Γαλακτοκομία. Ενότητα 1: Πρωτεΐνες Γάλακτος (1/2), 2ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Γαλακτοκομία. Ενότητα 1: Πρωτεΐνες Γάλακτος (1/2), 2ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου"

Transcript

1 Γαλακτοκομία Ενότητα 1: Πρωτεΐνες Γάλακτος (1/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια

2 Μαθησιακοί Στόχοι Να γνωρίζουν oι φοιτητές την ετερογένεια των πρωτεϊνών, τη σύσταση, τη δομή και τις φυσικοχημικές ιδιότητές τους. Να γνωρίζουν που και πώς γίνεται η βιοσύνθεση των πρωτεϊνών. Να γνωρίζουν την αποσταθεροποίηση των μικκυλίων και τους μηχανισμούς πήξης του γάλακτος.

3 Λέξεις Κλειδιά αs1-καζεϊνη αs2-καζεΐνη β-καζεΐνη γ-καζεΐνες Γαλακτικό κύτταρο Καζεΐνη κ-καζεΐνες Μικκύλιο Πρωτεΐνες

4 Γενικά Περι Πρωτεїνών 1/4 Πρωταρχικής σημασίας ουσίες γιατί αποτελούν συστατικό του πρωτοπλάσματος των οργανισμών. Παίζουν σημαντικό ρόλο στη διατροφή του ανθρώπου (απαραίτητα αμινοξέα, Ca, Ρ). Οι πρωτεΐνες αποτελούν το 25% περίπου των στερεών συστατικών του γάλακτος. Περιλαμβάνουν στο μόριό τους C (22%), O (22%), N (16%), H (7%), και ορισμένες S (1-2%, WP, α s2, κ ) και P (~1%, CN, PP).

5 Γενικά Περι Πρωτεїνών 2/4 Περιέχουν στο μόριό τους 19 αμινοξέα που συνδέονται σε διάφορους συνδυασμούς και αριθμούς μεταξύ τους με πεπτιδικούς δεσμούς που σχηματίζονται από την αντίδραση μιας αμινο- και μιας καρβοξυλικής ομάδας δύο μορίων αμινοξέων: R R R Ο Η R ǁ ΝΗ 2 CH COOH + NH 2 CH COOH NH 2 CH C N CH COOH - H 2 O Υπέρυθρη απορρόφηση στα 6,4 μ

6 Γενικά Περι Πρωτεїνών 3/4 Περιέχουν όλα τα απαραίτητα αμινοξέα:i.leu, Arg, Met Cys, Val, Lys, Try, Leu, His, Phe Tyr Αμινοξέα με υψηλή αναλογία: Glu, Pro, Leu, Lys, Asp, Val Έχουν υψηλό μοριακό βάρος και γι' αυτό συμπεριφέρονται ως κολλοειδή. Έχουν αμφολυτικές ιδιότητες που οφείλονται στην ταυτόχρονη παρουσία των καρβοξυλικών (- COOH) και αμινικών (-ΝΗ2) ομάδων στο μόριό τους. Έχουν αξιόλογη ποσότητα ενέργειας (4 Kcal / g).

7 Γενικά Περι Πρωτεїνών 4/4 Έχουν υψηλή βιολογική αξία 90%,, ιδιαίτερα οι πρωτεΐνες ορού, λόγω της ικανοποιητικής περιεκτικότητάς τους σε απαραίτητα αμινοξέα. (ΒΑ= Χρησιμοποιούμενο Ν / απορροφημένο Ν) Σε ph μεγαλύτερο του Ι.Σ. η πρωτεΐνη αποκτά αρνητικό φορτίο, ενώ σε ph μικρότερο του Ι.Σ. αποκτά θετικό φορτίο. Είναι σώματα πολύπλοκα. Το γάλα περιέχει μίγμα πρωτεϊνών και διαιρούνται σε δύο μεγάλες κατηγορίες (καζεΐνες & πρωτεΐνες του ορού).

8 Βιοσύνθεση των Πρωτεϊνών Σύνθεση των πολυπεπτιδικών αλυσίδων στα ριβοσωμάτια από αμινοξέα που απορροφήθηκαν από το αίμα ή συντέθηκαν από το μαστό και στη συνέχεια η συνένωσή τους σε πρωτεϊνικά μόρια στο σύμπλεγμα Golgi.

9 Γαλακτικό Κύτταρο Μικρολάχνες Λιποσφαίριο (Συνένωση λιποσταγονιδίων) Μιτοχόνδριο Λιποσταγονίδια Ενδοπλασματικό δίκτυο (Εστεροποίηση Λ.Ο.προς λίπος) Κορυφαία μεμβράνη Εκκριτικά κυστίδια Golgi με μικκύλια καζεΐνης Σύμπλεγμα Golgi (Φωσφορυλίωση & γλυκοζυλίωση των πρωτεϊνών, σχηματισμός του καζεϊνικού μικκυλίου, και της λακτόζης) Λυσόσωμα Εξωτερική κυτταροπλασματική μεμβράνη Πυρήνας Ριβοσωμάτια του ενδοπλασματικού δικτύου (Σύνθεση πολυπεπτιδίων) Βασική μεμβράνη

10 Σύνθεση Πολυπεπτιδικών Αλυσίδων 1/4 Βιοχημικός μηχανισμός της συνθέσεως των πολυπεπτιδικών αλυσίδων όπου συμμετέχουν στη σύνθεση των πρωτεϊνών και οι 3 τύποι του RNA:

11 Σύνθεση Πολυπεπτιδικών Αλυσίδων 2/4 mrna (messenger RNA - αγγελιαφόρο ριβοζονουκλεϊκό οξύ) Αποτελεί τον κώδικα με τους κωδικούς (αλληλουχία των βάσεων). Είναι αντίγραφο του DNA που υπάρχει στο πυρήνα και περιέχει τις γενετικές πληροφορίες που προσδιορίζουν την αλληλουχία των αμινοξέων στις πολυπεπτιδικές αλυσίδες.

12 Σύνθεση Πολυπεπτιδικών Αλυσίδων 3/4 t RNA (transfer RNA - μεταφορικό ριβοζονουκλεϊκό οξύ) Είναι προσαρμοστής και μεταφορέας αμινοξέων. Για κάθε αμινοξύ υπάρχει ένα ειδικό t-rna με αντικωδικό.

13 Σύνθεση Πολυπεπτιδικών Αλυσίδων 4/4 r RNA (ribosomal RNA - ριβοσωματικό ριβοζονουκλεϊκό οξύ ) Περιέχεται στα ριβοσώματα. Ενώνεται με το mrna κατά την μετακίνηση των ριβοσωμάτων προκειμένου να διαβαστεί το μήνυμα του mrna.

14 Είδη Πρωτεϊνών Γάλακτος 1/3 Πρωτεΐνες (Pr) Καζεΐνες (CN) - α s αs1 α s2 (2-6) - β - κ (Γλυκοπρωτεΐνη) - γ (Τμήμα της β-καζεΐνης) γ 1 (f ) γ 2 (f ) γ 3 (f ) % του γάλακτος 2,6 1,0 0,3 0,9 0,3 0,1 (80% των Pr) (40% των CN) (10% των CN) (35% των CN) (10% των CN) (5% των CN)

15 Είδη Πρωτεϊνών Γάλακτος 2/3 Πρωτεΐνες (Pr) Πρωτεΐνες ορού (WP) - β-γαλακτογλοβουλίνη (β-lg) - α-γαλακταλβουμίνη (a-la) - Οροαλβουμίνη (SA) - Ανοσογλοβουλίνες (Ig) IgG1 IgG2 IgA, IgM FSC - Πρωτεόζες- πεπτόνες (P-P) Συστατικό 3 Συστατικό 8 ταχύ (f 1-28) Συστατικό 8 βραδύ (f ή 107) Συστατικό 5 (f ή 107)) % του γάλακτος 0,6 (20% των Pr) 0,30 (50% των WP) 0,10 (20% των WP) 0,04 (5% των WP) 0,06 (10% των WP) 0,10 (15% των WP)

16 Είδη Πρωτεϊνών Γάλακτος 3/3 Πρωτεΐνες (Pr) Πρωτεΐνες σε μικροποσότητες Γαλακτοσιδερίνη (Lf) πρωτεΐνες της μεμβράνης λιποσφαιρίων Ένζυμα Λακτολίνη ή β- μικρογλοβουλίνη % του γάλακτος <0,01 ή 100ppm 2 ppm

17 Η Περιεκτικοτητα σε Πρωτεΐνες Εξαρτάται: από το είδος του ζώου, π.χ. στο αγελαδινό γάλα είναι 3,2%, στο πρόβειο 5,6% και στο αίγειο 3,6% κατά μέσο όρο. από το στάδιο της γαλακτικής περιόδου. από τη διατροφή. Η διατροφή των ζώων με συμπυκνώματα αυξάνει όπως προαναφέρθηκε το προπιονικό οξύ σε βάρος του οξικού στη μεγάλη κοιλία, με αποτέλεσμα τη μειωμένη παραγωγή λίπους και την αύξηση της πρωτεΐνης. από τη φυλή και την ατομικότητα του ζώου. από την κατάσταση υγείας του μαστού κ.ά.

18 Ιδιότητες Καζεϊνών 1/5 1) Κατακρημνίζονται από άπαχο γάλα με οξίνιση σε ph 4,6 στους 20 0 C, ή με την πυτιά παρουσία ιόντων Ca ++, ή με την επίδραση ουδετέρων αλάτων, ή με την υπερφυγοκέντρηση. 2) Συντίθενται στο μαστό και δεν ανευρίσκονται πουθενά αλλού.

19 Ιδιότητες Καζεϊνών 2/5 3) Είναι φωσφοροπρωτεΐνες: OH HOOC CH NH CO CH CH 2 O P = O R NH 2 OH Σερίνη Η α s2 - καζεΐνη περιέχει P Η α s1 - καζεΐνη περιέχει 8-9 P Η β-καζεΐνη περιέχει 5 P Η κ- καζεΐνη περιέχει 1-2 P Η γ 1 - καζεΐνη περιέχει 1 P

20 Ιδιότητες Καζεϊνών 3/5 4) Περιέχουν υψηλή μάλλον ποσότητα προλίνης. Η β-καζεΐνη περιέχει 35 prol / mol Η κ-καζεΐνη περιέχει 20 prol / mol Η α s1 -καζεΐνη περιέχει 17 prol / mol Η α s2 -καζεϊνη περιέχει 10 prol / mol

21 Ιδιότητες Καζεϊνών 4/5 5) Βασικό συστατικό των τυριών. Αποτελούν το σκελετό των τυριών. 6) Οι καζεΐνες δεν επηρεάζονται σημαντικά από τη θερμοκρασία. Πιο ευαίσθητες στη θέρμανση είναι η α s2 - και η κ-καζεΐνη που περιέχουν 2 cys / mol. 7) Η πυτιά προκαλεί πολύ μικρές μεταβολές στις καζεΐνες. Η πιο ευαίσθητη στην πυτιά είναι η κ- καζεΐνη και ακολουθούν η α s1- και η β-καζεΐνη.

22 Ιδιότητες Καζεϊνών 5/5 10)Έχουν ευαισθησία στο Ca εκτός της κ-καζεΐνης. Σειρά ευαισθησίας: α s2 > α s1 > πάρα κ- > β- στους 20 0 C. 11)Απαντούν στο γάλα κυρίως σε κολλοειδή κατάσταση υπό τη μορφή μικκυλίων.

23 Μέθοδοι Λήψης Καζεϊνών Μέθοδοι κατακρήμνισης καζεϊνών 1) Με οξίνιση σε ph 4,6 στους 20 0 C 2) Με την επίδραση της πυτιάς παρουσία ιόντων Ca ++ 3) Με την επίδραση ουδετέρων αλάτων στους 37 0 C. [Κορεσμός με NaCl ή προσθήκη διαλύματος 26% (NH 4 ) 2 SO 4 ]. 4) Με υπερφυγοκέντρηση στους 35 0 C ( g για 1 ώρα) Ιδιότητες απομονωμένων καζεϊνών Ισοηλεκτρική καζεΐνη χωρίς άλατα και φορτίο Καζεΐνη πυτιάς ή φωσφοροπαρα-καζεϊνικό ασβέστιο με μεγαλύτερη περιεκτικότητα σε άλατα. Φυσική καζεΐνη + μέρος των WP ( Ig) Φυσική καζεΐνη (φωσφοροκαζεϊνικό ασβέστιο) CN-ser-HPO 4 - Ca -HPO 4 -ser- CN

24 Μικκύλια Απεικόνιση του καζεϊνικού μικκυλίου σε νωπό γάλα με ηλεκτρονική μικροσκοπία διέλευσης (ΤΕΜ). Μεγέθυνση: Χ 8500.

25 Ορισμός Μικκυλίων Είναι σύμπλοκα μόρια των αs, β+γ, και κ- καζεϊνών, σχηματίζουν σφαιρικά ενυδατωμένα σωματίδια μικρά (υπομικκύλια) ή μεγάλα (μικκύλια) με τη βοήθεια κυρίως των ιόντων Ca και P και βρίσκονται ιδιαίτερα τα τελευταία σε κολλοειδή διασπορά στην υδάτινη φάση του γάλακτος.

26 Ιδιότητες Μικκυλίων 1/2 Διάμετρος μικκυλίων nm ή mμ. Διάμετρος μικκυλίων πρόβειου γάλακτος 80 nm. Διάμετρος μικκυλίων αγελαδινού γάλακτος 180 nm. Διάμετρος μικκυλίων γίδινου γάλακτος 280 nm. Ασβέστιο στα μικκύλια (mg/g) των 3 ειδών γάλακτος: Γάλα Αγελαδινό Πρόβειο Γίδινο

27 Ιδιότητες Μικκυλίων 2/2 Όγκος μικκυλίων 1,4X109 0A3 ή 2Χ10-15 cm3 Αριθμός μικκυλίων ~105 μικκύλια / ml γάλακτος. MB μικκυλίων 109 Daltons Ένα μικκύλιο αποτελείται από περίπου μονομερή καζεΐνης εάν ληφθεί υπόψη ότι το μέσο MB κάθε μονομερούς καζεΐνης είναι Αναλογία αs1 : αs2 : β+γ : κ- καζεΐνης 4 : 1 : 4 : 1 Βαθμός ενυδάτωσης των μικκυλίων 1,7-3,7 g H2O /g CN. Διάμετρος υπομικκυλίων nm.

28 Η Βασική Σύνθεση του Μικκυλίου: Πίνακας: Ενδεικτική μέση σύσταση του καζεϊνικού μικκυλίου του αγελαδινού γάλακτος, % Καζεϊνες % (β/β) Ανόργανα συστατικά % (β/β) α s1 -καζεΐνη 35 Ασβέστιο 4,8 α s2 -καζεΐνη 9 Μαγνήσιο 0,3 β-καζεΐνη 33 Φώσφορος (ανόργανος) 2,1 κ-καζεΐνη 12 Σύνολο ανόργανων συστατικών γ-καζεΐνες 3 Σύνολο καζεϊνών 92 Κιτρικά 0,8 7,2

29 Σύνθεση του Μικκυλίου

30 Ο Ρόλος των Ιόντων Ca & P Συνδέουν μονομερή καζεΐνης σε πολυμερή καζεϊνών (υπομικκύλια) ως εξής: CN-ser- HPO 4 - Ca- HPO 4 -ser-cn Συνδέουν υπομικκύλια σε μεγάλα συσσωματώματα (μικκύλια). Υπομικκύλιo Ca 9 (po 4 ) 6 Υπομικκύλιo Πεπτιδική αλυσίδα

31 Δομή Υπομικκυλίου Καζεΐνης Mόρια κ- καζεΐνης Τριχοειδείς προεκτάσεις υδρόφιλου τμήματος της κ- καζεΐνης. -PO 4 ομάδες Υδρόφοβος πυρήνας υπομικκυλίου καζεΐνης

32 Δομή Μικκυλίου Καζεΐνης 1/2 Υπομικκύλια καζεΐνης οργανωμένα σε μικκύλιo (Tetra Pak, 1995). Υπομικκύλιo Προεξέχουσααλυσίδα της κ- καζεΐνης. Φωσφορικό ασβέστιο κ- καζεΐνη Υδροφιλικές -PO 4 ομάδες

33 Δομή Μικκυλίου Καζεΐνης 2/2 Τα εσωτερικά υπομικκύλια είναι πλούσια σε αs- και β-καζεΐνη, ενώ τα υπομικκύλια της επιφάνειας του μικκυλίου είναι πλούσια σε κ- καζεΐνη. Σχηματική αναπαράσταση μικκυλίου: Υπομικκύλιo Υδρόφιλη ομάδα

34 Η Σταθερότητα των Μικκυλίων Οφείλεται 1/2 Στο αρνητικό φορτίο των μικκυλίων. Στην τάση ενυδάτωσης των μικκυλίων. Η παρουσία νερού μεταξύ των μικκυλίων και του ορού του γάλακτος παρεμποδίζει τη συνένωση των μικκυλίων και συμβάλλει στη σταθερότητά τους.

35 Η Σταθερότητα των Μικκυλίων Οφείλεται 2/2 Μικκύλιο καζεΐνης Διπολικά μόρια νερού προσανατολισμένα & δεσμευμένα (με τους θετικούς πόλους προς το αρνητικό φορτίο της επιφάνειας του μικκυλίου) Νερό επιφανειακής ενυδατώσεως (με ακανόνιστο προσανα-τολισμό) Στην προστατευτικότητα της κ- CN που περιβάλλει τα μικκύλια και είναι ανθεκτική σε ιόντα ασβεστίου σε αντίθεση με τα άλλα καζεϊνικά κλάσματα α s -, β-, κ- που είναι ευαίσθητα σε ιόντα ασβεστίου.

36 Βιβλιογραφία Ανυφαντάκης, Εμ. Χημεία και Ανάλυση του Γάλακτος Εκδόσεις Καραμπερόπουλος, Αθήνα, Καμιναρίδης, Στ. και Μοάτσου, Γ., Γαλακτοκομία, Εκδόσεις Έμβρυο, Αθήνα, Park Y.W.& Haenlein G.F.W., Milk and Dairy Products in Human Nutrition. Wiley-Blackwell, UK, Tetra Pak. Dairy processing handbook, pp Applied Science Publishers Ltd, London, Walstra, P. &Jenness, R. Dairy Chemistry and Physics. John Wiley & Sons, New York, 1983 Walstra, p., Wouters, J.T.M. & Geurts, T. J., Dairy Science and Technology. Second Edition. CRC- Taylor & Francis, New York, 2006.

Γαλακτοκομία. Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής

Γαλακτοκομία. Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Γαλακτοκομία Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί Στόχοι Να γνωρίζουν

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 3: Λιπίδια (1/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής

Γαλακτοκομία. Ενότητα 3: Λιπίδια (1/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Γαλακτοκομία Ενότητα 3: Λιπίδια (1/3), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί Στόχοι Να γνωρίζουν

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 7: Ιδιότητες του Γάλακτος (1/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 7: Ιδιότητες του Γάλακτος (1/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 7: Ιδιότητες του Γάλακτος (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί Στόχοι

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα (3/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα (3/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα (3/3), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 4: Θερμική Επεξεργασία Γάλακτος (1/2), 1.5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 4: Θερμική Επεξεργασία Γάλακτος (1/2), 1.5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 4: Θερμική Επεξεργασία Γάλακτος (1/2), 1.5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα(1/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα(1/3), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 3: Κύρια Συστατικά του Γάλακτος - Άλατα(1/3), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

χρησιμοποιήθηκαν βιβλιογραφίες, μεταξύ των οποίων σε σημαντικό βαθμό το παρακάτω βιβλίο, το οποίο είναι χρήσιμο για μελέτη.

χρησιμοποιήθηκαν βιβλιογραφίες, μεταξύ των οποίων σε σημαντικό βαθμό το παρακάτω βιβλίο, το οποίο είναι χρήσιμο για μελέτη. Στοιχεία παραδόσεων Για το τμήμα αυτό των στοιχείων παραδόσεων για το μάθημα Χημεία Τροφίμων, 2013-14, που δεν συνιστούν σημειώσεις, αλλά απλά είναι αποτέλεσμα πρώτης επεξεργασίας, χρησιμοποιήθηκαν βιβλιογραφίες,

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 5: Ενδογενή Ένζυμα του Γάλακτος (1/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 5: Ενδογενή Ένζυμα του Γάλακτος (1/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 5: Ενδογενή Ένζυμα του Γάλακτος (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΟΥ ΑΙΓΕΙΟΥ ΓΑΛΑΚΤΟΣ ΣΕ ΠΡΟΒΕΙΟ ΓΑΛΑ ΚΑΙ ΤΥΡΙ

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΟΥ ΑΙΓΕΙΟΥ ΓΑΛΑΚΤΟΣ ΣΕ ΠΡΟΒΕΙΟ ΓΑΛΑ ΚΑΙ ΤΥΡΙ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ «ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ» ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΟΥ ΑΙΓΕΙΟΥ ΓΑΛΑΚΤΟΣ ΣΕ ΠΡΟΒΕΙΟ ΓΑΛΑ ΚΑΙ ΤΥΡΙ ΜΕΤΑΠΤΥΧΙΑΚΗ

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 013 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ο αριθμός mol OH ΘΕΜΑ Α Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ

Γαλακτοκομία. Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ Γαλακτοκομία Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777 ΘΕΜΑ Α Α1. α Α2. γ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Σημειώσεις για την εργαστηριακή άσκηση ΑΝΑΛΥΣΗ ΓΑΛΑΚΤΟΣ του Εργαστηρίου Ανάλυσης και Τεχνολογίας Τροφίμων Καθηγητής Ιωάννης Ρούσσης.

Σημειώσεις για την εργαστηριακή άσκηση ΑΝΑΛΥΣΗ ΓΑΛΑΚΤΟΣ του Εργαστηρίου Ανάλυσης και Τεχνολογίας Τροφίμων Καθηγητής Ιωάννης Ρούσσης. Σημειώσεις για την εργαστηριακή άσκηση ΑΝΑΛΥΣΗ ΓΑΛΑΚΤΟΣ του Εργαστηρίου Ανάλυσης και Τεχνολογίας Τροφίμων Καθηγητής Ιωάννης Ρούσσης Προσδιορισμοί Ειδικό βάρος Οξύτητα Στερεό υπόλειμμα Λακτόζη Έλεγχος παστερίωσης

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 4: Δευτερεύοντα Συστατικά του Γάλακτος (2/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Δίνονται: Κ a CH 3 COOH = 10 5, Κ b NH 3 = 10 5 Μονάδες 3 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 5: Ψύξη, 2ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής

Γαλακτοκομία. Ενότητα 5: Ψύξη, 2ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Γαλακτοκομία Ενότητα 5: Ψύξη, 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί Στόχοι Να γνωρίζουν οι φοιτητές

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Όξινη μορφή Ουδέτερη μορφή αλκαλική μορφή ή zwitterion

Όξινη μορφή Ουδέτερη μορφή αλκαλική μορφή ή zwitterion 11 Απομόνωση της καζεΐνης από το γάλα και ιδιότητές της Στόχος της άσκησης: Κατανόηση της χημικής σύστασης των πρωτεϊνών. Η εξοικείωση με τις ηλεκτρικές ιδιότητες των πρωτεϊνών και την επίδραση οξέων και

Διαβάστε περισσότερα

ΥΠΟΒΑΘΡΟ ΣΠΟΥΔΑΣΤΩΝ ΓΙΑ ΤΟ ΠΕΙΡΑΜΑ Α: ΦΥΣΙΚΑ ΝΑΝΟ-ΥΛΙΚΑ

ΥΠΟΒΑΘΡΟ ΣΠΟΥΔΑΣΤΩΝ ΓΙΑ ΤΟ ΠΕΙΡΑΜΑ Α: ΦΥΣΙΚΑ ΝΑΝΟ-ΥΛΙΚΑ ΥΠΟΒΑΘΡΟ ΣΠΟΥΔΑΣΤΩΝ ΓΙΑ ΤΟ ΠΕΙΡΑΜΑ Α: ΦΥΣΙΚΑ ΝΑΝΟ-ΥΛΙΚΑ Έχουμε πολλά φυσικά νανο-υλικά γύρω μας και σε αυτό το πείραμα θα μάθετε ότι δύο πολύ κοινά υλικά, το γάλα και η ζελατίνη, είναι όντως δύο από αυτά.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 6: Μικροοργανισμοί του Νωπού Γάλακτος (1/3), 1.5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου

Γαλακτοκομία. Ενότητα 6: Μικροοργανισμοί του Νωπού Γάλακτος (1/3), 1.5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Γαλακτοκομία Ενότητα 6: Μικροοργανισμοί του Νωπού Γάλακτος (1/3), 1.5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί

Διαβάστε περισσότερα

ΠΑΡΑΡΤΗΜΑΤΑ. της πρότασης ΟΔΗΓΙΑ ΤΟΥ ΕΥΡΩΠΑΪΚΟΥ ΚΟΙΝΟΒΟΥΛΙΟΥ ΚΑΙ ΤΟΥ ΣΥΜΒΟΥΛΙΟΥ

ΠΑΡΑΡΤΗΜΑΤΑ. της πρότασης ΟΔΗΓΙΑ ΤΟΥ ΕΥΡΩΠΑΪΚΟΥ ΚΟΙΝΟΒΟΥΛΙΟΥ ΚΑΙ ΤΟΥ ΣΥΜΒΟΥΛΙΟΥ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ Βρυξέλλες, 20.3.2014 COM(2014) 174 final ANNEXES 1 to 3 ΠΑΡΑΡΤΗΜΑΤΑ της πρότασης ΟΔΗΓΙΑ ΤΟΥ ΕΥΡΩΠΑΪΚΟΥ ΚΟΙΝΟΒΟΥΛΙΟΥ ΚΑΙ ΤΟΥ ΣΥΜΒΟΥΛΙΟΥ για την προσέγγιση των νομοθεσιών των κρατών μελών

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΤΗΣ ΠΑΡΑΚΑΖΕΙΝΙΚΗΣ ΜΗΤΡΑΣ ΔΙΑΦΟΡΕΤΙΚΩΝ ΚΑΤΗΓΟΡΙΩΝ ΤΥΡΙΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΩΡΙΜΑΝΣΗΣ ΤΟΥΣ

ΜΕΛΕΤΗ ΤΗΣ ΠΑΡΑΚΑΖΕΙΝΙΚΗΣ ΜΗΤΡΑΣ ΔΙΑΦΟΡΕΤΙΚΩΝ ΚΑΤΗΓΟΡΙΩΝ ΤΥΡΙΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΩΡΙΜΑΝΣΗΣ ΤΟΥΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Ολοκληρωμένη Διαχείριση Παραγωγής Γάλακτος και Γαλακτοκομικών Προϊόντων» ΜΕΤΑΠΤΥΧΙΑΚΗ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

ΧΗΜΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΕΔΑΦΩΝ

ΧΗΜΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΕΔΑΦΩΝ Εδαφικά κολλοειδή Ανόργανα ορυκτά (άργιλος) ή οργανική ουσία (χούμος) με διάμετρο μικρότερη από 0,001 mm ή 1μ ανήκουν στα κολλοειδή. Ηάργιλος(

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (1ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (1ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Α. δ Α2 Α3 Α4 Α5 α Σ Λ Σ Λ Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Ηµεροµηνία: Τετάρτη 5 Απριλίου 205 ιάρκεια Εξέτασης: 3 ώρες Α: CH3CH2COOCH2CH3 Β:

Διαβάστε περισσότερα

ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο

ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Συµβολή του γάλακτος και των

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ

Γαλακτοκομία. Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ Γαλακτοκομία Ενότητα6: Παράγοντες που Επηρεάζουν την Ανάπτυξη των Μικροβίων μέσα στο Γάλα (3/3), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ Χημεία Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α, Β ΤΑΞΕΙΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α ΤΑΞΗ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ ΚΕΝΤΡΙΚΗ ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΠΙΤΡΟΠΗ ΤΡΑΠΕΖΑΣ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Για τις προτάσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και, δίπλα, το γράμμα που αντιστοιχεί στη σωστή επιλογή. Α1. Ποιο

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ A ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Η ασβεστοποίηση ως προηγμένη επεξεργασία για τηνεξυγίανση ξγ ητης λυματολάσπης και την μείωση των οσμών

Η ασβεστοποίηση ως προηγμένη επεξεργασία για τηνεξυγίανση ξγ ητης λυματολάσπης και την μείωση των οσμών Η ασβεστοποίηση ως προηγμένη επεξεργασία για τηνεξυγίανση ξγ ητης λυματολάσπης και την μείωση των οσμών ημητριάδης Γεώργιος 2310688380 caohellas@the.forthnet.gr Λυματολάσπη Στόχοι της επεξεργασίας της

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 ο ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

Δρ. Ιωάννης Καλαμαράς, Διδάκτωρ Χημικός. Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου

Δρ. Ιωάννης Καλαμαράς, Διδάκτωρ Χημικός. Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου 1. Το ιόν του νατρίου, 11Νa +, προκύπτει όταν το άτομο του Na προσλαμβάνει ένα ηλεκτρόνιο. Λ, όταν αποβάλλει ένα ηλεκτρόνιο 2. Σε 2 mol NH3

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg Αυγό Τα αυγά αποτελούνται από το κέλυφος (10 %), το ασπράδι ή λευκό (50-60 %), τον κρόκο ή κίτρινο (30 %). Το κέλυφος αποτελείται κατά 95 % από ανόργανα συστατικά όπως ανθρακικό ασβέστιο, ανθρακικό μαγνήσιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ο αλκοολικός τίτλος % vol είναι % v/v. Η αλκοόλη, % vol, μετράται στους 20 o C. Γίνεται διόρθωση της αλκοόλης όταν η θερμοκρασία είναι διαφορετική

Ο αλκοολικός τίτλος % vol είναι % v/v. Η αλκοόλη, % vol, μετράται στους 20 o C. Γίνεται διόρθωση της αλκοόλης όταν η θερμοκρασία είναι διαφορετική ΟΙΝΟΣ ΑΛΚΟΟΛΗ Με απόσταξη 200 ml οίνου συλλέγονται 133-150 ml αποστάγματος. Για την εξουδετέρωση της οξύτητας του οίνου, για να μη ληφθούν στο απόσταγμα πτητικά οξέα (οξικό, ανθρακικό και θειώδες), στα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 16/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΚΤΩ (8) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΗ ΣΧΟΛΗ ΑΓΡΙΝΙΟΥ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΕΤΟΣ ΣΠΟΥΔΩΝ 1ο Ζωολογία Δ. Ματθόπουλος 1 ΥΠΕΥΘΥΝΟΙ Από έδρας Δ. Ματθόπουλος Ζωολογία Δ. Ματθόπουλος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΕΚΦΩΝΗΣΕΙΣ. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1 ΘΕΜΑ 1 Ο ΕΚΦΩΝΗΣΕΙΣ A ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1) Το άτοµο του καλίου (Κ) έχει µαζικό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ

ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -OΣΤΑ -ΔΟΝΤΙΑ -ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΠΥΡΙΤΙΟΥ -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ Nacre (μαργαρο, σεντεφι) 95% Ανοργανη φαση=ανθρακικο

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF.

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 10 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής. Οι Πρωτεΐνες. Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης

Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής. Οι Πρωτεΐνες. Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης Δρ. Ιωάννης Τσαγκατάκης Σύμβουλος Διατροφικής Αγωγής Οι Πρωτεΐνες Ένωση Ελλήνων Χημικών Περιφερειακό Τμήμα Κρήτης Αμινοξέα, Πεπτίδια, Πρωτεΐνες, Ένζυμα Πεπτιδικός δεσμός Αμινοξέα Πεπτίδια (

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 29 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 29 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 29 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1:γ Α2:β Α3:δ Α4:β Α5:α)διαφορές θεωρίας του Arrhenius- Brönsted

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Οξείδωση της γλυκόζης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Καταβολισµός ή ανοµοίωση» C 6 H 12 O+6O 2 +6H 2 O 12H 2 O+6CO 2 +686 Kcal/mol Πηγές ενέργειας κατά την

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

Επαναληπτικές Ασκήσεις

Επαναληπτικές Ασκήσεις Επαναληπτικές Ασκήσεις Ενότητα 1: Εισαγωγή στη Χημεία 1.1 Στον επόμενο πίνακα δίνονται τα σημεία τήξης και τα σημεία ζέσης διαφόρων υλικών. Υλικό Σημείο Tήξης ( ο C) Σημείο Zέσης ( ο C) Α 0 100 Β 62 760

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα