Πλατφόρμα «Αίσωπος» Εγχειρίδιο Χρήσης Πλατφόρμας. Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων. Έκδοση 2.1 Αθήνα, Ιούλιος 2015

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πλατφόρμα «Αίσωπος» Εγχειρίδιο Χρήσης Πλατφόρμας. Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων. Έκδοση 2.1 Αθήνα, Ιούλιος 2015"


1 Σελίδα 1 από 152 Πλατφόρμα «Αίσωπος» Πλατφόρμα Ανάπτυξης / Σχεδίασης Ψηφιακών Διδακτικών Σεναρίων Εγχειρίδιο Χρήσης Πλατφόρμας Έκδοση 2.1 Αθήνα, Ιούλιος 2015



4 Σελίδα 4 από 152 ΜΕΡΟΣ Α

5 Σελίδα 5 από ΟΔΗΓΟΣ ΔΗΜΙΟΥΡΓΙΑΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ Προκειμένου να δημιουργήσουμε ένα νέο Ψηφιακό Σενάριο μεταβαίνουμε στην URL διεύθυνση και συνδεόμαστε χρησιμοποιώντας το Όνομα χρήστη και τον Κωδικό που αποκτήσαμε κατά τη διαδικασία εγγραφής μας (Εικόνα 1). Εικόνα 1 Το Ψηφιακό Σενάριο αποτελείται από τέσσερα βασικά μέρη: τον Τίτλο, το Εκπαιδευτικό Πρόβλημα, τους Διδακτικούς Στόχους και τις Φάσεις Σεναρίου. Η βασική δομή του Σεναρίου δημιουργείται με τη βοήθεια ενός οδηγού-wizard σε τέσσερα βήματα (εικόνες 2 έως 7). Παρακάτω παρουσιάζεται η δημιουργία ενός Σεναρίου με τη βοήθεια του οδηγού.

6 Σελίδα 6 από 152 ΒΗΜΑ 1 (Τίτλος) Στο πεδίο κειμένου Τίτλος Σεναρίου (Εικόνα 2) εισάγουμε τον τίτλο του Ψηφιακού Σεναρίου, για παράδειγμα «Ο Κούρος του Παλαικάστρου». Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 2

7 Σελίδα 7 από 152 ΒΗΜΑ 2 (Εκπαιδευτικό Πρόβλημα) Στο πεδίο κειμένου Εκπαιδευτικό Πρόβλημα (Εικόνα 3) περιγράφουμε το εκπαιδευτικό πρόβλημα που επιλύει το σενάριο μας, για παράδειγμα «Να γνωρίσουν οι μαθητές του Γυμνασίου Παλαικάστρου (Επαρχία Σητείας) το σπουδαιότερο εύρημα στη μινωική πόλη του Παλαικάστρου». Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 3

8 Σελίδα 8 από 152 ΒΗΜΑ 3 (Διδακτικοί Στόχοι) Στο πεδίο κειμένου Διδακτικοί Στόχοι (Εικόνα 4) εισάγουμε τους διδακτικούς στόχους που θα ικανοποιούνται από το σενάριο μας, για παράδειγμα «Να περιγράφουν συνοπτικά την ιστορία του Κούρου του Παλαικάστρου». Η εισαγωγή διδακτικού στόχου είναι προαιρετική, ενώ ο μέγιστος αριθμός διδακτικών στόχων είναι το πέντε (5). Εικόνα 4

9 Σελίδα 9 από 152 Πατώντας το κουμπί μπορούμε να προσθέσουμε νέο Διδακτικό Στόχο, ενώ πατώντας το κουμπί μπορούμε να αφαιρέσουμε κάποιο Διδακτικό Στόχο (Εικόνα 5). Υποχρεωτική είναι η προσθήκη τουλάχιστον ενός Διδακτικού Στόχου. Στη συνέχεια πατάμε το κουμπί Επόμενο για τη συνέχιση του οδηγού. Εικόνα 5

10 Σελίδα 10 από 152 ΒΗΜΑ 4 (Φάσεις Σεναρίου) Στο πεδίο κειμένου Φάσεις Σεναρίου (Εικόνα 6) εισάγουμε μία ή περισσότερες φάσεις για το σενάριό μας, για παράδειγμα «Βιβλιογραφική μελέτη του θέματος και συλλογή πληροφοριών». Εικόνα 6

11 Σελίδα 11 από 152 Πατώντας το κουμπί μπορούμε να προσθέσουμε νέα Φάση Σεναρίου, ενώ πατώντας το κουμπί μπορούμε να αφαιρέσουμε κάποια Φάση Σεναρίου (Εικόνα 7). Υποχρεωτική είναι η προσθήκη τουλάχιστον μίας Φάσης Σεναρίου. Στη συνέχεια πατάμε το κουμπί Ολοκλήρωση για την ολοκλήρωση του οδηγού. Εικόνα 7

12 2. ΠΕΡΙΒΑΛΛΟΝ ΕΠΕΞΕΡΓΑΣΙΑΣ ΚΑΙ ΟΡΙΣΤΙΚΗΣ ΥΠΟΒΟΛΗΣ ΨΗΦΙΑΚΟΥ ΣΕΝΑΡΙΟΥ Σελίδα 12 από 152 Μετά την ολοκλήρωση του οδηγού δημιουργίας νέου Ψηφιακού Σεναρίου μεταβαίνουμε αυτόματα στο ολοκληρωμένο περιβάλλον επεξεργασίας και οριστικής υποβολής του Ψηφιακού Σεναρίου (Εικόνα 8). Εικόνα 8 Το Περιβάλλον αποτελείται από μία λίστα επιλογών που βρίσκεται στο αριστερό μέρος της οθόνης (Εικόνα 9). Οι επιλογές είναι: Προεπισκόπηση σεναρίου Ταυτότητα σεναρίου Στοχοθεσία σεναρίου Φάσεις σεναρίου Κατάσταση σεναρίου Οριστική υποβολή σεναρίου Όταν ενεργοποιήσουμε μια από αυτές τις επιλογές, στο κύριο μέρος της οθόνης εμφανίζονται λεπτομέρειες για την επιλογή αυτή.

13 Σελίδα 13 από 152 Εικόνα 9

14 Σελίδα 14 από ΤΑΥΤΟΤΗΤΑ ΣΕΝΑΡΙΟΥ Στην ταυτότητα σεναρίου (Εικόνες 10 έως 22) διακρίνουμε τρεις επιλογές περιγραφής του σεναρίου, οι οποίες παρουσιάζονται υπό μορφή καρτελών: 1. Βασικές Πληροφορίες (Εικόνα 10). Από την καρτέλα αυτή μπορούμε να επεξεργαστούμε τον Τίτλο και το Εκπαιδευτικό Πρόβλημα του Σεναρίου, πεδία τα οποία προέκυψαν από το βήμα 1 και 2 του οδηγού δημιουργίας νέου σεναρίου. Εικόνα Επιπλέον Πληροφορίες. Από την καρτέλα αυτή μπορούμε: o να δώσουμε μια «Γενική περιγραφή περιεχομένου» του ψηφιακού σεναρίου (Εικόνα 11)

15 Σελίδα 15 από 152 Εικόνα 11 o να προσθέσουμε (Εικόνα 12) ή να αφαιρέσουμε (Εικόνα 13) την εικόνα που συνδέεται με το Σενάριό μας και εμφανίζεται στις προεπισκοπήσεις του (Εικόνα 14). Εικόνα 12 Εικόνα 13

16 Σελίδα 16 από 152 Εικόνα 14 o να ορίσουμε «Λέξεις κλειδιά που χαρακτηρίζουν τη θεματική του σεναρίου» (Εικόνα 15). Οι λέξεις αυτές θα χρησιμοποιηθούν ως κλειδιά για την αναζήτηση του Σεναρίου από τους εξωτερικούς χρήστες του συστήματος για τη δημιουργία Ψηφιακών Σεναρίων. o να ορίσουμε την «Υλικοτεχνική υποδομή» (Εικόνα 15) για την ολοκλήρωση του Σεναρίου, για παράδειγμα προβολικό μηχάνημα, Η/Υ, μέσα μεταφοράς κ.λπ.. o να ορίσουμε τον «Τυπικό χρόνο αλληλεπίδρασης με το εκπαιδευτικό σενάριο σε διδακτικές ώρες για δουλειά εντός του σχολείου» (Εικόνα 15). Ο μέγιστος χρόνος διάρκειας του Σεναρίου είναι οι τρεις (3) διδακτικές ώρες. o να δηλώσουμε, εφόσον υπάρχουν, «Πνευματικά δικαιώματα ή άλλους αντίστοιχους περιορισμούς» που θα διέπουν το Σενάριο (Εικόνα 15). o να ορίσουμε αν «Είναι το Σενάριο Διαθεματικό» (Εικόνα 15).

17 Σελίδα 17 από 152 Εικόνα 15 o να εντάξουμε το Σενάριό μας σε μία από τις προκαθορισμένες «Θεματικές Ταξινομίες» (Εικόνα 16). Εικόνα 16 Το πεδίο της θεματικής ταξινομίας είναι τύπου drop-down (επιλογή από αναπτυσσόμενο μενού), το οποίο μπορεί να έχει μέχρι και τρία επίπεδα. Ακολουθώντας τα παρακάτω βήματα: Επιλέγετε την επιθυμητή ταξινομία (έως τρία επίπεδα) [αριθμός 1 συνημμένης εικόνας] Επιλέγετε "Προσθήκη" κάνοντας κλικ στο κουμπί για να περαστεί η επιλεγμένη ταξινομία [αριθμός 2 συνημμένης εικόνας] Επιλέγετε "Αποθήκευση" κάνοντας κλικ στο κουμπί για να αποθηκευτεί το σύνολο των αλλαγών [αριθμός 3 συνημμένης εικόνας]

18 Σελίδα 18 από 152 Εικόνα 16α Οι ταξινομίες είναι ορισμένες από άλλο πρόγραμμα και δεν υπάρχει δυνατότητα αλλαγής. Σε περίπτωση που αδυνατείτε να εντοπίσετε επακριβώς την ταξινομία που αναζητάτε, πρέπει να επιλέξετε αυτήν που είναι νοητικά πιο κοντά στο επιθυμητό αντικείμενο. ΣΗΜΕΙΩΣΗ: Στην επιλογή: "Είναι το Σενάριο Διαθεματικό;", θα πρέπει να σημειώσετε «ΝΑΙ» μόνο αν το σενάριο ανήκει στο Γνωστικό Αντικείμενο: "Διαθεματική Ομάδα". Για παράδειγμα, αν υποθέσουμε ότι ένας εκπαιδευτικός που του έχει ανατεθεί το Γνωστικό Αντικείμενο: Καλλιτεχνική Παιδεία, επιθυμεί να δημιουργήσει Δειγματικό Σενάριο στην Γλυπτική τότε θα πρέπει: α) Στην επιλογή: Είναι το Σενάριο Διαθεματικό; - Να επιλέξει: "OXI" β) Στην Θεματική Ταξινομία - Να επιλέξει: Καλλιτεχνική Παιδεία -> Εικαστικά ->Γλυπτική ΚΑΙ ΟΧΙ Καλλιτεχνικά -> Γλυπτική o να ορίσουμε το «Εκτιμώμενο Επίπεδο Δυσκολίας» του Σεναρίου (Εικόνα 17) σε πεντάβαθμη κλίμακα (από πολύ εύκολο έως πολύ δύσκολο). Εικόνα 17

19 Σελίδα 19 από 152 Για να ολοκληρώσουμε την επεξεργασία της καρτέλας Επιπλέον Πληροφορίες πατάμε το κουμπί Αποθήκευση (Εικόνα 17). 3. Πρόσθετες Επιλογές (Εικόνα 18). Εικόνα 18 Από την καρτέλα αυτή μπορούμε: o να ορίσουμε τον «Τύπο διαδραστικότητας» (Εικόνα 19) μεταξύ των επιλογών Ενεργός μάθηση, Παθητική μάθηση και Συνδυασμός παθητικής και ενεργητικής μάθησης. Εικόνα 19 o να ορίσουμε το «Επίπεδο διαδραστικότητας» (Εικόνα 20) μεταξύ των επιλογών χαμηλό, μεσαίο, υψηλό, πολύ υψηλό.

20 Σελίδα 20 από 152 Εικόνα 20 o να ορίσουμε την «Προτεινόμενη ηλικιακή ομάδα του τελικού χρήστη» (Εικόνα 21) Εικόνα 21 o να ορίσουμε την «Εκπαιδευτική βαθμίδα που απευθύνεται το σενάριο» (Εικόνα 22) Εικόνα 22 Για να ολοκληρώσουμε την επεξεργασία της καρτέλας Πρόσθετες Επιλογές πατάμε το κουμπί Αποθήκευση (Εικόνα 18).

21 Σελίδα 21 από ΣΤΟΧΟΘΕΣΙΑ ΣΕΝΑΡΙΟΥ Στη Στοχοθεσία Σεναρίου εμφανίζονται οι Διδακτικοί Στόχοι που προέκυψαν από το βήμα 3 του οδηγού δημιουργίας νέου σεναρίου (Εικόνα 23). Υπενθυμίζουμε ότι οι Διδακτικοί Στόχοι είναι προαιρετικοί και μπορούμε να προσθέσουμε έως πέντε (5). Εικόνα 23 Μας δίνεται η δυνατότητα Επεξεργασίας κάθε Διδακτικού Στόχου (Εικόνα 24), διορθώνοντας το κείμενο του και πατώντας Αποθήκευση. Εικόνα 24 Μπορούμε να αλλάξουμε τη σειρά των διδακτικών στόχων με την τεχνική της μεταφοράς και απόθεσης (drag and drop) (Εικόνα 25) και ακολούθως πατώντας Αποθήκευση. Εικόνα 25

22 Τέλος, μπορούμε να διαγράψουμε οποιονδήποτε διδακτικό στόχο. Πριν την οριστική διαγραφή, εμφανίζεται προειδοποιητικό μήνυμα (Εικόνα 26). Σελίδα 22 από 152 Εικόνα 26 ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΣΤΟΧΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των στόχων με τον ακόλουθο τρόπο: 1. Επιλέγουμε ΣΤΟΧΟΘΕΣΙΑ ΣΕΝΑΡΙΟΥ (Εικόνα 9). 2. Στον πίνακα με τους έως 5 στόχους που εμφανίζονται, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε στόχο (Εικόνα 25). 3. Επιλέγουμε το στόχο που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση (Εικόνα 25). 4. Για να ολοκληρωθεί η νέα κατάταξη των στόχων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 23).

23 Σελίδα 23 από ΦΑΣΕΙΣ ΣΕΝΑΡΙΟΥ Στις Φάσεις Σεναρίου εμφανίζονται οι Φάσεις που προέκυψαν από το βήμα 4 του οδηγού δημιουργίας νέου σεναρίου (Εικόνα 27). Μας δίνεται η δυνατότητα προσθήκης Νέας Φάσης Υλοποίησης, Επεξεργασίας και Διαγραφής της. Εικόνα 27 Επιλέγοντας το κουμπί Επεξεργασία εμφανίζονται τρεις καρτέλες ρυθμίσεων (Εικόνες 28 έως 32): 1. Βασικές Πληροφορίες (Εικόνα 28). Από την καρτέλα αυτή μπορούμε: o να επεξεργαστούμε τον Τίτλο Φάσης Σεναρίου. o να ορίσουμε τον Χώρο Διεξαγωγής της Φάσης, για παράδειγμα σχολική αίθουσα, εργαστήριο Πληροφορικής, Μουσείο Σητείας κ.λπ.. o να ορίσουμε τη Χρονική Διάρκεια της Φάσης σε λεπτά. Υπενθυμίζουμε ότι μέγιστος επιτρεπτός χρόνος υλοποίησης ολόκληρου του Σεναρίου είναι οι τρεις (3) διδακτικές ώρες, δηλαδή τρία σαρανταπεντάλεπτα. o να δώσουμε μία αναλυτική Περιγραφή της Φάσης του Σεναρίου. o να φορτώσουμε ένα Φύλλo Εργασίας υπό μορφή επεξεργάσιμου εγγράφου (.doc και.docx) ή/και υπολογιστικού φύλλου (xls και xlsx). Για να το επιτύχουμε αυτό πατάμε το κουμπί Αναζήτηση Αρχείου και επιλέγουμε το αρχείο μέσα από το σύστημα αρχείων του Η/Υ μας (τοπικούς δίσκους, εξωτερικούς δίσκους, CD και DVD rom κ.λπ.). Επίσης, μας δίνεται η δυνατότητα να προσθέσουμε κι άλλα φύλλα εργασίας (κουμπί +Προσθήκη 1 ακόμη αρχείου), καθώς και να αφαιρέσουμε (κουμπί Αφαίρεση) κάποιο από τα φύλλα εργασίας που έχουμε ήδη ανεβάσει (Εικόνα 29).

24 Σελίδα 24 από 152 Εικόνα 28 Εικόνα 29 Να σημειωθεί ότι όσα πεδία σημειώνονται με κόκκινο αστερίσκο (*) είναι υποχρεωτικά και η μη συμπλήρωσή τους θα ενεργοποιήσει προειδοποιητικό μήνυμα. Για να διατηρηθούν οι αλλαγές που κάναμε στην καρτέλα Βασικές Πληροφορίες θα πρέπει να πατήσουμε το κουμπί Αποθήκευση.

25 2. Εισαγωγή Διαδραστικών Εργαλείων. Επιλέγοντας αυτήν την καρτέλα αναδύεται ένα παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία (π.χ. Ήχος, Εικόνα, Κείμενο, Διαδραστικό Βίντεο) τα οποία μπορούμε να χρησιμοποιήσουμε για τη δημιουργία του Ψηφιακού Σεναρίου μας (Εικόνα 30). Αναλυτική περιγραφή των εργαλείων αυτών δίνεται στο «Εγχειρίδιο Εισαγωγής Διαδραστικών Εργαλείων». Σελίδα 25 από 152 Εικόνα Επεξεργασία Διαδραστικών Εργαλείων. Επιλέγοντας αυτήν την καρτέλα εμφανίζεται λίστα με τα Διαδραστικά Εργαλεία που έχουμε εισάγει (Εικόνα 31). Εικόνα 31 Επιλέγοντας το κουμπί Επεξεργασία που βρίσκεται δίπλα σε κάθε Εργαλείο, μπορούμε να επεξεργαστούμε τα αντίστοιχα πεδία Τίτλος, Διευκρίνιση και Σχόλιο (Εικόνα 32).

26 Σελίδα 26 από 152 Εικόνα 32 Τέλος, υποστηρίζεται η Διαγραφή των Εργαλείων και η μετακίνηση τους με την τεχνική της μεταφοράς και απόθεσης (drag and drop). Η πλοήγηση στις Φάσεις Σεναρίου και στις ρυθμίσεις αυτών, μπορεί εναλλακτικά να γίνει μέσω του πλαισίου ελέγχου στο αριστερό μέρος της οθόνης (Εικόνα 33). Εικόνα 33

27 Σελίδα 27 από 152 ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΦΑΣΕΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των φάσεων με τον ακόλουθο τρόπο: 1. Επιλέγουμε ΦΑΣΕΙΣ ΣΕΝΑΡΙΟΥ (Εικόνα 9). 2. Στον πίνακα με τις έως 5 φάσεις που εμφανίζονται, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε φάση (Εικόνα 27). 3. Επιλέγουμε τη φάση που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση. 4. Για να ολοκληρωθεί η νέα κατάταξη των φάσεων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 27). ΑΛΛΑΓΗ ΣΕΙΡΑΣ ΕΜΦΑΝΙΣΗΣ ΔΟΜΙΚΩΝ/ΔΙΑΔΡΑΣΤΙΚΩΝ ΣΤΟΙΧΕΙΩΝ Όπως αναφέρθηκε παραπάνω, μπορούμε να αλλάξουμε τη σειρά εμφάνισης των δομικών/διαδραστικών εργαλείων με τον ακόλουθο τρόπο: 1. Επιλέγουμε μία συγκεκριμένη Φάση (Εικόνα 33). 2. Από το υπο-μενού επιλέγουμε ΕΠΕΞΕΡΓΑΣΙΑ ΔΙΑΔΡΑΣΤΙΚΩΝ ΕΡΓΑΛΕΙΩΝ (Εικόνα 33). 3. Στον πίνακα με τα διαδραστικά στοιχεία που έχουμε αναθέσει στη συγκεκριμένη φάση, αριστερά υπάρχει ένας σταυρός (σταυρόνημα) μπροστά από κάθε διαδραστικό στοιχείο (Εικόνα 31). 4. Επιλέγουμε το στοιχείο που επιθυμούμε να αλλάξουμε σειρά, κάνοντας κλικ με το ποντίκι στο αντίστοιχο σταυρόνημα, το σύρουμε πάνω ή κάτω και το αφήνουμε στη νέα επιθυμητή θέση κατάταξης στον πίνακα (τεχνική drag and drop ). Παρατηρούμε ότι μεταφέρεται όλη η γραμμή, η οποία κιτρινίζει στη νέα της θέση. 5. Για να ολοκληρωθεί η νέα κατάταξη των διαδραστικών στοιχείων, πρέπει να πατήσουμε το κουμπί Αποθήκευση (Εικόνα 31).

28 Σελίδα 28 από ΚΑΤΑΣΤΑΣΗ ΣΕΝΑΡΙΟΥ ΟΡΙΣΤΙΚΗ ΥΠΟΒΟΛΗ ΣΕΝΑΡΙΟΥ Στην Κατάσταση Σεναρίου εμφανίζεται η κατάσταση (συμπληρωμένο ή ασυμπλήρωτο ) των υποχρεωτικών πεδίων του Σεναρίου (Εικόνα 34) καθώς και το ποσοστό συμπλήρωσης (π.χ. 57%). Εικόνα 34 Προϋπόθεση για την Οριστική Υποβολή Σεναρίου (Εικόνα 35) είναι η συμπλήρωση όλων των υποχρεωτικών πεδίων.

29 Σελίδα 29 από 152 Εικόνα 35 Σε αντίθετη περίπτωση θα εμφανιστεί προειδοποιητικό μήνυμα (Εικόνα 36). Εικόνα 36 ΠΡΟΣΟΧΗ: Μετά από την επιτυχή οριστική υποβολή ενός σεναρίου, το σενάριο κλειδώνει και δεν μπορεί να δεχθεί κανενός είδους επεξεργασία.

30 Σελίδα 30 από ΠΡΟΕΠΙΣΚΟΠΗΣΗ ΣΕΝΑΡΙΟΥ Ανά πάσα στιγμή μπορούμε να πατήσουμε το κουμπί Προεπισκόπηση Σεναρίου (Εικόνα 37) και να δούμε σύνοψη του Σεναρίου μας (Εικόνα 38, Εικόνα 39, Εικόνα 40) Εικόνα 37 Εικόνα 38

31 Σελίδα 31 από 152 Εικόνα 39 Εικόνα 40

32 Σελίδα 32 από 152 ΜΕΡΟΣ Β

33 Σελίδα 33 από 152 ΕΙΣΑΓΩΓΗ Σε αυτό το μέρος αναλύεται ο τρόπος χρήσης των διαθέσιμων Διαδραστικών Εργαλείων (ΔΕ), ώστε να σχεδιάσετε/αναπτύξετε τα σενάριά σας. Για κάθε ΔΕ προσφέρεται (στο πάνω μέρος της εκάστοτε οθόνης διαχείρισης) βοήθεια για τον τρόπο χρήσης. Υπάρχουν τρία κουμπιά υπό τον τίτλο Επιλογές Βοήθειας, όπως φαίνονται στην ακόλουθη εικόνα. Πατώντας το πρώτο κουμπί, ανοίγει νέο παράθυρο με πληροφορίες σχετικά με τον τρόπο χρήσης του συγκεκριμένου ΔΕ. Το δεύτερο κουμπί προσφέρει τη δυνατότητα να κατέβουν ( download ) οι οδηγίες χρήσης του συγκεκριμένου ΔΕ και οι συνολικές οδηγίες της πλατφόρμας, σε διαφορετικά αρχεία τύπου.pdf. Το τρίτο κουμπί προσφέρει υπερσυνδέσμους με παραδείγματα χρήσης του συγκεκριμένου ΔΕ. Σε ορισμένα ΔΕ (υψηλής σχετικά πολυπλοκότητας) υπάρχει κι ένα τέταρτο κουμπί, το οποίο εμπεριέχει τον τρόπο χρήσης του συγκεκριμένου ΔΕ αποτυπωμένο σε βίντεο ( screencast ).

34 Σελίδα 34 από ΗΧΟΣ 1) Για να εισάγουμε ένα αρχείο ήχου κάνουμε κλικ στο εικονίδιο του ήχου Όπου πηγαίνουμε στις επιλογές των αρχείων ήχου: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Με το κουμπί μας ανοίγει παράθυρο για να εισάγουμε το αρχείο μας:

35 Σελίδα 35 από 152 Από την επιλογή «Επιλέξτε αρχείο για μεταμόρφωση» εισάγουμε αρχείο που το έχουμε τοπικά στον υπολογιστή μας. Οι επιτρεπόμενοι τύποι αρχείων ήχου είναι mp3, wav ή ogg. Από την επιλογή «συμπληρώστε την θέση (URL) του αρχείου» μπορούμε να εισάγουμε αρχείο ήχου από μια διεύθυνση του διαδικτύου. Αν το αρχείο μας έχει δικαιώματα χρήσης κάνουμε κλικ στο κουμπί «Δικαιώματα χρήσης» και μας ανοίγει το παρακάτω παράθυρο Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό τον δημιουργό του. Στη Χρονολογία την χρονολογία που δημιουργήθηκε. Στην Πηγή από πού το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια, «Με άδεια/copyright» για αρχεία που απαιτούν άδεια ή το «-». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

36 Σελίδα 36 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

37 Σελίδα 37 από ΕΙΚΟΝΑ Για να εισάγουμε εικόνα κάνουμε κλικ στο εικονίδιο της εικόνας: Όπου πηγαίνουμε στις επιλογές των αρχείων εικόνας: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Με το κουμπί (Προσθήκη Αρχείου) μας ανοίγει παράθυρο για να εισάγουμε το επιθυμητό αρχείο εικόνας για εισαγωγή. Οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif.

38 Σελίδα 38 από 152 Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό το δημιουργό του. Στη Χρονολογία τη χρονολογία που δημιουργήθηκε. Στην Πηγή από πού το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια, «Με άδεια/copyright» για αρχεία που απαιτούν άδεια ή το «-». Στο πεδίο «Εναλλακτικό κείμενο» γράφουμε κάτι το οποίο θα εμφανιστεί όταν δεν μπορεί να φορτωθεί η εικόνα Στο πεδίο «Βοηθητικό κείμενο» γράφουμε κείμενο το οποίο εμφανίζεται όταν ο χρήστης τοποθετεί τον δείκτη του ποντικιού πάνω από την εικόνα. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

39 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 39 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

40 Σελίδα 40 από ΚΕΙΜΕΝΟ Για να εισάγουμε κείμενο κάνουμε κλικ στο εικονίδιο του κειμένου: Όπου πηγαίνουμε στις επιλογές του κειμένου: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε ένα διευκρινιστικό κείμενο. Στο πεδίο «Κείμενο που θα φαίνεται» εισάγουμε το κείμενό μας Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

41 Σελίδα 41 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

42 Σελίδα 42 από 152 ΕΙΣΑΓΩΓΗ ΑΠΟΣΠΑΣΜΑΤΟΣ ΚΩΔΙΚΑ Επιλέγοντας το διαδραστικό εργαλείο Κείμενο δίνεται η δυνατότητα να προσθέσουμε απόσπασμα κώδικα προγραμματισμού. Η διαδικασία έχει ως ακολούθως: 1. Επιλογή διαδραστικού εργαλείου «Κείμενο» 2. Κλικ στο πλαίσιο «Κείμενο που θα φαίνεται» 3. Στη συνέχεια ανοίγει νέο παράθυρο, στο οποίο επιλέγουμε από την πάνω μπάρα το εικονίδιο «Εισαγωγή Αποσπάσματος Κώδικα» 4. Στη συνέχεια ανοίγει νέο παράθυρο με δύο επιλογές: α. Γλώσσα, β. Περιεχόμενο κώδικα. 5. Έστω ότι επιλέγουμε ως γλώσσα PHP και ως περιεχόμενο κώδικα το ακόλουθο κείμενο: /* PHP */

43 /* This is a piece of pseudo-code to locate a specific sequence of nucleocides in a given DNA piece of code */ // DNA piece of code $DNA_original="atggcccgagaccacctacttatgcattgtgcgaagttgctgcgtgactctgacacaaaacgca gtgcaaccttgttcagagggcaggtctacgcagaccagggagtgagtgcatgcgtt"; // locator, let's call it protein!! $protein="cag"; // return number of protein occurrences $number=substr_count($dna_original, $protein); // return the index of the first occurrence of the protein $first_occurrence=strpos($dna_original, $protein); // proper printing if ($number==0) { echo "This protein does not exist in the originally selected DNA sequence. Please try another sequence!"; } else if ($number==1) { echo "The protein $protein appears once in place $first_occurrence"; } else { echo "The protein $protein appears $number times while the first occurrence is in place $first_occurrence."; } Σελίδα 43 από Επιλέγουμε το κουμπί ΟΚ 7. Για να ολοκληρωθεί η αποθήκευση, φροντίζουμε ώστε όλα τα υποχρεωτικά πεδία με αστερίσκο να είναι συμπληρωμένα. Εδώ, το πεδίο Τίτλος πρέπει να είναι συμπληρωμένο.

44 Σελίδα 44 από Πατάμε το κουμπί Αποθήκευση. 9. Οι άνω επιλογές θα αποκτήσουν την ακόλουθη μορφή κατά την προεπισκόπηση του συγκεκριμένου διαδραστικού εργαλείου: ΕΙΣΑΓΩΓΗ ΜΑΘΗΜΑΤΙΚΗΣ ΣΥΝΑΡΤΗΣΗΣ Επιλέγοντας το διαδραστικό εργαλείο Κείμενο δίνεται η δυνατότητα να προσθέσουμε μαθηματική συνάρτηση με γραφική αποτύπωση. Η διαδικασία έχει ως ακολούθως: 1. Επιλογή διαδραστικού εργαλείου «Κείμενο» 2. Κλικ στο πλαίσιο «Κείμενο που θα φαίνεται» 3. Στη συνέχεια ανοίγει νέο παράθυρο, στο οποίο επιλέγουμε από την πάνω μπάρα το εικονίδιο «Μαθηματική Συνάρτηση» 4. Στη συνέχεια ανοίγει νέο παράθυρο όπου η μαθηματική συνάρτηση θα πρέπει να είναι συμβατή με τους κανόνες TeX. Οι κανόνες εμφανίζονται στον ακόλουθο σύνδεσμο https://en.wikibooks.org/wiki/latex/mathematics.

45 Σελίδα 45 από Επιλέγουμε το κουμπί ΟΚ 6. Για να ολοκληρωθεί η αποθήκευση, φροντίζουμε ώστε όλα τα υποχρεωτικά πεδία με αστερίσκο να είναι συμπληρωμένα. Εδώ, το πεδίο Τίτλος πρέπει να είναι συμπληρωμένο. 7. Πατάμε το κουμπί Αποθήκευση.

46 Σελίδα 46 από ΕΙΚΟΝΑ ΜΕ ΔΙΑΔΡΑΣΤΙΚΑ ΣΗΜΕΙΑ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας εικόνας, στην οποία μπορούμε να ορίσουμε πλήθος επεξηγηματικών σημείων, όπου ο χρήστης εξεταζόμενος μπορεί να δει επιπλέον πληροφορίες ανά σημείο. Για να δημιουργήσουμε εικόνα με διαδραστικά σημεία από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΙΚΟΝΑ ΜΕ ΔΙΑΔΡΑΣΤΙΚΑ ΣΗΜΕΙΑ». Ακολούθως, εμφανίζονται τα πεδία:

47 Σελίδα 47 από 152 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο. Μπορείτε να μεταφορτώσετε μία εικόνα (πεδίο Μεταφόρτωση Εικόνας / Φωτογραφίας) κάνοντας κλικ στο κουμπί «Προσθήκη Αρχείου», οπότε και ανοίγει παράθυρο διαλόγου για να εισάγουμε την εικόνα μας, πάνω στην οποία θα τοποθετήσουμε στη συνέχεια το πλήθος των διαδραστικών σημείων. Οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Πατώντας κλικ στα Δικαιώματα χρήσης, εμφανίζονται τα ακόλουθα πεδία: Στον τίτλο δίνουμε τον τίτλο του αρχείου. Στο δημιουργό τον δημιουργό του. Στη χρονολογία την χρονολογία που δημιουργήθηκε. Στην πηγή από πού το πήραμε. Στην άδεια χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια (εάν είμαστε σίγουροι για αυτό) ή «Με άδεια/copyright» για αρχεία που απαιτούν άδεια. Η επιλογή «-» υποδηλώνει το κενό και δεν είναι αποδεκτή. Για να κλείσετε τα εμφανιζόμενα πεδία των Δικαιωμάτων Χρήσης, πατήστε το κουμπί.

48 Στο πεδίο Χρώμα Διαδραστικού Σημείου μπορούμε να εισάγουμε το χρώμα της αρεσκείας μας για το διαδραστικό σημείο, όπως αυτό θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Σελίδα 48 από 152 Το χρώμα του διαδραστικού σημείου πάνω στην εικόνα ορίζεται σε δεκαεξαδική μορφή. Ενδεικτικά, το λευκό χρώμα απεικονίζεται ως FFFFFF, το μαύρο ως , το κόκκινο ως FF0000, το πράσινο ως 00FF00, το μπλε ως 0000FF, κοκ. Για περισσότερες πληροφορίες σχετικά με τους χρωματικούς κώδικες μπορείτε να επισκεφτείτε την ακόλουθη ιστοσελίδα: Για να εισάγουμε ένα διαδραστικό σημείο, επιλέγουμε «Περιγραφή Διαδραστικού Σημείου». Στη συνέχεια εμφανίζεται ο ακόλουθος πίνακας, οποίος έχει σειρά από πεδία τα οποία αναλύονται παρακάτω.

49 Σελίδα 49 από 152 Στον τίτλο, δίνουμε τον τίτλο του διαδραστικού σημείου. Στο κείμενο που θα φαίνεται, το κείμενο που θέλουμε να φαίνεται όταν κάνουμε κλικ πάνω στο διαδραστικό σημείο. Στην «Οριζόντια απόσταση (x)» δίνουμε την οριζόντια απόσταση από την αριστερή άκρη της εικόνας σε ποσοστό (0-100) [εάν π.χ θέλουμε να υποδείξουμε πως κάποιο σημείο βρίσκεται στο αριστερό μέρος της εικόνας επιλέγουμε εύρος τιμών 0 έως 35, για σημείο το οποίο θέλουμε να βρίσκεται στο κέντρο της εικόνας εύρος τιμών 36 έως 64, ενώ για σημείο το οποίο θέλουμε να βρίσκεται στο δεξιό μέρος της εικόνας επιλέγουμε εύρος τιμών 65 έως 100]. Στην «Κάθετη απόσταση (y)» δίνουμε την κάθετη απόσταση από το πάνω μέρος της εικόνας σε ποσοστό (0-100) [εάν π.χ θέλουμε να υποδείξουμε πως κάποιο σημείο βρίσκεται στο πάνω μέρος της εικόνας επιλέγουμε εύρος τιμών 0 έως 35, για σημείο το οποίο θέλουμε να

50 βρίσκεται στο μέσο της εικόνας εύρος τιμών 36 έως 64, ενώ για σημείο το οποίο θέλουμε να βρίσκεται στο κάτω μέρος της εικόνας επιλέγουμε εύρος τιμών 65 έως 100]. Για να επιτύχετε το ακριβές επιθυμητό σημείο, προτείνεται η επανειλημμένη αλλαγή των παραμέτρων x και y κατά βούληση. Σελίδα 50 από 152 Με κλικ στο κουμπί «Προσθήκη στοιχείου: Διαδραστικό σημείο» μπορούμε να προσθέσουμε και άλλα διαδραστικά σημεία στην εικόνα μας. Έχετε τη δυνατότητα να προσθέσετε όσα διαδραστικά σημεία επιθυμείτε, επαναλαμβάνοντας την προηγούμενη διαδικασία. Κάνοντας κλικ στο εικονίδιο μπορούμε να αφαιρέσουμε το διαδραστικό σημείο. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

51 Σελίδα 51 από ΕΡΩΤΗΣΗ ΑΝΤΙΣΤΟΙΧΙΣΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ερωτήσεων αντιστοίχισης. Μπορούμε να ορίσουμε πλήθος ερωτήσεων στις οποίες η σωστή απάντηση απουσιάζει στο σημείο που επιθυμούμε και βρίσκονται αριστερά, ενώ το πλήθος των ορθών απαντήσεων βρίσκονται προς τα δεξιά με τυχαία σειρά. Ο χρήστης εξεταζόμενος καλείται να διασυνδέσει τις προσφερόμενες ορθές απαντήσεις του δεξιού μέρους στις ερωτήσεις που βρίσκονται αριστερά, σύροντας με το ποντίκι την ορθή απάντηση και αφήνοντας στην ερώτηση (τεχνική drag-and-drop). Για να δημιουργήσουμε εικόνα με ερωτήσεις αντιστοίχισης από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΑΝΤΙΣΤΟΙΧΙΣΗΣ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

52 Σελίδα 52 από 152 Στη συνέχεια στο πεδίο Τίτλος για τις Ερωτήσεις Αντιστοίχισης δίνουμε την επιθυμητή περιγραφή του διαδραστικού στοιχείου. Στο πεδίο Πεδία Αντιστοίχισης μπορούμε να εισάγουμε πλήθος εκφράσεων για τις οποίες επιθυμούμε να γίνεται αντιστοίχιση. Κάθε έκφραση/παράγραφος δύναται να χωρίζεται με enter από την επόμενη. Για να ορίσουμε την πιθανή επιλογή αντιστοίχισης, τη χωρίζουμε με αστερίσκους (*), έναν στην αρχή της κι έναν στο τέλος της. ΠΡΟΣΟΧΗ: Στο κείμενο της πιθανής ορθής αντιστοίχισης δεν επιτρέπονται οι χαρακτήρες : (άνω-και-κάτω τελεία) και ο αστερίσκος (*). Ειδικότερα ο αστερίσκος αποτελεί διαχωριστικό σύμβολο και θα πρέπει να είστε προσεκτικοί, διότι εάν κατά λάθος τοποθετήσετε περιττό αριθμό αστερίσκων στο Πεδίο Αντιστοίχισης, ενδέχεται το αποτέλεσμα να οδηγήσει σε εσφαλμένη συμπεριφορά της Πλατφόρμας. Αξίζει να σημειωθεί πως σε μια έκφραση/ερώτηση έχετε τη δυνατότητα να προσφέρετε πάνω από μία επιλογές αντιστοίχισης, με την προϋπόθεση ότι συμπληρώνετε άρτιο αριθμό αστερίσκων (*) κατά βούληση. Κατά την προεπισκόπηση του διαδραστικού στοιχείου, ενδέχεται να προκύψει η ακόλουθη ερώτηση αντιστοίχισης, κατά την οποία πρέπει να σύρουμε το πλαίσιο της αντιστοίχισης στο δεξιό μέρος στην κατάλληλη θέση στις εκφράσεις στο αριστερό μέρος (τεχνική drag-and-

53 drop ). Υπόψη ότι κατά την προεπισκόπηση οι επιλογές αντιστοίχισης εμφανίζονται με τυχαία σειρά. Σελίδα 53 από 152 Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις Παραμέτρων παρέχουν τρεις επιλογές: Ενεργοποίηση επιλογής επανάληψης προσπάθειας (κουμπί) Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να επαναλάβει την προσπάθειά του για αντιστοίχιση, στην περίπτωση που έχει κάνει κάποιο λάθος κατά την αντιστοίχιση. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος Απαντήσεων), και στη συνέχεια το κουμπί (Επανάληψη Προσπάθειας), οπότε και του παρέχεται μια δεύτερη ευκαιρία να ξαναδοκιμάσει, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις αντιστοιχίσεις με το σωστό τρόπο, τότε δεν προσφέρεται η δυνατότητα για επανάληψη. Ενεργοποίηση επιλογής προβολής σωστών απαντήσεων (κουμπί) Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει τις ορθές απαντήσεις κατά την προεπισκόπηση του στοιχείου. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος Απαντήσεων). Στη συνέχεια, πατώντας το κουμπί (Προβολή Απαντήσεων) μπορεί να δει τις ορθές αντιστοιχίσεις, όπως φαίνεται στην ακόλουθη εικόνα,

54 μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις αντιστοιχίσεις με το σωστό τρόπο, τότε δεν υφίσταται ανάγκη για προβολή των ορθών απαντήσεων. Σελίδα 54 από 152 Άμεση προβολή σωστού/λάθος αποτελέσματος Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει άμεσα την ορθότητα ή μη της κάθε αντιστοίχισης κατά την προεπισκόπηση του στοιχείου, χωρίς να πατήσει κάποιο κουμπί. Χαρακτηριστική είναι η ακόλουθη εικόνα. Οι άνω τρεις επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τέσσερις επιλογές:

55 Σελίδα 55 από 152 Οι πρώτες τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος Απαντήσεων, Επανάληψη Προσπάθειας, Προβολή Απαντήσεων) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Η τέταρτη επιλογή δίνει τη δυνατότητα να επεξεργαστούμε το κείμενο του μηνύματος των αποτελεσμάτων. Το προκαθορισμένο κείμενο, το οποίο μπορείτε να επεξεργαστείτε προαιρετικά, είναι: σωστά». Η αφορά στο σύνολο των ορθών αντιστοιχίσεων, ενώ η στο σύνολο των αντιστοιχίσεων. Υπόψη ότι τα αποτελέσματα δεν αποθηκεύονται στη βάση. Σε περίπτωση ύπαρξης τουλάχιστον μιας λανθασμένης αντιστοίχισης κατά τη χρήση του διαδραστικού στοιχείου στην προεπισκόπηση, εμφανίζεται το ακόλουθο γράφημα: Αντίθετα, σε περίπτωση εντοπισμού των ορθών αντιστοιχίσεων συνολικά, το γράφημα εμφανίζεται με την ακόλουθη μορφή:

56 Σελίδα 56 από 152 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

57 6. ΕΡΩΤΗΣΗ ΕΠΙΛΟΓΗΣ ΛΕΞΕΩΝ Σελίδα 57 από 152 Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα να επιλέξουμε πλήθος συγκεκριμένων λέξεων μέσα σε εκφράσεις, τις οποίες δημιουργούμε κατά βούληση. Ο χρήστης εξεταζόμενος καλείται να επιλέξει τις ορθές λέξεις κάνοντας κλικ με το ποντίκι του (μαρκάροντας), πάνω στις εκφράσεις που έχουμε προηγουμένως ορίσει. Για να δημιουργήσουμε ερώτηση επιλογής λέξεων από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΕΠΙΛΟΓΗΣ ΛΕΞΕΩΝ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

58 Στη συνέχεια στο πεδίο Περιγραφή εργασίας δίνουμε την επιθυμητή περιγραφή του διαδραστικού στοιχείου. Σελίδα 58 από 152 Στο πεδίο Πεδίο κειμένου μπορούμε να εισάγουμε πλήθος εκφράσεων από τις οποίες επιθυμούμε να επιλέγουμε συγκεκριμένες λέξεις. Για να ορίσουμε την ορθά επιλεγμένη λέξη, τη χωρίζουμε με αστερίσκους (*), έναν στην αρχή της κι έναν στο τέλος της. ΠΡΟΣΟΧΗ: Η επιλογή ισχύει μόνο για μια λέξη και όχι για φράση, ενώ στο κείμενο της πιθανής επιλογής δεν επιτρέπονται οι χαρακτήρες κενό ( space ) και ο αστερίσκος (*). Ειδικότερα, το κενό δεν μπορεί να αποτελεί επιλογή καθόσον εκ των πραγμάτων είναι διαχωριστικό λέξεων (οπότε αποκλείονται οι εκφράσεις ως δυνατότητα επιλογής), ενώ ο αστερίσκος αποτελεί διαχωριστικό σύμβολο και θα πρέπει να είστε προσεκτικοί, διότι εάν κατά λάθος τοποθετήσετε περιττό αριθμό αστερίσκων στο Πεδίο κειμένου, ενδέχεται το αποτέλεσμα να οδηγήσει σε εσφαλμένη συμπεριφορά της Πλατφόρμας. Επίσης, πρέπει να δώσετε προσοχή σε ορισμένους ειδικούς χαρακτήρες, οι οποίοι ενώ μπορούν να χρησιμοποιηθούν στην αρχή ή στο μέσο μιας ορθής επιλεγμένης λέξης (χωρίς κανένα ενδιάμεσο κενό), παρουσιάζουν απρόβλεπτη συμπεριφορά όταν βρίσκονται στο τέλος της λέξης που επιθυμούμε να επιλέξουμε ή αποτελούν αποκλειστικά μόνοι τους μέρος της λύσης. Οι χαρακτήρες αυτοί είναι ερωτηματικό (;), άνω-κάτω-τελεία (:), μεγαλύτερο (>), μικρότερο (<), ampersand (&), δίεση (#). Ενδεχόμενη χρήση των παραπάνω ειδικών χαρακτήρων πρέπει να αποφεύγεται, ή τουλάχιστον να γίνεται με ιδιαίτερη προσοχή.

59 Σελίδα 59 από 152 Κατά την προεπισκόπηση του διαδραστικού στοιχείου, ενδέχεται να προκύψει η ακόλουθη ερώτηση επιλογής λέξεων, κατά την οποία πρέπει να επιλέξουμε με κλικ του ποντικιού τη σωστή απάντηση. Σε μια έκφραση μπορεί να υπάρχει πλήθος ορθών επιλογών λέξεων, αρκεί αυτές να χωρίζονται με σωστό τρόπο, όπως ακριβώς περιγράφτηκε προηγουμένως. Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις παρέχουν δύο επιλογές: Ενεργοποίηση Προσπάθησε ξανά

60 Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να επαναλάβει την προσπάθειά του για επιλογή λέξεων, στην περίπτωση που έχει κάνει κάποιο λάθος κατά την αρχική επιλογή. Πρώτα ο μαθητής πρέπει να πατήσει Σελίδα 60 από 152 το κουμπί (Έλεγχος απαντήσεων), και στη συνέχεια το κουμπί (Προσπάθησε ξανά), οπότε και του παρέχεται μια δεύτερη ευκαιρία να ξαναδοκιμάσει, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις επιλογές λέξεων με το σωστό τρόπο, τότε δεν προσφέρεται η δυνατότητα για επανάληψη. Ενεργοποίηση Προβολή λύσεων Εάν επιλέξουμε τη συγκεκριμένη επιλογή, τότε παρέχουμε τη δυνατότητα στο χρήστη/μαθητή να προβάλει τις ορθές απαντήσεις κατά την προεπισκόπηση του στοιχείου. Πρώτα ο μαθητής πρέπει να πατήσει το κουμπί (Έλεγχος απαντήσεων). Στη συνέχεια, πατώντας το κουμπί (Προβολή λύσεων) μπορεί να δει τις ορθές επιλογές, μόνο σε περίπτωση που έχει κάνει κάποιο λάθος. Αντίθετα, εάν έχει κάνει όλες τις επιλογές λέξεων με το σωστό τρόπο, τότε δεν υφίσταται ανάγκη για προβολή των ορθών απαντήσεων. Σχηματικά, το συγκεκριμένο διαδραστικό στοιχείο λειτουργεί ως ακολούθως κατά την προεπισκόπηση: 1. Επιλογή των λέξεων που επιθυμούμε με κλικ του ποντικιού.

61 2. Έλεγχος των απαντήσεων (κλικ), όπου με πράσινο χρώμα εμφανίζονται οι ορθές επιλογές και με κόκκινο οι λανθασμένες. Σελίδα 61 από Προβολή των λύσεων (κλικ), η οποία οριοθετείται από ένα διακεκομμένο πλαίσιο γύρω από κάθε ορθή επιλογή, η οποία δεν επιλέχτηκε αρχικά. Οι άνω δύο επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τέσσερις επιλογές:

62 Σελίδα 62 από 152 Οι πρώτες τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος απαντήσεων, Προσπάθησε ξανά, Προβολή λύσεων) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Η τέταρτη επιλογή δίνει τη δυνατότητα να επεξεργαστούμε το κείμενο του μηνύματος των αποτελεσμάτων. Το προκαθορισμένο κείμενο, το οποίο μπορείτε να επεξεργαστείτε προαιρετικά, είναι: από πόντων». Η αφορά στο σύνολο των ορθών αντιστοιχίσεων συνδυαστικά, ενώ η στο σύνολο των αντιστοιχίσεων. Υπόψη ότι τα αποτελέσματα δεν αποθηκεύονται στη βάση. Το σύνολο των διαθέσιμων μεταβλητών (συσχετιστικό σύνολο πόντων ανάλογα με τις (μέγιστο σύνολο (σύνολο ορθών επιλογών (σύνολο λανθασμένων επιλογών (σύνολο μηεπιλεγμένων λέξεων που αποτελούν ορθή επιλογή). Σε περίπτωση ύπαρξης τουλάχιστον μιας λανθασμένης επιλογής λέξεων κατά τη χρήση του διαδραστικού στοιχείου στην προεπισκόπηση, εμφανίζεται το ακόλουθο γράφημα: Αντίθετα, σε περίπτωση εντοπισμού των ορθών επιλογών λέξεων συνολικά, το γράφημα εμφανίζεται με την ακόλουθη μορφή: Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

63 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 63 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

64 Σελίδα 64 από ΕΡΩΤΗΣΗ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα να δημιουργήσουμε μια ερώτηση πολλαπλής επιλογής, η οποία ενδεχομένως να έχει μία ή περισσότερες ορθές απαντήσεις. Ο χρήστης εξεταζόμενος καλείται να επιλέξει την απάντηση που θεωρεί ορθή, και ανάλογα προκύπτει το αποτέλεσμα της επιλογής. Για να δημιουργήσουμε ερώτηση πολλαπλής επιλογής από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΡΩΤΗΣΗ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ». Ακολούθως, εμφανίζονται τα πεδία: Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Στο πεδίο Διευκρίνιση εισάγουμε προαιρετικά διευκρινιστικό κείμενο.

65 Προαιρετικά μπορείτε να εισάγετε εικόνα πάνω από τις ερωτήσεις σας (πεδίο Εικόνα Ερώτησης) κάνοντας κλικ στο κουμπί «Προσθήκη Αρχείου», οπότε και ανοίγει παράθυρο διαλόγου για να εισαχθεί η επιθυμητή εικόνα. Οι υποστηριζόμενοι τύποι αρχείων είναι jpg, png ή gif. Σελίδα 65 από 152 Πατώντας κλικ στα Δικαιώματα χρήσης, εμφανίζονται τα ακόλουθα πεδία, τα οποία αφορούν στα δικαιώματα χρήσης της εικόνας (εάν υπάρχουν): Στον Τίτλο δίνουμε τον τίτλο του αρχείου. Στο Δημιουργό το δημιουργό του. Στη Χρονολογία τη χρονολογία που δημιουργήθηκε. Στην Πηγή από που το πήραμε. Στην Άδεια Χρήσης μπορούμε να επιλέξουμε «Χωρίς άδεια» για αρχεία που δεν χρειάζονται άδεια (εάν είμαστε σίγουροι για αυτό) ή «Με άδεια/copyright» για αρχεία που απαιτούν άδεια. Η επιλογή «-» υποδηλώνει το κενό και δεν είναι αποδεκτή. Για να κλείσετε τα εμφανιζόμενα πεδία των Δικαιωμάτων Χρήσης, πατήστε το κουμπί.

66 Σελίδα 66 από 152 Για να εισάγουμε μία ερώτηση πολλαπλής επιλογής, επιλέγουμε το πεδίο «Ερώτηση Πολλαπλής Επιλογής» και γράφουμε την επιθυμητή ερώτηση. Στη συνέχεια, έχουμε τη δυνατότητα να προσθέσουμε πλήθος απαντήσεων, επιλέγοντας κατά βούληση ποιες και πόσες θα είναι ορθές. Συγκεκριμένα, επιλέγοντας το πεδίο Απάντηση, εμφανίζεται ο ακόλουθος πίνακας. Στο πεδίο Κείμενο Απάντησης ορίζουμε το κείμενο που θα αποτελεί πιθανή επιλογή ως απάντηση κατά την προεπισκόπηση. Εάν επιλέξουμε το πεδίο Σωστή Απάντηση, τότε η συγκεκριμένη απάντηση θα είναι ορθή. Έχουμε τη δυνατότητα να επιλέξουμε πάνω από μία ορθές απαντήσεις (ακόμα και όλες οι απαντήσεις δυνητικά μπορεί να είναι ορθές για μια ερώτηση). Το Σχόλιο αν ο χρήστης διαλέξει αυτή την απάντηση θα εμφανίζει επιθυμητό κείμενο στο χρήστη κατά την προεπισκόπηση. Το Σχόλιο αν ο χρήστης δεν διαλέξει αυτή την απάντηση θα εμφανίζει αντίστοιχα το επιθυμητό κείμενο στο χρήστη κατά την προεπισκόπηση. Ο χρήστης έχει τη δυνατότητα να προσθέσει όσες πιθανές απαντήσεις επιθυμεί για μία ερώτηση. Ο προκαθορισμένος αριθμός απαντήσεων όταν δημιουργείται το συγκεκριμένο διαδραστικό εργαλείο, είναι δύο. Βέβαια, ο χρήστης μπορεί να προσθέσει κι άλλες, αφού

67 Σελίδα 67 από 152 πατήσει προηγουμένως το κουμπί (Προσθήκη στοιχείου: Απάντηση). Μετά τη δημιουργία μιας πιθανής απάντησης, ο χρήστης δύναται να τη διαγράψει πατώντας το κουμπί. Σε αυτήν την περίπτωση, εμφανίζεται το ακόλουθο μήνυμα επιβεβαίωσης. Πατώντας OK, η απάντηση διαγράφεται, ενώ πατώντας Ακύρωση, η απάντηση παραμένει. Το συγκεκριμένο εργαλείο παρέχει μια σειρά από επιπλέον επιλογές. Οι Ρυθμίσεις Παραμέτρων παρέχουν πέντε επιλογές: Ενεργοποίηση επιλογής επανάληψης προσπάθειας (κουμπί) Με τη συγκεκριμένη επιλογή, αφού ο χρήστης κατά την προεπισκόπηση πατήσει το κουμπί (Έλεγχος απαντήσεων), είναι σε θέση να επαναλάβει την προσπάθειά του. Ειδικότερα, μόνο στην περίπτωση που επιλέξει λανθασμένη απάντηση, θα εμφανιστεί το κουμπί (Επανάληψη Προσπάθειας), με το οποίο έχει τη δυνατότητα να ξαναπροσπαθήσει. Υπόψη ότι όταν επιλεγεί ορθή απάντηση (σε περίπτωση

68 πολλαπλών ορθών απαντήσεων, οποιαδήποτε από αυτές), τότε το εν λόγω κουμπί δεν εμφανίζεται. Σελίδα 68 από 152 Ενεργοποίηση επιλογής προβολής σωστών απαντήσεων (κουμπί) Με τη συγκεκριμένη επιλογή, αφού ο χρήστης κατά την προεπισκόπηση πατήσει το κουμπί (Έλεγχος απαντήσεων), είναι σε θέση να προβάλει το σύνολο των ορθών απαντήσεων. Ειδικότερα, μόνο στην περίπτωση που επιλέξει λανθασμένη απάντηση, θα εμφανιστεί το κουμπί (Προβολή Απαντήσεων), με το οποίο έχει την παραπάνω δυνατότητα. Σε περίπτωση πολλαπλών ορθών απαντήσεων, αυτές εμφανίζονται στο σύνολό τους. Μοναδική απάντηση Με τη συγκεκριμένη επιλογή, ο χρήστης μπορεί να ρυθμίσει εάν κατά την προεπισκόπηση θα χρήστης/μαθητής θα είναι σε θέση να επιλέξει μόνο μία επιλογή ή εάν θα μπορεί να επιλέξει πάνω από μία. Ειδικότερα, εάν επιλεγεί με τικ η συγκεκριμένη επιλογή, ο χρήστης θα μπορεί να επιλέξει μόνο μία απάντηση, ανεξάρτητα από το πλήθος των ορθών απαντήσεων (τύπος radio-button ). Αντίθετα, εάν δεν την επιλέξει με τικ, τότε θα μπορεί να επιλέξει όσες από τις διαθέσιμες απαντήσεις επιθυμεί (τύπος check-box ). Στα παρακάτω δύο σχήματα φαίνεται η ίδια ερώτηση με τους δύο τύπους όπως μόλις περιγράφηκαν. Radio button Check box Στην πρώτη περίπτωση (αριστερά) ο χρήστης μπορεί να επιλέξει μόλις μία απάντηση, ενώ στη δεύτερη (δεξιά) πάνω από μία. Τυχαία σειρά των διαθέσιμων απαντήσεων Με τη συγκεκριμένη επιλογή τυχαιοποιείται η προβολή των απαντήσεων, κάθε φορά που γίνεται προεπισκόπηση. Για παράδειγμα, εάν επιθυμούμε να συμπεριλάβουμε ορθή απάντηση του τύπου Όλα τα παραπάνω (η οποία προφανώς θα πρέπει να διατίθεται πάντα ως τελευταία εναλλακτική επιλογή), προτείνεται να μην κάνουμε τικ στη συγκεκριμένη επιλογή, ώστε η συγκεκριμένη πιθανή απάντηση να βρίσκεται πάντα στο σημείο που επιθυμούμε.

69 Σελίδα 69 από 152 Απαιτείται τουλάχιστον μια εισαγωγή απάντησης πριν την υποβολή των σωστών απαντήσεων Με τη συγκεκριμένη επιλογή, ο χρήστης καλείται να δοκιμάσει πρώτα να επιλέξει μια ορθή απάντηση προτού του δοθεί η δυνατότητα να προβάλει το σύνολο των ορθών απαντήσεων. Κατά τον έλεγχο ορθότητας των απαντήσεων, σε περίπτωση επιτυχίας εμφανίζεται ένα πράσινο τικ δίπλα στην επιλογή που έγινε. Σε περίπτωση λάθους, εμφανίζεται αντίστοιχα ένα κόκκινο x. Τέλος, στην περίπτωση Ελέγχου των απαντήσεων, εμφανίζεται με πράσινο τικ το σύνολο των ορθών απαντήσεων. Οι άνω πέντε επιλογές μπορούν να χρησιμοποιηθούν συνδυαστικά. Οι Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα παρέχουν τρεις επιλογές.

70 Σελίδα 70 από 152 Και οι τρεις δίνουν τη δυνατότητα να επεξεργαστούμε το κείμενο των τριών προαναφερόμενων κουμπιών (Έλεγχος απαντήσεων, Προβολή Απαντήσεων, Επανάληψη Προσπάθειας) κατά βούληση, όπως θέλουμε να εμφανίζεται κατά την προεπισκόπηση. Οι παραπάνω ονομασίες είναι προκαθορισμένες και θα παραμείνουν ως έχουν, εάν δεν τις επεξεργαστείτε προαιρετικά. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

71 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 71 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

72 Σελίδα 72 από ΕΡΩΤΗΣΗ ΣΥΜΠΛΗΡΩΣΗΣ ΚΕΝΩΝ Το διαδραστικό αυτό στοιχείο παρουσιάζει ένα κείμενο από το οποίο λείπουν λέξεις οι φράσεις και στη θέση τους εμφανίζονται πεδία κειμένου όπου πρέπει να συμπληρωθούν. Εάν συμπληρωθούν όπως έχει προκαθοριστεί από το δημιουργό της ερώτησης τότε θεωρούνται σωστές αλλιώς λάθος. Αν τα πεδία είναι κενά θεωρείται ότι δεν έχουν ακόμα συμπληρωθεί. Είναι πιθανό να υπάρχουν για το ίδιο «κενό» περισσότερες από μία σωστές απαντήσεις. Σ αυτή την περίπτωση θα πρέπει να δηλωθούν κατάλληλα. Για να δημιουργήσουμε ερωτήσεις συμπλήρωσης κενών από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Ερώτηση συμπλήρωσης κενών» [σχ ΣΚ 1],

73 Σελίδα 73 από 152 Σχήμα ΣΚ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης κενών που περιλαμβάνει: Σχήμα ΣΚ 2

74 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για το κείμενο με τα προς συμπλήρωση πεδία «κενά» που θα ακολουθήσει. Σελίδα 74 από 152 Σχήμα ΣΚ 3 Στο πεδίο «Κείμενο» είναι πεδίο κειμένου εμπλουτισμένης μορφής και καταχωρείται το κείμενο που θα περιέχει τα κενά. Στο σημείο που είναι επιθυμητή η δημιουργία κενού εισάγεται ο χαρακτήρας * (αστέρι) και αμέσως (χωρίς οποιοδήποτε κενό διάστημα ή άλλο χαρακτήρα) ακολουθεί η σωστή λέξη ή έκφραση που αναμένεται να συμπληρωθεί. Στο τέλος της σωστής λέξης ή έκφρασης αμέσως εισάγεται εκ νέου ο χαρακτήρας * που σηματοδοτεί τη λήξη της σωστής λέξης ή έκφρασης. Δηλαδή η σωστή λέξη έκφραση θα πρέπει να περικλείεται από δύο *, ένα στην αρχή και ένα στο τέλος. Κατά την προβολή εκτέλεση το διαδραστικό στοιχείο αντικαθιστά αυτομάτως το περιεχόμενο μεταξύ των δύο * και εμφανίζει κενό πεδίο κειμένου. Αν για παράδειγμα το κείμενο ήταν : =12 και θέλαμε να εμφανισθεί κενό στο 5, το περιεχόμενο θα έπρεπε να διαμορφωθεί ως εξής: 7 + *5* = 12 Κατά την εκτέλεση/προβολή θα είχαμε την εμφάνιση: 7 + = 12

75 Σελίδα 75 από 152 Θα είχαμε σωστό αποτέλεσμα μόνο αν ο εξεταζόμενος συμπλήρωνε 5. Στις περιπτώσεις που υπάρχουν περισσότερες από μία λέξεις εκφράσεις τότε αυτές χωρίζονται μεταξύ τους με / (πλάγια κάθετο) [slash]. Για παράδειγμα αν το κείμενο ήταν: Ο Τιτανικός ήταν πλοίο υπερωκεάνιο Έστω ότι το κενό θα εμφανιστεί στη λέξη πλοίο, πιθανά να θέλαμε να είναι αποδεκτές και άλλες λέξεις όπως : καράβι και βαπόρι. Για να καλυφθεί αυτή η περίπτωση το κείμενο πρέπει να γραφεί ως εξής: Ο Τιτανικός ήταν *πλοίο/καράβι/βαπόρι* υπερωκεάνιο Κατά την εκτέλεση/προβολή θα είχαμε την εμφάνιση: Ο Τιτανικός ήταν υπερωκεάνιο Στο κείμενο είναι δυνατό να υπάρχουν πολλά κενά. Τα κενά θα είναι τόσα όσα και τα ζεύγη των αστερίσκων (*). Υπόψη ότι ορισμένοι χαρακτήρες θεωρούνται ειδικοί και δεν επιτρέπεται η εισαγωγή τους ως μέρος της ορθής απάντησης. Μεταξύ αυτών, είναι οι ακόλουθοι: < (μικρότερο), > (μεγαλύτερο), : (άνω-κάτω τελεία), & ( ambersand ). Επισημαίνεται πως οι χαρακτήρες * (αστερίσκος), / (δεξιά κάθετος) δεν μπορούν να θεωρηθούν ως μέρος ορθής απάντησης, διότι αποτελούν ειδικούς διαχωριστικούς χαρακτήρες (επιτελούν συγκεκριμένο ρόλο όπως αναγράφεται παραπάνω). Είναι επίσης δυνατό να έχουμε και πολλά κείμενα. Για να προστεθεί πεδίο κειμένου, επιλέγουμε: σχήματος [ΣΚ 3]. και θα προστεθεί νέο πεδίο κειμένου σαν αυτό του Για να διαγράψουμε κείμενο πάνω και δεξιά του πεδίου του προς διαγραφή κειμένου επιλέγουμε (επιλογή διαγραφής) και μετά από σχετικό μήνυμα επιβεβαίωσης το κείμενο διαγράφεται.

76 Σελίδα 76 από 152. Σχήμα ΣΚ 4 Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις Παραμέτρων» [σχ ΣΚ 4] μπορούμε να ρυθμίσουμε τη λειτουργική «συμπεριφορά» του διαδραστικού στοιχείου όπως επιθυμούμε ενεργοποιώντας και απενεργοποιώντας από τις παραπάνω επιλογές.

77 Σελίδα 77 από 152 Σχήμα ΣΚ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΣΚ 5] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Μήνυμα για τα αποτελέσματα» είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών απαντήσεων που δόθηκαν από τον εξεταζόμενο (σωστή συμπλήρωση κενού πεδίου) και επίσης είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των κενών (Πχ αν κάποιος σε σύνολο 7 κενών συμπλήρωσε σωστά 4 κενά, = 4 και το μήνυμα θα ήταν : «Είχες 4 από 7 σωστά». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

78 Σελίδα 78 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

79 Σελίδα 79 από ΕΚΦΡΑΣΕΙΣ ΤΥΠΟΥ ΣΩΣΤΟ / ΛΑΘΟΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ομάδων εκφράσεων όπου ο χρήστης εξεταζόμενος καλείται να επιλέξει μία έκφραση από κάθε ομάδα ως αληθή (σωστή). Για να δημιουργήσουμε ερωτήσεις μοναδικής επιλογής από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ» [σχ ΣΛ 1].

80 Σελίδα 80 από 152 Σχήμα ΣΛ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Εκφράσεων τύπου Σωστό / Λάθος, που περιλαμβάνει: Σχήμα ΣΛ 2

81 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Σελίδα 81 από 152 Σχήμα ΣΛ 3 Το «Εισαγωγικό κείμενο» είναι πεδίο κειμένου εμπλουτισμένης μορφής και εμφανίζεται πάνω από τις εκφράσεις. Το ίδιο κείμενο αφορά όλες τις ομάδες εκφράσεων. Πρέπει να συμπληρωθεί υποχρεωτικά, και το προκαθορισμένο περιεχόμενό του είναι «Διαλέξτε τη σωστή έκφραση».

82 Σελίδα 82 από 152 Σχήμα ΣΛ 4 Κάθε ομάδα εκφράσεων αποτελείται από ένα σύνολο εκφράσεων, που είναι πεδία κειμένου. Κάθε ομάδα μπορεί να περιέχει μεταβλητό αριθμό εκφράσεων. Το πρώτο πεδίο «Έκφραση» κάθε ομάδας εκφράσεων επέχει τη θέση του «σωστού». Κάθε ομάδα μπορεί να έχει μόνο μία σωστή έκφραση (την πρώτη στη σειρά). Κατά την προβολή εκτέλεση του σεναρίου, οι ομάδες εκφράσεων εμφανίζονται με τη σειρά τοποθέτησής τους. Οι περιεχόμενες όμως εκφράσεις κάθε ομάδας εμφανίζονται με τυχαία σειρά.

83 Σελίδα 83 από 152 Σχήμα ΣΛ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΣΛ 5], μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Αποτελέσματα», είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών εκφράσεων που επιλέχθηκαν από τον εξεταζόμενο, είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των ομάδων εκφράσεων, είναι μεταβλητή που αφορά το ποσοστό των σωστών εκφράσεων (που έχουν επιλεγεί) επί του συνολικού αριθμού των ομάδων εκφράσεων. (Π.χ αν κάποιος σε σύνολο 4 ομάδων εκφράσεων έχει επιλέξει 2 σωστές εκφράσεις, = 2 και το μήνυμα θα ήταν: «Είχες 2 από 4 σωστά (50%)». Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

84 Σελίδα 84 από ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα δημιουργίας ερωτήσεων κλειστού τύπου όπου σε κάθε ερώτηση μπορεί να υπάρχει πλήθος πιθανών απαντήσεων, μία όμως θα είναι η σωστή. Για να δημιουργήσουμε ερωτήσεις μοναδικής επιλογής από το κατακόρυφο μενού αριστερά και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου επιλέγω:

85 Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΣΕΙΡΑ ΕΡΩΤΗΣΕΩΝ ΜΟΝΑΔΙΚΗΣ ΕΠΙΛΟΓΗΣ» [σχ ΜΕ 1]. Σελίδα 85 από 152 Σχήμα ΜΕ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων Μοναδικής Επιλογής, που περιλαμβάνει: Σχήμα ΜΕ 2

86 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Σελίδα 86 από 152 Σωστή Απάντηση Εδώ Σχήμα ΜΕ 3 Η Λίστα Ερωτήσεων, όπως φαίνεται στο σχήμα ΜΕ 3, συγκροτείται από ομάδες δυνητικά επαναλαμβανόμενων πεδίων. Περιλαμβάνει αρχικά δύο ομάδες «ερώτηση και διαθέσιμες απαντήσεις», που αντιστοιχούν σε δύο ερωτήσεις με τις αντίστοιχες απαντήσεις τους. Κάθε ομάδα «ερώτηση και διαθέσιμες απαντήσεις» αντιστοιχεί σε μία ερώτηση με το σύνολο των διαθέσιμων απαντήσεών της. Η επικεφαλίδα κάθε ερώτησης είναι μία γραμμή εργαλείων που περιλαμβάνει: Το βέλος ανάπτυξης/σύμπτυξης, με το οποίο μπορούμε να αποκρύψουμε/εμφανίσουμε το περιεχόμενο της ερώτησης και των διαθέσιμων απαντήσεων. Την επιλογή διαγραφής

87 της συγκεκριμένης ερώτησης. Με την διαγραφή της ερώτησης διαγράφονται και όλες οι διαθέσιμες απαντήσεις που αντιστοιχούν στην ερώτηση αυτή. Το πεδίο «Ερώτηση» είναι πεδίο κειμένου και αφορά την ερώτηση που θέτουμε. Ακολουθούν τα πεδία των διαθέσιμων απαντήσεων τα οποία είναι και αυτά πεδία κειμένου. ΠΡΟΣΟΧΗ το πρώτο στη σειρά πεδίο από την ομάδα «Διαθέσιμες απαντήσεις» πάντοτε πρέπει να φιλοξενεί τη μοναδική σωστή απάντηση. Κατά τη διάρκεια προβολής εκτέλεσης του διαδραστικού στοιχείου οι απαντήσεις εμφανίζονται με τυχαία σειρά. Αν θέλουμε να προσθέσουμε διαθέσιμες απαντήσεις, τότε επιλέγουμε : Σελίδα 87 από 152 Αν θέλουμε να διαγράψουμε μία εκ των διαθέσιμων απαντήσεων, τότε πάνω και δεξιά του πεδίου της προς διαγραφή απάντησης επιλέγουμε (επιλογή διαγραφής), και μετά από σχετικό μήνυμα επιβεβαίωσης η διαθέσιμη απάντηση δεν είναι πλέον διαθέσιμη (διαγράφεται). Μπορούμε να προσθέσουμε νέα ερώτηση επιλέγοντας:

88 Τότε θα εμφανιστεί μία ομάδα πεδίων όπως αυτό που απεικονίζεται στο [σχ ΜΕ 3]. Εξ ορισμού υπάρχουν δύο διαθέσιμες απαντήσεις, αλλά όπως είδαμε πιο πάνω μπορούμε να προσθέσουμε και άλλες. Σελίδα 88 από 152 Σχήμα ΜΕ 4 Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις Παραμέτρων» [σχ ΜΕ 4] μπορούμε να ρυθμίσουμε τη χρονική και λειτουργική «συμπεριφορά» του διαδραστικού στοιχείου.

89 Σελίδα 89 από 152 Σχήμα ΜΕ 5 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΜΕ 5] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. ΠΡΟΣΟΧΗ! Στο πεδίο «Τίτλος οθόνης αποτελεσμάτων» το :numcorrect είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των σωστών απαντήσεων που δόθηκαν από τον εξεταζόμενο και το :maxscore επίσης είναι μεταβλητή της εφαρμογής και αφορά τον αριθμό των ερωτήσεων (π.χ αν κάποιος σε σύνολο 7 ερωτήσεων απαντήσει σωστά σε 4, τότε :numcorrect = 4 και :maxscore=7, ενώ το μήνυμα θα ήταν : «Είχες 4 από 7 σωστά».

90 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Σελίδα 90 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

91 Σελίδα 91 από ΕΞΩΤΕΡΙΚΟ ΠΕΡΙΕΧΟΜΕΝΟ Το διαδραστικό αυτό στοιχείο παρέχει τη δυνατότητα ενσωμάτωσης εξωτερικών διαδικτυακών πόρων που θα μπορούσαν να αποτελέσουν επιπρόσθετες πηγές πληροφόρησης για το διδακτικό στόχο για τον οποίο πρόκειται και που η αντιγραφή του στο συγκριμένο σενάριο θα ήταν επίπονη και τελικά ίσως άσκοπη. Η ενσωμάτωση στο περιβάλλον του σεναρίου θα μπορούσε να βοηθήσει το χρήστη να έχει όλη την απαραίτητη πληροφορία συγκεντρωμένη σε ένα «χώρο» παρά να περιηγείται σε ένα σύνολο εξωτερικών πόρων. Οι διαδικτυακοί αυτοί πόροι θα μπορούσαν να είναι: Χάρτες ή ιστότοποι. Κάθε πόρος όμως θα πρέπει να βρίσκεται στο διαδίκτυο (on line). Μειονέκτημα είναι ότι πρέπει να παρακολουθείται η διαθεσιμότητα και το περιεχόμενό του συνεχώς. Για να δημιουργήσουμε ενσωμάτωση εξωτερικού περιεχομένου από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΕΞΩΤΕΡΙΚΟ ΠΕΡΙΕΧΟΜΕΝΟ» [σχ ΕΠ 1],

92 Σελίδα 92 από 152 Σχήμα ΕΠ 1 Αμέσως μετά εμφανίζεται η φόρμα εισαγωγής περιλαμβάνει τα παρακάτω : εξωτερικού περιεχομένου που Σχήμα ΕΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις. Το Πεδίο «Πηγή» είναι πεδίο κειμένου και εκεί εισάγεται η ηλεκτρονική διεύθυνση (URL) του διαδικτυακού πόρου που πρόκειται να ενσωματωθεί. ΠΡΟΣΟΧΗ! Η διεύθυνση του

93 διαδικτυακού πόρου πρέπει να γραφεί σωστά. (Συνιστάται η χρήση αντιγραφής επικόλλησης για μεγαλύτερη σιγουριά). Σε περίπτωση που δε συμπληρωθεί το πεδίο Πηγή τότε κατά την προβολή εκτέλεση του διαδραστικού εργαλείου στο πλαίσιο ενσωμάτωσης θα δούμε το παρακάτω μήνυμα: Σελίδα 93 από 152 Σχήμα ΕΠ 3 Σε περίπτωση που συμπληρωθεί το πεδίο Πηγή αλλά η διεύθυνση του διαδικτυακού πόρου είναι εσφαλμένη τότε κατά την προβολή εκτέλεση του διαδραστικού εργαλείου στο πλαίσιο ενσωμάτωσης θα δούμε το παρακάτω μήνυμα: Σχήμα ΕΠ 4

94 Σελίδα 94 από 152 Κρίνεται σκόπιμο να σχεδιάζετε/αναπτύσσετε ΠΡΩΤΟΤΥΠΟ ΨΗΦΙΑΚΟ ΥΛΙΚΟ, δεδομένου ότι η χρήση Ψηφιακού Υλικού από εξωτερικές πηγές ενδεχομένως να δημιουργήσει μελλοντικές ελλείψεις στα Σενάρια που αναπτύσσετε, εφόσον το υλικό που χρησιμοποιείτε αποτελεί σύνδεσμο προς εξωτερικές πηγές και οι πηγές άντλησης του υλικού σας πάψουν να υφίστανται για οποιαδήποτε αιτία. Ορισμένες ιστοσελίδες χρησιμοποιούν την τεχνολογία "flash" για να προβάλουν πληροφορίες. Η συγκεκριμένη τεχνολογία πλέον θεωρείται ξεπερασμένη και μη συμβατή με τις νέες τεχνολογίες. Παρόλα αυτά, επιλέξαμε να την επιτρέψουμε στο εξωτερικό περιεχόμενο για να έχουν πρόσβαση οι εκπαιδευτικοί σε εκπαιδευτικά στοιχεία, όπως π.χ στα στοιχεία του Φωτόδεντρου. Επίσης, πρέπει να είστε ιδιαίτερα προσεκτικοί με το εξωτερικό περιεχόμενο διότι ορισμένες ιστοσελίδες ενδέχεται να χρειάζονται εγκατεστημένη έκδοση της Java, προκαλώντας εν γένει δυσκολίες στους χρήστες του σεναρίου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

95 Σελίδα 95 από ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ Πρόκειται για την ηλεκτρονική εκδοχή του παιχνιδιού όπου υπάρχει ένας αριθμός ζευγάρια κάρτες, όπου κάθε ζεύγος έχει από τη μία πλευρά του (εμπρός πλευρά) την ίδια απεικόνιση (ίδια εικόνα), η δε άλλη πλευρά (πίσω πλευρά) είναι ίδια για όλες τις κάρτες. Οι κάρτες είναι τοποθετημένες με τυχαίο τρόπο σε μία σειρά με θέα την πίσω πλευρά (την ίδια για όλες) και ο παίχτης καλείται γυρίζοντας δύο κάρτες (διαδοχικά) να βρει το ζευγάρι (την ίδια εικόνα). Αν δεν τα καταφέρει, οι κάρτες αυτές επανατοποθετούνται με θέα την πίσω πλευρά. Το παιχνίδι τελειώνει όταν αποκαλυφθούν όλα τα ζευγάρια καρτών με τη διαδικασία που μόλις περιγράφτηκε. Προκειμένου να υλοποιηθεί το παιχνίδι με τη χρήση του διαδραστικού στοιχείου «ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ» από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «ΠΑΙΓΝΙΔΙ ΜΝΗΜΗΣ» [σχήμα ΠΜ 1].

96 Σελίδα 96 από 152 Σχήμα ΠΜ 1 Αμέσως μετά εμφανίζεται η φόρμα εισαγωγής παιγνιδιού μνήμης που περιλαμβάνει τα εξής πεδία: Σχήμα ΠΜ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από το παιχνίδι. Το αναπτυσσόμενο πλαίσιο «Κάρτα» είναι ένα σύνθετο πεδίο που αντιστοιχεί σε ένα ζεύγος καρτών και αποτελείται:

97 Α) Από μία επιλογή μεταφόρτωσης αρχείων, όπου επιλέγοντας κάποιο αναδύεται το παράθυρο διαλόγου Φόρτωσης Αρχείου, από όπου μπορούμε να επιλέξουμε ένα αρχείο εικόνας που αντιπροσωπεύει ένα ζεύγος καρτών. Υπόψη ότι οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Σελίδα 97 από 152 Β) Την επιλογή «Δικαιώματα Χρήσης» όπου εμφανίζει τη σχετική φόρμα καταχώρισης των απαραίτητων πληροφοριών τεκμηρίωσης πνευματικών δικαιωμάτων για την εικόνα. Γ) Το πεδίο «Περιγραφή», που είναι πεδίο κειμένου και φιλοξενεί το μήνυμα που θα εμφανίζεται όταν βρεθεί το συγκεκριμένο ζεύγος καρτών. Με την επιλογή διαγραφής μπορούμε να διαγράψουμε μετά από σχετικό μήνυμα επιβεβαίωσης το σύνθετο πεδίο κάρτας, ενώ με την επιλογή προσθέτουμε ένα σύνθετο πεδίο κάρτας. Αν η μεταφόρτωση εικόνας είναι επιτυχής, θα παρατηρήσουμε ότι η φόρμα του [σχ ΠΜ 2] γίνεται

98 Σελίδα 98 από 152 Στη θέση της επιλογής Προσθήκη αρχείου εμφανίζεται η μικρογραφία που μεταφορτώσαμε Μπορούμε να διαγράψουμε την εικόνα και να μεταφορτώσουμε άλλη Σχήμα ΠΜ 3

99 Σελίδα 99 από 152 Σχήμα ΠΜ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ ΠΜ 4] μπορούμε να καθορίσουμε το περιεχόμενο των διαλογικών τμημάτων του διαδραστικού στοιχείου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

100 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 100 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

101 Σελίδα 101 από ΧΡΟΝΟΛΟΓΙΟ Το διαδραστικό στοιχείο «ΧΡΟΝΟΛΟΓΙΟ» μας δίνει τη δυνατότητα να παρουσιάσουμε σε εύληπτη διαγραμματική μορφή την εξέλιξη μιας σειράς γεγονότων σε συνάρτηση με το χρόνο παρέχοντας χρήσιμες συγκριτικές χρονικές πληροφορίες μεταξύ γεγονότων μιας περιόδου. Πως λειτουργεί Η ανατομία ενός στοιχείου χρονολογίου εμφανίζεται στο σχήμα «χ1» που ακολουθεί: 22

102 Σελίδα 102 από 152 Σχήμα χ1 Στον πίνακα Π(1) που ακολουθεί αναλύονται τα «συστατικά» μέρη του χρονολογίου: Θέση στο [σχ χ1] Πεδίο φόρμας συμπλήρωσης χρονολογίου περιγραφή 1 Τίτλος Ο τίτλος δραστηριότητας για το συγκεκριμένο διαδραστικό στοιχείο (υποχρεωτικό πεδίο) 2 Διευκρίνιση Σύντομο κείμενο διευκρινιστικό σχετικά με τη δραστηριότητα 3 - Πλοήγηση στο προηγούμενο γεγονός- περίοδο 4 - Πλοήγηση στο επόμενο γεγονός- περίοδο 5 Επικεφαλίδα ή Τίτλος Κείμενο που αφορά την επικεφαλίδα του χρονολογίου ή τον τίτλο της επόμενης χρονικής περιόδου - γεγονότος 6 Τίτλος Κείμενο που αφορά ή τον τίτλο της προηγούμενης χρονικής περιόδου - γεγονότος 7 Επικεφαλίδα ή Τίτλος Κείμενο που αφορά την επικεφαλίδα του χρονολογίου ή τον τίτλο της χρονικής περιόδου γεγονότος που είναι στο επίκεντρο 8 Κείμενο Κείμενο εμπλουτισμένης μορφής που αφορά το χρονολόγιο συνολικά ή κάθε χρονική περίοδο γεγονός που είναι στο επίκεντρο 9 Πολυμεσικό στοιχείο / στοιχείο Η μικρογραφία του διαδικτυακού πόρου 10 Πολυμεσικό στοιχείο/υπότιτλος Κείμενο που προσδιορίζει το πολυμεσικό στοιχείο 11 Πολυμεσικό στοιχείο/πηγή Κείμενο που προσδιορίζει την πηγή του πολυμεσικού στοιχείου

103 Σελίδα 103 από Ζώνες που αντιστοιχούν μία σε κάθε χρονική περίοδο - γεγονός του χρονολογίου 13 Συνοδευτική ετικέτα Πολύ σύντομο κείμενο που προσδιορίζει τη ζώνη της χρονικής περιόδου γεγονότος 14 - επαναφορά 15 Προεπιλεγμένο επίπεδο ζούμ μεγέθυνση 16 Προεπιλεγμένο επίπεδο ζούμ σμίκρυνση 17 - Οριζόντιος άξονας χρόνου (βαθμονομημένος) 18 - Κατακόρυφος άξονας ένδειξης χρονικής περιόδου-γεγονότος που είναι στο επίκεντρο 19 Τίτλος Κείμενο τίτλου χρονικής περιόδου - γεγονότος 20 Χρονική Περίοδος / Πολυμεσικό Στοιχείο /μικρή εικόνα Εικονίδιο διαστάσεων (32x32) αυστηρά 21 σχόλια κείμενο μετασχολιασμού σχετικά με τη δραστηριότητα 22 Χρονική Περίοδος /αρχική ημερομηνία Και Ημερομηνία ή έτος που αφορά τη χρονική περίοδο ή το γεγονός. Χρονική Περίοδος /τελική ημερομηνία Πίνακας Π1 Το χρονολόγιο χωρίζεται σε 2 νοητά μέρη που περικλείονται από τα πράσινα πλαίσια (Α) και (Β). [σχ. χ1] Το πλαίσιο (Α) απεικονίζει τις γενικές πληροφορίες του χρονολογίου (στην αρχή ) και κατά την πλοήγηση, τις πληροφορίες κάθε γεγονότος ή περιόδου που εξετάζεται. Όλες τις πληροφορίες δίνονται από φόρμες που θα αναλυθούν εκτενώς στη συνέχεια. Το πλαίσιο (Β) παρουσιάζει γραφικά, τα γεγονότα ή τις εξεταζόμενες περιόδους σε συνάρτηση με το χρόνο. Εδώ εμφανίζονται οι στοιχειώδεις πληροφορίες για το γεγονός - χρονική περίοδο γιατί δίνεται έμφαση στη χρονική συνάφεια και αλληλουχία των εξεταζόμενων γεγονότων - περιόδων.

104 Σελίδα 104 από 152 Πλοήγηση στο χρονολόγιο Η πλοήγηση μέσα στο χρονολόγιο γίνεται με δύο τρόπους : i) Σειριακά, επιλέγοντας με το ποντίκι («κλικ») τα βέλη πλοήγησης (3) ή (4) [σχ. χ1] για μεταφορά στο προηγούμενο ή επόμενο εξεταζόμενο γεγονός- περίοδο αντίστοιχα. ii) Με μη σειριακό τρόπο, επιλέγοντας με το ποντίκι («κλικ»), την ενεργό περιοχή του γεγονότος-περιόδου (19) [σχ. χ1]. Τότε ο χρονοδιάδρομος ολισθαίνει έτσι ώστε η αρχική ημερομηνία του γεγονότος - περιόδου να έρχεται στο επίκεντρο (18) [σχ. χ1] και τα γεγονότα περίοδοι που προηγούνται να βρίσκονται αριστερά του επικέντρου. Ταυτόχρονα στο πλαίσιο (Α) εμφανίζεται όλη η πληροφορία για το γεγονός- περίοδο που είναι στο επίκεντρο ενώ στις θέσεις (5) και (6) [σχ. χ1] εμφανίζεται ο τίτλος του προηγούμενου και επόμενου αντίστοιχα χρονικού γεγονότος-περιόδου. Αν στο επίκεντρο είναι το πρώτο γεγονός τότε στη θέση (5) [σχ. χ1] εμφανίζεται ο τίτλος του χρονολογίου ενώ αν στο επίκεντρο είναι το τελευταίο γεγονός τα (4) και (6) [σχ. χ1] εξαφανίζονται. reset (Επαναφορά) Όποιο γεγονός και να είναι στο επίκεντρο, είναι δυνατό το χρονολόγιο να ξαναέρθει στην αρχική θέση δηλαδή, στο επίκεντρο το πρώτο γεγονός και στο πλαίσιο (Α) οι γενικές πληροφορίες του χρονολογίου, επιλέγοντας με το ποντίκι («κλικ») το (14) [σχ. χ1]. Zoom in (Μεγέθυνση) Επιλέγοντας με το ποντίκι («κλικ») το (15) [σχ. χ1] αυξάνεται γραφικά η απόσταση μεταξύ των γεγονότων περιόδων που εξετάζονται, εστιάζοντας σε πιο συγκεκριμένες περιόδους- γεγονότα. Zoom out (Σμίκρυνση) Επιλέγοντας με το ποντίκι («κλικ») το (16) [σχ. χ1] μειώνεται γραφικά η απόσταση μεταξύ των γεγονότων περιόδων που εξετάζονται. δίνοντας εποπτική εικόνα του χρονικού γίγνεσθαι και εστιάζοντας στη χρονική σχέση των γεγονότων-περιόδων μέσα στο χρονολόγιο.

105 Σελίδα 105 από 152 Πως Συμπληρώνονται τα πεδία της φόρμας του χρονολογίου Από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω. Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδρατικά εργαλεία και επιλέγω από αυτά το «χρονολόγιο» [σχ χ2], Σχήμα χ2 Αμέσως εμφανίζεται η φόρμα εισαγωγής των απαραίτητων πεδίων για τη δημιουργία του χρονολογίου. Μία εικόνα της φόρμας φαίνεται στα σχήματα χ3, χ4, που ακολουθούν: Σχήμα χ3

106 Σελίδα 106 από 152 Ο τίτλος πρέπει να συμπληρωθεί υποχρεωτικά και περιλαμβάνει σύντομο κείμενο που αφορά τη δραστηριότητα στο σύνολό της. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (1) [σχ. χ1]. Η διευκρίνιση είναι προαιρετικό κείμενο και αφορά διευκρινίσεις ή υποδείξεις για το σύνολο της δραστηριότητας. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (2) [σχ. χ1]. Σχήμα χ4 Η Επικεφαλίδα περιλαμβάνει κείμενο και αποτελεί το γενικό τίτλο του χρονολογίου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (7) [σχ. χ1], αν είναι στην αρχή ή στη θέση (8) [σχ. χ1] αν στο επίκεντρο θέση (18) [σχ. χ1] είναι η πρώτη χρονική περίοδος-γεγονός. Το κείμενο είναι πεδίο κειμένου εμπλουτισμένης μορφής και κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (8) [σχ. χ1] μόνο κατά την έναρξη της περιήγησης ή την επαναφορά στην αρχή. Το προεπιλεγμένο επίπεδο ζουμ. Δέχεται μόνο αριθμούς θετικούς ή αρνητικούς. Ισοδυναμεί με το πάτημα της επιλογής μεγέθυνσης θέση (15) [σχ. χ1] όσες φορές ορίζεται στο πεδίο αν πρόκειται για θετικό αριθμό. Αν ο αριθμός είναι αρνητικός τότε ισοδυναμεί με το πάτημα σμίκρυνσης θέση (16) [σχ. χ1] όσες φορές ορίζεται στο πεδίο.

107 Πατώντας («κλικ») στο Πολυμεσικό Στοιχείο και συγκεκριμένα στο βέλος σύμπτυξης / ανάπτυξης αναπτύσσεται μία σειρά πεδίων όπου καταχωρούνται πληροφορίες απαραίτητες για την ενσωμάτωση κάποιου πολυμεσικού στοιχείου (χάρτης, δικτυακός τόπος, video κλπ) στο χρονολόγιο. Προϋπόθεση είναι το πολυμεσικό στοιχείο να είναι αναρτημένο στο διαδίκτυο. Σκοπός του είναι να παρέχει πρόσθετη πληροφόρηση σχετικά με το χρονολόγιο. Είναι προαιρετικό στοιχείο. Τα πεδία του πολυμεσικού στοιχείου του χρονολογίου εμφανίζονται στο σχήμα χ5 που ακολουθεί: Σελίδα 107 από 152 Σχήμα χ5 Στο πεδίο Στοιχείο εισάγεται η διεύθυνση (URL) του διαδικτυακού πόρου (χάρτης, δικτυακός τόπος, video κλπ) που θέλουμε να ενσωματωθεί ως επιπρόσθετη πηγή πληροφόρησης για το χρονολόγιο. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται ως μικρογραφία στη θέση (9) [σχ. χ1] στην αρχή της λειτουργίας και μετά από επαναφορά. Η μικρογραφία λειτουργεί ως εξωτερικός σύνδεσμος προς την επιπρόσθετη πηγή πληροφόρησης. Στο πεδίο Πνευματικά Δικαιώματα εισάγονται πληροφορίες που σχετίζονται με τα πνευματικά δικαιώματα του ενσωματωμένου πόρου (άδεια χρήσης κλπ) αν υπάρχουν. Το πεδίο είναι προαιρετικό. Στο πεδίο Υπότιτλος εισάγεται σύντομο κείμενο που προσδιορίζει το πολυμεσικό στοιχείο που ενσωματώθηκε στο χρονολόγιο. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (10) [σχ. χ1]. Πολύ σημαντικά τμήματα του χρονολογίου είναι τα επαναλαμβανόμενα τμήματα στην ενότητα «Χρονικές Περίοδοι» σχήμα χ6.

108 Σελίδα 108 από 152 Σχήμα χ6 Αριστερά της έκφρασης «Χρονική Περίοδος» υπάρχει βέλος ανάπτυξης/σύμπτυξης όπου επιλέγοντάς το (με το ποντίκι «κλίκ» πάνω του) αναπτύσσεται μία ομάδα πεδίων που είναι απαραίτητα για την περιγραφή του γεγονότος χρονική περίοδος και την ορθή ένταξή του στο χρονολόγιο. Μπορούμε να προσθέσουμε τμήμα χρονικής περιόδου επιλέγοντας : Θα πρέπει να έχουμε τόσα τμήματα «Χρονική Περίοδος» όσα και τα γεγονότα - χρονικές περίοδοι που θέλουμε να απεικονιστούν στο χρονολόγιο. Κάθε τμήμα «Χρονική Περίοδος» καταλαμβάνει και μία οριζόντια ζώνη στο χρονοδιάδρομο θέση (12) [σχ. χ1]. Επιλέγοντας (στα δεξιά του πλαισίου «Χρονική Περίοδος» διαγράφεται ύστερα από προειδοποιητικό μήνυμα το συγκεκριμένο γεγονός χρονική περίοδος. Στην ανάπτυξή του κάθε τμήμα «Χρονική Περίοδος» περιλαμβάνει τα πεδία που παρουσιάζονται στο σχήμα χ7 που ακολουθεί:

109 Σελίδα 109 από 152 Σχήμα χ7 Στο πεδίο Αρχική ημερομηνία εισάγονται από ένας ως τρείς αριθμοί χωρισμένοι με κόμμα «,» ο πρώτος αφορά το έτος, ο δεύτερος, το μήνα (1-12) και ο τρίτος την ημέρα (1-31). Είναι δυνατό να εισάγουμε μόνο Έτος, μήνα ή μόνο Έτος. Η αρχική ημερομηνία αντιπροσωπεύει την ημερομηνία του γεγονότος ή την ημερομηνία της χρονικής περιόδου. Στο χρονολόγιο το γεγονός εμφανίζεται ως πλαίσιο τοποθετημένο στη ζώνη που του αναλογεί και ξεκινά από το σημείο αρχικής ημερομηνίας. (πχ στο σχήμα χ1 η χρονική περίοδος με τίτλο «Γεγονός Β» έχει σαν αρχική ημερομηνία την τιμή 200). Το πεδίο Τελική ημερομηνία αφορά την ημερομηνία τέλους της χρονικής περιόδου που αναπαρίσταται. Αν πρόκειται για στιγμιαίο γεγονός τότε η τιμή του πεδίου αυτού μπορεί να είναι ίδια με το πεδίο Αρχική ημερομηνία. Ως προς τη μορφή του πεδίου ισχύουν όσα και στο προηγούμενο πεδίο.. Στο χρονολόγιο η διάρκεια της χρονικής περιόδου που μεσολαβεί από την αρχική ημερομηνία μέχρι την τελική εμφανίζεται με γαλάζια

110 υπογράμμιση του βαθμονομημένου χρονικού άξονα θέση (17) [σχ. χ1]. (πχ στο σχήμα χ1, για τη χρονική περίοδο με τίτλο «Γεγονός Β» το πεδίο τελική ημερομηνία έχει την τιμή 300, ενώ η χρονική περίοδος με τίτλο «Γεγονός Α» έχει Αρχική ημερομηνία και Τελική ημερομηνία την τιμή 100). Το πεδίο Τίτλος είναι πεδίο κειμένου και προσδιορίζει τον τίτλο του γεγονότος ή της χρονικής περιόδου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (7) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο και στη θέση (19) [σχ. χ1] στο χρονοδιάδρομο, στη ζώνη που της αναλογεί. Το πεδίο Κείμενο είναι πεδίο κειμένου εμπλουτισμένης μορφής και περιλαμβάνει λεπτομέρειες του γεγονότος ή της χρονικής περιόδου. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (8) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Στο χρoνοδιάδρομο δεν εμφανίζεται. Το πεδίο Συνοδευτική ετικέτα είναι πεδίο κειμένου και προσδιορίζει την ζώνη του γεγονότος ή της χρονικής περιόδου. Στο χρονοδιάδρομο. Πρέπει να είναι πολύ σύντομη περιγραφή. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (13) [σχ. χ1]. Αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο τότε εμφανίζεται και πάνω από τον τίτλο μαζί με τις ημερομηνίες αρχής τέλους. Το Πολυμεσικό Στοιχείο κάθε χρονικής περιόδου, είναι κάτι αντίστοιχο με αυτό που είδαμε πιο πάνω. Η διαφορά είναι ότι το προηγούμενο αφορά το σύνολο του χρονολογίου ενώ αυτό αφορά μόνο τη συγκεκριμένη χρονική περίοδο γεγονός. Σκοπός του είναι να παρέχει πρόσθετη πληροφόρηση σχετικά με μόνο τη συγκεκριμένη χρονική περίοδο γεγονός.. Είναι προαιρετικό στοιχείο. Τα πεδία του πολυμεσικού στοιχείου της χρονικής περιόδου εμφανίζονται στο σχήμα χ8 που ακολουθεί: Σελίδα 110 από 152

111 Σελίδα 111 από 152 Σχήμα χ8 Στο πεδίο Στοιχείο εισάγεται η διεύθυνση (URL) του διαδικτυακού πόρου (χάρτης, δικτυακός τόπος, video κλπ) που θέλουμε να ενσωματωθεί ως επιπρόσθετη πηγή πληροφόρησης για τη χρονική περίοδο - γεγονός. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται ως μικρογραφία στη θέση (9) [σχ. χ1] όταν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Η μικρογραφία λειτουργεί ως εξωτερικός σύνδεσμος προς την επιπρόσθετη πηγή πληροφόρησης. Επιλέγοντας μπορούμε να μεταφορτώσουμε μία μικρή εικόνα διαστάσεων 32x32 px (αυστηρά) και να εμφανίζεται κατά την εκτέλεση του διαδραστικού στοιχείου στη θέση (20) [σχ. χ1]. Είναι προαιρετικό πεδίο, ενώ οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Στο πεδίο Πηγή εισάγεται σύντομο κείμενο που πληροφορεί για την πηγή του πολυμεσικού στοιχείου που ενσωματώθηκε στη χρονική περίοδο -γεγονός. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (11) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο.

112 Στο πεδίο Υπότιτλος εισάγεται σύντομο κείμενο που προσδιορίζει το πολυμεσικό στοιχείο που στη χρονική περίοδο -γεγονός. Το πεδίο είναι προαιρετικό. Κατά την εκτέλεση του διαδραστικού στοιχείου εμφανίζεται στη θέση (10) [σχ. χ1] αν η συγκεκριμένη χρονική περίοδος είναι στο επίκεντρο. Σελίδα 112 από 152 Το πεδίο Σχόλιο κείμενο μετασχολιασμού και αφορά το σύνολο της δραστηριότητας. Είναι προαιρετικό. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο χρονολόγιο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

113 Σελίδα 113 από ΚΑΡΤΕΣ ΕΡΩΤΗΣΕΩΝ Το διαδραστικό στοιχείο «ΚΑΡΤΕΣ ΕΡΩΤΗΣΕΩΝ» παρουσιάζει πάνω σε ένα πλαίσιο (κάρτα) μία ερώτηση, κάτω από την οποία υπάρχει ένα κενό πλαίσιο υποδοχής κειμένου (πεδίο κειμένου), στο οποίο ο χρήστης εξεταζόμενος πληκτρολογεί την απάντηση που θεωρεί ότι αντιστοιχεί στη συγκεκριμένη ερώτηση. Ύστερα, επιλέγοντας έλεγχος απαντήσεων (κουμπί) που υπάρχει κάτω από το πλαίσιο για την απάντηση, ενημερώνεται για το αποτέλεσμα της απάντησής του (σωστή ή λάθος) και εμφανίζεται η σωστή απάντηση. Η κάρτα είναι δυνατό να περιλαμβάνει και εικόνα. Είναι δυνατό να δημιουργηθούν πολλές κάρτες στα πλαίσια λειτουργίας του διαδραστικού αυτού στοιχείου. Για να δημιουργήσουμε κάρτες ερωτήσεων από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Κάρτες Ερωτήσεων» [σχ ΚΕ 1].

114 Σελίδα 114 από 152 Σχήμα ΚΕ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης καρτών διαλόγου, που περιλαμβάνει:

115 Σελίδα 115 από 152 Σχήμα ΚΕ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για τις ερωτήσεις των καρτών, την πορεία διεξαγωγής της δραστηριότητας, κλπ.

116 Σελίδα 116 από 152 Σχήμα ΚΕ 3 Το πλαίσιο Κάρτες [σχ ΚΕ 3] συνιστά μία «συλλογή» καρτών. Στο αριστερό τμήμα εμφανίζονται υπό μορφή λίστας οι διαθέσιμες κάρτες. Στο δεξί τμήμα εμφανίζονται τα πεδία της τρέχουσας ενεργής κάρτας. Επιλέγοντας από το αριστερό τμήμα μία άλλη Κάρτα, τότε αυτή γίνεται η τρέχουσα ενεργή κάρτα. Στο πεδίο «Κείμενο» καταχωρείται η επιθυμητή ερώτηση. Στο πεδίο «Απάντηση» καταχωρείται η απάντηση.

117 Σελίδα 117 από 152 Προσθήκη νέας κάρτας γίνεται από την επιλογή Διαγραφή κάρτας γίνεται από την επιλογή διαγραφής η τρέχουσα ενεργή κάρτα.. Διαγράφεται πάντα Προαιρετικά, μπορούμε να εμφανίσουμε στην κάρτα μια εικόνα. Αυτό γίνεται στο πεδίο «Εικόνα» με την επιλογή μεταφόρτωσης αρχείων, όπου οι επιτρεπόμενοι τύποι αρχείων είναι jpg, png ή gif. Με επιλογή (τικ) στο παρακάτω Κατά την προβολή εκτέλεση του διαδραστικού στοιχείου όταν δεν έχει συμπληρώσει ο χρήστης-εξεταζόμενος την απάντηση και επιλέξει «έλεγχος απάντησης» δε γίνεται καμία ενέργεια, διότι η απουσία απάντησης θεωρείται εσφαλμένη απάντηση.

118 Σελίδα 118 από 152 Σχήμα ΚΕ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ. ΚΕ 4] μπορούμε να ρυθμίσουμε τα περιεχόμενα (κείμενα) των μηνυμάτων του διαδραστικού στοιχείου. Στο πεδίο «Κείμενο προόδου» είναι μεταβλητή που αντιστοιχεί στον αριθμό της τρέχουσας κάρτας που προβάλλεται και είναι επίσης μεταβλητή που αντιστοιχεί στον συνολικό αριθμό των διαθέσιμων καρτών διαλόγου του διαδραστικού στοιχείου.

119 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 119 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

120 Σελίδα 120 από ΚΑΡΤΕΣ ΔΙΑΛΟΓΟΥ Το διαδραστικό στοιχείο «ΚΑΡΤΕΣ ΔΙΑΛΟΓΟΥ» παρουσιάζει πάνω σε ένα πλαίσιο (κάρτα) μία ερώτηση κάτω από την οποία υπάρχει μια επιλογή (κουμπί) το οποίο όταν πατηθεί από το χρήστη, εμφανίζεται η απάντηση. Είναι δυνατό να δημιουργηθούν πολλές κάρτες στο πλαίσιο λειτουργίας του διαδραστικού αυτού στοιχείου. Για να δημιουργήσουμε κάρτες διαλόγου από το κατακόρυφο μενού αριστερά και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγω: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Κάρτες διαλόγου» [σχ ΚΔ 1].

121 Σελίδα 121 από 152 Σχήμα ΚΔ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας Ερωτήσεων συμπλήρωσης καρτών διαλόγου, που περιλαμβάνει: Σχήμα ΚΔ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τις ερωτήσεις συμπλήρωσης κειμένου. Η Περιγραφή εργασίας είναι πεδίο κειμένου εμπλουτισμένης μορφής και μπορεί να χρησιμοποιηθεί για να φιλοξενήσει πληροφορίες σχετικά με οδηγίες ή κάποιες επισημάνσεις για τις ερωτήσεις των καρτών, την πορεία διεξαγωγής της δραστηριότητας, κλπ.

122 Σελίδα 122 από 152 Αριστερό τμήμα Δεξί τμήμα Σχήμα ΚΔ 3 Το πλαίσιο Κάρτες Διαλόγου [σχ ΚΔ 3] συνιστά μία «συλλογή» καρτών. Στο αριστερό τμήμα εμφανίζονται υπό μορφή λίστας οι διαθέσιμες κάρτες. Στο δεξί τμήμα εμφανίζονται τα πεδία της τρέχουσας ενεργής κάρτας. Επιλέγοντας από το αριστερό τμήμα μία άλλη Κάρτα Διαλόγου, τότε αυτή γίνεται η τρέχουσα ενεργή κάρτα. Στο πεδίο «Κείμενο» καταχωρείται η επιθυμητή ερώτηση. Στο πεδίο «Απάντηση» καταχωρείται η απάντηση. Προσθήκη νέας κάρτας γίνεται από την επιλογή

123 Σελίδα 123 από 152 Διαγραφή κάρτας γίνεται από την επιλογή διαγραφής μία κάρτα θα πρέπει να είναι η τρέχουσα ενεργή.. Για να διαγραφεί Σχήμα ΚΔ 4 Στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» [σχ. ΚΔ 4] μπορούμε να ρυθμίσουμε τα περιεχόμενα (κείμενα) των μηνυμάτων του διαδραστικού στοιχείου. Στο πεδίο «Κείμενο προόδου» είναι μεταβλητή που αντιστοιχεί στον αριθμό της τρέχουσας κάρτας που προβάλλεται και είναι επίσης μεταβλητή που αντιστοιχεί στον συνολικό αριθμό των διαθέσιμων καρτών διαλόγου του διαδραστικού στοιχείου. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

124 Σελίδα 124 από 152 Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

125 Σελίδα 125 από ΔΙΑΔΡΑΣΤΙΚΟ ΒΙΝΤΕΟ Το διαδραστικό βίντεο είναι μία σύνθεση όπου κατά τη διάρκεια προβολής του είναι δυνατό να συμπροβάλλονται εκτελούνται, σε καθορισμένο χρονικό σημείο και για συγκεκριμένο χρονικό διάστημα, μια σειρά πρόσθετων διαδραστικών στοιχείων (π.χ ερωτήσεις αντιστοίχισης, συμπλήρωσης κειμένου, προβολής πληροφοριών), καθώς και καθορισμό ενεργών περιοχών που παρέχουν δυνατότητα ειδικών εργασιών. Για να δημιουργήσουμε διαδραστικό βίντεο από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω : Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Διαδραστικό βίντεο» [σχ ΔΒ 1]. Σχήμα ΔΒ 1

126 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικού βίντεο που περιλαμβάνει : Σελίδα 126 από 152 Σχήμα ΔΒ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από το βίντεο. Σχήμα ΔΒ 3 Στο τμήμα της φόρμας «Επεξεργασία Διαδραστικού Βίντεο» επιλέγω «1. Μεταφόρτωση Βίντεο [1/2]», (αν δεν είναι ήδη επιλεγμένο), [σχ ΔΒ 3] και κατόπιν «Αρχεία Βίντεο»

127 Σελίδα 127 από 152 Τότε εμφανίζεται αναδυόμενο πλαίσιο διαλόγου [σχ ΔΒ4] όπου μπορούμε να επιλέξουμε το βίντεο που θα μεταφορτωθεί. Σχήμα ΔΒ 4 Μπορούμε είτε να επιλέξουμε τοπικό αρχείο μέσω της επιλογής (1) [Επιλέξτε αρχείο για μεταφόρτωση] με επιτρεπτούς τύπους αρχείων mp4 ή webm, είτε να συμπληρώσουμε την ηλεκτρονική διεύθυνση (URL) στο πεδίο (2) που βρίσκεται το βίντεο, εφόσον είναι ήδη αναρτημένο στο διαδίκτυο. Κατόπιν επιλέγουμε εισαγωγή. Εάν υπάρχουν πνευματικά δικαιώματα συμπληρώνουμε το σχετικό πεδίο, [σχ ΔΒ 3]. Στο τμήμα της φόρμας «Επεξεργασία Διαδραστικού Βίντεο» επιλέγω «2. Προσθήκη Διαδραστικών Στοιχείων [2/2],[σχ ΔΒ 3] και εμφανίζεται το βίντεο που έχουμε επιλέξει και μια σειρά εργαλείων από πάνω του. [σχ ΔΒ5].

128 Σελίδα 128 από 152 Σχήμα ΔΒ 5 Μετακινούμε το δείκτη εξέλιξης αναπαραγωγής στο επιθυμητό χρονικό σημείο που θέλουμε εισαγωγή διαδραστικού στοιχείου. Από τη γραμμή διαδραστικών εργαλείων επιλέγουμε ένα και το σύρουμε στο σημείο που επιθυμούμε, μέσα στην περιοχή προβολής του βίντεο. Αμέσως εμφανίζεται ένα αναδυόμενο παράθυρο [σχ ΔΒ 6] που περιέχει ένα σύνολο πεδίων που αφορούν τη «συμπεριφορά» του επιλεγμένου διαδραστικού πεδίου πάνω στο βίντεο, και τη διαμόρφωσή του.

129 Σελίδα 129 από 152 Σχήμα ΔΒ 6 Το πεδίο χρόνος προβολής έχει δύο πεδία κειμένου. Στο πρώτο καταχωρείται η χρονική στιγμή που επιθυμούμε το επιλεγμένο διαδραστικό στοιχείο να εμφανιστεί (Στην περίπτωση του [σχ ΔΒ 6] το διαδραστικό στοιχείο θα εμφανιστεί σε 5 λεπτά και 30 δευτερόλεπτα από την έναρξη της αναπαραγωγής). Στο δεύτερο καταχωρείται η χρονική στιγμή που επιθυμούμε το επιλεγμένο διαδραστικό στοιχείο να εξαφανιστεί. (Στην περίπτωση του [σχ ΔΒ 6] το διαδραστικό στοιχείο θα εξαφανιστεί σε 6 λεπτά και 11 δευτερόλεπτα από την έναρξη της αναπαραγωγής). Αν είναι ενεργοποιημένο το πεδίο «Παύση αναπαραγωγής», τότε τη στιγμή εμφάνισης του διαδραστικού στοιχείου διακόπτεται η αναπαραγωγή του βίντεο (παύση).

130 Αν είναι ενεργοποιημένο το πεδίο «Προβολή σαν διαδραστικό κουμπί» τότε όταν έρθει ο χρόνος εμφάνισης παρουσιάζεται ένα κουμπί κατά τη διάρκεια αναπαραγωγής. Όταν πατηθεί, λαμβάνει χώρα η εκτέλεση της πρόσθετης δραστηριότητας. Το πεδίο «Τίτλος» είναι πεδίο κειμένου υποχρεωτικό και αφορά τη συγκεκριμένη πρόσθετη δραστηριότητα. Για τα πεδία που αφορούν το εκάστοτε διαδραστικό στοιχείο πχ (ερώτηση συμπλήρωσης κενών, ερώτηση μοναδικής επιλογής κλπ. Ανατρέξτε στο αντίστοιχο τμήμα του εγχειριδίου. Σελίδα 130 από 152 ΔΙΑΓΡΑΦΗ ΔΙΑΔΡΑΣΤΙΚΟΥ ΣΤΟΙΧΕΙΟΥ (ΕΝΤΟΣ ΤΟΥ ΔΕ ΔΙΑΔΡ. ΒΙΝΤΕΟ) 1. Στην οθόνη επεξεργασίας του διαδραστικού βίντεο πηγαίνετε στο καρέ του βίντεο που έχετε τοποθετήσει το διαδραστικό στοιχείο. 2. Έπειτα κάνετε διπλό κλικ πάνω στον τίτλο του στοιχείου και εμφανίζεται παράθυρο επεξεργασίας του διαδραστικού στοιχείου. 3. Εκεί πατάτε το κόκκινο κουμπί <<Αφαίρεση>> και στο παράθυρο επιβεβαίωσης πατάτε <<ΟΚ>>. 4. Μην ξεχάσετε να πατήσετε το κουμπί <<Αποθήκευση>> για να αποθηκευτούν οι αλλαγές που κάνατε. Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος. Τέλος, για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο, επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

131 Σελίδα 131 από ΔΙΑΔΡΑΣΤΙΚΕΣ ΕΝΕΡΓΕΣ ΠΕΡΙΟΧΕΣ Το διαδραστικό στοιχείο «Διαδραστικές Ενεργές Περιοχές» παρέχει τη δυνατότητα δημιουργίας διαδραστικών σημείων περιοχών πάνω σε ένα στατικό στοιχείο όπως πχ μια εικόνα. Ορίζονται δηλαδή ενεργές- «ζωντανές» περιοχές όπου ο χρήστης εξεταζόμενος έχει τη δυνατότητα να «ενεργεί» πάνω σ αυτές (πχ σύρσιμο και απόθεση, drag n drop). Για να δημιουργήσουμε Διαδραστικές Ενεργές Περιοχές από το κατακόρυφο μενού αριστερά και αφού έχει επιλεχτεί η συγκεκριμένη φάση του σεναρίου επιλέγω :

132 Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία και επιλέγω από αυτά το «Διαδραστικές Ενεργές Περιοχές» [σχ ΔΕΠ 1]. Σελίδα 132 από 152 Σχήμα ΔΕΠ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικών ενεργών περιοχών που περιλαμβάνει: Σχήμα ΔΕΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά.

133 Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει),αμέσως κάτω από τον τίτλο και πάνω από την εικόνα με τις διαδραστικές περιοχές. Ακολουθεί η ομάδα πεδίων που αφορά τη μεταφόρτωση της εικόνας πάνω στην οποία θα ορισθούν οι ενεργές περιοχές καθώς και οι λειτουργίες τους [σχ. ΔΕΠ 3]. Σελίδα 133 από 152 Σχήμα ΔΕΠ 3 Επιλέγουμε την καρτέλα βημάτων (αν δεν είναι ήδη επιλεγμένη) «1. Μέγεθος καμβά και επιλογές φόντου» και κατόπιν κάνουμε κλικ στο κουμπί (Προσθήκη Αρχείου), όπου εμφανίζεται το αναδυόμενο παράθυρο επιλογής εικόνας για μεταφόρτωση. Η εικόνα λειτουργεί ως υπόβαθρο(background). Αφού επιλέξουμε την εικόνα και μεταφορτωθεί (υπόψη ότι οι υποστηριζόμενοι τύποι αρχείων είναι jpg, png ή gif ), ύστερα στα πεδία <<Μέγεθος καμβά κύριας ενεργής περιοχής>> [σχ ΔΕΠ 3] καθορίζουμε τις διαστάσεις της περιοχής όπως θα φαίνεται στην καρτέλα «2. Ορισμός υποπεριοχών και εισαγωγή κειμένου/εικόνας» και θα περιέχει τα διαδραστικά μέρη του στοιχείου (Αυτές οι διαστάσεις αφορούν μόνο την οθόνη επεξεργασίας. Στην προβολή του διαδρ. στοιχείου στο σενάριο η εικόνα θα πάρει τις διαστάσεις του σεναρίου). Το πρώτο πεδίο αφορά το πλάτος (σε pixel) και το δεύτερο πεδίο αφορά το ύψος (σε pixel). Το πεδίο <<Αδιαφάνεια φόντου των κινούμενων στοιχείων (κείμενα και εικόνες)>> [σχ ΔΕΠ 3] καθορίζει την αδιαφάνεια του γκρί φόντου που αυτόματα τοποθετείται πίσω από τα κινούμενα στοιχεία (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια). Όταν αυτή η επιλογή συμπληρωθεί τότε εφαρμόζεται σε όλα

134 τα κινούμενα στοιχεία (κείμενα ή και εικόνες) και η επιλογή αδιαφάνειας που υπάρχει σε κάθε κινούμενο στοιχείο παραβλέπεται. Για παράδειγμα θα υποθέσουμε ότι σε μια εικόνα με εργαλεία θέλουμε οι χρήστες εξεταζόμενοι να «αναγνωρίσουν» αυτά τα εργαλεία. Για το σκοπό αυτό θα χρησιμοποιήσουμε μία εικόνα που απεικονίζει αυτά τα εργαλεία και θα ορίσουμε 4 σταθερές υποπεριοχές απόθεσης πάνω στα εργαλεία αυτά όπου θα λειτουργούν ως περιέκτες (containers) μέσα στις οποίες θα φιλοξενηθούν οι απαντήσεις που είναι κινούμενα στοιχεία (2 κείμενα και 2 εικόνες). Κατά το χρόνο εκτέλεσης η εμφάνιση του στοιχείου «Διαδραστικές ενεργές περιοχές θα είναι: [σχ ΔΕΠ 4] Σελίδα 134 από 152 Σχήμα ΔΕΠ 4 Για να καθορίσουμε ενεργά τμήματα (υποπεριοχές απόθεσης και κινούμενα στοιχεία) επιλέγουμε από τις καρτέλες βημάτων [σχ ΔΕΠ 3] «2. Ορισμός υποπεριοχών και εισαγωγή κειμένου/εικόνας», και θα προκύψουν τα πεδία καθορισμού ενεργών τμημάτων.

135 Σελίδα 135 από 152 Σχήμα ΔΕΠ 5 Από τη γραμμή εργαλείων τοποθέτησης ενεργών τμημάτων [σχ ΔΕΠ 5] πρώτα επιλέγουμε [εισαγωγή υποπεριοχής απόθεσης] και το σέρνουμε (drag n drop) στο σημείο που επιθυμούμε μέσα στην ενεργό περιοχή. Αμέσως εμφανίζονται τα απαραίτητα πεδία που αφορούν κάθε ενεργή περιοχή απόθεσης [σχ ΔΕΠ 6].

136 Σελίδα 136 από 152 Σχήμα ΔΕΠ 6 (Η παραπάνω εικόνα αφορά μια υποπεριοχή απόθεσης του παραδείγματος με τα εργαλεία αφού έχουν εισαχθεί τα κινούμενα στοιχεία κειμένου και εικόνας). Το πεδίο τίτλος είναι υποχρεωτικό και ορίζει τον τίτλο του συγκεκριμένου ενεργού σταθερού τμήματος υποπεριοχή απόθεσης. Σε περίπτωση που δε θέλουμε να εμφανίζεται ο τίτλος κατά το χρόνο προβολής-εκτέλεσης δεν «τσεκάρουμε» το πεδίο «Προβολή τίτλου». Μπορούμε επίσης να καθορίσουμε το βαθμό αδιαφάνειας για το συγκεκριμένο ενεργό σταθερό τμήμα υποπεριοχή απόθεσης (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια), και προαιρετικά να προσθέσουμε κάποιο βοηθητικό κείμενο. Επιλέγοντας αποθηκεύονται οι αλλαγές για το συγκεκριμένο ενεργό σταθερό τμήμα υποπεριοχή απόθεσης και επιλέγοντας διαγράφεται μετά από μήνυμα επιβεβαίωσης. Είναι δυνατό να προστεθούν περισσότερα από ένα ενεργά σταθερά τμήματα υποπεριοχές απόθεσης.

137 Αφού εισάγουμε όσα ενεργά σταθερά τμήματα υποπεριοχές απόθεσης επιθυμούμε θα έχουμε μια εικόνα [σχ ΔΕΠ 7] (για το παράδειγμα με τα εργαλεία που αναφέρθηκε παραπάνω) Σελίδα 137 από 152 Σχήμα ΔΕΠ 7 Εδώ έχουμε ορίσει 4 ενεργά σταθερά τμήματα - υποπεριοχές απόθεσης και τα ονομάσαμε ΠΕΡΙΟΧΗ ΤΣΕΚΟΥΡΙ, ΠΕΡΙΟΧΗ ΚΑΤΣΑΒΙΔΙ, ΠΕΡΙΟΧΗ ΓΑΛΛΙΚΟ ΚΛΕΙΔΙ, ΠΕΡΙΟΧΗ ΣΦΥΡΙ. Για να ορίσουμε τα ενεργά κινούμενα τμήματα, από τη γραμμή εργαλείων τοποθέτησης ενεργών τμημάτων [σχ ΔΕΠ 5] επιλέγουμε για κινούμενο τμήμα κειμένου ή για κινούμενο τμήμα εικόνας και το σέρνουμε (drag n drop) στο σημείο που επιθυμούμε μέσα στην ενεργό περιοχή. Αν πρόκειται για κείμενο θα

138 εμφανιστούν τα απαραίτητα πεδία για τον προσδιορισμό κάθε ενεργού κινούμενου τμήματος. [σχ ΔΕΠ 8]. Σελίδα 138 από 152 Σχήμα ΔΕΠ 8 (Η παραπάνω εικόνα αφορά ένα ενεργό κινούμενο τμήματος του παραδείγματος με τα εργαλεία). Στο πεδίο «Κείμενο που θα φαίνεται» καταχωρείτε το κείμενο που θα εμφανίζει το ενεργό κινούμενο τμήμα. Η ομάδα πεδίων «Επιλέξτε σε ποιες υποπεριοχές απόθεσης θα μπορεί να τοποθετείται το κινούμενο στοιχείο» εμφανίζουν τους τίτλους των σταθερών ενεργών τμημάτων υποπεριοχές απόθεσης που ορίσαμε πριν. Όσους από αυτούς επιλέξουμε (τσεκάρουμε), σημαίνει ότι το τρέχων ενεργό κινούμενο τμήμα θα μπορεί να φιλοξενηθεί ως περιεχόμενο από τον αντίστοιχο περιέκτη (Την σωστή αντιστοίχιση περιοχής απόθεσης με κινούμενο στοιχείο την ορίζουμε αργότερα). Μπορούμε επίσης να καθορίσουμε το βαθμό αδιαφάνειας για το συγκεκριμένο κινούμενο στοιχείο (με 0 καθόλου αδιαφάνεια, με 100 πλήρης αδιαφάνεια). Αποθηκεύουμε επιλέγοντας και διαγράφουμε επιλέγοντας μετά από σχετικό μήνυμα επιβεβαίωσης. Μπορούμε φυσικά να ορίσουμε περισσότερα από ένα ενεργά κινούμενα τμήματα.

139 Μένει τώρα να ορίσουμε τις «σωστές» απαντήσεις δηλαδή ποιο ζεύγος περιέκτη υποπεριοχή απόθεσης και κινούμενου στοιχείου θεωρείται σωστό. Αυτό γίνεται αφού έχουν ορισθεί τα ενεργά κινούμενα στοιχεία και έχουν καθοριστεί ποια από αυτά θα αντιστοιχούν σε ποιους περιέκτες υποπεριοχές απόθεσης όπως μόλις περιγράφηκε. Για να ορίσουμε σωστές απαντήσεις επιλέγουμε κάθε σταθερό ενεργό τμήμα- περιέκτη - υποπεριοχή απόθεσης κάνοντας διπλό «κλικ» πάνω του όπου εμφανίζονται τα πεδία του συγκεκριμένου σταθερού ενεργού τμήματος περιέκτηυποπεριοχή απόθεσης. Κάτω από το πεδίο <<Επιλέξτε τα σωστά στοιχεία που αντιστοιχούν στην τρέχουσα περιοχή απόθεσης.>> υπάρχει μία λίστα που παρουσιάζει τα ενεργά κινούμενα στοιχεία (που ορίσαμε πριν ότι μπορούν να φιλοξενούνται ως περιεχόμενα του συγκεκριμένου περιέκτη- υποπεριοχή απόθεσης) και όσα από αυτά επιλέγονται (τσεκάρονται) θεωρούνται ως σωστές απαντήσεις κατά την προβολή εκτέλεση του ψηφιακού σεναρίου. [σχ ΔΕΠ 6] Δεν παραλείπουμε μετά από κάθε μεταβολή να αποθηκεύουμε επιλέγοντας. Οποιαδήποτε στιγμή θέλουμε να επεξεργαστούμε ένα κινούμενο στοιχείο ή μια υποπεριοχή απόθεσης απλά κάνουμε διπλό κλικ πάνω του. Στο αναπτυσσόμενο πλαίσιο «Ρυθμίσεις» επιλέγουμε (τσεκάροντας) τις επιλογές που σχετίζονται με τον τρόπο λειτουργίας του διαδραστικού στοιχείου και στο αναπτυσσόμενο πλαίσιο «Ιδιαίτερες Ρυθμίσεις και Δυναμικά Κείμενα» καθορίζονται τα διαλογικά κείμενα μηνύματα που θα εμφανίζονται κατά τη διάρκεια προβολής εκτέλεσης του ψηφιακού σεναρίου. Σελίδα 139 από 152 Είναι δυνατό να προσθέσουμε σχόλια. Αυτό μπορεί να γίνει συμπληρώνοντας το αντίστοιχο πεδίο της φόρμας. Τα σχόλια είναι προαιρετικά και εμφανίζονται πάντοτε στο κάτω μέρος.

140 Τέλος για να αποθηκευτούν τα πεδία που έχουμε συμπληρώσει και γενικά οι αλλαγές που έχουν γίνει στο διαδραστικό εργαλείο επιλέγουμε κάνοντας «κλικ» με το ποντίκι το πλήκτρο Σελίδα 140 από 152 Προσοχή!!! Αν δεν πατήσουμε αποθήκευση τα δεδομένα και γενικά οι αλλαγές ΔΕΝ ΑΠΟΘΗΚΕΥΟΝΤΑΙ και χάνονται.

141 Σελίδα 141 από ΔΙΑΔΡΑΣΤΙΚΗ ΠΑΡΟΥΣΙΑΣΗ Οι Διαδραστικές παρουσιάσεις είναι μια συλλογή «διαφανειών», τα περιεχόμενα των οποίων είναι τα διάφορα διαδραστικά στοιχεία που υποστηρίζει η εφαρμογή. Για να δημιουργήσουμε διαδραστικές παρουσιάσεις από το κατακόρυφο μενού αριστερά, και αφού έχει επιλεγεί η συγκεκριμένη φάση του σεναρίου, επιλέγουμε: Εμφανίζεται αμέσως αναδυόμενο παράθυρο με τα διαθέσιμα διαδραστικά εργαλεία κι επιλέγουμε από αυτά το «Διαδραστικές Παρουσιάσεις» [σχ ΔΠ 1].

142 Σελίδα 142 από 152 Σχήμα ΔΠ 1 Αμέσως μετά εμφανίζεται η φόρμα δημιουργίας διαδραστικών παρουσιάσεων που περιλαμβάνει: Σχήμα ΔΠ 2 Ο Τίτλος είναι πεδίο κειμένου και αφορά το σύνολο της συγκεκριμένης δραστηριότητας. Πρέπει να συμπληρωθεί υποχρεωτικά. Η Διευκρίνιση είναι πεδίο κειμένου προαιρετικό. Το περιεχόμενό της εμφανίζεται (αν υπάρχει), αμέσως κάτω από τον τίτλο και πάνω από τη διαδραστική παρουσίαση.

143 Σελίδα 143 από 152 Σχήμα ΔΠ 3 Από τη γραμμή διαδραστικών εργαλείων [σχ ΔΠ 3], επιλέγουμε διαδραστικά στοιχεία και τα σύρουμε στο σημείο που επιθυμούμε, μέσα στην περιοχή της διαφάνειας. Σε περίπτωση που εισάγουμε κάποιο διαδραστικό στοιχείο ερώτησης, τότε προστίθεται αυτόματα στο τέλος μια διαφάνεια επιπλέον η οποία περιέχει την προβολή των απαντήσεων.

144 Σελίδα 144 από 152 Η επιλογή [σχ ΔΠ 3] της γραμμής διαδραστικών εργαλείων διαχειρίζεται τις λέξεις κλειδιά της παρουσίασης. Επιλέγοντάς την, εμφανίζεται πτυσσόμενο μενού όπως φαίνεται στο [σχ ΔΠ 4] Σχήμα ΔΠ 4

145 Σελίδα 145 από 152 Επιλέγοντας (τικ) στο «Λίστα λέξεων-κλειδιά», εμφανίζεται στο κάτω αριστερό άκρο της διαφάνειας η επιλογή διαχείρισης λέξεων κλειδιών [σχ ΔΠ 5] Σχήμα ΔΠ 5 Πατώντας πάνω της «κλικ», εμφανίζεται η λίστα λέξεων κλειδιών και η επιλογή προσθήκης νέας. Η κάθε λέξη κλειδί λειτουργεί ως «σελιδοδείκτης» για τις διαφάνειες (επιλέγοντάς την, μεταφερόμαστε στη συγκεκριμένη διαφάνεια). Κάθε διαφάνεια μπορεί να έχει περισσότερες από μία λέξεις κλειδιά. Εάν θελήσουμε να επεξεργαστούμε κάποιο διαδραστικό στοιχείο το οποίο έχουμε ήδη εισάγει, τότε θα πρέπει να το επιλέξουμε και να κάνουμε πάνω του διπλό κλικ, ώστε να μας ανοίξει το αντίστοιχο μενού επεξεργασίας. Πληροφορίες σχετικά με τη χρήση των εκάστοτε διαδραστικών εργαλείων μπορείτε να βρείτε στα αντίστοιχα τμήματα του Συνολικού Εγχειριδίου Χρήσης της Πλατφόρμας, καθόσον η λειτουργικότητα παραμένει κοινή είτε το ΔΕ χρησιμοποιείται άμεσα (ως ξεχωριστό ΔΕ) είτε έμμεσα (μέσω του ΔΕ «Διαδραστική Παρουσίαση»).

146 Σελίδα 146 από 152 Για παράδειγμα ως προς την εισαγωγή εικόνων, ισχύει ό, τι αναφέρεται στο αντίστοιχο ΔΕ (ΔΕ «Εικόνα»). Επιλέγοντας το κουμπί από το πάνω μενού, ανοίγει παράθυρο υπό τον τίτλο «Επεξεργασία Εικόνας» με τις γνωστές επιλογές του ΔΕ «Εικόνα». Επιπλέον, εμφανίζονται οι ακόλουθες καινούριες επιλογές, όπως εμφανίζονται ακολούθως [σχ ΔΠ 6]. Οι εν λόγω επιλογές εμφανίζονται για το σύνολο των διαδραστικών στοιχείων που προσφέρει το ΔΕ «Διαδραστική Παρουσίαση». Σχήμα ΔΠ 6 Το πεδίο Σχόλια περιλαμβάνει σχόλια τα οποία εμφανίζονται όταν γίνει προβολή των απαντήσεων, με αντίστοιχη επιλογή για μόνιμη προβολή των σχολίων. Εάν αυτή τσεκαριστεί, τότε στην προεπισκόπηση εμφανίζεται ένα ερωτηματικό μέρος της εικόνας [σχ ΔΠ 7], στο κάτω δεξιά

147 Σελίδα 147 από 152 Σχήμα ΔΠ 7 το οποίο όταν πατηθεί ανοίγει υπομενού με το σχόλιο που εισαγάγαμε [σχ ΔΠ 8]. Σχήμα ΔΠ 8 Το πεδίο «Διαφάνεια» λαμβάνει τιμές πολλαπλάσιες του 5 (έγκυρες τιμές: 0, 5, 10,15, κ.ο.κ.). Η χρηστικότητα του πεδίου αυτού είναι να διαχειρίζεται το επίπεδο εμφάνισης πλήθους εικόνων ή άλλων διαδραστικών στοιχείων στην ίδια σελίδα της διαδραστικής παρουσίασης (φόντο). Π.χ, εάν θέλουμε να δημιουργήσουμε το ακόλουθο αποτέλεσμα [σχ ΔΠ 9]

148 Σελίδα 148 από 152 Σχήμα ΔΠ 9 θα πρέπει να ορίσουμε στην εικόνα με τίτλο «ΦΟΝΤΟ #01» το χαμηλότερο αριθμό Διαφάνειας (έστω 5), στην εικόνα με τίτλο «ΦΟΝΤΟ #02» μεγαλύτερο αριθμό Διαφάνειας (έστω 10) και τέλος στην εικόνα που θέλουμε να βρίσκεται στο πάνω-πάνω επίπεδο το μέγιστο αριθμό Διαφάνειας (έστω 15). [ΣΗΜΕΙΩΣΗ: Προτείνεται το ανέβασμα των εικόνων να γίνεται βηματικά, δηλαδή κάθε φορά που ανεβαίνει (upload) μια εικόνα να πατιέται το κουμπί

Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου

Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου Εγχειρίδιο Λειτουργίας Τράπεζας Χρόνου Bee Group Α.Ε. [Type the company name] [Pick the date] Εγχειρίδιο λειτουργίας Τράπεζας Χρόνου 2 ΠΕΡΙΕΧΟΜΕΝΑ 1. Αρχική Σελίδα... 3 2. Δημιουργία Λογαριασμού... 3 3.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Field Service Management ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ


Διαβάστε περισσότερα

Σχεδίαση και Ανάλυση Τοπικών Δικτύων Υπολογιστών

Σχεδίαση και Ανάλυση Τοπικών Δικτύων Υπολογιστών Σχεδίαση και Ανάλυση Τοπικών Δικτύων Υπολογιστών Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΑΦΡΟΔΙΤΗ ΜΙΧΑΗΛΙΔΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Από την απλή στη σύνθετη και πολλαπλή δομή επιλογής

Από την απλή στη σύνθετη και πολλαπλή δομή επιλογής Από την απλή στη σύνθετη και πολλαπλή δομή επιλογής Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΑΦΡΟΔΙΤΗ ΜΙΧΑΗΛΙΔΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ

Διαβάστε περισσότερα

«Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά

«Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά ΙΝΣΤΙΤΟΥΤΟ ΕΠΕΞΕΡΓΑΣΙΑΣ ΤΟΥ ΛΟΓΟΥ / Ε. Κ. «ΑΘΗΝΑ» «Αερόστατο» Διαδικτυακή πύλη ψυχαγωγίας και μάθησης για μικρά παιδιά Οδηγίες: Δημιουργία ασκήσεων 2014 Περιεχόμενα 1. Εισαγωγή... 3 2. Δημιουργία ασκήσεων...

Διαβάστε περισσότερα

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 Οδηγίες Χρήσης Πίνακας Περιεχομένων 1. Αρχική οθόνη... 3 2. Αρχική Οθόνη Πιστοποιημένου Χρήστη... 4 2.1. Οριστικοποίηση της Περιουσιακής Εικόνας... 5 2.2. Καρτέλες

Διαβάστε περισσότερα

Εγχειρίδιο διαχείρισης χρηστών και λιστών διανομής για τον Υπεύθυνο Φορέα του Δικτύου "Σύζευξις" -1-

Εγχειρίδιο διαχείρισης χρηστών και λιστών διανομής για τον Υπεύθυνο Φορέα του Δικτύου Σύζευξις -1- -1- 1 Διαχείριση Χρηστών...3 1.1 Υπηρεσίες...5 1.1.1 Δημιουργία νέου χρήστη...6 1.1.2 Αναζήτηση χρήστη...7 1.1.2 Επεξεργασία στοιχείων χρήστη...8 1.1.3 Δημιουργία /Επεξεργασία mailbox plan...10 1.1.4 Ενεργοποίηση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Tα εργαλεία του εργαστηρίου της Τεχνολογίας

Tα εργαλεία του εργαστηρίου της Τεχνολογίας Tα εργαλεία του εργαστηρίου της Τεχνολογίας Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Τεχνολογία Δημιουργός: Λάμπρος Ντάλης ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ

Διαβάστε περισσότερα

Σενάριο Χρήσης myschool

Σενάριο Χρήσης myschool Σενάριο Χρήσης ΦΟΡΕΙΣ Επιβεβαίωση των Στοιχείων του Φορέα Αρχικά, θα κληθείτε να ελέγξετε την ορθότητα των στοιχείων του Φορέα σας. Επιλέγοντας την καρτέλα «Φορείς», από το μενού που βρίσκεται στο πάνω

Διαβάστε περισσότερα

Η Ελληνική Μετανάστευση κατά τον 20ο αιώνα

Η Ελληνική Μετανάστευση κατά τον 20ο αιώνα Η Ελληνική Μετανάστευση κατά τον 20ο αιώνα Επαρκές Σενάριο Γνωστικό αντικείμενο: Διαθεματικό Δημιουργός: ΜΑΡΙΑ ΔΗΜΟΥΛΕΑ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών. Κέντρο Επαγγελματικής Κατάρτισης. Σταδίου 5, 10562 Σύνταγμα

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών. Κέντρο Επαγγελματικής Κατάρτισης. Σταδίου 5, 10562 Σύνταγμα Σύστημα Διαχείρισης Εκπαίδευσης Εγχειρίδιο Χρήσης Εκπαιδευόμενου Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών Κέντρο Επαγγελματικής Κατάρτισης Σταδίου 5, 10562 Σύνταγμα τηλ.: 210-3689381, 210-3689354 fax:

Διαβάστε περισσότερα

Εφαρμογές Υπηρεσιών Νέφους

Εφαρμογές Υπηρεσιών Νέφους Εφαρμογές Υπηρεσιών Νέφους Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΑΦΡΟΔΙΤΗ ΜΙΧΑΗΛΙΔΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα


ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΔΙΑΧΕΙΡΙΣΗ ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΓΙΑΝΝΕΝΑ & ΣΥΓΧΡΟΝΗ ΔΗΜΙΟΥΡΓΙΑ ΔΙΑΧΕΙΡΙΣΗ Περιγραφή και επεξήγηση της χρήσης του χώρου διαχείρισης της ιστοσελίδας για τους καλλιτέχνες 1 Περιεχόμενα Είσοδος στο χώρο διαχείρισης...3 Επεξεργασία της σελίδας

Διαβάστε περισσότερα

Μουσικό ταξίδι στην Ελλάδα

Μουσικό ταξίδι στην Ελλάδα Μουσικό ταξίδι στην Ελλάδα Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική Δημιουργός: ΓΕΩΡΓΙΟΣ ΣΠΥΡΟΠΟΥΛΟΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ

Διαβάστε περισσότερα

Δραστηριότητα 9 Δημιουργία και διαχείριση blog μέσω του Blogger. Δημιουργία ιστολογίου

Δραστηριότητα 9 Δημιουργία και διαχείριση blog μέσω του Blogger. Δημιουργία ιστολογίου Δραστηριότητα 9 Δημιουργία και διαχείριση blog μέσω του Blogger Δημιουργία ιστολογίου 1. Ανοίξτε το φυλλομετρητή Google Chrome, πληκτρολογήστε στη γραμμή διευθύνσεων τη διεύθυνση www.blogger.com και πατήστε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεσοκάθετος ευθυγράμμου τμήματος

Μεσοκάθετος ευθυγράμμου τμήματος Μεσοκάθετος ευθυγράμμου τμήματος Επαρκές Σενάριο Γνωστικό αντικείμενο: Μαθηματικά (ΔΕ) Δημιουργός: ΑΛΕΞΑΝΔΡΑ ΠΟΥΛΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα

Κρατική παρέμβαση στην αγορά - Επιβολή i) ανώτατων τιμών και ii) κατώτατων τιμών

Κρατική παρέμβαση στην αγορά - Επιβολή i) ανώτατων τιμών και ii) κατώτατων τιμών Κρατική παρέμβαση στην αγορά - Επιβολή i) ανώτατων τιμών και ii) κατώτατων τιμών Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Κοινωνικές - Πολιτικές επιστήμες Δημιουργός: Γιώργος Παπαβασιλείου ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ

Διαβάστε περισσότερα

Οδηγίες Χρήσης Εφαρµογής Καταχώρησης Αποδείξεων µε απλά βήµατα

Οδηγίες Χρήσης Εφαρµογής Καταχώρησης Αποδείξεων µε απλά βήµατα Οδηγίες Χρήσης Εφαρµογής Καταχώρησης Αποδείξεων µε απλά βήµατα Βήµα 1 Έναρξη Λειτουργίας Εφαρµογής Μετά την ολοκλήρωση της εγκατάστασης έχει την δυνατότητα ο χρήστης µέσα από ένα ευέλικτο υποσύστηµα να

Διαβάστε περισσότερα

Περιοχές λειτουργίας τρανζίστορ BJT Ευθεία φόρτου - Σημείο Q

Περιοχές λειτουργίας τρανζίστορ BJT Ευθεία φόρτου - Σημείο Q Περιοχές λειτουργίας τρανζίστορ BJT Ευθεία φόρτου - Σημείο Q Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Ηλεκτρονική - Αυτοματισμός (Ε.Ε.) Δημιουργός: ΑΝΑΡΓΥΡΟΣ ΜΑΡΜΑΡΙΝΟΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δημιουργία παρουσίασης με εικόνες και εφέ κίνησης με το λογισμικό παρουσίασης Impress

Δημιουργία παρουσίασης με εικόνες και εφέ κίνησης με το λογισμικό παρουσίασης Impress Δημιουργία παρουσίασης με εικόνες και εφέ κίνησης με το λογισμικό παρουσίασης Impress Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΑΓΓΕΛΙΚΗ ΜΠΕΛΕΧΑΚΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙ ΙΟ ΧΡΗΣΗΣ. Πρόσβαση στην Καταγραφή και Εγχειρίδιο Χρήσης Εφαρµογών για ιευθύνσεις και Γραφεία Εκπαίδευσης

ΕΓΧΕΙΡΙ ΙΟ ΧΡΗΣΗΣ. Πρόσβαση στην Καταγραφή και Εγχειρίδιο Χρήσης Εφαρµογών για ιευθύνσεις και Γραφεία Εκπαίδευσης ΕΓΧΕΙΡΙ ΙΟ ΧΡΗΣΗΣ Πρόσβαση στην Καταγραφή και Εγχειρίδιο Χρήσης Εφαρµογών για ιευθύνσεις και Γραφεία Εκπαίδευσης ΠΕΡΙΕΧΌΜΕΝΑ Περιεχόµενα Περιεχόµενα... - 1 - Εισαγωγή... - 2 - Σηµείο πρόσβασης και αναγνώριση

Διαβάστε περισσότερα

Εργαστήριο «Τεχνολογία Πολιτισμικού Λογισμικού» Ενότητα. Επεξεργασία πινάκων

Εργαστήριο «Τεχνολογία Πολιτισμικού Λογισμικού» Ενότητα. Επεξεργασία πινάκων Ενότητα 4 Επεξεργασία πινάκων 36 37 4.1 Προσθήκη πεδίων Για να εισάγετε ένα πεδίο σε ένα πίνακα που υπάρχει ήδη στη βάση δεδομένων σας, βάζετε τον κέρσορα του ποντικιού στο πεδίο πάνω από το οποίο θέλετε

Διαβάστε περισσότερα

Υλικό Υπολογιστή. Γνωστικό αντικείμενο: Πληροφορική. Δημιουργός: ΕΛΕΝΗ ΧΩΡΙΑΝΟΠΟΥΛΟΥ

Υλικό Υπολογιστή. Γνωστικό αντικείμενο: Πληροφορική. Δημιουργός: ΕΛΕΝΗ ΧΩΡΙΑΝΟΠΟΥΛΟΥ Υλικό Υπολογιστή Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΕΛΕΝΗ ΧΩΡΙΑΝΟΠΟΥΛΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το παρόν

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΑΓΡΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4.

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ ΥΠΟΣΥΣΤΗΜΑΤΟΣ ΑΓΡΟΠΕΡΙΒΑΛΛΟΝΤΙΚΩΝ ΕΝΙΣΧΥΣΕΩΝ. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4. Δράση 1.1, Δράση 1.2, Δράση 2.1, Δράση 1.4, Δράση 2.3, Δράση 4.1, Δράση 4.2 Δεκέμβριος 2013 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ 1 ΓΕΝΙΚΕΣ ΛΕΙΤΟΥΡΓΙΕΣ... 5 1.1 Υποχρεωτικά Πεδία... 5 1.2 Βοηθητική Λίστα Τιμών (drop down

Διαβάστε περισσότερα

Προγραμματίζω παίζοντας: βασικές έννοιες προγραμματισμού με το Scratch

Προγραμματίζω παίζοντας: βασικές έννοιες προγραμματισμού με το Scratch Προγραμματίζω παίζοντας: βασικές έννοιες προγραμματισμού με το Scratch Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Ερευνητική Εργασία - Project Δημιουργός: ΦΩΤΙΟΣ ΛΑΖΑΡΙΝΗΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ

Διαβάστε περισσότερα

Εικονικό Εργαστήριο Χωρικής Ανάλυσης. Εγχειρίδιο Χρήστη ΤΕΙ ΑΘΗΝΑΣ

Εικονικό Εργαστήριο Χωρικής Ανάλυσης. Εγχειρίδιο Χρήστη ΤΕΙ ΑΘΗΝΑΣ Εικονικό Εργαστήριο Χωρικής Ανάλυσης Εγχειρίδιο Χρήστη ΤΕΙ ΑΘΗΝΑΣ Περιεχόμενα Εισαγωγή... 3 Είσοδος στο Σύστημα... 3 Εγγραφή Χρήστη... 4 Σύνδεση Χρήστη... 6 Επαναφορά Κωδικού Πρόσβασης... 7 Βασικά Χαρακτηριστικά...

Διαβάστε περισσότερα

Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων

Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων Οδηγίες για τη Ανάπτυξη Ανοικτών Ψηφιακών Μαθημάτων Δράση «Ανοικτά Ακαδημαϊκά Μαθήματα στο Πανεπιστήμιο Αθηνών» Σύνδεσμος: http://opencourses.uoa.gr / Περιεχόμενα ΠΡΟΫΠΟΘΕΣΕΙΣ... 2 1. ΕΙΣΑΓΩΓΗ ΧΡΗΣΤΗ ΣΤΗΝ

Διαβάστε περισσότερα

Σενάριο Χρήσης Moodle

Σενάριο Χρήσης Moodle Σενάριο Χρήσης Moodle Άσκηση 1 Μπείτε στη σελίδα http://pileas.com/m και συνδεθείτε με έναν από τους διαθέσιμους χρήστες σύμφωνα με τους κωδικούς που σας έχουν δοθεί. Αφού εισάγουμε το url του Moodle (π.χ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Άκουσµα. ιαδικτυακό λογισµικό για την εξάσκηση στη δεξιότητα της κατανόησης προφορικού λόγου. Εγχειρίδιο χρήσης

Άκουσµα. ιαδικτυακό λογισµικό για την εξάσκηση στη δεξιότητα της κατανόησης προφορικού λόγου. Εγχειρίδιο χρήσης Άκουσµα ιαδικτυακό λογισµικό για την εξάσκηση στη δεξιότητα της κατανόησης προφορικού λόγου Εγχειρίδιο χρήσης Περιεχόµενα 1 Το λογισµικό «Άκουσµα»... 3 2 Πλοήγηση στο λογισµικό... 3 2.1 Επιλογή χρήστη...

Διαβάστε περισσότερα

Δημιουργία, εμφάνιση, μέτρηση πλήθους γραμμών, λέξεων και χαρακτήρων αρχείων κειμένου στο Λ/Σ Unix

Δημιουργία, εμφάνιση, μέτρηση πλήθους γραμμών, λέξεων και χαρακτήρων αρχείων κειμένου στο Λ/Σ Unix Δημιουργία, εμφάνιση, μέτρηση πλήθους γραμμών, λέξεων και χαρακτήρων αρχείων κειμένου στο Λ/Σ Unix Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: Βασίλειος Βασιλάκης ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ

Διαβάστε περισσότερα

Ψυκτικός κύκλος με συμπίεση ατμών

Ψυκτικός κύκλος με συμπίεση ατμών Ψυκτικός κύκλος με συμπίεση ατμών Επαρκές Σενάριο Γνωστικό αντικείμενο: Μηχανολογία (Ε.Ε.) Δημιουργός: Νεκτάριος Κοντολαιμάκης ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ

Διαβάστε περισσότερα

Βασικές εντολές σχεδίασης στη γλώσσα προγραμματισμού Logo Εντολή επανάληψης

Βασικές εντολές σχεδίασης στη γλώσσα προγραμματισμού Logo Εντολή επανάληψης Βασικές εντολές σχεδίασης στη γλώσσα προγραμματισμού Logo Εντολή επανάληψης Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: Αθηνά Κοκκόρη ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ,

Διαβάστε περισσότερα

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΟΙΚΟΝΟΜΙΚΩΝ ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΠΛΗΡΟΦΟΡΙΑΚΩΝ ΣΥΣΤΗΜΑΤΩΝ Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 Οδηγίες Χρήσης Δεκέμβριος 2011 [1] Πίνακας Περιεχομένων 1. Αρχική Οθόνη...

Διαβάστε περισσότερα

Καταχώρηση Αποδείξεων

Καταχώρηση Αποδείξεων Καταχώρηση Αποδείξεων Το συγκεκριμένο εγχειρίδιο δημιουργήθηκε για να βοηθήσει την κατανόηση της διαδικασίας Καταχώρησης Αποδείξεων. Παρακάτω προτείνεται μια αλληλουχία ενεργειών την οποία ο χρήστης πρέπει

Διαβάστε περισσότερα

Pylon Entry. Πόροι. Στη διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή Αναζήτηση Πόρων

Pylon Entry. Πόροι. Στη διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή Αναζήτηση Πόρων Pylon Entry Πόροι Στη διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή Αναζήτηση Πόρων Περιεχόμενα Δημιουργία Νέου Πόρου... 3 Καρτέλα Βασικά Στοιχεία... 4 Καρτέλα Βασικά Στοιχεία... 4 Καρτέλα

Διαβάστε περισσότερα

Εφημερίδες! Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική. Δημιουργός: ΠΑΣΧΑΛΙΝΑ-ΛΙΝΑ ΒΑΛΣΑΜΙΔΟΥ

Εφημερίδες! Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική. Δημιουργός: ΠΑΣΧΑΛΙΝΑ-ΛΙΝΑ ΒΑΛΣΑΜΙΔΟΥ Εφημερίδες! Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική Δημιουργός: ΠΑΣΧΑΛΙΝΑ-ΛΙΝΑ ΒΑΛΣΑΜΙΔΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα

Browsers. Λειτουργικότητα και Παραμετροποίηση

Browsers. Λειτουργικότητα και Παραμετροποίηση Browsers Λειτουργικότητα και Παραμετροποίηση 1 Πίνακας περιεχομένων Γενική περιγραφή... 3 Γενικά... 3 Ποιο αναλυτικά τα μέρη ενός browser... 4 Φίλτρα αναζήτησης... 4 Σενάρια αναζήτησης... 4 Όψεις εμφάνισης

Διαβάστε περισσότερα

«Οδηγίες χρήσης εφαρμογής Ενιαίου Συστήματος Πληρωμών»

«Οδηγίες χρήσης εφαρμογής Ενιαίου Συστήματος Πληρωμών» «Οδηγίες χρήσης εφαρμογής Ενιαίου Συστήματος Πληρωμών» έκδοση v.1.2, 10/09/2014 Περιεχόμενα Είσοδος... 3 Οικονομικά Υπεύθυνος... 4 Αρχική Οθόνη... 4 Διαχείριση Χρηστών... 4 Αναζήτηση Χρήστη... 4 Δημιουργία

Διαβάστε περισσότερα

οδικός χάρτης Μπάμπης Γούτσος V6 Δεκέμβριος 2016

οδικός χάρτης Μπάμπης Γούτσος V6 Δεκέμβριος 2016 οδικός χάρτης Μπάμπης Γούτσος V6 Δεκέμβριος 2016 «Οδικός χάρτης» MySchool Με τη λήξη της σχολικής χρονιάς ακολουθούμε την παρακάτω διαδικασία: Α. Έκδοση Αποτελεσμάτων... 3 Α1.Ενημέρωση Διαγωγής... 3 Α2.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δυαδικό Σύστημα Αρίθμησης. Μετατροπές αριθμών από Δυαδικό σε Δεκαδικό και αντίστροφα

Δυαδικό Σύστημα Αρίθμησης. Μετατροπές αριθμών από Δυαδικό σε Δεκαδικό και αντίστροφα Δυαδικό Σύστημα Αρίθμησης. Μετατροπές αριθμών από Δυαδικό σε Δεκαδικό και αντίστροφα Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΚΩΝΣΤΑΝΤΙΝΑ ΚΟΝΤΟΣΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ

Διαβάστε περισσότερα

Τα είδη των χαρτών. Γνωστικό αντικείμενο: Γεωγραφία (ΠΕ) Δημιουργός: ΑΛΕΞΑΝΔΡΑ ΠΙΛΑΤΟΥ

Τα είδη των χαρτών. Γνωστικό αντικείμενο: Γεωγραφία (ΠΕ) Δημιουργός: ΑΛΕΞΑΝΔΡΑ ΠΙΛΑΤΟΥ Τα είδη των χαρτών Επαρκές Σενάριο Γνωστικό αντικείμενο: Γεωγραφία (ΠΕ) Δημιουργός: ΑΛΕΞΑΝΔΡΑ ΠΙΛΑΤΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το παρόν έγγραφο

Διαβάστε περισσότερα

Ελληνική ταινία μικρού μήκους

Ελληνική ταινία μικρού μήκους Ελληνική ταινία μικρού μήκους Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Θεατρική αγωγή Δημιουργός: ΑΧΙΛΛΕΑΣ ΝΤΕΛΛΗΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα

Το Ανάγλυφο της Ευρώπης

Το Ανάγλυφο της Ευρώπης Το Ανάγλυφο της Ευρώπης Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Γεωγραφία (ΠΕ) Δημιουργός: Αθανάσιος Μπατσίλας ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Επιπλέει ή βυθίζεται; Μέτρησε την πυκνότητα!

Επιπλέει ή βυθίζεται; Μέτρησε την πυκνότητα! Επιπλέει ή βυθίζεται; Μέτρησε την πυκνότητα! Επαρκές Σενάριο Γνωστικό αντικείμενο: Φυσική (ΔΕ) Δημιουργός: ΑΓΓΕΛΗΣ ΤΡΙΑΝΤΑΦΥΛΛΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Εισαγωγή στο ΟΠΣ - ΠΔΕ

1. Εισαγωγή στο ΟΠΣ - ΠΔΕ 1. Εισαγωγή στο ΟΠΣ - ΠΔΕ 1.1 Εισαγωγή 1.1.1 Σύντομη περιγραφή και σκοπός ΟΠΣ Το Ολοκληρωμένο Πληροφοριακό Σύστημα (Ο.Π.Σ.) αποτελεί ένα σύστημα πληροφόρησης και διαχείρισης, η χρήση του οποίου επιβάλλεται

Διαβάστε περισσότερα

Οδηγός Χρήσης της Υπηρεσίας Σχολικών Ηλεκτρονικών Περιοδικών και Εφημερίδων.

Οδηγός Χρήσης της Υπηρεσίας Σχολικών Ηλεκτρονικών Περιοδικών και Εφημερίδων. Οδηγός Χρήσης της Υπηρεσίας Σχολικών Ηλεκτρονικών Περιοδικών και Εφημερίδων http://schoolpress.sch.gr Ερευνητικό Ακαδημαϊκό Ινστιτούτο Τεχνολογίας Υπολογιστών Έκδοση 1.0 Ιανουάριος 2013 Περιεχόμενα 1.

Διαβάστε περισσότερα

Εγχειρίδιο Χρήσης για Διαχειριστές. Πλατφόρμα Μεταφόρτωσης και Μετατροπής Βίντεο

Εγχειρίδιο Χρήσης για Διαχειριστές. Πλατφόρμα Μεταφόρτωσης και Μετατροπής Βίντεο Εγχειρίδιο Χρήσης για Διαχειριστές Πλατφόρμα Μεταφόρτωσης και Μετατροπής Βίντεο 1. Εισαγωγή 1.1 Περιγραφή Λειτουργίας Πλατφόρμας Η Πλατφόρμα Μεταφόρτωσης και Μετατροπής Βίντεο παρέχει τη δυνατότητα της

Διαβάστε περισσότερα

Εγχειρίδιο Φοιτητή. Course Management Platform. Εισαγωγή. for Universities Ομάδα Ασύγχρονης Τηλεκπαίδευσης Παν. Μακεδονίας Σεπτέμβριος 2004

Εγχειρίδιο Φοιτητή. Course Management Platform. Εισαγωγή. for Universities Ομάδα Ασύγχρονης Τηλεκπαίδευσης Παν. Μακεδονίας Σεπτέμβριος 2004 Εγχειρίδιο Φοιτητή Εισαγωγή Η ηλεκτρονική πλατφόρμα, αποτελεί ένα ολοκληρωμένο σύστημα Ασύγχρονης Τηλεκπαίδευσης. Στόχος της είναι η παροχή υποδομών εκπαίδευσης και κατάρτισης ανεξάρτητα από τους περιοριστικούς

Διαβάστε περισσότερα

Σύντομη περιγραφή 5. Για να ξεκινήσετε 6. Οι οθόνες του προγράμματος 8. Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7

Σύντομη περιγραφή 5. Για να ξεκινήσετε 6. Οι οθόνες του προγράμματος 8. Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7 Σύντομη περιγραφή 5 Για να ξεκινήσετε 6 Εγκατάσταση προγράμματος 6 Δημιουργία κωδικών χρήστη 7 Οι οθόνες του προγράμματος 8 Αρχική οθόνη 8 Στοιχεία ασθενή 9 Εργασίες - Ραντεβού 10 Εικόνες 11 Ημερολόγιο

Διαβάστε περισσότερα

Ανοικτό Ψηφιακό Μάθημα για την κατάρτιση του προσωπικού υποστήριξης ανάπτυξης ψηφιακών μαθημάτων

Ανοικτό Ψηφιακό Μάθημα για την κατάρτιση του προσωπικού υποστήριξης ανάπτυξης ψηφιακών μαθημάτων Ανοικτό Ψηφιακό Μάθημα για την κατάρτιση του προσωπικού υποστήριξης ανάπτυξης ψηφιακών μαθημάτων Ενότητα 5: Δημιουργία Μαθήματος & Εργαλεία Διαχείρισης Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται

Διαβάστε περισσότερα

Πίνακας Περιεχομένων. Εγχειρίδιο Χρήσης Υπηρεσίες Φοιτητή Σελίδα 1 / 10

Πίνακας Περιεχομένων. Εγχειρίδιο Χρήσης Υπηρεσίες Φοιτητή Σελίδα 1 / 10 Πίνακας Περιεχομένων 1. Υπηρεσίες Φοιτητή... 3 1.1 Ακαδημαϊκή Δομή... 3 1.2 Καρτέλα Φοιτητή... 3 Σταθερή Διεύθυνση... 3 Επισκόπηση Διεύθυνσης... 3 Στοιχεία Ανεξάρτητα από Διεύθυνση... 4 1.3 Έλεγχος Κανόνων

Διαβάστε περισσότερα

Pylon Entry. Υπηρεσίες. Στην διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή και Αναζήτηση υπηρεσίας

Pylon Entry. Υπηρεσίες. Στην διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή και Αναζήτηση υπηρεσίας Pylon Entry Υπηρεσίες Στην διαδικασία αυτή περιγράφεται η Δημιουργία- Μεταβολή-Διαγραφή και Αναζήτηση υπηρεσίας Περιεχόμενα Δημιουργία Νέας Υπηρεσίας... 3 Καρτέλα Βασικά Στοιχεία... 4 Καρτέλα Προτεινόμενες

Διαβάστε περισσότερα

Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης

Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης Εγχειρίδιο Εφαρμογής Συμβούλων Υποστήριξης / Ενημέρωσης Περιεχόμενα 1. Εισαγωγή... 3 2. Σελίδα εισόδου... 4 3. Αρχική καρτέλα... 6 4. Στοιχεία Συμβούλου... 7 5. Στοιχεία λογαριασμού... 8 6. Αιτήματα Παρόχων...

Διαβάστε περισσότερα

Είσοδος. Καλωσορίσατε στο Ενιαίο Σύστημα Πληρωμών Δαπανών Ηλεκτρονικών Υπηρεσιών.

Είσοδος. Καλωσορίσατε στο Ενιαίο Σύστημα Πληρωμών Δαπανών Ηλεκτρονικών Υπηρεσιών. «Οδηγίες χρήσης εφαρμογής Ενιαίου Συστήματος Πληρωμών» έκδοση v.1.2, 10/09/2014 Περιεχόμενα Είσοδος... 3 Οικονομικά Υπεύθυνος... 4 Αρχική Οθόνη... 4 Διαχείριση Χρηστών... 4 Αναζήτηση Χρήστη... 4 Δημιουργία

Διαβάστε περισσότερα

Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων

Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων Ψηφιακή Εκπαιδευτική Πλατφόρμα, Διαδραστικά Βιβλία και Αποθετήριο Μαθησιακών Αντικειμένων ΑΝΑΖΗΤΗΣΗ ΣΤΟ ΦΩΤΟΔΕΝΤΡΟ Για να αναζητήσετε Μαθησιακά Αντικείμενα στο Φωτόδεντρο χρησιμοποιείστε το πεδίο εισαγωγής

Διαβάστε περισσότερα

Γνωρίζω καλύτερα τα κέρματα του ευρώ

Γνωρίζω καλύτερα τα κέρματα του ευρώ Γνωρίζω καλύτερα τα κέρματα του ευρώ Διδακτικό Σενάριο Γνωστικό αντικείμενο: Μαθηματικά (ΠΕ) Δημιουργός: ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το παρόν

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διδάσκοντας παράλληλα λατινική γλώσσα και ρωμαϊκή ιστορία

Διδάσκοντας παράλληλα λατινική γλώσσα και ρωμαϊκή ιστορία Διδάσκοντας παράλληλα λατινική γλώσσα και ρωμαϊκή ιστορία Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Λατινικά Δημιουργός: Αλεξάνδρα Χιώτη ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ

Διαβάστε περισσότερα

Δημιουργία η-μαθήματος με τη. 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας

Δημιουργία η-μαθήματος με τη. 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας Δημιουργία η-μαθήματος με τη χρήση του Moodle 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας Δημιουργία η-μαθήματος με τη χρήση του Moodle 3 ο Μέρος Εισαγωγή πληροφοριών: δημιουργία ιστοσελίδας

Διαβάστε περισσότερα

Οδηγίες Χρήσης Εφαρμογής

Οδηγίες Χρήσης Εφαρμογής Οδηγίες Χρήσης Εφαρμογής SciFY - Οκτώβριος 2016 Περιεχόμενα Εισαγωγή 3 Οδηγίες για τον εργοθεραπευτή / φροντιστή 4 Αρχική Οθόνη 4 Δημιουργία προφίλ 5 Ρυθμίσεις Επικοινωνίας 6 Ρυθμίσεις Ψυχαγωγίας 9 Ρυθμίσεις

Διαβάστε περισσότερα


ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΧΡΗΣΤΗ. Ηλεκτρονική Υποβολή Α.Π.Δ. ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΧΡΗΣΤΗ Ηλεκτρονική Υποβολή Α.Π.Δ. ΠΕΡΙΕΧΟΜΕΝΑ 1) Είσοδος στην εφαρμογή 2) Δημιουργία Περιόδου Υποβολής 2.α) Ακύρωση Περιόδου Υποβολής 3) Μέθοδος Υποβολής: Συμπλήρωση Φόρμας 3.α) Συμπλήρωση

Διαβάστε περισσότερα

Ο κήπος των συναισθημάτων

Ο κήπος των συναισθημάτων Ο κήπος των συναισθημάτων Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική Δημιουργός: ΗΛΙΑΝΑ ΠΑΠΑΝΤΩΝΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση

Διαβάστε περισσότερα

Ksyla.gr Σύντομη περιγραφή λειτουργίας

Ksyla.gr Σύντομη περιγραφή λειτουργίας Οδηγός Εφαρμογής Ksyla.gr Σύντομη περιγραφή λειτουργίας Το ksyla.gr είναι μια κοινότητα αγοραπωλησίας καύσιμου ξύλου σε οποιαδήποτε μορφή (καυσόξυλα, πέλλετ, μπρικέτες, κάρβουνα) καθώς επίσης και ειδών

Διαβάστε περισσότερα

Η έννοια της μεταβλητής και της λίστας με την βοήθεια του λογισμικού Scratch

Η έννοια της μεταβλητής και της λίστας με την βοήθεια του λογισμικού Scratch Η έννοια της μεταβλητής και της λίστας με την βοήθεια του λογισμικού Scratch Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: Ουρανία Καλαντζή ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ

Διαβάστε περισσότερα

Φύγε-φύγε ποντικάκι...

Φύγε-φύγε ποντικάκι... Φύγε-φύγε ποντικάκι... Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Προσχολική Παιδαγωγική Δημιουργός: ΠΑΣΧΑΛΙΝΑ-ΛΙΝΑ ΒΑΛΣΑΜΙΔΟΥ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ

Διαβάστε περισσότερα

Υπολογισμός και αποστολή Αναλυτικής Περιοδικής Δήλωσης

Υπολογισμός και αποστολή Αναλυτικής Περιοδικής Δήλωσης Υπολογισμός και αποστολή Αναλυτικής Περιοδικής Δήλωσης Το συγκεκριμένο εγχειρίδιο δημιουργήθηκε για να βοηθήσει την κατανόηση της Διαδικασίας υπολογισμού και αυτόματης υποβολής της Αναλυτικής Περιοδικής

Διαβάστε περισσότερα

Σενάριο Χρήσης myschool

Σενάριο Χρήσης myschool Σενάριο Χρήσης Το παρόν Εγχειρίδιο αποτελεί ένα σύντομο οδηγό γνωριμίας με το πληροφοριακό σύστημα myschool. Σε αυτό, παρουσιάζονται οι βασικές λειτουργίες της εφαρμογής ενώ ταυτόχρονα σας δίδεται ένα

Διαβάστε περισσότερα

Παιχνίδι γνώσεων της Ελλάδας

Παιχνίδι γνώσεων της Ελλάδας Παιχνίδι γνώσεων της Ελλάδας Βέλτιστο Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: Καλλιόπη Καταράκη ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το

Διαβάστε περισσότερα

Διαδικασία εγγραφής σχολείου στην Ηλεκτρονική Πύλη Επαγγελματικής Μάθησης

Διαδικασία εγγραφής σχολείου στην Ηλεκτρονική Πύλη Επαγγελματικής Μάθησης ΠΑΡΑΡΤΗΜΑ Α Διαδικασία εγγραφής σχολείου στην Ηλεκτρονική Πύλη Επαγγελματικής Μάθησης http://epaggelmatikimathisi.pi.ac.cy Για την εγγραφή του σχολείου στην Ηλεκτρονική Πύλη Επαγγελματικής Μάθησης ακολουθούνται

Διαβάστε περισσότερα

Δημιουργίας Ενεργειών

Δημιουργίας Ενεργειών Δημιουργίας Ενεργειών Περιεχόμενα Δημιουργία Ενεργειών (Επικοινωνίας, Ραντεβού)... 3 Καταχώρηση Επικοινωνίας και Ραντεβού... 4 Βασικά Στοιχεία... 7 Πεδία Χρήστη... 8 Υπομνήματα... 8 Μεταβολή Ενέργειας...

Διαβάστε περισσότερα


ΠΛΑΤΦΟΡΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΒΙΝΤΕΟΔΙΑΛΕΞΕΩΝ ΔΗΛΟΣ delos.uoa.gr. Εγχειρίδιο Χρήσης Μελών ΔΕΠ ΠΛΑΤΦΟΡΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΒΙΝΤΕΟΔΙΑΛΕΞΕΩΝ ΔΗΛΟΣ delos.uoa.gr Εγχειρίδιο Χρήσης Μελών ΔΕΠ Αναζήτηση Δημόσιου Περιεχομένου Η διεύθυνση ιστού της νεάς πλατφόρμας διαχείρισης βιντεοδιαλέξεων Δήλος είναι: http://delos.uoa.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το συγκεκριμένο εγχειρίδιο δημιουργήθηκε για να βοηθήσει την κατανόηση της διαδικασίας των αριθμοδεικτών. Παρακάτω προτείνεται μια αλληλουχία

Το συγκεκριμένο εγχειρίδιο δημιουργήθηκε για να βοηθήσει την κατανόηση της διαδικασίας των αριθμοδεικτών. Παρακάτω προτείνεται μια αλληλουχία Αριθμοδείκτες Το συγκεκριμένο εγχειρίδιο δημιουργήθηκε για να βοηθήσει την κατανόηση της διαδικασίας των αριθμοδεικτών. Παρακάτω προτείνεται μια αλληλουχία ενεργειών την οποία ο χρήστης πρέπει να ακολουθήσει

Διαβάστε περισσότερα

Εισαγωγή στις δομές δεδομένων Στοίβα και Ουρά με τη βοήθεια του Scratch

Εισαγωγή στις δομές δεδομένων Στοίβα και Ουρά με τη βοήθεια του Scratch Εισαγωγή στις δομές δεδομένων Στοίβα και Ουρά με τη βοήθεια του Scratch Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΘΕΟΔΩΡΟΣ ΠΑΠΠΑΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ,

Διαβάστε περισσότερα

Πανεπιστήμιο Αιγαίου. Ναυτίλος. Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου

Πανεπιστήμιο Αιγαίου. Ναυτίλος. Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου Πανεπιστήμιο Αιγαίου Ναυτίλος Σύστημα Ηλεκτρονικής Υποβολής Αιτήσεων Μεταπτυχιακών Προγραμμάτων Πανεπιστημίου Αιγαίου Εγχειρίδιο Χρήσης για τον υποψήφιο Έκδοση 1.4.1 Περιεχόμενα 1. Εισαγωγικά... 3 2. Εγγραφή

Διαβάστε περισσότερα


ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ ΗΛΕΚΤΡΟΝΙΚΗ ΥΠΗΡΕΣΙΑ ΑΠΟΚΤΗΣΗΣ ΑΚΑΔΗΜΑΪΚΗΣ ΤΑΥΤΟΤΗΤΑΣ Εγχειρίδιο Εφαρμογής Φοιτητών Πίνακας Εικόνων Εικόνα 1.1. Εκκίνηση της διαδικασία εγγραφής...5 Εικόνα 1.2. Σελίδα εγγραφής...6 Εικόνα 1.3. Είσοδος

Διαβάστε περισσότερα

Οδοντιατρικό Λογισμικό

Οδοντιατρικό Λογισμικό Οδοντιατρικό Λογισμικό Με το παρόν εγχειρίδιο, θα μάθετε απλά και γρήγορα, τις βασικές λειτουργίες της εφαρμογής, ώστε να ξεκινήσετε άμεσα τη χρήση της, ενώ στην ενότητα για προχωρημένους χρήστες, θα ανακαλύψετε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

A7.2 Δημιουργία Απλής Γραφικής Εφαρμογής σε Περιβάλλον Scratch

A7.2 Δημιουργία Απλής Γραφικής Εφαρμογής σε Περιβάλλον Scratch A7.2 Δημιουργία Απλής Γραφικής Εφαρμογής σε Περιβάλλον Scratch Τι θα μάθουμε σήμερα: Να ενεργοποιούμε το λογισμικό Scratch Να αναγνωρίζουμε τα κύρια μέρη του περιβάλλοντος του Scratch Να δημιουργούμε/εισάγουμε/τροποποιούμε

Διαβάστε περισσότερα


ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΑΙΤΗΣΗΣ ΕΝΤΑΞΗΣ ΣΤΟ ΜΗΤΡΩΟ ΕΚΠΑΙΔΕΥΤΩΝ Ε.Κ.Δ.Δ.Α. ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΥΠΟΒΟΛΗ ΑΙΤΗΣΗΣ ΕΝΤΑΞΗΣ ΣΤΟ ΜΗΤΡΩΟ ΕΚΠΑΙΔΕΥΤΩΝ Ε.Κ.Δ.Δ.Α. Με την επιλογή του συνδέσμου βρίσκεστε στην πρώτη σελίδα της εφαρμογής (Εικόνα 1). Για να ξεκινήσετε την εγγραφή σας στο νέο μητρώο

Διαβάστε περισσότερα

Pylon Entry. Προμηθευτές. Στην διαδικασία αυτή περιγράφεται η Δημιουργία-Μεταβολή- Διαγραφή Αναζήτηση ενός προμηθευτή

Pylon Entry. Προμηθευτές. Στην διαδικασία αυτή περιγράφεται η Δημιουργία-Μεταβολή- Διαγραφή Αναζήτηση ενός προμηθευτή Pylon Entry Προμηθευτές Στην διαδικασία αυτή περιγράφεται η Δημιουργία-Μεταβολή- Διαγραφή Αναζήτηση ενός προμηθευτή Περιεχόμενα Δημιουργία Νέου Προμηθευτή... 3 Καρτέλα Βασικά Στοιχεία... 5 Καρτέλα Εμπορικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Για τη διαδικτυακή εφαρμογή. Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων

ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ. Για τη διαδικτυακή εφαρμογή. Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ Για τη διαδικτυακή εφαρμογή Εγγραφής Φοιτητών σε Ωρολόγια Προγράμματα και Ελέγχου Διενέργειας Εκπαιδευτικών Δραστηριοτήτων στο πλαίσιο του έργου ΕΚΠΑΙΔΕΥΣΗ ΦΟΙΤΗΤΩΝ ΓΙΑ ΤΗΝ ΑΝΑΠΤΥΞΗ ΔΕΞΙΟΤΗΤΩΝ

Διαβάστε περισσότερα


WORDPRESS ΕΙΣΑΓΩΓΗ ΕΙΚΟΝΑΣ ΕΙΣΑΓΩΓΗ ΒΙΝΤΕΟ ΕΙΣΑΓΩΓΗ ΣΥΝΔΕΣΜΟΥ WORDPRESS ΕΙΣΑΓΩΓΗ ΕΙΚΟΝΑΣ ΕΙΣΑΓΩΓΗ ΒΙΝΤΕΟ ΕΙΣΑΓΩΓΗ ΣΥΝΔΕΣΜΟΥ Το Wordpress σας δίνει την δυνατότητα να εμπλουτίσετε τα άρθρα σας με εικόνες. Τις εικόνες αυτές είτε τις δημιουργήσει είτε τις έχετε προμηθευτεί

Διαβάστε περισσότερα

Ραντεβού στην αυλή μας

Ραντεβού στην αυλή μας Ραντεβού στην αυλή μας Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Πρόγραμμα Περιβαλλοντικής Εκπαίδευσης Δημιουργός: ΚΩΝΣΤΑΝΤΙΝΟΣ ΚΩΤΣΙΔΗΣ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ

Διαβάστε περισσότερα

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης

Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9. Οδηγίες Χρήσης Εφαρμογή Ηλεκτρονικής Υποβολής Δηλώσεων Ε9 Οδηγίες Χρήσης Πίνακας Περιεχομένων 1. Εισαγωγή... 3 2. Πρόσθετα Πεδία για την υποβολή δήλωσης Ε9 έτους 2013... 5 3. Αρχική οθόνη... 8 4. Αρχική Οθόνη Πιστοποιημένου

Διαβάστε περισσότερα

Στάδια επίλυσης προβλήματος -Εφαρμογή στη Δομή της Επανάληψης

Στάδια επίλυσης προβλήματος -Εφαρμογή στη Δομή της Επανάληψης Στάδια επίλυσης προβλήματος -Εφαρμογή στη Δομή της Επανάληψης Επαρκές Σενάριο Γνωστικό αντικείμενο: Πληροφορική Δημιουργός: ΚΑΤΕΡΙΝΑ ΓΚΟΡΙΛΑ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ

Διαβάστε περισσότερα

Road safety. Γνωστικό αντικείμενο: Αγγλική Γλώσσα. Δημιουργός: ΕΥΑΓΓΕΛΙΑ ΚΑΡΑΓΙΑΝΝΗ

Road safety. Γνωστικό αντικείμενο: Αγγλική Γλώσσα. Δημιουργός: ΕΥΑΓΓΕΛΙΑ ΚΑΡΑΓΙΑΝΝΗ Road safety Υποδειγματικό Σενάριο Γνωστικό αντικείμενο: Αγγλική Γλώσσα Δημιουργός: ΕΥΑΓΓΕΛΙΑ ΚΑΡΑΓΙΑΝΝΗ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΕΡΕΥΝΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Σημείωση Το παρόν

Διαβάστε περισσότερα