο κώδικα. 5. Έστω ότι επιλέγουμε ως γλώσσα PHP και ως περιεχόμενο κώδικα το ακόλουθο κείμενο: /* PHP */

43 /* This is a piece of pseudo-code to locate a specific sequence of nucleocides in a given DNA piece of code */ // DNA piece of code $DNA_original="atggcccgagaccacctacttatgcattgtgcgaagttgctgcgtgactctgacacaaaacgca gtgcaaccttgttcagagggcaggtctacgcagaccagggagtgagtgcatgcgtt"; // locator, let's call it protein!! $protein="cag"; // return number of protein occurrences $number=substr_count($dna_original, $protein); // return the index of the first occurrence of the protein $first_occurrence=strpos($dna_original, $protein); // proper printing if ($number==0) { echo "This protein does not exist in the originally selected DNA sequence. Please try another sequence!"; } else if ($number==1) { echo "The protein $protein appears once in place $first_occurrence"; } else { echo "The protein $protein appears $number times while the first occurrence is in place $first_occurrence."; } Σελίδα 43 από Επιλέγουμε το κουμπί ΟΚ 7. Για να ολοκληρωθεί η αποθήκευση, φροντίζουμε ώστε όλα τα υποχρεωτικά πεδία με αστερίσκο να είναι συμπληρωμένα. Εδώ, το πεδίο Τίτλος πρέπει να είναι συμπληρωμένο.

44 Σελίδα 44 από Πατάμε το κουμπί Αποθήκευση. 9. Οι άνω επιλογές θα αποκτήσουν την ακόλουθη μορφή κατά την προεπισκόπηση του συγκεκριμένου διαδραστικού εργαλείου: ΕΙΣΑΓΩΓΗ ΜΑΘΗΜΑΤΙΚΗΣ ΣΥΝΑΡΤΗΣΗΣ Επιλέγοντας το διαδραστικό εργαλείο Κείμενο δίνεται η δυνατότητα να προσθέσουμε μαθηματική συνάρτηση με γραφική αποτύπωση. Η διαδικασία έχει ως ακολούθως: 1. Επιλογή διαδραστικού εργαλείου «Κείμενο» 2. Κλικ στο πλαίσιο «Κείμενο που θα φαίνεται» 3. Στη συνέχεια ανοίγει νέο παράθυρο, στο οποίο επιλέγουμε από την πάνω μπάρα το εικονίδιο «Μαθηματική Συνάρτηση» 4. Στη συνέχεια ανοίγει νέο παράθυρο όπου η μαθηματική συνάρτηση θα πρέπει να είναι συμβατή με τους κανόνες TeX. Οι κανόνες εμφανίζονται στον ακόλουθο σύνδεσμο https://en.wikibooks.org/wiki/latex/mathematics.

45 Σελίδα 45 από Επιλέγουμε το κουμπί ΟΚ 6. Για να ολοκληρωθεί η αποθήκευση, φροντίζουμε ώστε όλα τα υποχρεωτικά πεδία με αστερίσκο να είναι συμπληρωμένα. Εδώ, το πεδίο Τίτλος πρέπει να είναι συμπληρωμένο. 7. Πατάμε το κουμπί Αποθήκευση.

46 Σελίδα 46 από ΕΙΚΟΝΑ ΜΕ ΔΙΑΔΡΑΣΤΙΚΑ ΣΗΜΕΙΑ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας εικόνας, στην οποία μπορούμε να ορίσουμε πλήθος επεξηγηματικών σημείων, όπου ο χρήστης εξεταζόμενος μπορεί να δει επιπλέον πληροφορίες ανά σημείο. Για να δημιουργήσουμε εικόνα με διαδραστικά σημεία από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΙΚΟΝΑ ΜΕ ΔΙΑΔΡΑΣΤΙΚΑ ΣΗΜΕΙΑ». Ακολούθως, εμφανίζονται τα πεδία:

47 Σελίδα 47 από 152 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο. Μπορείτε να μεταφορτώσετε μία εικόνα (πεδίο Μεταφόρτωση Εικόνας / Φωτογραφίας) κάνοντας κλικ στο κουμπί «Προσθήκη Αρχείου», οπότε και ανοίγει παράθυρο διαλόγου για να εισάγουμε την εικόνα μας, πάνω στην οποία θα τοποθετήσουμε στη συνέχεια το πλήθος των διαδραστικών σημείων. Οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Πατώντας κλικ στα Δικαιώματα χρήσης, εμφανίζονται τα ακόλουθα πεδία: Στον τίτλο δίνουμε τον τίτλο του αρχείου. Στο δημιουργό τον δημιουργό του. Στη χρονολογία την χρονολογία που δημιουργήθηκε. Στην πηγή από πού το πήραμε. Στην άδεια χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια (εάν είμαστε σίγουροι για αυτό) ή «Με άδεια/copyright» για αρχεία που απαιτούν άδεια. Η επιλογή «-» υποδηλώνει το κενό και δεν είναι αποδεκτή. Για να κλείσετε τα εμφανιζόμενα πεδία των Δικαιωμάτων Χρήσης, πατήστε το κουμπί.

48 Στο πεδίο Χρώμα Διαδραστικού Σημείου μπορούμε να εισάγουμε το χρώμα της αρεσκείας μας για το διαδραστικό σημείο, όπως αυτό θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Σελίδα 48 από 152 Το χρώμα του διαδραστικού σημείου πάνω στην εικόνα ορίζεται σε δεκαεξαδική μορφή. Ενδεικτικά, το λευκό χρώμα απεικονίζεται ως FFFFFF, το μαύρο ως , το κόκκινο ως FF0000, το πράσινο ως 00FF00, το μπλε ως 0000FF, κοκ. Για περισσότερες πληροφορίες σχετικά με τους χρωματικούς κώδικες μπορείτε να επισκεφτείτε την ακόλουθη ιστοσελίδα: Για να εισάγουμε ένα διαδραστικό σημείο, επιλέγουμε «Περιγραφή Διαδραστικού Σημείου». Στη συνέχεια εμφανίζεται ο ακόλουθος πίνακας, οποίος έχει σειρά από πεδία τα οποία αναλύονται παρακάτω.

49 Σελίδα 49 από 152 Στον τίτλο, δίνουμε τον τίτλο του διαδραστικού σημείου. Στο κείμενο που θα φαίνεται, το κείμενο που θέλουμε να φαίνεται όταν κάνουμε κλικ πάνω στο διαδραστικό σημείο. Στην «Οριζόντια απόσταση (x)» δίνουμε την οριζόντια απόσταση από την αριστερή άκρη της εικόνας σε ποσοστό (0-100) [εάν π.χ θέλουμε να υποδείξουμε πως κάποιο σημείο βρίσκεται στο αριστερό μέρος της εικόνας επιλέγουμε εύρος τιμών 0 έως 35, για σημείο το οποίο θέλουμε να βρίσκεται στο κέντρο της εικόνας εύρος τιμών 36 έως 64, ενώ για σημείο το οποίο θέλουμε να βρίσκεται στο δεξιό μέρος της εικόνας επιλέγουμε εύρος τιμών 65 έως 100]. Στην «Κάθετη απόσταση (y)» δίνουμε την κάθετη απόσταση από το πάνω μέρος της εικόνας σε ποσοστό (0-100) [εάν π.χ θέλουμε να υποδείξουμε πως κάποιο σημείο βρίσκεται στο πάνω μέρος της εικόνας επιλέγουμε εύρος τιμών 0 έως 35, για σημείο το οποίο θέλουμε να

50 βρίσκεται στο μέσο της εικόνας εύρος τιμών 36 έως 64, ενώ για σημείο το οποίο θέλουμε να βρίσκεται στο κάτω μέρος της εικόνας επιλέγουμε εύρος τιμών 65 έως 100]. Για να επιτύχετε το ακριβές επιθυμητό σημείο, προτείνεται η επανειλημμένη αλλαγή των παραμέτρων x και y κατά βούληση. Σελίδα 50 από 152 Με κλικ στο κουμπί «Προσθήκη στοιχείου: Διαδραστικό σημείο» μπορούμε να προσθέσουμε και άλλα διαδραστικά σημεία στην εικόνα μας. Έχετε τη δυνατότητα να προσθέσετε όσα διαδραστικά σημεία επιθυμείτε, επαναλαμβάνοντας την προηγούμενη διαδικασία. Κάνοντας κλικ στο εικονίδιο μπορούμε να αφαιρέσουμε το διαδραστικό σημείο. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

51 Σελίδα 51 από ΕΡΩΤΗΣΗ ΑΝΤΙΣΤΟΙΧΙΣΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ερωτήσεων αντιστοίχισης. Μπορούμε να ορίσουμε πλήθος ερωτήσεων στις οποίες η σωστή απάντηση απουσιάζει στο σημείο που επιθυμούμε και βρίσκονται αριστερά, ενώ το πλήθος των ορθών απαντήσεων βρίσκονται προς τα δεξιά με τυχαία σειρά. Ο χρήστης εξεταζόμενος καλείται να διασυνδέσει τις προσφερόμενες ορθές απαντήσεις του δεξιού μέρους στις ερωτήσεις που βρίσκονται αριστερά, σύροντας με το ποντίκι την ορθή απάντηση και αφήνοντας στην ερώτηση (τεχνική drag-and-drop). Για να δημιουργήσουμε εικόνα με ερωτήσεις αντιστοίχισης από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΑΝΤΙΣΤΟΙΧΙΣΗΣ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

52 Σελίδα 52 από 152 Στη συνέχεια στο πεδίο Τίτλος για τις Ερωτήσεις Αντιστοίχισης δίνουμε την επιθυμητή περιγραφή του διαδραστικού στοιχείου. Στο πεδίο Πεδία Αντιστοίχισης μπορούμε να εισάγουμε πλήθος εκφράσεων για τις οποίες επιθυμούμε να γίνεται αντιστοίχιση. Κάθε έκφραση/παράγραφος δύναται να χωρίζεται με enter από την επόμενη. Για να ορίσουμε την πιθανή επιλογή αντιστοίχισης, τη χωρίζουμε με αστερίσκους (*), έναν στην αρχή της κι έναν στο τέλος της. ΠΡΟΣΟΧΗ: Στο κείμενο της πιθανής ορθής αντιστοίχισης δεν επιτρέπονται οι χαρακτήρες : (άνω-και-κάτω τελεία) και ο αστερίσκος (*). Ειδικότερα ο αστερίσκος αποτελεί διαχωριστικό σύμβολο και θα πρέπει να είστε προσεκτικοί, διότι εάν κατά λάθος τοποθετήσετε περιττό αριθμό αστερίσκων στο Πεδίο Αντιστοίχισης, ενδέχεται το αποτέλεσμα να οδηγήσει σε εσφαλμένη συμπεριφορά της Πλατφόρμας. Αξίζει να σημειωθεί πως σε μια έκφραση/ερώτηση έχετε τη δυνατότητα να προσφέρετε πάνω από μία επιλογές αντιστοίχισης, με την προϋπόθεση ότι συμπληρώνετε άρτιο αριθμό αστερίσκων (*) κατά βούληση. Κατά την προεπισκόπηση του διαδραστικού στοιχείου, ενδέχεται να προκύψει η ακόλουθη ερώτηση αντιστοίχισης, κατά την οποία πρέπει να σύρουμε το πλαίσιο της αντιστοίχισης στο δεξιό μέρος στην κατάλληλη θέση στις εκφράσεις στο αριστερό μέρος (τεχνική drag-and-

53 drop ). Υπόψη ότι κατά την προεπισκόπηση οι επιλογές αντιστοίχισης εμφανίζονται με τυχαία σειρά. Σελίδα 53 από 152 Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις Παραμέτρων παρέχουν τρεις επιλογές: Ενεργοποίηση επιλογής επανάληψης προσπάθειας (κουμπί) Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να επαναλάβει την προσπάθειά του για αντιστοίχιση, στην περίπτωση που έχει κάνει κάποιο λάθος κατά την αντιστοίχιση. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος Απαντήσεων), και στη συνέχεια το κουμπί (Επανάληψη Προσπάθειας), οπότε και του παρέχεται μια δεύτερη ευκαιρία να ξαναδοκιμάσει, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις αντιστοιχίσεις με το σωστό τρόπο, τότε δεν προσφέρεται η δυνατότητα για επανάληψη. Ενεργοποίηση επιλογής προβολής σωστών απαντήσεων (κουμπί) Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει τις ορθές απαντήσεις κατά την προεπισκόπηση του στοιχείου. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος Απαντήσεων). Στη συνέχεια, πατώντας το κουμπί (Προβολή Απαντήσεων) μπορεί να δει τις ορθές αντιστοιχίσεις, όπως φαίνεται στην ακόλουθη εικόνα,

54 μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις αντιστοιχίσεις με το σωστό τρόπο, τότε δεν υφίσταται ανάγκη για προβολή των ορθών απαντήσεων. Σελίδα 54 από 152 Άμεση προβολή σωστού/λάθος αποτελέσματος Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει άμεσα την ορθότητα ή μη της κάθε αντιστοίχισης κατά την προεπισκόπηση του στοιχείου, χωρίς να πατήσει κάποιο κουμπί. Χαρακτηριστική είναι η ακόλουθη εικόνα. Οι άνω τρεις επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τέσσερις επιλογές:

55 Σελίδα 55 από 152 Οι πρώτες τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος Απαντήσεων, Επανάληψη Προσπάθειας, Προβολή Απαντήσεων) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Η τέταρτη επιλογή δίνει τη δυνατότητα να επεξεργαστούμε το κείμενο του μηνύματος των αποτελεσμάτων. Το προκαθορισμένο κείμενο, το οποίο μπορείτε να επεξεργαστείτε προαιρετικά, είναι: σωστά». Η αφορά στο σύνολο των ορθών αντιστοιχίσεων, ενώ η στο σύνολο των αντιστοιχίσεων. Υπόψη ότι τα αποτελέσματα δεν αποθηκεύονται στη βάση. Σε περίπτωση ύπαρξης τουλάχιστον μιας λανθασμένης αντιστοίχισης κατά τη χρήση του διαδραστικού στοιχείου στην προεπισκόπηση, εμφανίζεται το ακόλουθο γράφημα: Αντίθετα, σε περίπτωση εντοπισμού των ορθών αντιστοιχίσεων συνολικά, το γράφημα εμφανίζεται με την ακόλουθη μορφή:

56 Σελίδα 56 από 152 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

57 6. ΕΡΩΤΗΣΗ ΕΠΙΛΟΓΗΣ ΛΕΞΕΩΝ Σελίδα 57 από 152 Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα να επιλέξουμε πλήθος συγκεκριμένων λέξεων μέσα σε εκφράσεις, τις οποίες δημιουργούμε κατά βούληση. Ο χρήστης εξεταζόμενος καλείται να επιλέξει τις ορθές λέξεις κάνοντας κλικ με το ποντίκι του (μαρκάροντας), πάνω στις εκφράσεις που έχουμε προηγουμένως ορίσει. Για να δημιουργήσουμε ερώτηση επιλογής λέξεων από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΕΠΙΛΟΓΗΣ ΛΕΞΕΩΝ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

58 Στη συνέχεια στο πεδίο Περιγραφή εργασίας δίνουμε την επιθυμητή περιγραφή του διαδραστικού στοιχείου. Σελίδα 58 από 152 Στο πεδίο Πεδίο κειμένου μπορούμε να εισάγουμε πλήθος εκφράσεων από τις οποίες επιθυμούμε να επιλέγουμε συγκεκριμένες λέξεις. Για να ορίσουμε την ορθά επιλεγμένη λέξη, τη χωρίζουμε με αστερίσκους (*), έναν στην αρχή της κι έναν στο τέλος της. ΠΡΟΣΟΧΗ: Η επιλογή ισχύει μόνο για μια λέξη και όχι για φράση, ενώ στο κείμενο της πιθανής επιλογής δεν επιτρέπονται οι χαρακτήρες κενό ( space ) και ο αστερίσκος (*). Ειδικότερα, το κενό δεν μπορεί να αποτελεί επιλογή καθόσον εκ των πραγμάτων είναι διαχωριστικό λέξεων (οπότε αποκλείονται οι εκφράσεις ως δυνατότητα επιλογής), ενώ ο αστερίσκος αποτελεί διαχωριστικό σύμβολο και θα πρέπει να είστε προσεκτικοί, διότι εάν κατά λάθος τοποθετήσετε περιττό αριθμό αστερίσκων στο Πεδίο κειμένου, ενδέχεται το αποτέλεσμα να οδηγήσει σε εσφαλμένη συμπεριφορά της Πλατφόρμας. Επίσης, πρέπει να δώσετε προσοχή σε ορισμένους ειδικούς χαρακτήρες, οι οποίοι ενώ μπορούν να χρησιμοποιηθούν στην αρχή ή στο μέσο μιας ορθής επιλεγμένης λέξης (χωρίς κανένα ενδιάμεσο κενό), παρουσιάζουν απρόβλεπτη συμπεριφορά όταν βρίσκονται στο τέλος της λέξης που επιθυμούμε να επιλέξουμε ή αποτελούν αποκλειστικά μόνοι τους μέρος της λύσης. Οι χαρακτήρες αυτοί είναι ερωτηματικό (;), άνω-κάτω-τελεία (:), μεγαλύτερο (>), μικρότερο (<), ampersand (&), δίεση (#). Ενδεχόμενη χρήση των παραπάνω ειδικών χαρακτήρων πρέπει να αποφεύγεται, ή τουλάχιστον να γίνεται με ιδιαίτερη προσοχή.

59 Σελίδα 59 από 152 Κατά την προεπισκόπηση του διαδραστικού στοιχείου, ενδέχεται να προκύψει η ακόλουθη ερώτηση επιλογής λέξεων, κατά την οποία πρέπει να επιλέξουμε με κλικ του ποντικιού τη σωστή απάντηση. Σε μια έκφραση μπορεί να υπάρχει πλήθος ορθών επιλογών λέξεων, αρκεί αυτές να χωρίζονται με σωστό τρόπο, όπως ακριβώς περιγράφτηκε προηγουμένως. Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις παρέχουν δύο επιλογές: Ενεργοποίηση Προσπάθησε ξανά

60 Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να επαναλάβει την προσπάθειά του για επιλογή λέξεων, στην περίπτωση που έχει κάνει κάποιο λάθος κατά την αρχική επιλογή. Πρώτα ο μαθητής πρέπει να πατήσει Σελίδα 60 από 152 το κουμπί (Έλεγχος απαντήσεων), και στη συνέχεια το κουμπί (Προσπάθησε ξανά), οπότε και του παρέχεται μια δεύτερη ευκαιρία να ξαναδοκιμάσει, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις επιλογές λέξεων με το σωστό τρόπο, τότε δεν προσφέρεται η δυνατότητα για επανάληψη. Ενεργοποίηση Προβολή λύσεων Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει τις ορθές απαντήσεις κατά την προεπισκόπηση του στοιχείου. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος απαντήσεων). Στη συνέχεια, πατώντας το κουμπί (Προβολή λύσεων) μπορεί να δει τις ορθές επιλογές, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις επιλογές λέξεων με το σωστό τρόπο, τότε δεν υφίσταται ανάγκη για προβολή των ορθών απαντήσεων. Σχηματικά, το συγκεκριμένο διαδραστικό στοιχείο λειτουργεί ως ακολούθως κατά την προεπισκόπηση: 1. Επιλογή των λέξεων που επιθυμούμε με κλικ του ποντικιού.

61 2. Έλεγχος των απαντήσεων (κλικ), όπου με πράσινο χρώμα εμφανίζονται οι ορθές επιλογές και με κόκκινο οι λανθασμένες. Σελίδα 61 από Προβολή των λύσεων (κλικ), η οποία οριοθετείται από ένα διακεκομμένο πλαίσιο γύρω από κάθε ορθή επιλογή, η οποία δεν επιλέχτηκε αρχικά. Οι άνω δύο επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τέσσερις επιλογές:

62 Σελίδα 62 από 152 Οι πρώτες τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος απαντήσεων, Προσπάθησε ξανά, Προβολή λύσεων) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Η τέταρτη επιλογή δίνει τη δυνατότητα να επεξεργαστούμε το κείμενο του μηνύματος των αποτελεσμάτων. Το προκαθορισμένο κείμενο, το οποίο μπορείτε να επεξεργαστείτε προαιρετικά, είναι: από πόντων». Η αφορά στο σύνολο των ορθών αντιστοιχίσεων συνδυαστικά, ενώ η στο σύνολο των αντιστοιχίσεων. Υπόψη ότι τα αποτελέσματα δεν αποθηκεύονται στη βάση. Το σύνολο των διαθέσιμων μεταβλητών (συσχετιστικό σύνολο πόντων ανάλογα με τις (μέγιστο σύνολο (σύνολο ορθών επιλογών (σύνολο λανθασμένων επιλογών (σύνολο μηεπιλεγμένων λέξεων που αποτελούν ορθή επιλογή). Σε περίπτωση ύπαρξης τουλάχιστον μιας λανθασμένης επιλογής λέξεων κατά τη χρήση του διαδραστικού στοιχείου στην προεπισκόπηση, εμφανίζεται το ακόλουθο γράφημα: Αντίθετα, σε περίπτωση εντοπισμού των ορθών επιλογών λέξεων συνολικά, το γράφημα εμφανίζεται με την ακόλουθη μορφή: Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

63 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 63 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

64 Σελίδα 64 από ΕΡΩΤΗΣΗ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα να δημιουργήσουμε μια ερώτηση πολλαπλής επιλογής, η οποία ενδεχομένως να έχει μία ή περισσότερες ορθές απαντήσεις. Ο χρήστης εξεταζόμενος καλείται να επιλέξει την απάντηση που θεωρεί ορθή, και ανάλογα προκύπτει το αποτέλεσμα της επιλογής. Για να δημιουργήσουμε ερώτηση πολλαπλής επιλογής από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

65 Προαιρετικά μπορείτε να εισάγετε εικόνα πάνω από τις ερωτήσεις σας (πεδίο Εικόνα Ερώτησης) κάνοντας κλικ στο κουμπί «Προσθήκη Αρχείου», οπότε και ανοίγει παράθυρο διαλόγου για να εισαχθεί η επιθυμητή εικόνα. Οι υποστηριζόμενοι τύποι αρχείων είναι jpg, png ή gif. Σελίδα 65 από 152 Πατώντας κλικ στα Δικαιώματα χρήσης, εμφανίζονται τα ακόλουθα πεδία, τα οποία αφορούν στα δικαιώματα χρήσης της εικόνας (εάν υπάρχουν): Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό το δημιουργό του. Στη Χρονολογία τη χρονολογία που δημιουργήθηκε. Στην Πηγή από που το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια (εάν είμαστε σίγουροι για αυτό) ή «Με άδεια/copyright» για αρχεία που απαιτούν άδεια. Η επιλογή «-» υποδηλώνει το κενό και δεν είναι αποδεκτή. Για να κλείσετε τα εμφανιζόμενα πεδία των Δικαιωμάτων Χρήσης, πατήστε το κουμπί.

66 Σελίδα 66 από 152 Για να εισάγουμε μία ερώτηση πολλαπλής επιλογής, επιλέγουμε το πεδίο «Ερώτηση Πολλαπλής Επιλογής» και γράφουμε την επιθυμητή ερώτηση. Στη συνέχεια, έχουμε τη δυνατότητα να προσθέσουμε πλήθος απαντήσεων, επιλέγοντας κατά βούληση ποιες και πόσες θα είναι ορθές. Συγκεκριμένα, επιλέγοντας το πεδίο Απάντηση, εμφανίζεται ο ακόλουθος πίνακας. Στο πεδίο Κείμενο Απάντησης ορίζουμε το κείμενο που θα αποτελεί πιθανή επιλογή ως απάντηση κατά την προεπισκόπηση. Εάν επιλέξουμε το πεδίο Σωστή Απάντηση, τότε η συγκεκριμένη απάντηση θα είναι ορθή. Έχουμε τη δυνατότητα να επιλέξουμε πάνω από μία ορθές απαντήσεις (ακόμα και όλες οι απαντήσεις δυνητικά μπορεί να είναι ορθές για μια ερώτηση). Το Σχόλιο αν ο χρήστης διαλέξει αυτή την απάντηση θα εμφανίζει επιθυμητό κείμενο στο χρήστη κατά την προεπισκόπηση. Το Σχόλιο αν ο χρήστης δεν διαλέξει αυτή την απάντηση θα εμφανίζει αντίστοιχα το επιθυμητό κείμενο στο χρήστη κατά την προεπισκόπηση. Ο χρήστης έχει τη δυνατότητα να προσθέσει όσες πιθανές απαντήσεις επιθυμεί για μία ερώτηση. Ο προκαθορισμένος αριθμός απαντήσεων όταν δημιουργείται το συγκεκριμένο διαδραστικό εργαλείο, είναι δύο. Βέβαια, ο χρήστης μπορεί να προσθέσει κι άλλες, αφού

67 Σελίδα 67 από 152 πατήσει προηγουμένως το κουμπί (Προσθήκη στοιχείου: Απάντηση). Μετά τη δημιουργία μιας πιθανής απάντησης, ο χρήστης δύναται να τη διαγράψει πατώντας το κουμπί. Σε αυτήν την περίπτωση, εμφανίζεται το ακόλουθο μήνυμα επιβεβαίωσης. Πατώντας OK, η απάντηση διαγράφεται, ενώ πατώντας Ακύρωση, η απάντηση παραμένει. Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις Παραμέτρων παρέχουν πέντε επιλογές: Ενεργοποίηση επιλογής επανάληψης προσπάθειας (κουμπί) Με τη συγκεκριμένη επιλογή, αφού ο χρήστης κατά την προεπισκόπηση πατήσει το κουμπί (Έλεγχος απαντήσεων), είναι σε θέση να επαναλάβει την προσπάθειά του. Ειδικότερα, μόνο στην περίπτωση που επιλέξει λανθασμένη απάντηση, θα εμφανιστεί το κουμπί (Επανάληψη Προσπάθειας), με το οποίο έχει τη δυνατότητα να ξαναπροσπαθήσει. Υπόψη ότι όταν επιλεγεί ορθή απάντηση (σε περίπτωση

68 πολλαπλών ορθών απαντήσεων, οποιαδήποτε από αυτές), τότε το εν λόγω κουμπί δεν εμφανίζεται. Σελίδα 68 από 152 Ενεργοποίηση επιλογής προβολής σωστών απαντήσεων (κουμπί) Με τη συγκεκριμένη επιλογή, αφού ο χρήστης κατά την προεπισκόπηση πατήσει το κουμπί (Έλεγχος απαντήσεων), είναι σε θέση να προβάλει το σύνολο των ορθών απαντήσεων. Ειδικότερα, μόνο στην περίπτωση που επιλέξει λανθασμένη απάντηση, θα εμφανιστεί το κουμπί (Προβολή Απαντήσεων), με το οποίο έχει την παραπάνω δυνατότητα. Σε περίπτωση πολλαπλών ορθών απαντήσεων, αυτές εμφανίζονται στο σύνολό τους. Μοναδική απάντηση Με τη συγκεκριμένη επιλογή, ο χρήστης μπορεί να ρυθμίσει εάν κατά την προεπισκόπηση θα χρήστης/μαθητής θα είναι σε θέση να επιλέξει μόνο μία επιλογή ή εάν θα μπορεί να επιλέξει πάνω από μία. Ειδικότερα, εάν επιλεγεί με τικ η συγκεκριμένη επιλογή, ο χρήστης θα μπορεί να επιλέξει μόνο μία απάντηση, ανεξάρτητα από το πλήθος των ορθών απαντήσεων (τύπος radio-button ). Αντίθετα, εάν δεν την επιλέξει με τικ, τότε θα μπορεί να επιλέξει όσες από τις διαθέσιμες απαντήσεις επιθυμεί (τύπος check-box ). Στα παρακάτω δύο σχήματα φαίνεται η ίδια ερώτηση με τους δύο τύπους όπως μόλις περιγράφηκαν. Radio button Check box Στην πρώτη περίπτωση (αριστερά) ο χρήστης μπορεί να επιλέξει μόλις μία απάντηση, ενώ στη δεύτερη (δεξιά) πάνω από μία. Τυχαία σειρά των διαθέσιμων απαντήσεων Με τη συγκεκριμένη επιλογή τυχαιοποιείται η προβολή των απαντήσεων, κάθε φορά που γίνεται προεπισκόπηση. Για παράδειγμα, εάν επιθυμούμε να συμπεριλάβουμε ορθή απάντηση του τύπου Όλα τα παραπάνω (η οποία προφανώς θα πρέπει να διατίθεται πάντα ως τελευταία εναλλακτική επιλογή), προτείνεται να μην κάνουμε τικ στη συγκεκριμένη επιλογή, ώστε η συγκεκριμένη πιθανή απάντηση να βρίσκεται πάντα στο σημείο που επιθυμούμε.

69 Σελίδα 69 από 152 Απαιτείται τουλάχιστον μια εισαγωγή απάντησης πριν την υποβολή των σωστών απαντήσεων Με τη συγκεκριμένη επιλογή, ο χρήστης καλείται να δοκιμάσει πρώτα να επιλέξει μια ορθή απάντηση προτού του δοθεί η δυνατότητα να προβάλει το σύνολο των ορθών απαντήσεων. Κατά τον έλεγχο ορθότητας των απαντήσεων, σε περίπτωση επιτυχίας εμφανίζεται ένα πράσινο τικ δίπλα στην επιλογή που έγινε. Σε περίπτωση λάθους, εμφανίζεται αντίστοιχα ένα κόκκινο x. Τέλος, στην περίπτωση Ελέγχου των απαντήσεων, εμφανίζεται με πράσινο τικ το σύνολο των ορθών απαντήσεων. Οι άνω πέντε επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τρεις επιλογές.

70 Σελίδα 70 από 152 Και οι τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος απαντήσεων, Προβολή Απαντήσεων, Επανάληψη Προσπάθειας) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

71 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 71 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

72 Σελίδα 72 από ΕΡΩΤΗΣΗ ΣΥΜΠΛΗΡΩΣΗΣ ΚΕΝΩΝ Το διαδραστικό αυτό στοιχείο παρουσιάζει ένα κείμενο από το οποίο λείπουν λέξεις οι φράσεις και στη θέση τους εμφανίζονται πεδία κειμένου όπου πρέπει να συμπληρωθούν. Εάν συμπληρωθούν όπως έχει προκαθοριστεί από το δημιουργό της ερώτησης τότε θεωρούνται σωστές αλλιώς λάθος. Αν τα πεδία είναι κενά θεωρείται ότι δεν έχουν ακόμα συμπληρωθεί. Είναι πιθανό να υπάρχουν για το ίδιο «κενό» περισσότερες από μία σωστές απαντήσεις. Σ αυτή την περίπτωση θα πρέπει να δηλωθούν κατάλληλα. Για να δημιουργήσουμε ερωτήσεις συμπλήρωσης κενών από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Ερώτηση συμπλήρωσης κενών» [σχ ΣΚ 1],

73 Σελίδα 73 από 152 Σχήμα ΣΚ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης κενών που περιλαμβάνει: Σχήμα ΣΚ 2

74 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για το κείμενο με τα προς συμπλήρωση πεδία «κενά» που θα ακολουθήσει. Σελίδα 74 από 152 Σχήμα ΣΚ 3 Στο πεδίο «Κείμενο» είναι πεδίο κειμένου εμπλουτισμένης μορφής και καταχωρείται το κείμενο που θα περιέχει τα κενά. Στο σημείο που είναι επιθυμητή η δημιουργία κενού εισάγεται ο χαρακτήρας * (αστέρι) και αμέσως (χωρίς οποιοδήποτε κενό διάστημα ή άλλο χαρακτήρα) ακολουθεί η σωστή λέξη ή έκφραση που αναμένεται να συμπληρωθεί. Στο τέλος της σωστής λέξης ή έκφρασης αμέσως εισάγεται εκ νέου ο χαρακτήρας * που σηματοδοτεί τη λήξη της σωστής λέξης ή έκφρασης. Δηλαδή η σωστή λέξη έκφραση θα πρέπει να περικλείεται από δύο *, ένα στην αρχή και ένα στο τέλος. Κατά την προβολή εκτέλεση το διαδραστικό στοιχείο αντικαθιστά αυτομάτως το περιεχόμενο μεταξύ των δύο * και εμφανίζει κενό πεδίο κειμένου. Αν για παράδειγμα το κείμενο ήταν : =12 και θέλαμε να εμφανισθεί κενό στο 5, το περιεχόμενο θα έπρεπε να διαμορφωθεί ως εξής: 7 + *5* = 12 Κατά την εκτέλεση/προβολή θα είχαμε την εμφάνιση: 7 + = 12

75 Σελίδα 75 από 152 Θα είχαμε σωστό αποτέλεσμα μόνο αν ο εξεταζόμενος συμπλήρωνε 5. Στις περιπτώσεις που υπάρχουν περισσότερες από μία λέξεις εκφράσεις τότε αυτές χωρίζονται μεταξύ τους με / (πλάγια κάθετο) [slash]. Για παράδειγμα αν το κείμενο ήταν: Ο Τιτανικός ήταν πλοίο υπερωκεάνιο Έστω ότι το κενό θα εμφανιστεί στη λέξη πλοίο, πιθανά να θέλαμε να είναι αποδεκτές και άλλες λέξεις όπως : καράβι και βαπόρι. Για να καλυφθεί αυτή η περίπτωση το κείμενο πρέπει να γραφεί ως εξής: Ο Τιτανικός ήταν *πλοίο/καράβι/βαπόρι* υπερωκεάνιο Κατά την εκτέλεση/προβολή θα είχαμε την εμφάνιση: Ο Τιτανικός ήταν υπερωκεάνιο Στο κείμενο είναι δυνατό να υπάρχουν πολλά κενά. Τα κενά θα είναι τόσα όσα και τα ζεύγη των αστερίσκων (*). Υπόψη ότι ορισμένοι χαρακτήρες θεωρούνται ειδικοί και δεν επιτρέπεται η εισαγωγή τους ως μέρος της ορθής απάντησης. Μεταξύ αυτών, είναι οι ακόλουθοι: < (μικρότερο), > (μεγαλύτερο), : (άνω-κάτω τελεία), & ( ambersand ). Επισημαίνεται πως οι χαρακτήρες * (αστερίσκος), / (δεξιά κάθετος) δεν μπορούν να θεωρηθούν ως μέρος ορθής απάντησης, διότι αποτελούν ειδικούς διαχωριστικούς χαρακτήρες (επιτελούν συγκεκριμένο ρόλο όπως αναγράφεται παραπάνω). Είναι επίσης δυνατό να έχουμε και πολλά κείμενα. Για να προστεθεί πεδίο κειμένου, επιλέγουμε: σχήματος [ΣΚ 3]. και θα προστεθεί νέο πεδίο κειμένου σαν αυτό του Για να διαγράψουμε κείμενο πάνω και δεξιά του πεδίου του προς διαγραφή κειμένου επιλέγουμε (επιλογή διαγραφής) και μετά από σχετικό μήνυμα επιβεβαίωσης το κείμενο διαγράφεται.

76 Σελίδα 76 από 152. Σχήμα ΣΚ 4 Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις Παραμέτρων» [σχ ΣΚ 4] μπορούμε να ρυθμίσουμε τη λειτουργική «συμπεριφορά» του διαδραστικού στοιχείου όπως επιθυμούμε ενεργοποιώντας και απενεργοποιώντας από τις παραπάνω επιλογές.

77 Σελίδα 77 από 152 Σχήμα ΣΚ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΣΚ 5] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Μήνυμα για τα αποτελέσματα» είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών απαντήσεων που δόθηκαν από τον εξεταζόμενο (σωστή συμπλήρωση κενού πεδίου) και επίσης είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των κενών (Πχ αν κάποιος σε σύνολο 7 κενών συμπλήρωσε σωστά 4 κενά, = 4 και το μήνυμα θα ήταν : «Είχες 4 από 7 σωστά». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

78 Σελίδα 78 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

79 Σελίδα 79 από ΕΚΦΡΑΣΕΙΣ ΤΥΠΟΥ ΣΩΣΤΟ / ΛΑΘΟΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ομάδων εκφράσεων όπου ο χρήστης εξεταζόμενος καλείται να επιλέξει μία έκφραση από κάθε ομάδα ως αληθή (σωστή). Για να δημιουργήσουμε ερωτήσεις μοναδικής επιλογής από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ» [σχ ΣΛ 1].

80 Σελίδα 80 από 152 Σχήμα ΣΛ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Εκφράσεων τύπου Σωστό / Λάθος, που περιλαμβάνει: Σχήμα ΣΛ 2

81 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Σελίδα 81 από 152 Σχήμα ΣΛ 3 Το «Εισαγωγικό κείμενο» είναι πεδίο κειμένου εμπλουτισμένης μορφής και εμφανίζεται πάνω από τις εκφράσεις. Το ίδιο κείμενο αφορά όλες τις ομάδες εκφράσεων. Πρέπει να συμπληρωθεί υποχρεωτικά, και το προκαθορισμένο περιεχόμενό του είναι «Διαλέξτε τη σωστή έκφραση».

82 Σελίδα 82 από 152 Σχήμα ΣΛ 4 Κάθε ομάδα εκφράσεων αποτελείται από ένα σύνολο εκφράσεων, που είναι πεδία κειμένου. Κάθε ομάδα μπορεί να περιέχει μεταβλητό αριθμό εκφράσεων. Το πρώτο πεδίο «Έκφραση» κάθε ομάδας εκφράσεων επέχει τη θέση του «σωστού». Κάθε ομάδα μπορεί να έχει μόνο μία σωστή έκφραση (την πρώτη στη σειρά). Κατά την προβολή εκτέλεση του σεναρίου, οι ομάδες εκφράσεων εμφανίζονται με τη σειρά τοποθέτησής τους. Οι περιεχόμενες όμως εκφράσεις κάθε ομάδας εμφανίζονται με τυχαία σειρά.

83 Σελίδα 83 από 152 Σχήμα ΣΛ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΣΛ 5], μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Αποτελέσματα», είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών εκφράσεων που επιλέχθηκαν από τον εξεταζόμενο, είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των ομάδων εκφράσεων, είναι μεταβλητή που αφορά το ποσοστό των σωστών εκφράσεων (που έχουν επιλεγεί) επί του συνολικού αριθμού των ομάδων εκφράσεων. (Π.χ αν κάποιος σε σύνολο 4 ομάδων εκφράσεων έχει επιλέξει 2 σωστές εκφράσεις, = 2 και το μήνυμα θα ήταν: «Είχες 2 από 4 σωστά (50%)». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

84 Σελίδα 84 από ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ερωτήσεων κλειστού τύπου όπου σε κάθε ερώτηση μπορεί να υπάρχει πλήθος πιθανών απαντήσεων, μία όμως θα είναι η σωστή. Για να δημιουργήσουμε ερωτήσεις μοναδικής επιλογής από το κατακόρυφο μενού αριστερά και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου επιλέγω:

85 Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ» [σχ ΜΕ 1]. Σελίδα 85 από 152 Σχήμα ΜΕ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων Μοναδικής Επιλογής, που περιλαμβάνει: Σχήμα ΜΕ 2

86 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Σελίδα 86 από 152 Σωστή Απάντηση Εδώ Σχήμα ΜΕ 3 Η Λίστα Ερωτήσεων, όπως φαίνεται στο σχήμα ΜΕ 3, συγκροτείται από ομάδες δυνητικά επαναλαμβανόμενων πεδίων. Περιλαμβάνει αρχικά δύο ομάδες «ερώτηση και διαθέσιμες απαντήσεις», που αντιστοιχούν σε δύο ερωτήσεις με τις αντίστοιχες απαντήσεις τους. Κάθε ομάδα «ερώτηση και διαθέσιμες απαντήσεις» αντιστοιχεί σε μία ερώτηση με το σύνολο των διαθέσιμων απαντήσεών της. Η επικεφαλίδα κάθε ερώτησης είναι μία γραμμή εργαλείων που περιλαμβάνει: Το βέλος ανάπτυξης/σύμπτυξης, με το οποίο μπορούμε να αποκρύψουμε/εμφανίσουμε το περιεχόμενο της ερώτησης και των διαθέσιμων απαντήσεων. Την επιλογή διαγραφής

87 της συγκεκριμένης ερώτησης. Με την διαγραφή της ερώτησης διαγράφονται και όλες οι διαθέσιμες απαντήσεις που αντιστοιχούν στην ερώτηση αυτή. Το πεδίο «Ερώτηση» είναι πεδίο κειμένου και αφορά την ερώτηση που θέτουμε. Ακολουθούν τα πεδία των διαθέσιμων απαντήσεων τα οποία είναι και αυτά πεδία κειμένου. ΠΡΟΣΟΧΗ το πρώτο στη σειρά πεδίο από την ομάδα «Διαθέσιμες απαντήσεις» πάντοτε πρέπει να φιλοξενεί τη μοναδική σωστή απάντηση. Κατά τη διάρκεια προβολής εκτέλεσης του διαδραστικού στοιχείου οι απαντήσεις εμφανίζονται με τυχαία σειρά. Αν θέλουμε να προσθέσουμε διαθέσιμες απαντήσεις, τότε επιλέγουμε : Σελίδα 87 από 152 Αν θέλουμε να διαγράψουμε μία εκ των διαθέσιμων απαντήσεων, τότε πάνω και δεξιά του πεδίου της προς διαγραφή απάντησης επιλέγουμε (επιλογή διαγραφής), και μετά από σχετικό μήνυμα επιβεβαίωσης η διαθέσιμη απάντηση δεν είναι πλέον διαθέσιμη (διαγράφεται). Μπορούμε να προσθέσουμε νέα ερώτηση επιλέγοντας:

88 Τότε θα εμφανιστεί μία ομάδα πεδίων όπως αυτό που απεικονίζεται στο [σχ ΜΕ 3]. Εξ ορισμού υπάρχουν δύο διαθέσιμες απαντήσεις, αλλά όπως είδαμε πιο πάνω μπορούμε να προσθέσουμε και άλλες. Σελίδα 88 από 152 Σχήμα ΜΕ 4 Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις Παραμέτρων» [σχ ΜΕ 4] μπορούμε να ρυθμίσουμε τη χρονική και λειτουργική «συμπεριφορά» του διαδραστικού στοιχείου.

89 Σελίδα 89 από 152 Σχήμα ΜΕ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΜΕ 5] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Τίτλος οθόνης αποτελεσμάτων» το :numcorrect είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών απαντήσεων που δόθηκαν από τον εξεταζόμενο και το :maxscore επίσης είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των ερωτήσεων (π.χ αν κάποιος σε σύνολο 7 ερωτήσεων απαντήσει σωστά σε 4, τότε :numcorrect = 4 και :maxscore=7, ενώ το μήνυμα θα ήταν : «Είχες 4 από 7 σωστά».

90 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Σελίδα 90 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

91 Σελίδα 91 από ΕΞΩΤΕΡΙΚΟ ΠΕΡΙΕΧΟΜΕΝΟ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα ενσωμάτωσης εξωτερικών διαδικτυακών πόρων που θα μπορούσαν να αποτελέσουν επιπρόσθετες πηγές πληροφόρησης για το διδακτικό στόχο για τον οποίο πρόκειται και που η αντιγραφή του στο συγκριμένο σενάριο θα ήταν επίπονη και τελικά ίσως άσκοπη. Η ενσωμάτωση στο περιβάλλον του σεναρίου θα μπορούσε να βοηθήσει το χρήστη να έχει όλη την απαραίτητη πληροφορία συγκεντρωμένη σε ένα «χώρο» παρά να περιηγείται σε ένα σύνολο εξωτερικών πόρων. Οι διαδικτυακοί αυτοί πόροι θα μπορούσαν να είναι: Χάρτες ή ιστότοποι. Κάθε πόρος όμως θα πρέπει να βρίσκεται στο διαδίκτυο (on line). Μειονέκτημα είναι ότι πρέπει να παρακολουθείται η διαθεσιμότητα και το περιεχόμενό του συνεχώς. Για να δημιουργήσουμε ενσωμάτωση εξωτερικού περιεχομένου από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΞΩΤΕΡΙΚΟ ΠΕΡΙΕΧΟΜΕΝΟ» [σχ ΕΠ 1],

92 Σελίδα 92 από 152 Σχήμα ΕΠ 1 Αμέσως μετά εμφανίζεται η φόρμα εισαγωγής περιλαμβάνει τα παρακάτω : εξωτερικού περιεχομένου που Σχήμα ΕΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Το Πεδίο «Πηγή» είναι πεδίο κειμένου και εκεί εισάγεται η ηλεκτρονική διεύθυνση (URL) του διαδικτυακού πόρου που πρόκειται να ενσωματωθεί. ΠΡΟΣΟΧΗ! Η διεύθυνση του

93 διαδικτυακού πόρου πρέπει να γραφεί σωστά. (Συνιστάται η χρήση αντιγραφής επικόλλησης για μεγαλύτερη σιγουριά). Σε περίπτωση που δε συμπληρωθεί το πεδίο Πηγή τότε κατά την προβολή εκτέλεση του διαδραστικού εργαλείου στο πλαίσιο ενσωμάτωσης θα δούμε το παρακάτω μήνυμα: Σελίδα 93 από 152 Σχήμα ΕΠ 3 Σε περίπτωση που συμπληρωθεί το πεδίο Πηγή αλλά η διεύθυνση του διαδικτυακού πόρου είναι εσφαλμένη τότε κατά την προβολή εκτέλεση του διαδραστικού εργαλείου στο πλαίσιο ενσωμάτωσης θα δούμε το παρακάτω μήνυμα: Σχήμα ΕΠ 4

94 Σελίδα 94 από 152 Κρίνεται σκόπιμο να σχεδιάζετε/αναπτύσσετε ΠΡΩΤΟΤΥΠΟ ΨΗΦΙΑΚΟ ΥΛΙΚΟ, δεδομένου ότι η χρήση Ψηφιακού Υλικού από εξωτερικές πηγές ενδεχομένως να δημιουργήσει μελλοντικές ελλείψεις στα Σενάρια που αναπτύσσετε, εφόσον το υλικό που χρησιμοποιείτε αποτελεί σύνδεσμο προς εξωτερικές πηγές και οι πηγές άντλησης του υλικού σας πάψουν να υφίστανται για οποιαδήποτε αιτία. Ορισμένες ιστοσελίδες χρησιμοποιούν την τεχνολογία "flash" για να προβάλουν πληροφορίες. Η συγκεκριμένη τεχνολογία πλέον θεωρείται ξεπερασμένη και μη συμβατή με τις νέες τεχνολογίες. Παρόλα αυτά, επιλέξαμε να την επιτρέψουμε στο εξωτερικό περιεχόμενο για να έχουν πρόσβαση οι εκπαιδευτικοί σε εκπαιδευτικά στοιχεία, όπως π.χ στα στοιχεία του Φωτόδεντρου. Επίσης, πρέπει να είστε ιδιαίτερα προσεκτικοί με το εξωτερικό περιεχόμενο διότι ορισμένες ιστοσελίδες ενδέχεται να χρειάζονται εγκατεστημένη έκδοση της Java, προκαλώντας εν γένει δυσκολίες στους χρήστες του σεναρίου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

95 Σελίδα 95 από ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ Πρόκειται για την ηλεκτρονική εκδοχή του παιχνιδιού όπου υπάρχει ένας αριθμός ζευγάρια κάρτες, όπου κάθε ζεύγος έχει από τη μία πλευρά του (εμπρός πλευρά) την ίδια απεικόνιση (ίδια εικόνα), η δε άλλη πλευρά (πίσω πλευρά) είναι ίδια για όλες τις κάρτες. Οι κάρτες είναι τοποθετημένες με τυχαίο τρόπο σε μία σειρά με θέα την πίσω πλευρά (την ίδια για όλες) και ο παίχτης καλείται γυρίζοντας δύο κάρτες (διαδοχικά) να βρει το ζευγάρι (την ίδια εικόνα). Αν δεν τα καταφέρει, οι κάρτες αυτές επανατοποθετούνται με θέα την πίσω πλευρά. Το παιχνίδι τελειώνει όταν αποκαλυφθούν όλα τα ζευγάρια καρτών με τη διαδικασία που μόλις περιγράφτηκε. Προκειμένου να υλοποιηθεί το παιχνίδι με τη χρήση του διαδραστικού στοιχείου «ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ» από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ» [σχήμα ΠΜ 1].

96 Σελίδα 96 από 152 Σχήμα ΠΜ 1 Αμέσως μετά εμφανίζεται η φόρμα εισαγωγής παιγνιδιού μνήμης που περιλαμβάνει τα εξής πεδία: Σχήμα ΠΜ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από το παιχνίδι. Το αναπτυσσόμενο πλαίσιο «Κάρτα» είναι ένα σύνθετο πεδίο που αντιστοιχεί σε ένα ζεύγος καρτών και αποτελείται:

97 Α) Από μία επιλογή μεταφόρτωσης αρχείων, όπου επιλέγοντας κάποιο αναδύεται το παράθυρο διαλόγου Φόρτωσης Αρχείου, από όπου μπορούμε να επιλέξουμε ένα αρχείο εικόνας που αντιπροσωπεύει ένα ζεύγος καρτών. Υπόψη ότι οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Σελίδα 97 από 152 Β) Την επιλογή «Δικαιώματα Χρήσης» όπου εμφανίζει τη σχετική φόρμα καταχώρισης των απαραίτητων πληροφοριών τεκμηρίωσης πνευματικών δικαιωμάτων για την εικόνα. Γ) Το πεδίο «Περιγραφή», που είναι πεδίο κειμένου και φιλοξενεί το μήνυμα που θα εμφανίζεται όταν βρεθεί το συγκεκριμένο ζεύγος καρτών. Με την επιλογή διαγραφής μπορούμε να διαγράψουμε μετά από σχετικό μήνυμα επιβεβαίωσης το σύνθετο πεδίο κάρτας, ενώ με την επιλογή προσθέτουμε ένα σύνθετο πεδίο κάρτας. Αν η μεταφόρτωση εικόνας είναι επιτυχής, θα παρατηρήσουμε ότι η φόρμα του [σχ ΠΜ 2] γίνεται

98 Σελίδα 98 από 152 Στη θέση της επιλογής Προσθήκη αρχείου εμφανίζεται η μικρογραφία που μεταφορτώσαμε Μπορούμε να διαγράψουμε την εικόνα και να μεταφορτώσουμε άλλη Σχήμα ΠΜ 3

99 Σελίδα 99 από 152 Σχήμα ΠΜ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΠΜ 4] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

100 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 100 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

101 Σελίδα 101 από ΧΡΟΝΟΛΟΓΙΟ Το διαδραστικό στοιχείο «ΧΡΟΝΟΛΟΓΙΟ» μας δίνει τη δυνατότητα να παρουσιάσουμε σε εύληπτη διαγραμματική μορφή την εξέλιξη μιας σειράς γεγονότων σε συνάρτηση με το χρόνο παρέχοντας χρήσιμες συγκριτικές χρονικές πληροφορίες μεταξύ γεγονότων μιας περιόδου. Πως λειτουργεί Η ανατομία ενός στοιχείου χρονολογίου εμφανίζεται στο σχήμα «χ1» που ακολουθεί: 22

102 Σελίδα 102 από 152 Σχήμα χ1 Στον πίνακα Π(1) που ακολουθεί αναλύονται τα «συστατικά» μέρη του χρονολογίου: Θέση στο [σχ χ1] Πεδίο φόρμας συμπλήρωσης χρονολογίου περιγραφή 1 Τίτλος Ο τίτλος δραστηριότητας για το συγκεκριμένο διαδραστικό στοιχείο (υποχρεωτικό πεδίο) 2 Διευκρίνιση Σύντομο κείμενο διευκρινιστικό σχετικά με τη δραστηριότητα 3 - Πλοήγηση στο προηγούμενο γεγονός- περίοδο 4 - Πλοήγηση στο επόμενο γεγονός- περίοδο 5 Επικεφαλίδα ή Τίτλος Κείμενο που αφορά την επικεφαλίδα του χρονολογίου ή τον τίτλο της επόμενης χρονικής περιόδου - γεγονότος 6 Τίτλος Κείμενο που αφορά ή τον τίτλο της προηγούμενης χρονικής περιόδου - γεγονότος 7 Επικεφαλίδα ή Τίτλος Κείμενο που αφορά την επικεφαλίδα του χρονολογίου ή τον τίτλο της χρονικής περιόδου γεγονότος που είναι στο επίκεντρο 8 Κείμενο Κείμενο εμπλουτισμένης μορφής που αφορά το χρονολόγιο συνολικά ή κάθε χρονική περίοδο γεγονός που είναι στο επίκεντρο 9 Πολυμεσικό στοιχείο / στοιχείο Η μικρογραφία του διαδικτυακού πόρου 10 Πολυμεσικό στοιχείο/υπότιτλος Κείμενο που προσδιορίζει το πολυμεσικό στοιχείο 11 Πολυμεσικό στοιχείο/πηγή Κείμενο που προσδιορίζει την πηγή του πολυμεσικού στοιχείου

103 Σελίδα 103 από Ζώνες που αντιστοιχούν μία σε κάθε χρονική περίοδο - γεγονός του χρονολογίου 13 Συνοδευτική ετικέτα Πολύ σύντομο κείμενο που προσδιορίζει τη ζώνη της χρονικής περιόδου γεγονότος 14 - επαναφορά 15 Προεπιλεγμένο επίπεδο ζούμ μεγέθυνση 16 Προεπιλεγμένο επίπεδο ζούμ σμίκρυνση 17 - Οριζόντιος άξονας χρόνου (βαθμονομημένος) 18 - Κατακόρυφος άξονας ένδειξης χρονικής περιόδου-γεγονότος που είναι στο επίκεντρο 19 Τίτλος Κείμενο τίτλου χρονικής περιόδου - γεγονότος 20 Χρονική Περίοδος / Πολυμεσικό Στοιχείο /μικρή εικόνα Εικονίδιο διαστάσεων (32x32) αυστηρά 21 σχόλια κείμενο μετασχολιασμού σχετικά με τη δραστηριότητα 22 Χρονική Περίοδος /αρχική ημερομηνία Και Ημερομηνία ή έτος που αφορά τη χρονική περίοδο ή το γεγονός. Χρονική Περίοδος /τελική ημερομηνία Πίνακας Π1 Το χρονολόγιο χωρίζεται σε 2 νοητά μέρη που περικλείονται από τα πράσινα πλαίσια (Α) και (Β). [σχ. χ1] Το πλαίσιο (Α) απεικονίζει τις γενικές πληροφορίες του χρονολογίου (στην αρχή ) και κατά την πλοήγηση, τις πληροφορίες κάθε γεγονότος ή περιόδου που εξετάζεται. Όλες τις πληροφορίες δίνονται από φόρμες που θα αναλυθούν εκτενώς στη συνέχεια. Το πλαίσιο (Β) παρουσιάζει γραφικά, τα γεγονότα ή τις εξεταζόμενες περιόδους σε συνάρτηση με το χρόνο. Εδώ εμφανίζονται οι στοιχειώδεις πληροφορίες για το γεγονός - χρονική περίοδο γιατί δίνεται έμφαση στη χρονική συνάφεια και αλληλουχία των εξεταζόμενων γεγονότων - περιόδων.

104 Σελίδα 104 από 152 Πλοήγηση στο χρονολόγιο Η πλοήγηση μέσα στο χρονολόγιο γίνεται με δύο τρόπους : i) Σειριακά, επιλέγοντας με το ποντίκι («κλικ») τα βέλη πλοήγησης (3) ή (4) [σχ. χ1] για μεταφορά στο προηγούμενο ή επόμενο εξεταζόμενο γεγονός- περίοδο αντίστοιχα. ii) Με μη σειριακό τρόπο, επιλέγοντας με το ποντίκι («κλικ»), την ενεργό περιοχή του γεγονότος-περιόδου (19) [σχ. χ1]. Τότε ο χρονοδιάδρομος ολισθαίνει έτσι ώστε η αρχική ημερομηνία του γεγονότος - περιόδου να έρχεται στο επίκεντρο (18) [σχ. χ1] και τα γεγονότα περίοδοι που προηγούνται να βρίσκονται αριστερά του επικέντρου. Ταυτόχρονα στο πλαίσιο (Α) εμφανίζεται όλη η πληροφορία για το γεγονός- περίοδο που είναι στο επίκεντρο ενώ στις θέσεις (5) και (6) [σχ. χ1] εμφανίζεται ο τίτλος του προηγούμενου και επόμενου αντίστοιχα χρονικού γεγονότος-περιόδου. Αν στο επίκεντρο είναι το πρώτο γεγονός τότε στη θέση (5) [σχ. χ1] εμφανίζεται ο τίτλος του χρονολογίου ενώ αν στο επίκεντρο είναι το τελευταίο γεγονός τα (4) και (6) [σχ. χ1] εξαφανίζονται. reset (Επαναφορά) Όποιο γεγονός και να είναι στο επίκεντρο, είναι δυνατό το χρονολόγιο να ξαναέρθει στην αρχική θέση δηλαδή, στο επίκεντρο το πρώτο γεγονός και στο πλαίσιο (Α) οι γενικές πληροφορίες του χρονολογίου, επιλέγοντας με το ποντίκι («κλικ») το (14) [σχ. χ1]. Zoom in (Μεγέθυνση) Επιλέγοντας με το ποντίκι («κλικ») το (15) [σχ. χ1] αυξάνεται γραφικά η απόσταση μεταξύ των γεγονότων περιόδων που εξετάζονται, εστιάζοντας σε πιο συγκεκριμένες περιόδους- γεγονότα. Zoom out (Σμίκρυνση) Επιλέγοντας με το ποντίκι («κλικ») το (16) [σχ. χ1] μειώνεται γραφικά η απόσταση μεταξύ των γεγονότων περιόδων που εξετάζονται. δίνοντας εποπτική εικόνα του χρονικού γίγνεσθαι και εστιάζοντας στη χρονική σχέση των γεγονότων-περιόδων μέσα στο χρονολόγιο.

105 Σελίδα 105 από 152 Πως Συμπληρώνονται τα πεδία της φόρμας του χρονολογίου Από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδρατικά εργαλεία και επιλέγω από αυτά το «χρονολόγιο» [σχ χ2], Σχήμα χ2 Αμέσως εμφανίζεται η φόρμα εισαγωγής των απαραίτητων πεδίων για τη δημιουργία του χρονολογίου. Μία εικόνα της φόρμας φαίνεται στα σχήματα χ3, χ4, που ακολουθούν: Σχήμα χ3

106 Σελίδα 106 από 152 Ο τίτλος πρέπει να συμπληρωθεί υποχρεωτικά και περιλαμβάνει σύντομο κείμενο που αφορά τη δραστηριότητα στο σύνολό της. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (1) [σχ. χ1]. Η διευκρίνιση είναι προαιρετικό κείμενο και αφορά διευκρινίσεις ή υποδείξεις για το σύνολο της δραστηριότητας. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (2) [σχ. χ1]. Σχήμα χ4 Η Επικεφαλίδα περιλαμβάνει κείμενο και αποτελεί το γενικό τίτλο του χρονολογίου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (7) [σχ. χ1], αν είναι στην αρχή ή στη θέση (8) [σχ. χ1] αν στο επίκεντρο θέση (18) [σχ. χ1] είναι η πρώτη χρονική περίοδος-γεγονός. Το κείμενο είναι πεδίο κειμένου εμπλουτισμένης μορφής και κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (8) [σχ. χ1] μόνο κατά την έναρξη της περιήγησης ή την επαναφορά στην αρχή. Το προεπιλεγμένο επίπεδο ζουμ. Δέχεται μόνο αριθμούς θετικούς ή αρνητικούς. Ισοδυναμεί με το πάτημα της επιλογής μεγέθυνσης θέση (15) [σχ. χ1] όσες φορές ορίζεται στο πεδίο αν πρόκειται για θετικό αριθμό. Αν ο αριθμός είναι αρνητικός τότε ισοδυναμεί με το πάτημα σμίκρυνσης θέση (16) [σχ. χ1] όσες φορές ορίζεται στο πεδίο.

107 Πατώντας («κλικ») στο Πολυμεσικό Στοιχείο και συγκεκριμένα στο βέλος σύμπτυξης / ανάπτυξης αναπτύσσεται μία σειρά πεδίων όπου καταχωρούνται πληροφορίες απαραίτητες για την ενσωμάτωση κάποιου πολυμεσικού στοιχείου (χάρτης, δικτυακός τόπος, video κλπ) στο χρονολόγιο. Προϋπόθεση είναι το πολυμεσικό στοιχείο να είναι αναρτημένο στο διαδίκτυο. Σκοπός του είναι να παρέχει πρόσθετη πληροφόρηση σχετικά με το χρονολόγιο. Είναι προαιρετικό στοιχείο. Τα πεδία του πολυμεσικού στοιχείου του χρονολογίου εμφανίζονται στο σχήμα χ5 που ακολουθεί: Σελίδα 107 από 152 Σχήμα χ5 Στο πεδίο Στοιχείο εισάγεται η διεύθυνση (URL) του διαδικτυακού πόρου (χάρτης, δικτυακός τόπος, video κλπ) που θέλουμε να ενσωματωθεί ως επιπρόσθετη πηγή πληροφόρησης για το χρονολόγιο. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται ως μικρογραφία στη θέση (9) [σχ. χ1] στην αρχή της λειτουργίας και μετά από επαναφορά. Η μικρογραφία λειτουργεί ως εξωτερικός σύνδεσμος προς την επιπρόσθετη πηγή πληροφόρησης. Στο πεδίο Πνευματικά Δικαιώματα εισάγονται πληροφορίες που σχετίζονται με τα πνευματικά δικαιώματα του ενσωματωμένου πόρου (άδεια χρήσης κλπ) αν υπάρχουν. Το πεδίο είναι προαιρετικό. Στο πεδίο Υπότιτλος εισάγεται σύντομο κείμενο που προσδιορίζει το πολυμεσικό στοιχείο που ενσωματώθηκε στο χρονολόγιο. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (10) [σχ. χ1]. Πολύ σημαντικά τμήματα του χρονολογίου είναι τα επαναλαμβανόμενα τμήματα στην ενότητα «Χρονικές Περίοδοι» σχήμα χ6.

108 Σελίδα 108 από 152 Σχήμα χ6 Αριστερά της έκφρασης «Χρονική Περίοδος» υπάρχει βέλος ανάπτυξης/σύμπτυξης όπου επιλέγοντάς το (με το ποντίκι «κλίκ» πάνω του) αναπτύσσεται μία ομάδα πεδίων που είναι απαραίτητα για την περιγραφή του γεγονότος χρονική περίοδος και την ορθή ένταξή του στο χρονολόγιο. Μπορούμε να προσθέσουμε τμήμα χρονικής περιόδου επιλέγοντας : Θα πρέπει να έχουμε τόσα τμήματα «Χρονική Περίοδος» όσα και τα γεγονότα - χρονικές περίοδοι που θέλουμε να απεικονιστούν στο χρονολόγιο. Κάθε τμήμα «Χρονική Περίοδος» καταλαμβάνει και μία οριζόντια ζώνη στο χρονοδιάδρομο θέση (12) [σχ. χ1]. Επιλέγοντας (στα δεξιά του πλαισίου «Χρονική Περίοδος» διαγράφεται ύστερα από προειδοποιητικό μήνυμα το συγκεκριμένο γεγονός χρονική περίοδος. Στην ανάπτυξή του κάθε τμήμα «Χρονική Περίοδος» περιλαμβάνει τα πεδία που παρουσιάζονται στο σχήμα χ7 που ακολουθεί:

109 Σελίδα 109 από 152 Σχήμα χ7 Στο πεδίο Αρχική ημερομηνία εισάγονται από ένας ως τρείς αριθμοί χωρισμένοι με κόμμα «,» ο πρώτος αφορά το έτος, ο δεύτερος, το μήνα (1-12) και ο τρίτος την ημέρα (1-31). Είναι δυνατό να εισάγουμε μόνο Έτος, μήνα ή μόνο Έτος. Η αρχική ημερομηνία αντιπροσωπεύει την ημερομηνία του γεγονότος ή την ημερομηνία της χρονικής περιόδου. Στο χρονολόγιο το γεγονός εμφανίζεται ως πλαίσιο τοποθετημένο στη ζώνη που του αναλογεί και ξεκινά από το σημείο αρχικής ημερομηνίας. (πχ στο σχήμα χ1 η χρονική περίοδος με τίτλο «Γεγονός Β» έχει σαν αρχική ημερομηνία την τιμή 200). Το πεδίο Τελική ημερομηνία αφορά την ημερομηνία τέλους της χρονικής περιόδου που αναπαρίσταται. Αν πρόκειται για στιγμιαίο γεγονός τότε η τιμή του πεδίου αυτού μπορεί να είναι ίδια με το πεδίο Αρχική ημερομηνία. Ως προς τη μορφή του πεδίου ισχύουν όσα και στο προηγούμενο πεδίο.. Στο χρονολόγιο η διάρκεια της χρονικής περιόδου που μεσολαβεί από την αρχική ημερομηνία μέχρι την τελική εμφανίζεται με γαλάζια

110 υπογράμμιση του βαθμονομημένου χρονικού άξονα θέση (17) [σχ. χ1]. (πχ στο σχήμα χ1, για τη χρονική περίοδο με τίτλο «Γεγονός Β» το πεδίο τελική ημερομηνία έχει την τιμή 300, ενώ η χρονική περίοδος με τίτλο «Γεγονός Α» έχει Αρχική ημερομηνία και Τελική ημερομηνία την τιμή 100). Το πεδίο Τίτλος είναι πεδίο κειμένου και προσδιορίζει τον τίτλο του γεγονότος ή της χρονικής περιόδου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (7) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο και στη θέση (19) [σχ. χ1] στο χρονοδιάδρομο, στη ζώνη που της αναλογεί. Το πεδίο Κείμενο είναι πεδίο κειμένου εμπλουτισμένης μορφής και περιλαμβάνει λεπτομέρειες του γεγονότος ή της χρονικής περιόδου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (8) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Στο χρoνοδιάδρομο δεν εμφανίζεται. Το πεδίο Συνοδευτική ετικέτα είναι πεδίο κειμένου και προσδιορίζει την ζώνη του γεγονότος ή της χρονικής περιόδου. Στο χρονοδιάδρομο. Πρέπει να είναι πολύ σύντομη περιγραφή. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (13) [σχ. χ1]. Αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο τότε εμφανίζεται και πάνω από τον τίτλο μαζί με τις ημερομηνίες αρχής τέλους. Το Πολυμεσικό Στοιχείο κάθε χρονικής περιόδου, είναι κάτι αντίστοιχο με αυτό που είδαμε πιο πάνω. Η διαφορά είναι ότι το προηγούμενο αφορά το σύνολο του χρονολογίου ενώ αυτό αφορά μόνο τη συγκεκριμένη χρονική περίοδο γεγονός. Σκοπός του είναι να παρέχει πρόσθετη πληροφόρηση σχετικά με μόνο τη συγκεκριμένη χρονική περίοδο γεγονός.. Είναι προαιρετικό στοιχείο. Τα πεδία του πολυμεσικού στοιχείου της χρονικής περιόδου εμφανίζονται στο σχήμα χ8 που ακολουθεί: Σελίδα 110 από 152

111 Σελίδα 111 από 152 Σχήμα χ8 Στο πεδίο Στοιχείο εισάγεται η διεύθυνση (URL) του διαδικτυακού πόρου (χάρτης, δικτυακός τόπος, video κλπ) που θέλουμε να ενσωματωθεί ως επιπρόσθετη πηγή πληροφόρησης για τη χρονική περίοδο - γεγονός. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται ως μικρογραφία στη θέση (9) [σχ. χ1] όταν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Η μικρογραφία λειτουργεί ως εξωτερικός σύνδεσμος προς την επιπρόσθετη πηγή πληροφόρησης. Επιλέγοντας μπορούμε να μεταφορτώσουμε μία μικρή εικόνα διαστάσεων 32x32 px (αυστηρά) και να εμφανίζεται κατά την εκτέλεση του διαδραστικού στοιχείου στη θέση (20) [σχ. χ1]. Είναι προαιρετικό πεδίο, ενώ οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Στο πεδίο Πηγή εισάγεται σύντομο κείμενο που πληροφορεί για την πηγή του πολυμεσικού στοιχείου που ενσωματώθηκε στη χρονική περίοδο -γεγονός. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (11) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο.

112 Στο πεδίο Υπότιτλος εισάγεται σύντομο κείμενο που προσδιορίζει το πολυμεσικό στοιχείο που στη χρονική περίοδο -γεγονός. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (10) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Σελίδα 112 από 152 Το πεδίο Σχόλιο κείμενο μετασχολιασμού και αφορά το σύνολο της δραστηριότητας. Είναι προαιρετικό. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο χρονολόγιο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

113 Σελίδα 113 από ΚΑΡΤΕΣ ΕΡΩΤΗΣΕΩΝ Το διαδραστικό στοιχείο «ΚΑΡΤΕΣ ΕΡΩΤΗΣΕΩΝ» παρουσιάζει πάνω σε ένα πλαίσιο (κάρτα) μία ερώτηση, κάτω από την οποία υπάρχει ένα κενό πλαίσιο υποδοχής κειμένου (πεδίο κειμένου), στο οποίο ο χρήστης εξεταζόμενος πληκτρολογεί την απάντηση που θεωρεί ότι αντιστοιχεί στη συγκεκριμένη ερώτηση. Ύστερα, επιλέγοντας έλεγχος απαντήσεων (κουμπί) που υπάρχει κάτω από το πλαίσιο για την απάντηση, ενημερώνεται για το αποτέλεσμα της απάντησής του (σωστή ή λάθος) και εμφανίζεται η σωστή απάντηση. Η κάρτα είναι δυνατό να περιλαμβάνει και εικόνα. Είναι δυνατό να δημιουργηθούν πολλές κάρτες στα πλαίσια λειτουργίας του διαδραστικού αυτού στοιχείου. Για να δημιουργήσουμε κάρτες ερωτήσεων από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Κάρτες Ερωτήσεων» [σχ ΚΕ 1].

114 Σελίδα 114 από 152 Σχήμα ΚΕ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης καρτών διαλόγου, που περιλαμβάνει:

115 Σελίδα 115 από 152 Σχήμα ΚΕ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για τις ερωτήσεις των καρτών, την πορεία διεξαγωγής της δραστηριότητας, κλπ.

116 Σελίδα 116 από 152 Σχήμα ΚΕ 3 Το πλαίσιο Κάρτες [σχ ΚΕ 3] συνιστά μία «συλλογή» καρτών. Στο αριστερό τμήμα εμφανίζονται υπό μορφή λίστας οι διαθέσιμες κάρτες. Στο δεξί τμήμα εμφανίζονται τα πεδία της τρέχουσας ενεργής κάρτας. Επιλέγοντας από το αριστερό τμήμα μία άλλη Κάρτα, τότε αυτή γίνεται η τρέχουσα ενεργή κάρτα. Στο πεδίο «Κείμενο» καταχωρείται η επιθυμητή ερώτηση. Στο πεδίο «Απάντηση» καταχωρείται η απάντηση.

117 Σελίδα 117 από 152 Προσθήκη νέας κάρτας γίνεται από την επιλογή Διαγραφή κάρτας γίνεται από την επιλογή διαγραφής η τρέχουσα ενεργή κάρτα.. Διαγράφεται πάντα Προαιρετικά, μπορούμε να εμφανίσουμε στην κάρτα μια εικόνα. Αυτό γίνεται στο πεδίο «Εικόνα» με την επιλογή μεταφόρτωσης αρχείων, όπου οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Με επιλογή (τικ) στο παρακάτω Κατά την προβολή εκτέλεση του διαδραστικού στοιχείου όταν δεν έχει συμπληρώσει ο χρήστης-εξεταζόμενος την απάντηση και επιλέξει «έλεγχος απάντησης» δε γίνεται καμία ενέργεια, διότι η απουσία απάντησης θεωρείται εσφαλμένη απάντηση.

118 Σελίδα 118 από 152 Σχήμα ΚΕ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ. ΚΕ 4] μπορούμε να ρυθμίσουμε τα περιεχόμενα (κείμενα) των μηνυμάτων του διαδραστικού στοιχείου. Στο πεδίο «Κείμενο προόδου» είναι μεταβλητή που αντιστοιχεί στον αριθμό της τρέχουσας κάρτας που προβάλλεται και είναι επίσης μεταβλητή που αντιστοιχεί στον συνολικό αριθμό των διαθέσιμων καρτών διαλόγου του διαδραστικού στοιχείου.

119 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 119 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

120 Σελίδα 120 από ΚΑΡΤΕΣ ΔΙΑΛΟΓΟΥ Το διαδραστικό στοιχείο «ΚΑΡΤΕΣ ΔΙΑΛΟΓΟΥ» παρουσιάζει πάνω σε ένα πλαίσιο (κάρτα) μία ερώτηση κάτω από την οποία υπάρχει μια επιλογή (κουμπί) το οποίο όταν πατηθεί από το χρήστη, εμφανίζεται η απάντηση. Είναι δυνατό να δημιουργηθούν πολλές κάρτες στο πλαίσιο λειτουργίας του διαδραστικού αυτού στοιχείου. Για να δημιουργήσουμε κάρτες διαλόγου από το κατακόρυφο μενού αριστερά και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Κάρτες διαλόγου» [σχ ΚΔ 1].

121 Σελίδα 121 από 152 Σχήμα ΚΔ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης καρτών διαλόγου, που περιλαμβάνει: Σχήμα ΚΔ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για τις ερωτήσεις των καρτών, την πορεία διεξαγωγής της δραστηριότητας, κλπ.

122 Σελίδα 122 από 152 Αριστερό τμήμα Δεξί τμήμα Σχήμα ΚΔ 3 Το πλαίσιο Κάρτες Διαλόγου [σχ ΚΔ 3] συνιστά μία «συλλογή» καρτών. Στο αριστερό τμήμα εμφανίζονται υπό μορφή λίστας οι διαθέσιμες κάρτες. Στο δεξί τμήμα εμφανίζονται τα πεδία της τρέχουσας ενεργής κάρτας. Επιλέγοντας από το αριστερό τμήμα μία άλλη Κάρτα Διαλόγου, τότε αυτή γίνεται η τρέχουσα ενεργή κάρτα. Στο πεδίο «Κείμενο» καταχωρείται η επιθυμητή ερώτηση. Στο πεδίο «Απάντηση» καταχωρείται η απάντηση. Προσθήκη νέας κάρτας γίνεται από την επιλογή

123 Σελίδα 123 από 152 Διαγραφή κάρτας γίνεται από την επιλογή διαγραφής μία κάρτα θα πρέπει να είναι η τρέχουσα ενεργή.. Για να διαγραφεί Σχήμα ΚΔ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ. ΚΔ 4] μπορούμε να ρυθμίσουμε τα περιεχόμενα (κείμενα) των μηνυμάτων του διαδραστικού στοιχείου. Στο πεδίο «Κείμενο προόδου» είναι μεταβλητή που αντιστοιχεί στον αριθμό της τρέχουσας κάρτας που προβάλλεται και είναι επίσης μεταβλητή που αντιστοιχεί στον συνολικό αριθμό των διαθέσιμων καρτών διαλόγου του διαδραστικού στοιχείου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

124 Σελίδα 124 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

125 Σελίδα 125 από ΔΙΑΔΡΑΣΤΙΚΟ ΒΙΝΤΕΟ Το διαδραστικό βίντεο είναι μία σύνθεση όπου κατά τη διάρκεια προβολής του είναι δυνατό να συμπροβάλλονται εκτελούνται, σε καθορισμένο χρονικό σημείο και για συγκεκριμένο χρονικό διάστημα, μια σειρά πρόσθετων διαδραστικών στοιχείων (π.χ ερωτήσεις αντιστοίχισης, συμπλήρωσης κειμένου, προβολής πληροφοριών), καθώς και καθορισμό ενεργών περιοχών που παρέχουν δυνατότητα ειδικών εργασιών. Για να δημιουργήσουμε διαδραστικό βίντεο από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω : Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Διαδραστικό βίντεο» [σχ ΔΒ 1]. Σχήμα ΔΒ 1

126 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικού βίντεο που περιλαμβάνει : Σελίδα 126 από 152 Σχήμα ΔΒ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από το βίντεο. Σχήμα ΔΒ 3 Στο τμήμα της φόρμας «Επεξεργασία Διαδραστικού Βίντεο» επιλέγω «1. Μεταφόρτωση Βίντεο [1/2]», (αν δεν είναι ήδη επιλεγμένο), [σχ ΔΒ 3] και κατόπιν «Αρχεία Βίντεο»

127 Σελίδα 127 από 152 Τότε εμφανίζεται αναδυόμενο πλαίσιο διαλόγου [σχ ΔΒ4] όπου μπορούμε να επιλέξουμε το βίντεο που θα μεταφορτωθεί. Σχήμα ΔΒ 4 Μπορούμε είτε να επιλέξουμε τοπικό αρχείο μέσω της επιλογής (1) [Επιλέξτε αρχείο για μεταφόρτωση] με επιτρεπτούς τύπους αρχείων mp4 ή webm, είτε να συμπληρώσουμε την ηλεκτρονική διεύθυνση (URL) στο πεδίο (2) που βρίσκεται το βίντεο, εφόσον είναι ήδη αναρτημένο στο διαδίκτυο. Κατόπιν επιλέγουμε εισαγωγή. Εάν υπάρχουν πνευματικά δικαιώματα συμπληρώνουμε το σχετικό πεδίο, [σχ ΔΒ 3]. Στο τμήμα της φόρμας «Επεξεργασία Διαδραστικού Βίντεο» επιλέγω «2. Προσθήκη Διαδραστικών Στοιχείων [2/2],[σχ ΔΒ 3] και εμφανίζεται το βίντεο που έχουμε επιλέξει και μια σειρά εργαλείων από πάνω του. [σχ ΔΒ5].

128 Σελίδα 128 από 152 Σχήμα ΔΒ 5 Μετακινούμε το δείκτη εξέλιξης αναπαραγωγής στο επιθυμητό χρονικό σημείο που θέλουμε εισαγωγή διαδραστικού στοιχείου. Από τη γραμμή διαδραστικών εργαλείων επιλέγουμε ένα και το σύρουμε στο σημείο που επιθυμούμε, μέσα στην περιοχή προβολής του βίντεο. Αμέσως εμφανίζεται ένα αναδυόμενο παράθυρο [σχ ΔΒ 6] που περιέχει ένα σύνολο πεδίων που αφορούν τη «συμπεριφορά» του επιλεγμένου διαδραστικού πεδίου πάνω στο βίντεο, και τη διαμόρφωσή του.

129 Σελίδα 129 από 152 Σχήμα ΔΒ 6 Το πεδίο χρόνος προβολής έχει δύο πεδία κειμένου. Στο πρώτο καταχωρείται η χρονική στιγμή που επιθυμούμε το επιλεγμένο διαδραστικό στοιχείο να εμφανιστεί (Στην περίπτωση του [σχ ΔΒ 6] το διαδραστικό στοιχείο θα εμφανιστεί σε 5 λεπτά και 30 δευτερόλεπτα από την έναρξη της αναπαραγωγής). Στο δεύτερο καταχωρείται η χρονική στιγμή που επιθυμούμε το επιλεγμένο διαδραστικό στοιχείο να εξαφανιστεί. (Στην περίπτωση του [σχ ΔΒ 6] το διαδραστικό στοιχείο θα εξαφανιστεί σε 6 λεπτά και 11 δευτερόλεπτα από την έναρξη της αναπαραγωγής). Αν είναι ενεργοποιημένο το πεδίο «Παύση αναπαραγωγής», τότε τη στιγμή εμφάνισης του διαδραστικού στοιχείου διακόπτεται η αναπαραγωγή του βίντεο (παύση).

130 Αν είναι ενεργοποιημένο το πεδίο «Προβολή σαν διαδραστικό κουμπί» τότε όταν έρθει ο χρόνος εμφάνισης παρουσιάζεται ένα κουμπί κατά τη διάρκεια αναπαραγωγής. Όταν πατηθεί, λαμβάνει χώρα η εκτέλεση της πρόσθετης δραστηριότητας. Το πεδίο «Τίτλος» είναι πεδίο κειμένου υποχρεωτικό και αφορά τη συγκεκριμένη πρόσθετη δραστηριότητα. Για τα πεδία που αφορούν το εκάστοτε διαδραστικό στοιχείο πχ (ερώτηση συμπλήρωσης κενών, ερώτηση μοναδικής επιλογής κλπ. Ανατρέξτε στο αντίστοιχο τμήμα του εγχειριδίου. Σελίδα 130 από 152 ΔΙΑΓΡΑΦΗ ΔΙΑΔΡΑΣΤΙΚΟΥ ΣΤΟΙΧΕΙΟΥ (ΕΝΤΟΣ ΤΟΥ ΔΕ ΔΙΑΔΡ. ΒΙΝΤΕΟ) 1. Στην οθόνη επεξεργασίας του διαδραστικού βίντεο πηγαίνετε στο καρέ του βίντεο που έχετε τοποθετήσει το διαδραστικό στοιχείο. 2. Έπειτα κάνετε διπλό κλικ πάνω στον τίτλο του στοιχείου και εμφανίζεται παράθυρο επεξεργασίας του διαδραστικού στοιχείου. 3. Εκεί πατάτε το κόκκινο κουμπί <<Αφαίρεση>> και στο παράθυρο επιβεβαίωσης πατάτε <<ΟΚ>>. 4. Μην ξεχάσετε να πατήσετε το κουμπί <<Αποθήκευση>> για να αποθηκευτούν οι αλλαγές που κάνατε. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

131 Σελίδα 131 από ΔΙΑΔΡΑΣΤΙΚΕΣ ΕΝΕΡΓΕΣ ΠΕΡΙΟΧΕΣ Το διαδραστικό στοιχείο «Διαδραστικές Ενεργές Περιοχές» παρέχει τη δυνατότητα δημιουργίας διαδραστικών σημείων περιοχών πάνω σε ένα στατικό στοιχείο όπως πχ μια εικόνα. Ορίζονται δηλαδή ενεργές- «ζωντανές» περιοχές όπου ο χρήστης εξεταζόμενος έχει τη δυνατότητα να «ενεργεί» πάνω σ αυτές (πχ σύρσιμο και απόθεση, drag n drop). Για να δημιουργήσουμε Διαδραστικές Ενεργές Περιοχές από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω :

132 Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Διαδραστικές Ενεργές Περιοχές» [σχ ΔΕΠ 1]. Σελίδα 132 από 152 Σχήμα ΔΕΠ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικών ενεργών περιοχών που περιλαμβάνει: Σχήμα ΔΕΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά.

133 Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από την εικόνα με τις διαδραστικές περιοχές. Ακολουθεί η ομάδα πεδίων που αφορά τη μεταφόρτωση της εικόνας πάνω στην οποία θα ορισθούν οι ενεργές περιοχές καθώς και οι λειτουργίες τους [σχ. ΔΕΠ 3]. Σελίδα 133 από 152 Σχήμα ΔΕΠ 3 Επιλέγουμε την καρτέλα βημάτων (αν δεν είναι ήδη επιλεγμένη) «1. Μέγεθος καμβά και επιλογές φόντου» και κατόπιν κάνουμε κλικ στο κουμπί (Προσθήκη Αρχείου), όπου εμφανίζεται το αναδυόμενο παράθυρο επιλογής εικόνας για μεταφόρτωση. Η εικόνα λειτουργεί ως υπόβαθρο(background). Αφού επιλέξουμε την εικόνα και μεταφορτωθεί (υπόψη ότι οι υποστηριζόμενοι τύποι αρχείων είναι jpg, png ή gif ), ύστερα στα πεδία <<Μέγεθος καμβά κύριας ενεργής περιοχής>> [σχ ΔΕΠ 3] καθορίζουμε τις διαστάσεις της περιοχής όπως θα φαίνεται στην καρτέλα «2. Ορισμός υποπεριοχών και εισαγωγή κειμένου/εικόνας» και θα περιέχει τα διαδραστικά μέρη του στοιχείου (Αυτές οι διαστάσεις αφορούν μόνο την οθόνη επεξεργασίας. Στην προβολή του διαδρ. στοιχείου στο σενάριο η εικόνα θα πάρει τις διαστάσεις του σεναρίου). Το πρώτο πεδίο αφορά το πλάτος (σε pixel) και το δεύτερο πεδίο αφορά το ύψος (σε pixel). Το πεδίο <<Αδιαφάνεια φόντου των κινούμενων στοιχείων (κείμενα και εικόνες)>> [σχ ΔΕΠ 3] καθορίζει την αδιαφάνεια του γκρί φόντου που αυτόματα τοποθετείται πίσω από τα κινούμενα στοιχεία (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια). Όταν αυτή η επιλογή συμπληρωθεί τότε εφαρμόζεται σε όλα

134 τα κινούμενα στοιχεία (κείμενα ή και εικόνες) και η επιλογή αδιαφάνειας που υπάρχει σε κάθε κινούμενο στοιχείο παραβλέπεται. Για παράδειγμα θα υποθέσουμε ότι σε μια εικόνα με εργαλεία θέλουμε οι χρήστες εξεταζόμενοι να «αναγνωρίσουν» αυτά τα εργαλεία. Για το σκοπό αυτό θα χρησιμοποιήσουμε μία εικόνα που απεικονίζει αυτά τα εργαλεία και θα ορίσουμε 4 σταθερές υποπεριοχές απόθεσης πάνω στα εργαλεία αυτά όπου θα λειτουργούν ως περιέκτες (containers) μέσα στις οποίες θα φιλοξενηθούν οι απαντήσεις που είναι κινούμενα στοιχεία (2 κείμενα και 2 εικόνες). Κατά το χρόνο εκτέλεσης η εμφάνιση του στοιχείου «Διαδραστικές ενεργές περιοχές θα είναι: [σχ ΔΕΠ 4] Σελίδα 134 από 152 Σχήμα ΔΕΠ 4 Για να καθορίσουμε ενεργά τμήματα (υποπεριοχές απόθεσης και κινούμενα στοιχεία) επιλέγουμε από τις καρτέλες βημάτων [σχ ΔΕΠ 3] «2. Ορισμός υποπεριοχών και εισαγωγή κειμένου/εικόνας», και θα προκύψουν τα πεδία καθορισμού ενεργών τμημάτων.

135 Σελίδα 135 από 152 Σχήμα ΔΕΠ 5 Από τη γραμμή εργαλείων τοποθέτησης ενεργών τμημάτων [σχ ΔΕΠ 5] πρώτα επιλέγουμε [εισαγωγή υποπεριοχής απόθεσης] και το σέρνουμε (drag n drop) στο σημείο που επιθυμούμε μέσα στην ενεργό περιοχή. Αμέσως εμφανίζονται τα απαραίτητα πεδία που αφορούν κάθε ενεργή περιοχή απόθεσης [σχ ΔΕΠ 6].

136 Σελίδα 136 από 152 Σχήμα ΔΕΠ 6 (Η παραπάνω εικόνα αφορά μια υποπεριοχή απόθεσης του παραδείγματος με τα εργαλεία αφού έχουν εισαχθεί τα κινούμενα στοιχεία κειμένου και εικόνας). Το πεδίο τίτλος είναι υποχρεωτικό και ορίζει τον τίτλο του συγκεκριμένου ενεργού σταθερού τμήματος υποπεριοχή απόθεσης. Σε περίπτωση που δε θέλουμε να εμφανίζεται ο τίτλος κατά το χρόνο προβολής-εκτέλεσης δεν «τσεκάρουμε» το πεδίο «Προβολή τίτλου». Μπορούμε επίσης να καθορίσουμε το βαθμό αδιαφάνειας για το συγκεκριμένο ενεργό σταθερό τμήμα υποπεριοχή απόθεσης (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια), και προαιρετικά να προσθέσουμε κάποιο βοηθητικό κείμενο. Επιλέγοντας αποθηκεύονται οι αλλαγές για το συγκεκριμένο ενεργό σταθερό τμήμα υποπεριοχή απόθεσης και επιλέγοντας διαγράφεται μετά από μήνυμα επιβεβαίωσης. Είναι δυνατό να προστεθούν περισσότερα από ένα ενεργά σταθερά τμήματα υποπεριοχές απόθεσης.

137 Αφού εισάγουμε όσα ενεργά σταθερά τμήματα υποπεριοχές απόθεσης επιθυμούμε θα έχουμε μια εικόνα [σχ ΔΕΠ 7] (για το παράδειγμα με τα εργαλεία που αναφέρθηκε παραπάνω) Σελίδα 137 από 152 Σχήμα ΔΕΠ 7 Εδώ έχουμε ορίσει 4 ενεργά σταθερά τμήματα - υποπεριοχές απόθεσης και τα ονομάσαμε ΠΕΡΙΟΧΗ ΤΣΕΚΟΥΡΙ, ΠΕΡΙΟΧΗ ΚΑΤΣΑΒΙΔΙ, ΠΕΡΙΟΧΗ ΓΑΛΛΙΚΟ ΚΛΕΙΔΙ, ΠΕΡΙΟΧΗ ΣΦΥΡΙ. Για να ορίσουμε τα ενεργά κινούμενα τμήματα, από τη γραμμή εργαλείων τοποθέτησης ενεργών τμημάτων [σχ ΔΕΠ 5] επιλέγουμε για κινούμενο τμήμα κειμένου ή για κινούμενο τμήμα εικόνας και το σέρνουμε (drag n drop) στο σημείο που επιθυμούμε μέσα στην ενεργό περιοχή. Αν πρόκειται για κείμενο θα

138 εμφανιστούν τα απαραίτητα πεδία για τον προσδιορισμό κάθε ενεργού κινούμενου τμήματος. [σχ ΔΕΠ 8]. Σελίδα 138 από 152 Σχήμα ΔΕΠ 8 (Η παραπάνω εικόνα αφορά ένα ενεργό κινούμενο τμήματος του παραδείγματος με τα εργαλεία). Στο πεδίο «Κείμενο που θα φαίνεται» καταχωρείτε το κείμενο που θα εμφανίζει το ενεργό κινούμενο τμήμα. Η ομάδα πεδίων «Επιλέξτε σε ποιες υποπεριοχές απόθεσης θα μπορεί να τοποθετείται το κινούμενο στοιχείο» εμφανίζουν τους τίτλους των σταθερών ενεργών τμημάτων υποπεριοχές απόθεσης που ορίσαμε πριν. Όσους από αυτούς επιλέξουμε (τσεκάρουμε), σημαίνει ότι το τρέχων ενεργό κινούμενο τμήμα θα μπορεί να φιλοξενηθεί ως περιεχόμενο από τον αντίστοιχο περιέκτη (Την σωστή αντιστοίχιση περιοχής απόθεσης με κινούμενο στοιχείο την ορίζουμε αργότερα). Μπορούμε επίσης να καθορίσουμε το βαθμό αδιαφάνειας για το συγκεκριμένο κινούμενο στοιχείο (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια). Αποθηκεύουμε επιλέγοντας και διαγράφουμε επιλέγοντας μετά από σχετικό μήνυμα επιβεβαίωσης. Μπορούμε φυσικά να ορίσουμε περισσότερα από ένα ενεργά κινούμενα τμήματα.

139 Μένει τώρα να ορίσουμε τις «σωστές» απαντήσεις δηλαδή ποιο ζεύγος περιέκτη υποπεριοχή απόθεσης και κινούμενου στοιχείου θεωρείται σωστό. Αυτό γίνεται αφού έχουν ορισθεί τα ενεργά κινούμενα στοιχεία και έχουν καθοριστεί ποια από αυτά θα αντιστοιχούν σε ποιους περιέκτες υποπεριοχές απόθεσης όπως μόλις περιγράφηκε. Για να ορίσουμε σωστές απαντήσεις επιλέγουμε κάθε σταθερό ενεργό τμήμα- περιέκτη - υποπεριοχή απόθεσης κάνοντας διπλό «κλικ» πάνω του όπου εμφανίζονται τα πεδία του συγκεκριμένου σταθερού ενεργού τμήματος περιέκτηυποπεριοχή απόθεσης. Κάτω από το πεδίο <<Επιλέξτε τα σωστά στοιχεία που αντιστοιχούν στην τρέχουσα περιοχή απόθεσης.>> υπάρχει μία λίστα που παρουσιάζει τα ενεργά κινούμενα στοιχεία (που ορίσαμε πριν ότι μπορούν να φιλοξενούνται ως περιεχόμενα του συγκεκριμένου περιέκτη- υποπεριοχή απόθεσης) και όσα από αυτά επιλέγονται (τσεκάρονται) θεωρούνται ως σωστές απαντήσεις κατά την προβολή εκτέλεση του ψηφιακού σεναρίου. [σχ ΔΕΠ 6] Δεν παραλείπουμε μετά από κάθε μεταβολή να αποθηκεύουμε επιλέγοντας. Οποιαδήποτε στιγμή θέλουμε να επεξεργαστούμε ένα κινούμενο στοιχείο ή μια υποπεριοχή απόθεσης απλά κάνουμε διπλό κλικ πάνω του. Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις» επιλέγουμε (τσεκάροντας) τις επιλογές που σχετίζονται με τον τρόπο λειτουργίας του διαδραστικού στοιχείου και στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» καθορίζονται τα διαλογικά κείμενα μηνύματα που θα εμφανίζονται κατά τη διάρκεια προβολής εκτέλεσης του ψηφιακού σεναρίου. Σελίδα 139 από 152 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

140 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 140 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

141 Σελίδα 141 από ΔΙΑΔΡΑΣΤΙΚΗ ΠΑΡΟΥΣΙΑΣΗ Οι Διαδραστικές παρουσιάσεις είναι μια συλλογή «διαφανειών», τα περιεχόμενα των οποίων είναι τα διάφορα διαδραστικά στοιχεία που υποστηρίζει η εφαρμογή. Για να δημιουργήσουμε διαδραστικές παρουσιάσεις από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγουμε: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία κι επιλέγουμε από αυτά το «Διαδραστικές Παρουσιάσεις» [σχ ΔΠ 1].

142 Σελίδα 142 από 152 Σχήμα ΔΠ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικών παρουσιάσεων που περιλαμβάνει: Σχήμα ΔΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τη διαδραστική παρουσίαση.

143 Σελίδα 143 από 152 Σχήμα ΔΠ 3 Από τη γραμμή διαδραστικών εργαλείων [σχ ΔΠ 3], επιλέγουμε διαδραστικά στοιχεία και τα σύρουμε στο σημείο που επιθυμούμε, μέσα στην περιοχή της διαφάνειας. Σε περίπτωση που εισάγουμε κάποιο διαδραστικό στοιχείο ερώτησης, τότε προστίθεται αυτόματα στο τέλος μια διαφάνεια επιπλέον η οποία περιέχει την προβολή των απαντήσεων.

144 Σελίδα 144 από 152 Η επιλογή [σχ ΔΠ 3] της γραμμής διαδραστικών εργαλείων διαχειρίζεται τις λέξεις κλειδιά της παρουσίασης. Επιλέγοντάς την, εμφανίζεται πτυσσόμενο μενού όπως φαίνεται στο [σχ ΔΠ 4] Σχήμα ΔΠ 4

145 Σελίδα 145 από 152 Επιλέγοντας (τικ) στο «Λίστα λέξεων-κλειδιά», εμφανίζεται στο κάτω αριστερό άκρο της διαφάνειας η επιλογή διαχείρισης λέξεων κλειδιών [σχ ΔΠ 5] Σχήμα ΔΠ 5 Πατώντας πάνω της «κλικ», εμφανίζεται η λίστα λέξεων κλειδιών και η επιλογή προσθήκης νέας. Η κάθε λέξη κλειδί λειτουργεί ως «σελιδοδείκτης» για τις διαφάνειες (επιλέγοντάς την, μεταφερόμαστε στη συγκεκριμένη διαφάνεια). Κάθε διαφάνεια μπορεί να έχει περισσότερες από μία λέξεις κλειδιά. Εάν θελήσουμε να επεξεργαστούμε κάποιο διαδραστικό στοιχείο το οποίο έχουμε ήδη εισάγει, τότε θα πρέπει να το επιλέξουμε και να κάνουμε πάνω του διπλό κλικ, ώστε να μας ανοίξει το αντίστοιχο μενού επεξεργασίας. Πληροφορίες σχετικά με τη χρήση των εκάστοτε διαδραστικών εργαλείων μπορείτε να βρείτε στα αντίστοιχα τμήματα του Συνολικού Εγχειριδίου Χρήσης της Πλατφόρμας, καθόσον η λειτουργικότητα παραμένει κοινή είτε το ΔΕ χρησιμοποιείται άμεσα (ως ξεχωριστό ΔΕ) είτε έμμεσα (μέσω του ΔΕ «Διαδραστική Παρουσίαση»).

146 Σελίδα 146 από 152 Για παράδειγμα ως προς την εισαγωγή εικόνων, ισχύει ό, τι αναφέρεται στο αντίστοιχο ΔΕ (ΔΕ «Εικόνα»). Επιλέγοντας το κουμπί από το πάνω μενού, ανοίγει παράθυρο υπό τον τίτλο «Επεξεργασία Εικόνας» με τις γνωστές επιλογές του ΔΕ «Εικόνα». Επιπλέον, εμφανίζονται οι ακόλουθες καινούριες επιλογές, όπως εμφανίζονται ακολούθως [σχ ΔΠ 6]. Οι εν λόγω επιλογές εμφανίζονται για το σύνολο των διαδραστικών στοιχείων που προσφέρει το ΔΕ «Διαδραστική Παρουσίαση». Σχήμα ΔΠ 6 Το πεδίο Σχόλια περιλαμβάνει σχόλια τα οποία εμφανίζονται όταν γίνει προβολή των απαντήσεων, με αντίστοιχη επιλογή για μόνιμη προβολή των σχολίων. Εάν αυτή τσεκαριστεί, τότε στην προεπισκόπηση εμφανίζεται ένα ερωτηματικό μέρος της εικόνας [σχ ΔΠ 7], στο κάτω δεξιά

147 Σελίδα 147 από 152 Σχήμα ΔΠ 7 το οποίο όταν πατηθεί ανοίγει υπομενού με το σχόλιο που εισαγάγαμε [σχ ΔΠ 8]. Σχήμα ΔΠ 8 Το πεδίο «Διαφάνεια» λαμβάνει τιμές πολλαπλάσιες του 5 (έγκυρες τιμές: 0, 5, 10,15, κ.ο.κ.). Η χρηστικότητα του πεδίου αυτού είναι να διαχειρίζεται το επίπεδο εμφάνισης πλήθους εικόνων ή άλλων διαδραστικών στοιχείων στην ίδια σελίδα της διαδραστικής παρουσίασης (φόντο). Π.χ, εάν θέλουμε να δημιουργήσουμε το ακόλουθο αποτέλεσμα [σχ ΔΠ 9]

148 Σελίδα 148 από 152 Σχήμα ΔΠ 9 θα πρέπει να ορίσουμε στην εικόνα με τίτλο «ΦΟΝΤΟ #01» το χαμηλότερο αριθμό Διαφάνειας (έστω 5), στην εικόνα με τίτλο «ΦΟΝΤΟ #02» μεγαλύτερο αριθμό Διαφάνειας (έστω 10) και τέλος στην εικόνα που θέλουμε να βρίσκεται στο πάνω-πάνω επίπεδο το μέγιστο αριθμό Διαφάνειας (έστω 15). [ΣΗΜΕΙΩΣΗ: Προτείνεται το ανέβασμα των εικόνων να γίνεται βηματικά, δηλαδή κάθε φορά που ανεβαίνει (upload) μια εικόνα να πατιέται το κουμπί

Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου

Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου Bee Group Α.Ε. [Type the company name] [Pick the date] Εγχειρίδιο λειτουργίας Τράπεζας Χρόνου 2 ΠΕΡΙΕΧΟΜΕΝΑ 1. Αρχική Σελίδα... 3 2. Δημιουργία Λογαριασμού... 3 3.

Διαβάστε περισσότερα

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 Οδηγίες Χρήσης Πίνακας Περιεχομένων 1. Αρχική οθόνη... 3 2. Αρχική Οθόνη Πιστοποιημένου Χρήστη... 4 2.1. Οριστικοποίηση της Περιουσιακής Εικόνας... 5 2.2. Καρτέλες

Διαβάστε περισσότερα

«Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά

«Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά ΙΝΣΤΙΤΟΥΤΟ ΕΠΕΞΕΡΓΑΣΙΑΣ ΤΟΥ ΛΟΓΟΥ / Ε. Κ. «ΑΘΗΝΑ» «Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά Οδηγίες: Δημιουργία ασκήσεων 2014 Περιεχόμενα 1. Εισαγωγή... 3 2. Δημιουργία ασκήσεων...

Διαβάστε περισσότερα

Εγχειρίδιο διαχείρισης χρηστών και λιστών διανομής για τον Υπεύθυνο Φορέα του Δικτύου "Σύζευξις" -1-

Εγχειρίδιο διαχείρισης χρηστών και λιστών διανομής για τον Υπεύθυνο Φορέα του Δικτύου Σύζευξις -1- -1- 1 Διαχείριση Χρηστών...3 1.1 Υπηρεσίες...5 1.1.1 Δημιουργία νέου χρήστη...6 1.1.2 Αναζήτηση χρήστη...7 1.1.2 Επεξεργασία στοιχείων χρήστη...8 1.1.3 Δημιουργία /Επεξεργασία mailbox plan...10 1.1.4 Ενεργοποίηση

Διαβάστε περισσότερα

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών. Κέντρο Επαγγελματικής Κατάρτισης. Σταδίου 5, 10562 Σύνταγμα

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών. Κέντρο Επαγγελματικής Κατάρτισης. Σταδίου 5, 10562 Σύνταγμα Σύστημα Διαχείρισης Εκπαίδευσης Εγχειρίδιο Χρήσης Εκπαιδευόμενου Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών Κέντρο Επαγγελματικής Κατάρτισης Σταδίου 5, 10562 Σύνταγμα τηλ.: 210-3689381, 210-3689354 fax:

Διαβάστε περισσότερα

ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΔΙΑΧΕΙΡΙΣΗ ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ

ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΔΙΑΧΕΙΡΙΣΗ ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΔΙΑΧΕΙΡΙΣΗ Περιγραφή και επεξήγηση της χρήσης του χώρου διαχείρισης της ιστοσελίδας για τους καλλιτέχνες 1 Περιεχόμενα Είσοδος στο χώρο διαχείρισης...3 Επεξεργασία της σελίδας

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΑΓΡΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4.

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΑΓΡΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4.2 Δεκέμβριος 2013 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ 1 ΓΕΝΙΚΕΣ ΛΕΙΤΟΥΡΓΙΕΣ... 5 1.1 Υποχρεωτικά Πεδία... 5 1.2 Βοηθητική Λίστα Τιμών (drop down

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΠΡΑΣΙΝΗ ΕΠΙΧΕΙΡΗΣΗ 2010

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΠΡΑΣΙΝΗ ΕΠΙΧΕΙΡΗΣΗ 2010 ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΠΡΑΣΙΝΗ ΕΠΙΧΕΙΡΗΣΗ 2010 Μ.Ο.Δ..ΜΟΝΑΔΑ ΟΡΓΑΝΩΣΗΣ ΤΗΣ ΔΙΑΧΕΙΡΙΣΗΣ ΑΝΑΠΤΥΞΙΑΚΩΝ ΠΡΟΓΡΑΜΜΑΤΩΝ Α.Ε. 1 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ 1. Εγγραφή στο σύστημα...3 2.

Διαβάστε περισσότερα

Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων

Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων Δράση «Ανοικτά Ακαδημαϊκά Μαθήματα στο Πανεπιστήμιο Αθηνών» Σύνδεσμος: http://opencourses.uoa.gr / Περιεχόμενα ΠΡΟΫΠΟΘΕΣΕΙΣ... 2 1. ΕΙΣΑΓΩΓΗ ΧΡΗΣΤΗ ΣΤΗΝ

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΧΡΗΣΤΗ. Ηλεκτρονική Υποβολή Α.Π.Δ.

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΧΡΗΣΤΗ. Ηλεκτρονική Υποβολή Α.Π.Δ. ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΧΡΗΣΤΗ Ηλεκτρονική Υποβολή Α.Π.Δ. ΠΕΡΙΕΧΟΜΕΝΑ 1) Είσοδος στην εφαρμογή 2) Δημιουργία Περιόδου Υποβολής 2.α) Ακύρωση Περιόδου Υποβολής 3) Μέθοδος Υποβολής: Συμπλήρωση Φόρμας 3.α) Συμπλήρωση

Διαβάστε περισσότερα

Δημιουργία η-μαθήματος με τη. 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας

Δημιουργία η-μαθήματος με τη. 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας Δημιουργία η-μαθήματος με τη χρήση του Moodle 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας Δημιουργία η-μαθήματος με τη χρήση του Moodle 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΜΕΤΑΠΟΙΗΣΗ ΣΤΙΣ ΝΕΕΣ ΣΥΝΘΗΚΕΣ

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΜΕΤΑΠΟΙΗΣΗ ΣΤΙΣ ΝΕΕΣ ΣΥΝΘΗΚΕΣ ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΠΡΟΤΑΣΗΣ ΓΙΑ ΤΗ ΔΡΑΣΗ ΜΕΤΑΠΟΙΗΣΗ ΣΤΙΣ ΝΕΕΣ ΣΥΝΘΗΚΕΣ Μ.Ο.Δ..ΜΟΝΑΔΑ ΟΡΓΑΝΩΣΗΣ ΤΗΣ ΔΙΑΧΕΙΡΙΣΗΣ ΑΝΑΠΤΥΞΙΑΚΩΝ ΠΡΟΓΡΑΜΜΑΤΩΝ Α.Ε. 1 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ 1. Εγγραφή στο σύστημα...3

Διαβάστε περισσότερα

Ksyla.gr Σύντομη περιγραφή λειτουργίας

Ksyla.gr Σύντομη περιγραφή λειτουργίας Οδηγός Εφαρμογής Ksyla.gr Σύντομη περιγραφή λειτουργίας Το ksyla.gr είναι μια κοινότητα αγοραπωλησίας καύσιμου ξύλου σε οποιαδήποτε μορφή (καυσόξυλα, πέλλετ, μπρικέτες, κάρβουνα) καθώς επίσης και ειδών

Διαβάστε περισσότερα

Σύντομη περιγραφή 5. Για να ξεκινήσετε 6. Οι οθόνες του προγράμματος 8. Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7

Σύντομη περιγραφή 5. Για να ξεκινήσετε 6. Οι οθόνες του προγράμματος 8. Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7 Σύντομη περιγραφή 5 Για να ξεκινήσετε 6 Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7 Οι οθόνες του προγράμματος 8 Αρχική οθόνη 8 Στοιχεία ασθενή 9 Εργασίες - Ραντεβού 10 Εικόνες 11 Ημερολόγιο

Διαβάστε περισσότερα

Πανεπιστήμιο Αιγαίου. Ναυτίλος. Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου

Πανεπιστήμιο Αιγαίου. Ναυτίλος. Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου Πανεπιστήμιο Αιγαίου Ναυτίλος Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου Εγχειρίδιο Χρήσης για τον υποψήφιο Έκδοση 1.4.1 Περιεχόμενα 1. Εισαγωγικά... 3 2. Εγγραφή

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ Εγχειρίδιο Εφαρμογής Φοιτητών Πίνακας Εικόνων Εικόνα 1.1. Εκκίνηση της διαδικασία εγγραφής...5 Εικόνα 1.2. Σελίδα εγγραφής...6 Εικόνα 1.3. Είσοδος

Διαβάστε περισσότερα

Σενάριο Χρήσης myschool

Σενάριο Χρήσης myschool Σενάριο Χρήσης Το παρόν Εγχειρίδιο αποτελεί ένα σύντομο οδηγό γνωριμίας με το πληροφοριακό σύστημα myschool. Σε αυτό, παρουσιάζονται οι βασικές λειτουργίες της εφαρμογής ενώ ταυτόχρονα σας δίδεται ένα

Διαβάστε περισσότερα

Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης

Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης Περιεχόμενα 1. Εισαγωγή... 3 2. Σελίδα εισόδου... 4 3. Αρχική καρτέλα... 6 4. Στοιχεία Συμβούλου... 7 5. Στοιχεία λογαριασμού... 8 6. Αιτήματα Παρόχων...

Διαβάστε περισσότερα

Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων

Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων ΑΝΑΖΗΤΗΣΗ ΣΤΟ ΦΩΤΟΔΕΝΤΡΟ Για να αναζητήσετε Μαθησιακά Αντικείμενα στο Φωτόδεντρο χρησιμοποιείστε το πεδίο εισαγωγής

Διαβάστε περισσότερα

ΠΛΑΤΦΟΡΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΒΙΝΤΕΟΔΙΑΛΕΞΕΩΝ ΔΗΛΟΣ delos.uoa.gr. Εγχειρίδιο Χρήσης Μελών ΔΕΠ

ΠΛΑΤΦΟΡΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΒΙΝΤΕΟΔΙΑΛΕΞΕΩΝ ΔΗΛΟΣ delos.uoa.gr. Εγχειρίδιο Χρήσης Μελών ΔΕΠ ΠΛΑΤΦΟΡΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΒΙΝΤΕΟΔΙΑΛΕΞΕΩΝ ΔΗΛΟΣ delos.uoa.gr Εγχειρίδιο Χρήσης Μελών ΔΕΠ Αναζήτηση Δημόσιου Περιεχομένου Η διεύθυνση ιστού της νεάς πλατφόρμας διαχείρισης βιντεοδιαλέξεων Δήλος είναι: http://delos.uoa.gr

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Για τη διαδικτυακή εφαρμογή. Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Για τη διαδικτυακή εφαρμογή. Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ Για τη διαδικτυακή εφαρμογή Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων στο πλαίσιο του έργου ΕΚΠΑΙΔΕΥΣΗ ΦΟΙΤΗΤΩΝ ΓΙΑ ΤΗΝ ΑΝΑΠΤΥΞΗ ΔΕΞΙΟΤΗΤΩΝ

Διαβάστε περισσότερα

1. Εισαγωγή στο ΟΠΣ - ΠΔΕ

1. Εισαγωγή στο ΟΠΣ - ΠΔΕ 1. Εισαγωγή στο ΟΠΣ - ΠΔΕ 1.1 Εισαγωγή 1.1.1 Σύντομη περιγραφή και σκοπός ΟΠΣ Το Ολοκληρωμένο Πληροφοριακό Σύστημα (Ο.Π.Σ.) αποτελεί ένα σύστημα πληροφόρησης και διαχείρισης, η χρήση του οποίου επιβάλλεται

Διαβάστε περισσότερα

ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΑΙΤΗΣΗΣ ΕΝΤΑΞΗΣ ΣΤΟ ΜΗΤΡΩΟ ΕΚΠΑΙΔΕΥΤΩΝ Ε.Κ.Δ.Δ.Α.

ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΑΙΤΗΣΗΣ ΕΝΤΑΞΗΣ ΣΤΟ ΜΗΤΡΩΟ ΕΚΠΑΙΔΕΥΤΩΝ Ε.Κ.Δ.Δ.Α. ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΑΙΤΗΣΗΣ ΕΝΤΑΞΗΣ ΣΤΟ ΜΗΤΡΩΟ ΕΚΠΑΙΔΕΥΤΩΝ Ε.Κ.Δ.Δ.Α. Με την επιλογή του συνδέσμου βρίσκεστε στην πρώτη σελίδα της εφαρμογής (Εικόνα 1). Για να ξεκινήσετε την εγγραφή σας στο νέο μητρώο

Διαβάστε περισσότερα

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 Οδηγίες Χρήσης Πίνακας Περιεχομένων 1. Εισαγωγή... 3 2. Πρόσθετα Πεδία για την υποβολή δήλωσης Ε9 έτους 2013... 5 3. Αρχική οθόνη... 8 4. Αρχική Οθόνη Πιστοποιημένου

Διαβάστε περισσότερα

Οδηγίες Χρήσης Εφαρμογής Βελτίωσης Περιεχομένου δήλωσης Ε9

Οδηγίες Χρήσης Εφαρμογής Βελτίωσης Περιεχομένου δήλωσης Ε9 Οδηγίες Χρήσης Εφαρμογής Βελτίωσης Περιεχομένου δήλωσης Ε9 1. Οθόνη εισόδου στην εφαρμογή βελτίωσης περιεχομένου Δηλώσεων Ε9 Για την είσοδο στην εφαρμογή απαιτείται να συμπληρωθούν (Εικόνα 1): Ο Α.Φ.Μ.

Διαβάστε περισσότερα

SITEBUILDER ΠΛΑΤΦΟΡΜΑ ΑΥΤΟΝΟΜΗΣ ΚΑΤΑΣΚΕΥΗΣ & ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΚΤΥΑΚΩΝ ΤΟΠΩΝ (WEBSITE) ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Version 2.0

SITEBUILDER ΠΛΑΤΦΟΡΜΑ ΑΥΤΟΝΟΜΗΣ ΚΑΤΑΣΚΕΥΗΣ & ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΚΤΥΑΚΩΝ ΤΟΠΩΝ (WEBSITE) ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Version 2.0 SITEBUILDER ΠΛΑΤΦΟΡΜΑ ΑΥΤΟΝΟΜΗΣ ΚΑΤΑΣΚΕΥΗΣ & ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΚΤΥΑΚΩΝ ΤΟΠΩΝ (WEBSITE) ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ Version 2.0 Περιεχόμενα 1. Οδηγίες πρόσβασης... 3 2. Οδηγίες Σχεδιασμού Website... 4 2.1. Έναρξη...

Διαβάστε περισσότερα

Οδηγό ς Σχ. Έτόυς 2014-2015

Οδηγό ς Σχ. Έτόυς 2014-2015 Οδηγό ς Σχ. Έτόυς 2014-2015 Σχολικό Έτος Στο ΠΣ myschool υλοποιείται πλήρης ιστορικότητα και τα δεδομένα σας είναι διαθέσιμα για κάθε Σχολικό Έτος. Μέσα από την ΑΡΧΙΚΗ σελίδα μπορείτε κάθε φορά να ορίζετε

Διαβάστε περισσότερα

Εγχειρίδιο Χρήσης Εφαρμογής Προσωπικού Ιδρυμάτων/Ερευνητικών Φορέων

Εγχειρίδιο Χρήσης Εφαρμογής Προσωπικού Ιδρυμάτων/Ερευνητικών Φορέων ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ Εγχειρίδιο Χρήσης Εφαρμογής Προσωπικού ΠΕΡΙΕΧΟΜΕΝΑ 1. Δημιουργία Λογαριασμού... 4 2. Διαδικασία υποβολής αίτησης... 13 3. Διόρθωση αίτησης κατόπιν

Διαβάστε περισσότερα

Οδηγίες για τη Χρήση του Google Drive

Οδηγίες για τη Χρήση του Google Drive Οδηγίες για τη Χρήση του Google Drive Χαρπαντίδου Ζαχαρούλα Επιμορφώτρια Β επιπέδου ΠΕ 19-20 Υπεύθυνη ΚΕ.ΠΛΗ.ΝΕ.Τ. Δράμας 2013 Περιεχόμενα Δημιουργία λογαριασμού στο Google Drive. 3 Διαχείριση του GoogleDrive..

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΨΗΦΙΟΥ ΕΠΑΛ Α Έκδοση 1.0, Ιούνιος 2011 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ ΠΙΝΑΚΑΣ

Διαβάστε περισσότερα

ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ

ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΤΟΥ ΣΥΣΤΗΜΑΤΟΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΚΑΙ ΠΑΡΑΚΟΛΟΥΘΗΣΗ ΤΗΣ ΔΙΑΔΙΚΑΣΙΑΣ ΔΙΕΚΠΕΡΑΙΩΣΗΣ ΑΙΤΗΣΕΩΝ ΚΑΤΑΣΚΕΥΑΣΤΩΝ VLT ΕΚΔΟΣΗ 1.0 Δεκέμβριος 2014 1 Περιεχόμενα

Διαβάστε περισσότερα

Vodafone Business Connect

Vodafone Business Connect Vodafone Business Connect Vodafone Business WebHosting Αναλυτικός Οδηγός Χρήσης Photo Album Αναλυτικός οδηγός χρήσης: Photo Album Vodafone Business Connect - Υπηρεσίες φιλοξενίας εταιρικού e-mail & web

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΑΝΕΠΙΣΤΗΜΙΟ

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΑΝΕΠΙΣΤΗΜΙΟ ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΑΝΕΠΙΣΤΗΜΙΟ Επιχειρησιακό Πρόγραμμα: Εθνικό Στρατηγικό Πλαίσιο Αναφοράς (ΕΣΠΑ) 2007-2013 Έργο: Ελληνικό Ανοικτό Πανεπιστήμιο με κωδικό ΟΠΣ296121 Υπο-έργο 5: Εργαστήριο Εκπαιδευτικού Υλικού

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΜΑΘΗΤΗ. της Πλατφόρμας Τηλεκατάρτισης

ΕΓΧΕΙΡΙΔΙΟ ΜΑΘΗΤΗ. της Πλατφόρμας Τηλεκατάρτισης ΕΓΧΕΙΡΙΔΙΟ ΜΑΘΗΤΗ της Πλατφόρμας Τηλεκατάρτισης ΠΕΡΙΕΧΟΜΕΝΑ 1. Εισαγωγή...2 2. Αρχική σελίδα, Εισαγωγή & Περιβάλλον Συστήματος...3 2.1. Αρχική σελίδα εισαγωγής...3 2.2. Εισαγωγή στην Πλατφόρμα Τηλε-κατάρτισης...4

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΑΙΤΗΣΗΣ ΓΙΑ ΤΟ ΕΘΝΙΚΟ ΜΗΤΡΩΟ ΠΙΣΤΟΠΟΙΗΜΕΝΩΝ ΑΞΙΟΛΟΓΗΤΩΝ / ΕΛΕΓΚΤΩΝ

ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΑΙΤΗΣΗΣ ΓΙΑ ΤΟ ΕΘΝΙΚΟ ΜΗΤΡΩΟ ΠΙΣΤΟΠΟΙΗΜΕΝΩΝ ΑΞΙΟΛΟΓΗΤΩΝ / ΕΛΕΓΚΤΩΝ ΕΓΧΕΙΡΙΔΙΟ ΥΠΟΒΟΛΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΑΙΤΗΣΗΣ ΓΙΑ ΤΟ ΕΘΝΙΚΟ ΜΗΤΡΩΟ ΠΙΣΤΟΠΟΙΗΜΕΝΩΝ ΑΞΙΟΛΟΓΗΤΩΝ / ΕΛΕΓΚΤΩΝ Ν.3908/2011 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ 1.Εγγραφή στο σύστημα...3 2. Είσοδος στο σύστημα...4 3. Υποβολή Αίτησης...6

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΤΗΣ ΕΛΛΑΔΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ

ΤΡΑΠΕΖΑ ΤΗΣ ΕΛΛΑΔΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΤΡΑΠΕΖΑ ΤΗΣ ΕΛΛΑΔΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΟΔΗΓΙΕΣ ΣΥΜΠΛΗΡΩΣΗΣ ΥΠΟΔΕΙΓΜΑΤΟΣ ΓΙΑ ΤΟΝ ΙΣΟΛΟΓΙΣΜΟ ΚΑΙ ΤΗΝ ΚΑΤΑΣΤΑΣΗ ΑΠΟΤΕΛΕΣΜΑΤΩΝ ΧΡΗΣΕΩΝ (BSD16) ΙΟΥΛΙΟΣ 2008 Ηλεκτρονική υποβολή στοιχείων

Διαβάστε περισσότερα

Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ

Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ Οδηγός Χρήσης Εφαρμογής Φορέων Υποδοχής Πρακτικής Άσκησης Αφού πιστοποιηθεί ο λογαριασμός που δημιουργήσατε στο πρόγραμμα «Άτλας» ως Φορέας

Διαβάστε περισσότερα

Εγχειρίδιο Χρήσης Προσωποποιημένων Υπηρεσιών Γ.Ε.ΜΗ. (ΕΠΙΧΕΙΡΗΣΕΙΣ)

Εγχειρίδιο Χρήσης Προσωποποιημένων Υπηρεσιών Γ.Ε.ΜΗ. (ΕΠΙΧΕΙΡΗΣΕΙΣ) Εγχειρίδιο Χρήσης Προσωποποιημένων Υπηρεσιών Γ.Ε.ΜΗ. (ΕΠΙΧΕΙΡΗΣΕΙΣ) Έκδοση 2 - ΙΟΥΝΙΟΣ 2014 1 Πίνακας περιεχομένων Εισαγωγή... 3 1. Είσοδος στο σύστημα... 3 2. Αρχική Οθόνη Επιχείρησης... 4 2 Τα έγγραφά

Διαβάστε περισσότερα

Οδηγίες Οργάνωσης Μαθήματος στην Ιδρυματική πλατφόρμα του open e class. Σύνταξη: MY-AOC

Οδηγίες Οργάνωσης Μαθήματος στην Ιδρυματική πλατφόρμα του open e class. Σύνταξη: MY-AOC Οδηγίες Οργάνωσης Μαθήματος στην Ιδρυματική πλατφόρμα του open e class Σύνταξη: MY-AOC Άδεια Χρήσης Το παρόν υλικό υπόκειται σε άδειες χρήσης Creative Commons. Οργάνωση Μαθήματος 3 Η πλήρης οργάνωση ενός

Διαβάστε περισσότερα

Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ

Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ Σύστημα Κεντρικής Υποστήριξης της Πρακτικής Άσκησης Φοιτητών ΑΕΙ Οδηγός Χρήσης Εφαρμογής Γραφείων Πρακτικής Άσκησης Αφού πιστοποιηθεί ο λογαριασμός που δημιουργήσατε στο πρόγραμμα «Άτλας» ως Γραφείο Πρακτικής,

Διαβάστε περισσότερα

Εγχειρίδιο Χρήσης Φορέα Πιστοποίησης

Εγχειρίδιο Χρήσης Φορέα Πιστοποίησης Εγχειρίδιο Χρήσης Φορέα Πιστοποίησης ΕΙΣΟΔΟΣ ΣΤΗΝ ΕΦΑΡΜΟΓΗ Για την είσοδο στην εφαρμογή απαιτείται, 1. Πλοηγός ιστοσελίδων (Internet Explorer, Mozilla Firefox, Google Chrome, Netscape Navigator), 2. Όνομα

Διαβάστε περισσότερα

Ολοκληρωμένες Δράσεις προβολής δημοσιότητας για το Δήμο Αρχανών Αστερουσίων Εγχειρίδιο Χρήσης - Παρουσίαση

Ολοκληρωμένες Δράσεις προβολής δημοσιότητας για το Δήμο Αρχανών Αστερουσίων Εγχειρίδιο Χρήσης - Παρουσίαση Novel Tech «Μέλος του Επιστημονικού & Τεχνολογικού Πάρκου Κρήτης» http://www.noveltech.gr info@noveltech.gr Ολοκληρωμένες Δράσεις προβολής δημοσιότητας για το Δήμο Αρχανών Αστερουσίων Εγχειρίδιο Χρήσης

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΨΗΦΙΟΥ ΓΕΛ & ΕΠΑΛ Β Έκδοση 1.0, Ιούνιος 2012 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ

Διαβάστε περισσότερα

Οδηγίες Συμπλήρωσης της Έκθεσης Ολοκλήρωσης

Οδηγίες Συμπλήρωσης της Έκθεσης Ολοκλήρωσης -0 Οδηγίες Συμπλήρωσης της Έκθεσης Ολοκλήρωσης H διαδικασία συνοπτικά Κάθε επιχείρηση της οποίας η πρόταση βρίσκεται σε κατάσταση «Σε υλοποίηση», έχει το δικαίωμα να υποβάλει ηλεκτρονικά Έκθεση ολοκλήρωσης.

Διαβάστε περισσότερα

Εγχειρίδιο Χρήσης-Οδηγός Εκπαίδευσης Χρηστών. - Δήμος Δέλτα - Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης

Εγχειρίδιο Χρήσης-Οδηγός Εκπαίδευσης Χρηστών. - Δήμος Δέλτα - Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Ανάπτυξη διαδικτυακής εφαρμογής υποστήριξης των δράσεων περιβαλλοντικής διαχείρισης της παράκτιας ζώνης του Θερμαϊκού Κόλπου και διαδραστικής εφαρμογής αναφοράς περιβαλλοντικών προβλημάτων Εγχειρίδιο Χρήσης-Οδηγός

Διαβάστε περισσότερα

Οδηγός Εγγραφής και Χρήσης Εφαρμογής. Διαχειριστής Ιδρύματος

Οδηγός Εγγραφής και Χρήσης Εφαρμογής. Διαχειριστής Ιδρύματος Οδηγός Εγγραφής και Χρήσης Εφαρμογής Διαχειριστής Ιδρύματος 1 Δημιουργία λογαριασμού και Είσοδος στο σύστημα Για να εγγραφείτε στο Πληροφοριακό Σύστημα «Απέλλα» ως Διαχειριστής Ιδρύματος θα πρέπει να δημιουργήσετε

Διαβάστε περισσότερα

Οδηγός Εγκατάστασης και Εγχειρίδιο Χρήσης του λογισμικού. «Ταξίδι στο Χρόνο με Νόημα» Ιστορία Γ, Δ, Ε & ΣΤ Δημοτικού

Οδηγός Εγκατάστασης και Εγχειρίδιο Χρήσης του λογισμικού. «Ταξίδι στο Χρόνο με Νόημα» Ιστορία Γ, Δ, Ε & ΣΤ Δημοτικού Οδηγός Εγκατάστασης και Εγχειρίδιο Χρήσης του λογισμικού «Ταξίδι στο Χρόνο με Νόημα» Ιστορία Γ, Δ, Ε & ΣΤ Δημοτικού 2 ΤΑΞΙΔΙ ΣΤΟ ΧΡΟΝΟ ΜΕ ΝΟΗΜΑ Οδηγός Εγκατάστασης και Χρήσης του λογισμικού Συντελεστές:

Διαβάστε περισσότερα

Εγχειρίδιο εγκατάστασης και χρήσης περιοδικών etwinning

Εγχειρίδιο εγκατάστασης και χρήσης περιοδικών etwinning Εγχειρίδιο εγκατάστασης και χρήσης περιοδικών etwinning Εισαγωγή Η εφαρμογή των περιοδικών etwinning δίνει τη δυνατότητα σε εκπαιδευτικούς που έχουν λογαριασμό στο Πανελλήνιο Σχολικό Δίκτυο και που έχουν

Διαβάστε περισσότερα

GET SDI PORTAL v1. Οδηγός Βοήθειας

GET SDI PORTAL v1. Οδηγός Βοήθειας GET SDI PORTAL v1 Οδηγός Βοήθειας Μεταδεδομένα εγγράφου Στοιχείο/Element Τιμή/value Ημερομηνία/Date 2011-06-16 Τίτλος/Title GETSDIPortal_v1_Help_v1.0 Θέμα/Subject Οδηγός Βοήθειας Έκδοση/Version 1.0 Σελίδα

Διαβάστε περισσότερα

Simplifying Complexity. Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας

Simplifying Complexity. Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας Simplifying Complexity Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας Περιεχόμενα 1 Εισαγωγή... 2 2 Οδηγίες Χρήσης... 2 2.1 Πρώτη Εγγραφή στην Πλατφόρμα... 2 2.2 Είσοδος στην Πλατφόρμα...4 2.3 Δημιουργία Καρτέλας

Διαβάστε περισσότερα

Simplifying Complexity. Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας

Simplifying Complexity. Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας Simplifying Complexity Οδηγός Χρήσης Διαδικτυακής Πλατφόρμας Περιεχόμενα 1 Εισαγωγή... 2 2 Οδηγίες Χρήσης... 2 2.1 Πρώτη Εγγραφή στην Πλατφόρμα... 2 2.2 Είσοδος στην Πλατφόρμα... 4 2.3 Δημιουργία Καρτέλας

Διαβάστε περισσότερα

1. Τα τμήματα της επιφάνειας εργασίας των Windows

1. Τα τμήματα της επιφάνειας εργασίας των Windows 1. Τα τμήματα της επιφάνειας εργασίας των Windows Εικονίδια συντομεύσεων (αρχείου-φακέλου) Εικονίδια Ανενεργά Ενεργό Επιφάνεια (αρχείου-φακέλου) παράθυρα παράθυρο εργασίας Γραμμή μενού Γραμμή εργαλείων

Διαβάστε περισσότερα

ΥΠΟΒΟΛΗ ΑΝΑΛΩΣΙΜΩΝ ΥΛΙΚΩΝ

ΥΠΟΒΟΛΗ ΑΝΑΛΩΣΙΜΩΝ ΥΛΙΚΩΝ ΥΠΟΒΟΛΗ ΑΝΑΛΩΣΙΜΩΝ ΥΛΙΚΩΝ Εισαγωγή γνωματεύσεων διαβητικών υλικών στο internet (eδαπυ) 1. Εισάγουμε τον κωδικό χρήστη και το συνθηματικό για να εισέλθουμε στην εφαρμογή https://apps.ika.gr/econsummedsuppl/faces/login.xhtml.

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΤΗΣ ΕΛΛΑΔΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ

ΤΡΑΠΕΖΑ ΤΗΣ ΕΛΛΑΔΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΔΙΕΥΘΥΝΣΗ ΕΠΟΠΤΕΙΑΣ ΠΙΣΤΩΤΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΟΔΗΓΙΕΣ ΣΥΜΠΛΗΡΩΣΗΣ ΥΠΟΔΕΙΓΜΑΤΟΣ ΓΙΑ ΤΗΝ ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΟΒΟΛΗ ΣΤΟΙΧΕΙΩΝ ΡΕΥΣΤΟΤΗΤΑΣ (BSD07) (ΠΔ.Τ.Ε. 2563/19.7.2005 Ε50) Ιανουάριος 2005 ΓΕΝΙΚΑ... 4 1. Προϋποθέσεις

Διαβάστε περισσότερα

Εισαγωγή 6. Δημιουργία λογαριασμού 13. Εγκατάσταση και λειτουργία του Skype 28. Βασικές λειτουργίες 32. Επιλογές συνομιλίας 48

Εισαγωγή 6. Δημιουργία λογαριασμού 13. Εγκατάσταση και λειτουργία του Skype 28. Βασικές λειτουργίες 32. Επιλογές συνομιλίας 48 ΠΕΡΙΕΧΟΜΕΝΑ Εισαγωγή 6 Δημιουργία λογαριασμού 13 Εγκατάσταση και λειτουργία του Skype 28 Βασικές λειτουργίες 32 Επιλογές συνομιλίας 48 Γενικές ρυθμίσεις Skype 64 Το Skype σε φορητές συσκευές 78 Εγγραφή

Διαβάστε περισσότερα

4.1 Άνοιγμα υπάρχοντος βιβλίου εργασίας

4.1 Άνοιγμα υπάρχοντος βιβλίου εργασίας 4.1 Άνοιγμα υπάρχοντος βιβλίου εργασίας 4.1.1 Άνοιγμα υπάρχοντος βιβλίου εργασίας από βάση δεδομένων Όταν εκκινήσουμε τον Discoverer εμφανίζεται στην οθόνη μας το παράθυρο διαλόγου του βοηθητικού προγράμματος

Διαβάστε περισσότερα

«Ταξίδι στον Κόσμο με Νόημα» Ε ΣΤ

«Ταξίδι στον Κόσμο με Νόημα» Ε ΣΤ «Ταξίδι στον Κόσμο με Νόημα» Ε ΣΤ 1 «Ταξίδι στον Κόσμο με Νόημα» Ε ΣΤ Ταξίδι στον Κόσμο με Νόημα Οδηγός Εγκατάστασης και Χρήσης του λογισμικού Συντελεστές: Συγγραφή διδακτικού υλικού Νίκη Κακιά-Βόλου,

Διαβάστε περισσότερα

Συνεργείο Αυτοκινήτων

Συνεργείο Αυτοκινήτων Συνεργείο Αυτοκινήτων v2.102, Οκτώβριος 2015 Σύντοµες οδηγίες χρήσης Εισαγωγή Το πρόγραµµα Συνεργείο Αυτοκινήτων έχει σκοπό τη διαχείριση και παρακολούθηση του πελατολογίου, των αυτοκινήτων και των εργασιών

Διαβάστε περισσότερα

YourSMS User s Manual

YourSMS User s Manual YourSMS User s Manual Contents Πίνακας περιεχομένων Κεντρική οθόνη... 2 Αποστολές... 3 Αποστολή μοναδικού μηνύματος... 3 Αποστολή μαζικού μηνύματος σε ομάδα παραληπτών... 4 Αποστολή μαζικού προγραμματισμένου

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΚΑΡΤΑΣ ΦΟΙΤΗΤΗ. Εγχειρίδιο Εφαρμογής Γραμματειών

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΚΑΡΤΑΣ ΦΟΙΤΗΤΗ. Εγχειρίδιο Εφαρμογής Γραμματειών ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΚΑΡΤΑΣ ΦΟΙΤΗΤΗ Εγχειρίδιο Εφαρμογής Γραμματειών Από το ακαδημαϊκό έτος 2011-12 οι φοιτητές των Πανεπιστημίων και Τ.Ε.Ι. της χώρας θα παραλαμβάνουν το Δελτίο Ειδικού Εισιτηρίου

Διαβάστε περισσότερα

Εγχειρίδιο λειτουργιών χρήστη (αποφοίτου) στο Mathiteia4u

Εγχειρίδιο λειτουργιών χρήστη (αποφοίτου) στο Mathiteia4u Εγχειρίδιο λειτουργιών χρήστη (αποφοίτου) στο Mathiteia4u Μέσω της ηλεκτρονικής πύλης www.mathiteia4u.gov.gr δίνεται πρόσβαση σε ένα νέο πρόγραμμα για την στήριξη νέων που έχουν μόλις αποφοιτήσει από την

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ

ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ Εγχειρίδιο Εφαρµογής Γραµµατειών Περιεχόμενα Πίνακας Εικόνων...3 1. Είσοδος στο σύστημα...5 2. Στοιχεία Γραμματείας...9 3. Μεταπτυχιακά Προγράμματα...

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΣΥΝΤΟΝΙΣΤΩΝ (ΣΥΝ) και ΔΙΑΧΕΙΡΙΣΤΩΝ (PORTAL OFFICERS) ΗΛΕΚΤΡΟΝΙΚΟΙ ΧΩΡΟΙ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΔΙΑΔΙΚΑΣΙΑΣ Έκδοση 1.0 ΣΕΠΤΕΜΒΡΙΟΣ 2013 Εγχειρίδιο χρήσης Συντονιστών και Διαχειριστών (Portal officers)

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΤΩΝ ΛΕΙΤΟΥΡΓΙΩΝ ΤΟΥ ΔΙΑΧΕΙΡΙΣΤΗ ΤΟΥ ΠΙΣΤΟΠΟΙΗΜΕΝΟΥ ΦΟΡΕΑ

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΤΩΝ ΛΕΙΤΟΥΡΓΙΩΝ ΤΟΥ ΔΙΑΧΕΙΡΙΣΤΗ ΤΟΥ ΠΙΣΤΟΠΟΙΗΜΕΝΟΥ ΦΟΡΕΑ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΤΩΝ ΛΕΙΤΟΥΡΓΙΩΝ ΤΟΥ ΔΙΑΧΕΙΡΙΣΤΗ ΤΟΥ ΠΙΣΤΟΠΟΙΗΜΕΝΟΥ ΦΟΡΕΑ ΕΥΡΕΤΗΡΙΟ ΠΕΡΙΕΧΟΜΕΝΩΝ ΛΕΙΤΟΥΡΓΙΕΣ ΔΙΑΧΕΙΡΙΣΤΗ / ΑΝΤΙΚΑΤΑΣΤΑΤΗ ΔΙΑΧΕΙΡΙΣΤΗ ΠΙΣΤΟΠΟΙΗΜΕΝΟΥ ΦΟΡΕΑ.... 3 ΔΗΜΙΟΥΡΓΙΑ ΧΡΗΣΤΗ... 3 ΣΤΟΙΧΕΙΑ

Διαβάστε περισσότερα

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΠΡΟΓΡΑΜΜΑΤΟΣ Dcad 1.0

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΠΡΟΓΡΑΜΜΑΤΟΣ Dcad 1.0 ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΠΡΟΓΡΑΜΜΑΤΟΣ Dcad 1.0 20130510 ΠΕΡΙΕΧΟΜΕΝΑ 1. Εγκατάσταση προγράμματος DCAD 2 2. Ενεργοποίηση Registration 2 3. DCAD 3 3.1 Εισαγωγή σημείων 3 3.2 Εξαγωγή σημείων 5 3.3 Στοιχεία ιδιοκτησίας

Διαβάστε περισσότερα

Εγχειρίδιο Εγκατάστασης και Χρήσης Εκπαιδευτικής Εφαρμογής

Εγχειρίδιο Εγκατάστασης και Χρήσης Εκπαιδευτικής Εφαρμογής Εγχειρίδιο Εγκατάστασης και Χρήσης Εκπαιδευτικής Εφαρμογής Εγχειρίδιο Εγκατάστασης και Χρήσης Πίνακας Περιεχομένων. Πριν την εγκατάσταση... 3. Ελάχιστες απαιτήσεις σε εξοπλισμό... 3 2. Εγκατάσταση... 4

Διαβάστε περισσότερα

Εθνικό Κέντρο Τεκμηρίωσης ΕΙΕ. Copyright 2014 Εθνικό Κέντρο Τεκμηρίωσης Ι EIE

Εθνικό Κέντρο Τεκμηρίωσης ΕΙΕ. Copyright 2014 Εθνικό Κέντρο Τεκμηρίωσης Ι EIE Εθνικό Κέντρο Τεκμηρίωσης ΕΙΕ Copyright 2014 Εθνικό Κέντρο Τεκμηρίωσης Ι EIE δ. Βασιλέως Κωνσταντίνου 48, 11635 Αθήνα τ.: 210 7273900 f: 210 7246824 e: ekt@ekt.gr www.ekt.gr Το έργο αυτό διατίθεται με

Διαβάστε περισσότερα

Μελίσσια, 16 Ιουνίου 2010. Οδηγός Εξαγωγής Συγκεντρωτικών Καταστάσεων ΚΕΠΥΟ από InnovEra

Μελίσσια, 16 Ιουνίου 2010. Οδηγός Εξαγωγής Συγκεντρωτικών Καταστάσεων ΚΕΠΥΟ από InnovEra Μελίσσια, 16 Ιουνίου 2010 Οδηγός Εξαγωγής Συγκεντρωτικών Καταστάσεων ΚΕΠΥΟ από InnovEra Εισαγωγή Αρχείων-Objects για τη συγκεντρωτική ΚΕΠΥΟ (ΜΥΦ) Πριν προχωρήσετε στη διαδικασία της εξαγωγής των συγκεντρωτικών

Διαβάστε περισσότερα

Stellarium Εγχειρίδιο Οδηγιών

Stellarium Εγχειρίδιο Οδηγιών Προϋποθέσεις συστήματος: Windows (XP, Vista, 7) με DirectX 9.x και τελευταίες ServicePack ή MacOS X 10.3.x (ή υψηλότερη), κάρτα γραφικών 3D με υποστήριξη OpenGL, ελάχ. 512 MB RAM, 1 GB διαθέσιμος χώρος

Διαβάστε περισσότερα

Εγχειρίδιο Χρήστη. Ιούνιος 2009. Σελίδα - 1 -

Εγχειρίδιο Χρήστη. Ιούνιος 2009. Σελίδα - 1 - Εγχειρίδιο Χρήστη Ιούνιος 2009 Σελίδα - 1 - 1 Γενικά Η εφαρμογή Intelsoft Hotel (IS HOTEL) αφορά τη διαχείριση μίας μικρής ξενοδοχειακής μονάδας και επιτρέπει τη διαχείριση : των δωματίων και των πελατών

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΓΕΩΡΓΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ ONLINE ΔΗΛΩΣΗ ΕΦΑΡΜΟΓΗΣ ΔΡΑΣΗ 2.3 Β

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΓΕΩΡΓΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ ONLINE ΔΗΛΩΣΗ ΕΦΑΡΜΟΓΗΣ ΔΡΑΣΗ 2.3 Β ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΓΕΩΡΓΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ ONLINE ΔΗΛΩΣΗ ΕΦΑΡΜΟΓΗΣ ΔΡΑΣΗ 2.3 Β (Ολοκληρωμένη Διαχείριση Στην Παραγωγή Σακχαροτεύτλων) 1 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ ΕΙΣΟΔΟΣ ΣΤΟ ΣΥΣΤΗΜΑ...

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΨΗΦΙΟΥ ΓΕΛ & ΕΠΑΛ Β Έκδοση 1.0, Ιούνιος 2012 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ

Διαβάστε περισσότερα

Εγχειρίδιο εγγραφής και σύνδεσης χρήστη

Εγχειρίδιο εγγραφής και σύνδεσης χρήστη Εγχειρίδιο εγγραφής και σύνδεσης χρήστη Μέσω της ηλεκτρονικής πύλης www.step.gov.gr δίνεται η δυνατότητα στους χρήστες να εγγραφούν στην υπηρεσία προσωποποιημένης πληροφόρησης, μέσω της οποίας μπορούν

Διαβάστε περισσότερα

Οδηγίες για τη Χρήση του Εκπαιδευτικού Κοινωνικού δικτύου

Οδηγίες για τη Χρήση του Εκπαιδευτικού Κοινωνικού δικτύου Οδηγίες για τη Χρήση του Εκπαιδευτικού Κοινωνικού δικτύου Χαρπαντίδου Ζαχαρούλα Επιμορφώτρια Β επιπέδου ΠΕ 19-20 Υπεύθυνη ΚΕ.ΠΛΗ.ΝΕ.Τ. Δράμας 2014 Περιεχόμενα 1. Εισαγωγικά στοιχεία για το Edmodo.. 3 2.

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΨΗΦΙΟΥ ΕΠΑΛ Α Έκδοση 1.0, Ιούνιος 2014 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ

Διαβάστε περισσότερα

ΟΔΗΓΟΣ ΧΡΗΣΗΣ(ΜΑΝUΑL) ΔΙΑΧΕΙΡΙΣΤΗ-ΧΡΗΣΤΗ.

ΟΔΗΓΟΣ ΧΡΗΣΗΣ(ΜΑΝUΑL) ΔΙΑΧΕΙΡΙΣΤΗ-ΧΡΗΣΤΗ. ΟΔΗΓΟΣ ΧΡΗΣΗΣ(ΜΑΝUΑL) ΔΙΑΧΕΙΡΙΣΤΗ-ΧΡΗΣΤΗ. Οδηγός Διαχειριστή Το m-learning Toolkit είναι μια ολοκληρωμένη πλατφόρμα εξ αποστάσεως εκπαίδευσης που έχει σχεδιαστεί για να υπάρχει η δυνατότητα της πρόσβασης

Διαβάστε περισσότερα

Εφαρμογές Πληροφορικής Διαχείριση Αρχείων Η έννοια του αρχείου, βασικές έννοιες διαχείρισης αρχείων.

Εφαρμογές Πληροφορικής Διαχείριση Αρχείων Η έννοια του αρχείου, βασικές έννοιες διαχείρισης αρχείων. Εφαρμογές Πληροφορικής Διαχείριση Αρχείων Η έννοια του αρχείου, βασικές έννοιες διαχείρισης αρχείων. Ορισμός Ένα αρχείο είναι ένα σύνολο από σχετιζόμενες πληροφορίες οι οποίες έχουν αποθηκευτεί σε κάποιο

Διαβάστε περισσότερα

Οδηγός Χρήστη. Καλώς ήλθατε στο Ηλεκτρονικό Περιβάλλον Μάθησης. http://elearning.kekdiastasi.edu.gr/

Οδηγός Χρήστη. Καλώς ήλθατε στο Ηλεκτρονικό Περιβάλλον Μάθησης. http://elearning.kekdiastasi.edu.gr/ Οδηγός Χρήστη Καλώς ήλθατε στο Ηλεκτρονικό Περιβάλλον Μάθησης http://elearning.kekdiastasi.edu.gr/ Περιεχόµενα 1. ΕΙΣΟ ΟΣ ΣΤΗΝ ΠΛΑΤΦΟΡΜΑ 3 2. ΤΟ ΠΡΟΦΙΛ ΣΑΣ 6 3. ΤΟ ΠΕΡΙΒΑΛΛΟΝ ΤΟΥ ΜΑΘΗΜΑΤΟΣ 9 4. ΤΟ ΜΑΘΗΜΑ

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΣΧΟΛΙΚΗΣ ΜΟΝΑΔΑΣ Έκδοση 1.0, Ιούνιος 2015 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΟΛΙΤΙΣΜΟΥ, ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ ΠΙΝΑΚΑΣ

Διαβάστε περισσότερα

Οδηγίες για την Υποβολή Συμφωνητικού μέσω αρχείου

Οδηγίες για την Υποβολή Συμφωνητικού μέσω αρχείου Οδηγίες για την Υποβολή Συμφωνητικού μέσω αρχείου Περιεχόμενα ΡΥΘΜΙΣΕΙΣ ΑΣΦΑΛΕΙΑΣ ΚΑΤΑ ΤΗΝ ΕΓΚΑΤΑΣΤΑΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ TAXISNET OFFLINE ΣΕ JAVA ΑΝΩ ΤΗΣ 1.7.51... 2 Χρήση Εφαρμογής-Συνοπτικά Βήματα... 4 Χρήση

Διαβάστε περισσότερα

4 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΓΕΝΙΚΟΣ ΣΚΟΠΟΣ :

4 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΓΕΝΙΚΟΣ ΣΚΟΠΟΣ : 4 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΓΕΝΙΚΟΣ ΣΚΟΠΟΣ : Σκοπός του συγκεκριμένου φύλλου εργασίας είναι ο μαθητής να εξοικειωθεί με τις συναρτήσεις, τις αριθμητικές πράξεις καθώς και την επισήμανση κελιών υπό όρους με στόχο

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΟΡΓΑΝΩΣΗΣ ΓΡΑΦΕΙΟΥ. Helpdesk

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΟΡΓΑΝΩΣΗΣ ΓΡΑΦΕΙΟΥ. Helpdesk ΕΙΔΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΕΘΝΙΚΟΥ ΣΤΡΑΤΗΓΙΚΟΥ ΠΛΑΙΣΙΟΥ ΑΝΑΦΟΡΑΣ Υπηρεσία Ολοκληρωμένου Πληροφοριακού Συστήματος ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΟΡΓΑΝΩΣΗΣ ΓΡΑΦΕΙΟΥ Helpdesk Σύντομη περιγραφή λειτουργίας Έκδοση 1 Μάιος 2011

Διαβάστε περισσότερα

Περιεχόμενα. Περιβάλλον ηλεκτρονικού υπολογιστή...9 Επιφάνεια εργασίας...12 Διαχείριση αρχείων...15 Ιοί Η/Υ...21 Διαχείριση εκτυπώσεων...

Περιεχόμενα. Περιβάλλον ηλεκτρονικού υπολογιστή...9 Επιφάνεια εργασίας...12 Διαχείριση αρχείων...15 Ιοί Η/Υ...21 Διαχείριση εκτυπώσεων... Περιεχόμενα Περιβάλλον ηλεκτρονικού υπολογιστή...9 Επιφάνεια εργασίας...12 Διαχείριση αρχείων...15 Ιοί Η/Υ...21 Διαχείριση εκτυπώσεων...22 Περιβάλλον ηλεκτρονικού υπολογιστή...23 Επιφάνεια εργασίας...26

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ. Πρόγραμμα Διαχείρισης Α.Π.Δ.

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ. Πρόγραμμα Διαχείρισης Α.Π.Δ. ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ Πρόγραμμα Διαχείρισης Α.Π.Δ. Περιεχόμενα ΚΕΦΑΛΑΙΟ 1 Εγκατάσταση του προγράμματος 1 ΚΕΦΑΛΑΙΟ 2 Οδηγίες χρήσης προγράμματος με παράδειγμα 2 ΚΕΦΑΛΑΙΟ 3 Αντιγραφή Α.Π.Δ. προηγούμενης περιόδου

Διαβάστε περισσότερα

ΑΡΧΕΙΟ ΕΚΘΕΣΕΩΝ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗΣ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ 8 ΝΟΕΜΒΡΙΟΥ 2014

ΑΡΧΕΙΟ ΕΚΘΕΣΕΩΝ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗΣ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ 8 ΝΟΕΜΒΡΙΟΥ 2014 8 ΝΟΕΜΒΡΙΟΥ 2014 ΑΡΧΕΙΟ ΕΚΘΕΣΕΩΝ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗΣ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΝΙΚΟΛΑΟΣ ΜΙΧΑΛΟΔΗΜΗΤΡΑΚΗΣ ΝΙΚΟΛΑΟΣ ΜΙΧΑΛΟΔΗΜΗΤΡΑΚΗΣ - ΠΡΟΓΡΑΜΜΑΤΙΣΤΗΣ ΥΠΗΡΕΣΙΕΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Σολωμού 41, 71306, Ηράκλειο Κρήτης τηλ/φαξ:

Διαβάστε περισσότερα

Οδηγίες Εγκατάστασης

Οδηγίες Εγκατάστασης Οδηγίες Εγκατάστασης Εισάγετε το DVD στη μονάδα ανάγνωσης DVD του υπολογιστή σας. Περιμένετε λίγα δευτερόλεπτα να εμφανιστεί το παράθυρο εγκατάστασης. Σε περίπτωση που αυτό δεν γίνει αυτόματα, από την

Διαβάστε περισσότερα

ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual)

ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual) ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual) «WeKnow» ΔΗΜΗΤΡΙΟΣ ΨΥΧΙΑΣ & ΣΙΑ Ε.Ε. Υποστήριξη Πληροφοριακών Συστημάτων και Επικοινωνιών Σελίδα 1 από 19

Διαβάστε περισσότερα

Οδηγός Χρήσης Υποβολής ήλωσης µέσω ιαδικτύου

Οδηγός Χρήσης Υποβολής ήλωσης µέσω ιαδικτύου Οδηγός Χρήσης Υποβολής ήλωσης µέσω ιαδικτύου Ιούνιος 2008 (1/29) ΠΕΡΙΕΧΟΜΕΝΑ Εισαγωγή...3 Εγγραφή Νέου Χρήστη...5 Σύνδεση Χρήστη...7 Στοιχεία ικαιούχου...8 Υποβολή ήλωσης...13 Προσθήκη Ακινήτου... 14 Προσθήκη

Διαβάστε περισσότερα

ΟΔΗΓΟΣ ΓΡΗΓΟΡΗΣ ΕΝΑΡΞΗΣ

ΟΔΗΓΟΣ ΓΡΗΓΟΡΗΣ ΕΝΑΡΞΗΣ ΟΔΗΓΟΣ ΓΡΗΓΟΡΗΣ ΕΝΑΡΞΗΣ ΟΔΗΓΟΣ ΓΡΗΓΟΡΗΣ ΕΝΑΡΞΗΣ Σημειώσεις και ειδοποιήσεις ΣΗΜΕΙΩΣΗ: Η ΣΗΜΕΙΩΣΗ υποδεικνύει σημαντικές πληροφορίες που σας βοηθούν να χρησιμοποιείτε καλύτερα τον υπολογιστή σας. ΠΡΟΣΟΧΗ:

Διαβάστε περισσότερα

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΤΟΥ ΠΛΗΡΟΦΟΡΙΑΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΥΠΟΒΟΛΗΣ ΘΕΜΑΤΩΝ ΠΡΟΣ ΑΞΙΟΛΟΓΗΣΗ

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΤΟΥ ΠΛΗΡΟΦΟΡΙΑΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΥΠΟΒΟΛΗΣ ΘΕΜΑΤΩΝ ΠΡΟΣ ΑΞΙΟΛΟΓΗΣΗ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΔΙΑΒΑΘΜΙΣΜΕΝΗΣ ΔΥΣΚΟΛΙΑΣ ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΤΟΥ ΠΛΗΡΟΦΟΡΙΑΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΥΠΟΒΟΛΗΣ ΘΕΜΑΤΩΝ ΠΡΟΣ ΑΞΙΟΛΟΓΗΣΗ 1 η ΕΚΔΟΣΗ - ΑΘΗΝΑ 2014 Ι.Ε.Π. - ΓΡΑΦΕΙΟ ΤΕΧΝΙΚΗΣ ΥΠΟΣΤΗΡΙΞΗΣ ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ

Διαβάστε περισσότερα

Συνοπτικό εγχειρίδιο χρήσης του Microsoft Visual Studio 2010

Συνοπτικό εγχειρίδιο χρήσης του Microsoft Visual Studio 2010 Τμήμα Πληροφορικής & Επικοινωνιών Τομέας Υπολογιστικών Τεχνικών & Συστημάτων Συνοπτικό εγχειρίδιο χρήσης του Microsoft Visual Studio 2010 Ιωάννης Γεωργουδάκης - Πάρις Μαστοροκώστας Σεπτέμβριος 2011 ΠΕΡΙΕΧΟΜΕΝΑ

Διαβάστε περισσότερα

ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ

ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ ΠΛΗΡΟΦΟΡΙΑΚΟ ΣΥΣΤΗΜΑ ΠΙΣΤΟΠΟΙΗΣΕΩΝ ΚΑΙ ΕΛΕΓΧΩΝ ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ ΤΟΥ ΣΥΣΤΗΜΑΤΟΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΚΑΙ ΠΑΡΑΚΟΛΟΥΘΗΣΗ ΤΗΣ ΔΙΑΔΙΚΑΣΙΑΣ ΔΙΕΚΠΕΡΑΙΩΣΗΣ ΑΙΤΗΣΕΩΝ ΤΕΧΝΙΚΩΝ ΕΚΔΟΣΗ 3.0 Δεκέμβιος 2014 1 Περιεχόμενα 1

Διαβάστε περισσότερα

Η. ΠΙΘΑΝΑ ΕΡΩΤΗΜΑΤΑ... 227

Η. ΠΙΘΑΝΑ ΕΡΩΤΗΜΑΤΑ... 227 ΠΕΡΙΕΧΟΜΕΝΑ Η. ΠΙΘΑΝΑ ΕΡΩΤΗΜΑΤΑ... 227 1. ΓΕΝΙΚΑ... 227 2. ΓΕΝΙΚΗ ΛΟΓΙΣΤΙΚΗ... 228 3. ΠΕΛΑΤΕΣ ΠΡΟΜΗΘΕΥΤΕΣ... 230 4. ΑΞΙΟΓΡΑΦΑ... 232 4. ΑΣΦΑΛΕΙΑ... 232 copyright DATA COMMUNICATION ΠΙΘΑΝΑ ΕΡΩΤΗΜΑΤΑ Η.

Διαβάστε περισσότερα

Χρήσιμες Οδηγίες για την Πλοήγηση στο Υποστηρικτικό Υλικό. Περιεχόμενα

Χρήσιμες Οδηγίες για την Πλοήγηση στο Υποστηρικτικό Υλικό. Περιεχόμενα Χρήσιμες Οδηγίες για την Πλοήγηση στο Υποστηρικτικό Υλικό Περιεχόμενα Βασικές απαιτήσεις... 2 Εγκατάσταση και Εκκίνηση... 2 Παράθυρο Πλοήγησης... 8 Πλήκτρα Ενεργειών του Πίνακα Πλοήγησης... 13 Πλήκτρα

Διαβάστε περισσότερα

«Ανάδειξη και Ενεργοποίηση του Ρόλου των Κέντρων Υγείας στις Τοπικές Κοινωνίες»

«Ανάδειξη και Ενεργοποίηση του Ρόλου των Κέντρων Υγείας στις Τοπικές Κοινωνίες» ΤΙΤΛΟΣ ΠΡΑΞΗΣ «Ανάδειξη και Ενεργοποίηση του Ρόλου των Κέντρων Υγείας στις Τοπικές Κοινωνίες» (MIS: 439851) Σύστημα ηλεκτρονικών ραντεβού για εμβολιασμό στα Κέντρα Υγείας. Εγχειρίδιο χρήστη Έκδοση 1.2

Διαβάστε περισσότερα

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ

ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΗΛΕΚΤΡΟΝΙΚΟ ΣΥΣΤΗΜΑ ΥΠΟΒΟΛΗΣ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΔΕΛΤΙΟΥ ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΨΗΦΙΟΥ ΕΠΑΛ A Έκδοση 1.0, Ιούνιος 2015 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΟΛΙΤΙΣΜΟΥ, ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΛΙΣΤΑ ΣΧΗΜΑΤΩΝ ΠΙΝΑΚΑΣ

Διαβάστε περισσότερα

Interactive Power Point

Interactive Power Point Interactive Power Point Οι περισσότεροι χρήστες γνωρίζουν τη χρήση του Microsoft Power Point για τη δημιουργία παρουσιάσεων. Αυτό όμως που λίγοι γνωρίζουν, είναι ότι το πρόγραμμα αυτό, έχει δυνατότητες

Διαβάστε περισσότερα

Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo;

Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo; Κεφάλαιο 2 Εισαγωγή Πώς μπορούμε να δημιουργούμε γεωμετρικά σχέδια με τη Logo; Η Logo είναι μία από τις πολλές γλώσσες προγραμματισμού. Κάθε γλώσσα προγραμματισμού έχει σκοπό τη δημιουργία προγραμμάτων

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΕΦΑΡΜΟΓΗΣ EASYPROTOCOL Έκδοση 1.0

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΕΦΑΡΜΟΓΗΣ EASYPROTOCOL Έκδοση 1.0 ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΕΦΑΡΜΟΓΗΣ Έκδοση 1.0 banet Α.Ε. Βαλαωρίτου 20 54625 Θεσσαλονίκη Τ.2310253999 F.2310253998 www.banet.gr info@banet.gr Είσοδος στην εφαρμογή Για την είσοδο (login) στην εφαρμογή χρησιμοποιούμε

Διαβάστε περισσότερα

«ΕΘΝΙΚΟ ΣΥΣΤΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΔΗΜΟΣΙΩΝ ΣΥΜΒΑΣΕΩΝ» (ΕΣΗΔΗΣ) ΣΧΕΔΙΑΣΜΟΣ ΔΙΑΓΩΝΙΣΜΩΝ

«ΕΘΝΙΚΟ ΣΥΣΤΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΔΗΜΟΣΙΩΝ ΣΥΜΒΑΣΕΩΝ» (ΕΣΗΔΗΣ) ΣΧΕΔΙΑΣΜΟΣ ΔΙΑΓΩΝΙΣΜΩΝ «ΕΘΝΙΚΟ ΣΥΣΤΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΔΗΜΟΣΙΩΝ ΣΥΜΒΑΣΕΩΝ» (ΕΣΗΔΗΣ) ΣΧΕΔΙΑΣΜΟΣ ΔΙΑΓΩΝΙΣΜΩΝ Έκδοση: 01.00 20/09/2013 Πίνακας Περιεχομένων Πίνακας Περιεχομένων...2 1. ΕΙΣΑΓΩΓΗ ΣΧΕΔΙΑΣΜΟΣ ΔΙΑΓΩΝΙΣΜΩΝ...3 1.1 Έναρξη

Διαβάστε περισσότερα