ΑΡΗΣΟΣΔΛΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΓΔΧΠΟΝΗΑ, ΓΑΟΛΟΓΗΑ & ΦΤΗΚΟΤ ΠΔΡΗΒΑΛΛΟΝΣΟ ΣΟΜΔΑ ΔΠΗΣΖΜΖ & ΣΔΥΝΟΛΟΓΗΑ ΣΡΟΦΗΜΧΝ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΡΗΣΟΣΔΛΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΓΔΧΠΟΝΗΑ, ΓΑΟΛΟΓΗΑ & ΦΤΗΚΟΤ ΠΔΡΗΒΑΛΛΟΝΣΟ ΣΟΜΔΑ ΔΠΗΣΖΜΖ & ΣΔΥΝΟΛΟΓΗΑ ΣΡΟΦΗΜΧΝ"

Transcript

1 ΑΡΗΣΟΣΔΛΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΓΔΧΠΟΝΗΑ, ΓΑΟΛΟΓΗΑ & ΦΤΗΚΟΤ ΠΔΡΗΒΑΛΛΟΝΣΟ ΣΟΜΔΑ ΔΠΗΣΖΜΖ & ΣΔΥΝΟΛΟΓΗΑ ΣΡΟΦΗΜΧΝ ΖΛΗΑ Γ. ΝΑΝΖ Πηπρηνύρνπ ΜSc Γεσπόλνπ ΜΗΚΡΟΒΗΟΛΟΓΗΚΔ ΚΑΗ ΦΤΗΚΟΥΖΜΗΚΔ ΜΔΣΑΒΟΛΔ ΚΑΣΑ ΣΖ ΕΤΜΧΖ ΣΟΤ ΣΔΡΔΟΤ ΤΠΟΛΔΗΜΜΑΣΟ ΚΟΚΗΝΗΖ ΣΧΝ ΤΓΡΧΝ ΑΠΟΒΛΖΣΧΝ ΔΛΑΗΟΤΡΓΔΗΟΤ ΣΟ ΟΠΟΗΟ ΑΞΗΟΠΟΗΔΗΣΑΗ ΓΗΑ ΣΖΝ ΠΑΡΑΚΔΤΖ ΠΡΟΨΟΝΣΟ ΣΤΠΟΤ ΠΑΣΑ ΔΛΗΑ ΜΔΣΑΠΣΤΥΗΑΚΖ ΓΗΑΣΡΗΒΖ ΘΔΑΛΟΝΗΚΖ 2014

2 ΖΛΗΑ Γ. ΝΑΝΖ Πηπρηνύρνπ ΜSc Γεσπόλνπ ΜΗΚΡΟΒΗΟΛΟΓΗΚΔ ΚΑΗ ΦΤΗΚΟΥΖΜΗΚΔ ΜΔΣΑΒΟΛΔ ΚΑΣΑ ΣΖ ΕΤΜΧΖ ΣΟΤ ΣΔΡΔΟΤ ΤΠΟΛΔΗΜΜΑΣΟ ΚΟΚΗΝΗΖ ΣΧΝ ΤΓΡΧΝ ΑΠΟΒΛΖΣΧΝ ΔΛΑΗΟΤΡΓΔΗΟΤ ΣΟ ΟΠΟΗΟ ΑΞΗΟΠΟΗΔΗΣΑΗ ΓΗΑ ΣΖΝ ΠΑΡΑΚΔΤΖ ΠΡΟΨΟΝΣΟ ΣΤΠΟΤ ΠΑΣΑ ΔΛΗΑ ΜΔΣΑΠΣΤΥΗΑΚΖ ΔΡΓΑΗΑ Τπνβιήζεθε ζηε Γεσπνληθή ρνιή Σνκέαο Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ Ζκεξνκελία Πξνθνξηθήο Δμέηαζεο : 23 Ματνπ 2014 Δμεηαζηηθή Δπηηξνπή Γ. Γεξαζόπνπινο, Δπηβιέπσλ Καζεγεηήο Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ. A. Γνύια, Λέθηνξαο Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ. ζηνλ Σνκέα ηεο Μεραληθήο Σξνθίκσλ Λ. Αηθαηεξηληάδνπ, Αλαπιεξψηξηα Δξεπλήηξηα Μνξηαθήο Μηθξνβηνινγίαο ζην Ηδξπκα Κηεληαηξηθψλ Δξεπλψλ Θεζζαινλίθεο ii

3 Ζιίαο Γ. Νάλεο Α.Π.Θ. ΜΗΚΡΟΒΗΟΛΟΓΗΚΔ ΚΑΗ ΦΤΗΚΟΥΖΜΗΚΔ ΜΔΣΑΒΟΛΔ ΚΑΣΑ ΣΖ ΕΤΜΧΖ ΣΟΤ ΣΔΡΔΟΤ ΤΠΟΛΔΗΜΜΑΣΟ ΚΟΚΗΝΗΖ ΣΧΝ ΤΓΡΧΝ ΑΠΟΒΛΖΣΧΝ ΔΛΑΗΟΤΡΓΔΗΟΤ ΣΟ ΟΠΟΗΟ ΑΞΗΟΠΟΗΔΗΣΑΗ ΓΗΑ ΣΖΝ ΠΑΡΑΚΔΤΖ ΠΡΟΨΟΝΣΟ ΣΤΠΟΤ ΠΑΣΑ ΔΛΗΑ ISBN «Ζ έγθξηζε ηεο παξνχζεο Μεηαπηπρηαθήο Γηαηξηβήο απφ ηε Γεσπνληθή ρνιή ηνπ Αξηζηνηειείνπ Παλεπηζηεκίνπ Θεζζαινλίθεο, δελ ππνδειψλεη απνδνρή ησλ γλσκψλ ηνπ ζπγγξαθέσο» (Ν. 5343/1932, άξζξν 202, παξ. 2). iii

4 Δπραξηζηίεο Ζ παξνχζα κεηαπηπρηαθή δηαηξηβή εθπνλήζεθε θαηά ηα έηε ζηε Γεσπνληθή ρνιή ηνπ Αξηζηνηέιεηνπ Παλεπηζηεκίνπ Θεζζαινλίθεο. Οινθιεξψλνληαο ηε ζπγγξαθή απηήο ηεο δηαηξηβήο, έρσ ππνρξέσζε λα επραξηζηήζσ ζεξκά ηνπο αλζξψπνπο πνπ ζπλέβαιαλ ζηελ πξαγκαηνπνίεζή ηεο. Δπραξηζηψ ζεξκά ηνλ θαζεγεηή ηεο Γεσπνληθήο ρνιήο θαη επηβιέπσλ θαζεγεηή κνπ θ. Γεξαζφπνπιν Γεκήηξην γηα ηελ αλάζεζε ηνπ ζέκαηνο, ηελ εκπηζηνζχλε πνπ έδεημε ζηνλ πξφζσπφ κνπ, ηε δηαξθή θαζνδήγεζε θαη ακέξηζηε ζπκπαξάζηαζή ηνπ, θαζψο θαη γηα ηε ζπλερή παξνπζία θαη εξγαηηθφηεηά ηνπ, πνπ απνηέιεζε πξφηππν θαζνδήγεζήο κνπ απηά ηα ρξφληα. Δπίζεο, ζεξκέο επραξηζηίεο νθείισ ζηελ θαζεγήηξηα ηεο Γεσπνληθήο ρνιήο θ. Δπαλζία Ληηνπνχινπ Σδαλεηάθε γηα ηελ θαζνδήγεζε θαη ηε πνιχηηκε ζπλεηζθνξά ηεο ζηελ εξκελεία ησλ απνηειεζκάησλ ησλ πεηξακαηηθψλ δεδνκέλσλ, θαζψο θαη γηα φιεο ηηο παξαηεξήζεηο ηεο. Δπραξηζηψ επίζεο ζεξκά ηελ θ. Γνχια Αζαλαζία ιέθηνξα ηεο Γεσπνληθήο ρνιήο γηα ηηο πνιχηηκεο ζπκβνπιέο ηεο θαζφιε ηε δηάξθεηα ηεο εξγαζίαο. Δπραξηζηψ ζεξκά ηελ θ. Υαηδεθακάξε Μάγδα, κέινο ΔΔΓΗΠ ηεο Γεσπνληθήο ρνιήο γηα ηηο γλψζεηο θαη ηε βνήζεηα πνπ κνπ πξνζέθεξε ζηε δηεθπεξαίσζε κεγάινπ κέξνπο ησλ πεηξακάησλ. Δπίζεο, αηζζάλνκαη ηελ αλάγθε λα επραξηζηήζσ φινπο ηνπο θαζεγεηέο κνπ γηα ηηο γλψζεηο θαη ηε βνήζεηα πνπ κνπ πξνζέθεξαλ θαηά ηε δηάξθεηα ησλ κεηαπηπρηαθψλ κνπ ζπνπδψλ. Δπραξηζηψ πνιχ αθφκε ηε Γξ. Λνπθία Αηθαηεξηληάδνπ θαη ηε Γξ. Δπξηδίθε Μπνπθνπβάια γηα ηελ επθαηξία πνπ κνπ έδσζαλ λα εθπαηδεπηψ ζηε ρξήζε ζχγρξνλσλ κνξηαθψλ ηερληθψλ, ζην Ηλζηηηνχην Κηεληαηξηθψλ Δξεπλψλ Θεζζαινλίθεο, θαζψο επίζεο θαη γηα ηηο γλψζεηο, ηηο ζπκβνπιέο ηνπο θαη ηελ επηζηεκνληθή ηνπο θαζνδήγεζε. Ζ θα Αηθαηεξηληάδνπ επίζεο, σο κέινο ηεο εμεηαζηηθήο επηηξνπήο, κε βνήζεζε ηδηαίηεξα λα πξνεηνηκαζηψ θαηάιιεια ψζηε λα κπνξψ λα αληηκεησπίζσ νπνηνδήπνηε πξφβιεκα κπνξνχζε λα παξνπζηαζηεί. Δπραξηζηψ επίζεο ζεξκά ηνλ θ. Δπζηάζην Κάηιν, βηνιφγν, γηα ηελ πνιχηηκε βνήζεηά ηνπ θαηά ηε δηεμαγσγή ησλ πεηξακάησλ πνπ αθνξνχζαλ ηηο δηαδηθαζίεο κνξηαθήο ηαπηνπνίεζεο ησλ κηθξννξγαληζκψλ. Ννησζσ επίζεο ηελ αλάγθε λα επραξηζηήζσ ην πξνζσπηθφ ηνπ εξγαζηεξίνπ Μεραληθήο Σξνθίκσλ θαη ηδηαίηεξα ηελ θ. Καιηνχ Μαξία γηα ηε βνήζεηα πνπ κνπ πξνζέθεξε θαηά ηε δηεμαγσγή ησλ πεηξακάησλ, φπσο θπζηθά θαη ηνλ ππνςήθην iv

5 δηδάθηνξα Κπξηηζάθε Κσλζηαληίλν γηα ηελ πνιχηηκε ζπκβνιή ηνπ ζηελ εμνηθείσζή κνπ κε νξηζκέλεο εμεηδηθεπκέλεο δηαδηθαζίεο θαη κεραλήκαηα. Δπραξηζηψ αθφκε ζεξκά ην πξνζσπηθφ ηνπ εξγαζηεξίνπ Μηθξνβηνινγίαο & Τγηεηλήο Σξνθίκσλ γηα ηε ζπλεξγαζία θαη ηελ θαηαλφεζή ηνπο θαη ηδηαίηεξα ζα πξέπεη λα ζηαζψ θαη λα επραξηζηήζσ ηελ θ. Δπγελία Υαξηησλίδνπ γηα ηε βνήζεηά ηεο θαη ηε κφληκα επράξηζηε δηάζεζή ηεο. Ζ θ. Υαξηησλίδνπ κε βνήζεζε ηδηαίηεξα ζηελ πξνζαξκνγή κνπ ζε έλαλ θαηλνχξγην γηα κέλα ρψξν. Δπίζεο, επραξηζηψ πνιχ ηελ ππνςήθηα δηδάθηνξα, θ. Μπνδνχδε Γέζπνηλα γηα ηηο ζπκβνπιέο θαη ηελ ακέξηζηε βνήζεηά ηεο. Δπραξηζηψ αθφκε ηε κεηαδηδαθηνξηθή εξεπλήηξηα θ. Mπνζλέα Λνπινχδα γηα ηηο πνιχηηκεο ζπκβνπιέο ηεο θαηά ηε δηάξθεηα εθπφλεζεο ησλ πεηξακάησλ. Δπραξηζηψ βέβαηα ζεξκά ην θίιν κνπ θαη κεηαπηπρηαθφ θνηηεηή ηνπ Σνκέα θ. Υαζεθηφγινπ Αζαλάζην γηα ηηο γλψζεηο, ηε δηάζεζε θαη ηε βνήζεηα πνπ κνπ πξνζέθεξε θαζφιε ηε δηάξθεηα ησλ κεηαπηπρηαθψλ κνπ ζπνπδψλ. Δπραξηζηψ ηέινο φινπο ηνπο ππνςήθηνπο δηδάθηνξεο θαζψο θαη ηνπο πξνπηπρηαθνχο θαη κεηαπηπρηαθνχο θνηηεηέο ηνπ Σνκέα πνπ βνήζεζαλ ν θαζέλαο κε ην δηθφ ηνπ ηξφπν ζηελ νινθιεξσζε απηήο ηεο εξγαζίαο. Ζ παξνχζα δηαηξηβή αθηεξψλεηαη ζηνπο γνλείο κνπ θαη ζηε ζχληξνθφ κνπ, σο δείγκα επγλσκνζχλεο γηα φηη κνπ έρνπλ πξνζθέξεη. v

6 Πεξίιεςε Αληηθείκελν ηεο παξνχζαο εξγαζίαο ήηαλ ε αμηνπνίεζε ηνπ ζηεξενχ ππνιείκκαηνο ηεο θνζθίληζεο ησλ πγξψλ απνβιήησλ (OMW S ) ελφο ειαηνπξγείνπ ηξηψλ θάζεσλ, κέζσ θπζηθήο δχκσζεο ζε 6% NaCl, κε ζηφρν ηελ παξαζθεπή ελφο πξντφληνο ηχπνπ πάζηαο ειηάο. Καηά ηελ παξαιαβή ηνπ πιηθνχ θαη θαηά ηε δηάξθεηα ηεο δχκσζεο, κειεηήζεθαλ κηθξνβηνινγηθά (εληεξνβαθηήξηα, ςεπδνκνλάδεο, ζηαθπιφθνθθνη, γαιαθηηθά βαθηήξηα, δχκεο, κχθεηεο, νιηθή κεζφθηιε ρισξίδα) θαη θπζηθνρεκηθά ραξαθηεξηζηηθά (πγξαζία, ph, νμχηεηα, νιηθέο θαηλνιηθέο νπζίεο, δηαιπηά ζηεξεά ζπζηαηηθά). Δπηπιένλ, εμεηάζηεθαλ νη βηνρεκηθέο δξαζηεξηφηεηεο ηεο επηθξαηνχζαο κηθξνρισξίδαο (παξαγσγή ησλ ελδχκσλ θαηαιάζεο, πξσηεάζεο, μπιαλάζεο, πνιπγαιαθηνπξνλάζεο, ιηπάζεο, εζηεξάζεο & β-γιπθνζηδάζεο) θαη έγηλε κνξηαθή ηαπηνπνίεζή ηεο κε RFLP (Restriction Fragment Length Polymorphism). Μεηά ηε δχκσζε, έγηλε παξαζθεπή ελφο πξντφληνο ηχπνπ πάζηαο ειηάο απφ ην δπκνχκελν ζηεξεφ ππφιεηκκα θαη αθνινχζεζε νξγαλνιεπηηθφο έιεγρφο ηνπ θαη ζχγθξηζή ηνπ κε πάζηα ειηάο ηνπ εκπνξίνπ θαη πάζηα απφ επηηξαπέδηεο ειηέο ηνπ Αγξνθηήκαηνο ηνπ Α.Π.Θ. Ο κηθξνβηνινγηθφο έιεγρνο έδεημε φηη ε επηθξαηνχζα κηθξνρισξίδα θαηά ηε δχκσζε ηνπ OMWs ήηαλ νη δχκεο. Σν δπκνχκελν OMWs απνδείρζεθε κηθξνβηνινγηθά αζθαιέο ιφγσ απνπζίαο εληεξνβαθηεξίσλ, ςεπδνκνλάδσλ θαη ζηαθπινθφθθσλ θαη θπζηθνρεκηθά απνδεθηφ. Eπίζεο, ε εμέηαζε ησλ βηνρεκηθψλ δξαζηεξηνηήησλ ησλ δπκψλ πνπ απνκνλψζεθαλ απφ ην OMWs, έδεημε φηη ε επηθξαηνχζα κηθξνρισξίδα έρεη δξαζηεξηφηεηα β-γιπθνζηδάζεο, ε νπνία είλαη πνιχ ζεκαληηθή γηα ηε δηάζπαζε ηεο ειεπξσπαΐλεο θαη ηελ απνκάθξπλζε ηεο πηθξήο γεχζεο. Απφ ηα 30 ζηειέρε δπκψλ πνπ ηαπηνπνηήζεθαλ κε κνξηαθέο κεζφδνπο, ηα 28 βξέζεθε λα αλήθνπλ ζην είδνο Saccharomyces cerevisiae κε 99% νκνινγία θαη κφιηο 2 ζε είδε ηνπ γέλνπο Pichia κε 99% νκνινγία θαη ζην είδνο Pichia membranifaciens κε 95% νκνινγία. ηειέρε πνπ αλήθνπλ ζε απηά ηα είδε ζα κπνξνχζαλ λα ρξεζηκνπνηεζνχλ σο θαιιηέξγεηεο εθθίλεζεο πξνθεηκέλνπ λα εμαζθαιίζνπλ ηε γξήγνξε επηθξάηεζε ηεο επηζπκεηήο κηθξνρισξίδαο θαη λα απνθεπρζνχλ αλσκαιίεο θαηά ηελ δηαδηθαζία ηεο δχκσζεο. O νξγαλνιεπηηθφο έιεγρνο ηνπ πξντφληνο ηχπνπ πάζηαο ειηάο πνπ παξαζθεπάζηεθε έδεημε επίζεο φηη ηα vi

7 πνηνηηθά ηνπ ραξαθηεξηζηηθά ήηαλ παξφκνηα ζπγθξηλφκελα κε ηα αληίζηνηρα απφ πάζηεο ειηάο ηνπ εκπνξίνπ. vii

8 Abstract Σo exploit the solid residue (OMW S ) of olive mill wastewaters (OMW) towards the production of an olive paste - type product, the natural fermentation in 6% sodium chloride of OMWs was implemented. The microbiological (enterobacteria, pseudomonas, staphylococcus, lactic acid bacteria, yeasts, moulds, total mesophilic counts) and physicochemical (moisture, ph, acidity, total phenolic compounds, total soluble solids) characteristics of OMW S were studied during fermentation. Further, predominant microflora was identified by molecular means (RFLP) and its biochemical activities were examined. Following fermentation, an olive paste - type product was produced from OMW S, which was tested organoleptically. Microbiological examination of OMWs samples revealed that fermentation of OMWs relies on yeasts. The fermented OMW S proved microbiologically safe due to the absence of enterobacteria, pseudomonas and staphylococcus and its physicochemical characteristics were acceptable. The most important biochemical activity was the appearance of strong b-glucosidase activity thus removing the bitter taste. Molecular identification of 30 yeasts isolates showed that 28 strains belong to the species Saccharomyces cerevisiae (99% homology) and only 2 belong to species of the genus Pichia (99% homology) and species Pichia membranifaciens (95% homology). Strains belonging to these yeast species could be used as starters in order to ensure the fast prevalence of desirable microflora and avoid abnormalities during fermentation process. The sensory testing of the product revealed that the qualitative characteristics were similar compared to those from commercial olive pastes. viii

9 Δπξεηήξην πηλάθσλ 1. Πίλαθαο 2.1. Πνζφηεηεο απνβιήησλ σο ζπλάξηεζε ηεο επηιεγφκελεο κεζφδνπ εμαγσγήο ειαηνιάδνπ Πίλαθαο 2.2. Δθηηκψκελνη φγθνη πγξψλ απνβιήησλ ειαηνπξγείσλ πξνθαινχκελνη απφ ηε δηαδηθαζία παξαγσγήο ειαηνιάδνπ Πίλαθαο 2.3. Υεκηθή ζχλζεζε ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ Πίλαθαο 2.4. Μεηξήζεηο κηθξνβηαθψλ νκάδσλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείνπ απφ δηαθνξεηηθέο πεξηνρέο Πίλαθαο 2.5. Μεηξήζεηο κηθξνβηαθψλ θπηηάξσλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείνπ απφ δηαθνξεηηθέο ιίκλεο Πίλαθαο 2.6. Bηνρεκηθέο δνθηκέο γηα ζηειέρε δπκψλ απνκνλσκέλα απφ δηαθνξεηηθέο πνηθηιίεο επηηξαπέδησλ ειηψλ θαη δηαθνξεηηθέο κεζφδνπο βηνκεραληθήο δχκσζεο Πίλαθαο 2.7. Καηαλνκή ζηειερψλ δπκψλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείσλ Πίλαθαο 2.8. Καηαλνκή ζηειερψλ κπθήησλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείσλ Πίλαθαο 2.9. Μχθεηεο απνκνλσκέλνη απφ δηαθνξεηηθέο ιίκλεο απφζεζεο ΟΜW. Γηαθξίλεηαη ν αξηζκφο ζηειερψλ πνπ απνκνλψζεθε απφ θάζε ιίκλε Πίλαθαο Xξήζεηο ησλ ππνπξντφλησλ ησλ ειαηνπξγείσλ Πίλαθαο Μειέηεο βηνκεηαηξνπήο πγξψλ θαη ζηεξεψλ απνβιήησλ ηξηθαζηθψλ θαη δηθαζηθψλ ειαηνπξγείσλ ζε ρξήζηκα πξντφληα Πίλαθαο 4.1. Μηθξνρισξίδεο πνπ κειεηήζεθαλ, αληίζηνηρα ππνζηξψκαηα, κέζνδνη εκβνιηαζκνχ θαη ζπλζήθεο επψαζεο Πίλαθαο 4.2. πζηαηηθά ησλ αληηδξάζεσλ πέςεο κε ηα έλδπκα πεξηνξηζκνχ EcoRI, HaeIII θαη HinfI Πίλαθαο 4.3. Οη ζέζεηο αλαγλψξηζεο αιιεινπρηψλ βάζεσλ θαζψο θαη ηα ηκήκαηα πνπ πξνθχπηνπλ κεηά ηελ πέςε ηνπ γνληδίνπ 5.8S rrna κε ηα έλδπκα EcoRI, HaeIII θαη HinfI ζχκθσλα κε ην πξφγξακκα Nebcutter γηα ζηειέρε 841 δεπγψλ βάζεσλ (bp) Πίλαθαο 4.4. Οη ζέζεηο αλαγλψξηζεο αιιεινπρηψλ βάζεσλ θαζψο θαη ηα ηκήκαηα πνπ πξνθχπηνπλ κεηά ηελ πέςε ηνπ γνληδίνπ 5.8S rrna κε ηα έλδπκα EcoRI, HaeIII θαη HinfI ζχκθσλα κε ην πξφγξακκα Nebcutter γηα ζηειέρε 425 bp ix

10 16. Πίλαθαο 4.5. χζηαζε παζηψλ ειηάο απφ επηηξαπέδηεο ειηέο (πάζηα Α), απφ πνιηφ ειηάο OMWs (πάζηα Β) θαη εκπνξίνπ (πάζηα Γ) Πίλαθαο 5.1. Πιεζπζκνί κηθξννξγαληζκψλ (log (cfu/g)) κεηά απφ 0, 2, 5, 7, 10 θαη 14 εκέξεο απφ ηελ έλαξμε δχκσζεο ησλ ΟΜWs κε 6% NaCl Πίλαθαο 5.2. Αξηζκφο ζηειερψλ δπκψλ θαη έληαζε αληίδξαζεο ζηηο βηνρεκηθέο δνθηκέο Πίλαθαο 5.3. Σα θπξίαξρα είδε δπκψλ πνπ ηαπηνπνηνχληαη κε κνξηαθέο κεζφδνπο ζπρλά απνκνλσκέλα απφ επηηξαπέδηεο ειηέο ζχκθσλα κε ηνλ ηχπν πξνεηνηκαζίαο, ηελ πνηθηιία ηεο ειηάο θαη ηε ρψξα Πίλαθαο 5.4. Γηαθνξνπνίεζε ζηειερψλ δπκψλ κε βάζε ηηο βηνρεκηθέο δνθηκέο Πίλαθαο 5.5. Οκαδνπνίεζε ζηειερψλ δπκψλ κε βάζε ηηο βηνρεκηθέο δνθηκέο Πίλαθαο 5.6. Tαπηφηεηεο αιιεινπρίαο ησλ ζηειερψλ κε ηα νπνία ζπγθξίζεθαλ ηα δηθά καο ζηειέρε ζηε βάζε δεδνκέλσλ ηνπ NCBI Πίλαθαο 5.7. Φπζηθνρεκηθά ραξαθηεξηζηηθά θαηά ηε δηάξθεηα ηεο δχκσζεο ηνπ ζηεξενχ ππνιείκκαηνο θνζθίληζεο ησλ πγξψλ απνβιήησλ ζε άικε 6% x

11 Eπξεηήξην ζρεκάησλ 1. Σρήκα 2.1. Ρνή παξαιαβήο ειαηνιάδνπ ζηελ παξαδνζηαθή κέζνδν ηεο πίεζεο Σρήκα 2.2. Ρνή παξαιαβήο ειαηνιάδνπ ζε θπγνθεληξηθφ ζχζηεκα δχν θάζεσλ Σρήκα 2.3. Ρνή παξαιαβήο ειαηνιάδνπ ζε θπγνθεληξηθφ ζχζηεκα ηξηψλ θάζεσλ Σρήκα 4.1. Κακπχιε αλαθνξάο δηαιπκάησλ γαιιηθνχ νμένο γλσζηψλ ζπγθεληξψζεσλ Σρήκα 5.1. Κακπχιεο αλάπηπμεο κηθξννξγαληζκψλ ζην ζηεξεφ ππφιεηκκα θνζθίληζεο πγξψλ απνβιήησλ θαηά ηε δηάξθεηα ηεο δχκσζεο 14 εκεξψλ Σρήκα 5.2. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο θαηαιάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην κέγεζνο ησλ θπζαιίδσλ) Σρήκα 5.3. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο πξσηεάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή, 3,1-4,0: πνιχ ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο) Σρήκα 5.4. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο εζηεξάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο) Σρήκα 5.5. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο πνιπγαιαθηνπξνλάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-2,1: αζζελήο, 2,1-4,0: κέηξηα, 4,1-6,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο) Σρήκα 5.6. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο β-γιπθνζηδάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1: αζζελήο, 1-2: κέηξηα, 2-3: ηζρπξή, 3-4: πνιχ ηζρπξή). (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ηελ έληαζε ηνπ ζθνχξνπ ρξψκαηνο γχξσ απφ ηηο απνηθίεο) Σρήκα 5.7. χγθξηζε ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ηνπ πξηκνδφηε ITS 1 γηα ην ζηέιερνο (Query) κε ηελ αληίζηνηρε ζηειέρνπο Saccharomyces cerevisiae (Sbjct) θαη νκνινγία απηψλ (99%) xi

12 12. Σρήκα 5.8. χγθξηζε ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ηνπ πξηκνδφηε ITS 1 γηα ην ζηέιερνο (Query) κε ηελ αληίζηνηρε ζηειέρνπο πνπ αλήθεη ζε είδνο ηνπ γέλνπο Pichia (Sbjct) θαη νκνινγία απηψλ (99%). Ζ νκνινγία είλαη 95% κε ζηέιερνο Pichia membranifaciens var. manchurica Σρήκα 5.9. Απνηειέζκαηα νξγαλνιεπηηθνχ ειέγρνπ ησλ ραξαθηεξηζηηθψλ ηεο πάζηαο απφ επηηξαπέδηεο ειηέο (ΔΔ), ηεο πάζηαο πνιηνχ ειηάο (OMW) θαη ηεο πάζηαο ειηάο ηνπ εκπνξίνπ (ΔΜΠ). Γηα ην θάζε ραξαθηεξηζηηθφ, νη ηηκέο κε ην ίδην γξάκκα δελ έρνπλ ζηαηηζηηθψο ζεκαληηθή δηαθνξά ζε επίπεδν P< xii

13 Eπξεηήξην εηθόλσλ 1. Δηθόλα 2.1. Καηαλνκή βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πεξηβάιινληα πγξψλ απνβιήησλ Δηθόλα 2.2. Καηαλνκή κέζα ζηα Gammaproteobacteria θαη Betaproteobacteria βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ Δηθόλα 2.3. Καηαλνκή κέζα ζηα Alphaproteobacteria θαη Firmicutes βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ Δηθόλα 2.4. Καηαλνκή κέζα ζηα Actinobacteria θαη Bacteroidetes βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ Δηθόλα 2.5. Καηαλνκή κπθεηνινγηθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ Δηθόλα 2.6. Μέζνδνο δνλνχκελνπ θπθιηθνχ θνζθίλνπ (α) θαη ε αξρή ιεηηνπξγίαο ηεο (β) Δηθόλα 2.7. Γπλαηέο ρξήζεηο θαη κηθξνβηαθή αμηνπνίεζε ησλ απνβιήησλ ειαηνπξγείνπ Δηθόλα 4.1. (α) Μεραληθφ δνλνχκελν θφζθηλν δηαρσξηζκνχ πγξψλ απνβιήησλ, (β) εηθνληθή αλαπαξάζηαζε ηνπ ζπζηήκαηνο δηαρσξηζκνχ πγξψλ απνβιήησλ. ην αξηζηεξφ δνρείν θαηεπζχλνληαη ηα πγξά (OMW L ) θαη ζην δεμί δνρείν ηα ζηεξεά κέξε ηνπ θαηζίγαξνπ (OMWs) Δηθόλα 4.2. (α) Σν δεχγνο ησλ πξηκνδνηψλ (primers) πνπ ρξεζηκνπνηήζεθε (β) rrna γνλίδηα πνπ δείρλνπλ ηε ζέζε ησλ πξηκνδνηψλ ITS1 θαη ITS Δηθόλα 5.1. Πξντφληα ελίζρπζεο PCR ησλ ζηειερψλ (2), (3), (4), (5), (6), (7), (8) θαη κάξηπξαο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder/ Ηnvitrogen) (1) Δηθόλα 5.2. Πξντφληα ελίζρπζεο PCR ησλ ζηειερψλ (2), (3), (4), (5), (6), (7), (8), (9) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (1) Δηθόλα 5.3. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7) θαη (8). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ EcoRI (δηαδξνκέο 2-8) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκή 1) xiii

14 13. Δηθόλα 5.4. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7) θαη (8), (9), (10) θαη (11). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HaeIII (δηαδξνκέο 2-11) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκέο 1, 12). ηε δηαδξνκή 13 απεηθνλίδεηαη ην πξντφλ ελίζρπζεο PCR Δηθόλα 5.5. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (1), (2), (3), (4), (5) θαη (6), (7), (8), (9) θαη (10). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HaeIII (δηαδξνκέο 1-10) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Ηnvitrogen) (δηαδξνκή 11) Δηθόλα 5.6. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7)., (8), (9), (10)., (11), (12), (13) θαη (14). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HinfI (δηαδξνκέο 2-14) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκή 1) Δηθόλα 5.7. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7)., (8), (9), (10), (11), (12), (13) θαη (14). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HinfI (δηαδξνκέο 2-13) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder /Invitrogen) (δηαδξνκή 1) xiv

15 ΠΔΡΗΔΥΟΜΔΝΑ 1. ΔΗΑΓΩΓΖ ΑΝΑΚΟΠΖΖ ΒΗΒΛΗΟΓΡΑΦΗΑ Τγξά απόβιεηα ειαηνπξγείσλ Σν πξφβιεκα Υαξαθηεξηζηηθά πγξψλ απνβιήησλ ειαηνπξγείνπ Δίδε απνβιήηωλ Φπζηθνρεκηθά ραξαθηεξηζηηθά Μηθξνβηνινγηθά ραξαθηεξηζηηθά Μηθξνβηαθή ρισξίδα ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ Πνηθηινκνξθία βαθηεξίσλ ζηα πγξά απφβιεηα ειαηνπξγείσλ Πνηθηινκνξθία δπκψλ θαη κπθήησλ ζηα πγξά απφβιεηα ειαηνπξγείσλ Μέζνδνη ηαπηνπνίεζεο δπκψλ Μέζνδνη κεηαρείξηζεο ησλ πγξώλ απνβιήησλ ειαηνπξγείσλ Μηθηέο κέζνδνη επεμεξγαζίαο Οινθιεξσκέλεο κέζνδνη επεμεξγαζίαο Γηαρείξηζε πγξώλ απνβιήηωλ ειαηνπξγείωλ (ΟΟΜW) κε ζπκπαξαγωγή ζθόλεο ειηάο, πξνϊόληνο ηύπνπ πάζηαο ειηάο θαη ελζπιαθωκέλωλ πνιπθαηλνιώλ Δπαλαρξεζηκνπνίεζε θαη εθαξκνγή ππνπξντόλησλ Βηνκεηαηξνπή ζε ρξήζηκα πξντφληα Παξαζθεπή πξνϊόληνο ηύπνπ πάζηα ειηάο Μειινληηθέο ηάζεηο ΑΝΣΗΚΔΗΜΔΝΗΚΟ ΚΟΠΟ ΣΖ ΜΔΛΔΣΖ ΤΛΗΚΑ ΚΑΗ ΜΔΘΟΓΟΗ Παξαζθεπή δεηγκάησλ Πεηξακαηηθόο ζρεδηαζκόο.. 59 xv

16 4.3. Αλαιπηηθή πεξηγξαθή ηεο κεζνδνινγίαο ησλ κεηξήζεσλ Μηθξνβηνινγηθέο θαη θπζηθνρεκηθέο αλαιχζεηο Mειέηε ηεο εμέιημεο ηωλ ελδνγελώλ κηθξνριωξίδωλ θαηά ηε δηάξθεηα ηεο δύκωζεο Απνκόλωζε επηθξαηνύζαο κηθξνριωξίδαο Μειέηε ηεο κνξθνινγίαο ηεο επηθξαηνύζαο κηθξνριωξίδαο κε κηθξνζθόπεζε Μειέηε ηωλ βηνρεκηθώλ δξαζηεξηνηήηωλ ηεο επηθξαηνύζαο κηθξνριωξίδαο Γξαζηεξηφηεηα θαηαιάζεο Γξαζηεξηφηεηα πξσηεάζεο Γξαζηεξηφηεηα μπιαλάζεο Γξαζηεξηφηεηεο ιηπάζεο θαη εζηεξάζεο Γξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο Γξαζηεξηφηεηα β-γιπθνζηδάζεο Ταπηνπνίεζε επηθξαηνύζαο κηθξνριωξίδαο κε κνξηαθέο κεζόδνπο Απνκφλσζε DNA Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) Πνιπκνξθηζκφο κήθνπο ζξαχζκαηνο απφ έλδπκν πεξηνξηζκνχ γελσκηθνχ DNA (RFLP) Αλάιπζε αθνινπζίαο Μειέηε θπζηθνρεκηθώλ ραξαθηεξηζηηθώλ θαηά ηε δηάξθεηα ηεο δύκωζεο Πξνζδηνξηζκφο ph Πξνζδηνξηζκφο πγξαζίαο Πξνζδηνξηζκφο νιηθψλ θαηλνιηθψλ ελψζεσλ Πξνζδηνξηζκφο νιηθήο νμχηεηαο Πξνζδηνξηζκφο δηαιπηψλ ζηεξεψλ ζπζηαηηθψλ Παξαζθεπή θαη νξγαλνιεπηηθφο έιεγρνο πξντφληνο ηχπνπ πάζηαο ειηάο xvi

17 Δλζωκάηωζε 6% NaCl Έθπιπζε ηνπ πιηθνύ Παξαζθεπή πξνϊόληνο ηύπνπ πάζηαο ειηάο Οξγαλνιεπηηθόο έιεγρνο ηαηηζηηθή αλάιπζε ΑΠΟΣΔΛΔΜΑΣΑ ΚΑΗ ΤΕΖΣΖΖ Μηθξνβηνινγηθά ραξαθηεξηζηηθά ησλ OMWs Δθηίκεζε ηνπ πιεζπζκνχ ηεο νιηθήο κεζφθηιεο αεξφβηαο ρισξίδαο Δθηίκεζε ηνπ πιεζπζκνχ ησλ γαιαθηηθψλ βαθηεξίσλ Δθηίκεζε ηνπ πιεζπζκνχ δπκψλ θαη κπθήησλ Δθηίκεζε ηνπ πιεζπζκνχ ησλ εληεξνβαθηεξίσλ θαη ςεπδνκνλάδσλ Δθηίκεζε ηνπ πιεζπζκνχ ηεο ζηαθπινθφθθσλ Μνξθνινγηθά ραξαθηεξηζηηθά ηεο επηθξαηνύζαο κηθξνρισξίδαο Βηνρεκηθέο δξαζηεξηόηεηεο επηθξαηνύζαο κηθξνρισξίδαο Γξαζηεξηφηεηα θαηαιάζεο Γξαζηεξηφηεηα πξσηεάζεο Γξαζηεξηφηεηα μπιαλάζεο Γξαζηεξηφηεηεο ιηπάζεο θαη εζηεξάζεο Γξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο Γξαζηεξηφηεηα β-γιπθνζηδάζεο Σαπηνπνίεζε επηθξαηνύζαο κηθξνρισξίδαο κε κνξηαθέο κεζόδνπο Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) Πνιπκνξθηζκφο κήθνπο ζξαχζκαηνο απφ έλδπκν πεξηνξηζκνχ DNA. 100 xvii

18 Αλάιπζε αθνινπζίαο Μειέηε θπζηθνρεκηθώλ ραξαθηεξηζηηθώλ θαηά ηε δηάξθεηα ηεο δύκσζεο Οξγαλνιεπηηθόο έιεγρνο ΤΜΠΔΡΑΜΑΣΑ ΒΗΒΛΗΟΓΡΑΦΗΑ xviii

19 1. ΔΗΑΓΩΓΖ Σα απφβιεηα ησλ ειαηνπξγείσλ ζπγθαηαιέγνληαη ζηα ηδηαίηεξα ηνμηθά, απφ άπνςε ξππαληηθνχ θνξηίνπ, αγξνηνβηνκεραληθά απφβιεηα. Γεδνκέλνπ φηη απφ 1 ηφλν επεμεξγάζηκνπ ειαηνθάξπνπ παξάγνληαη κφιηο 200 θηιά ειαηφιαδν θαη ηαπηφρξνλα ιίηξα πγξά απφβιεηα θαη θηιά ζηεξεά απφβιεηα (αλάινγα κε ηε κέζνδν πνπ ρξεζηκνπνηείηαη), γίλεηαη εχθνια αληηιεπηφ φηη ε ξχπαλζε πνπ πξνθαιείηαη απφ ηα ειαηνπξγεία είλαη έλα απφ ηα ζεκαληηθφηεξα πεξηβαιινληηθά πξνβιήκαηα πνπ απαζρνινχλ ηηο ρψξεο ηεο Μεζνγείνπ (www.bcua.org). Σα κεγαιχηεξα πξνβιήκαηα δεκηνπξγνχληαη απφ ηα πγξά απφβιεηα ησλ ειαηνπξγείσλ. Σα απφλεξα απηά, φπσο πξνθχπηνπλ απφ ηα ειαηνηξηβεία, εθρχλνληαη αξθεηέο θνξέο, κέρξη θαη ζήκεξα, ζε θνληηλνχο πδάηηλνπο απνδέθηεο φπσο ξεκαηηέο, πνηάκηα, ιίκλεο θαη ζάιαζζεο. ηηο πεξηπηψζεηο απηέο δεκηνπξγνχληαη ηεξάζηηα πξνβιήκαηα κφιπλζεο ησλ ππνγείσλ πδάησλ ιφγσ ηεο ηνμηθφηεηαο ησλ απνβιήησλ, θαζψο θαη κία γεληθφηεξε ππνβάζκηζε ηνπ πεξηβάιινληνο γχξσ απφ ηα ειαηνηξηβεία. Δίλαη ζχλεζεο ην θαηλφκελν ηεο θαηαζηξνθήο ησλ πδάηηλσλ ζπζηεκάησλ ζηα ζεκεία απφξξηςεο ησλ απνβιήησλ απηψλ, ιφγσ ηεο έιιεηςεο νμπγφλνπ πνπ παξαηεξείηαη (θαηαλαιψλεηαη γηα ηελ νμείδσζε ησλ νξγαληθψλ νπζηψλ), απφ νκάδεο κηθξννξγαληζκψλ πνπ αλαπηχζζνληαη θαη επηθξαηνχλ ζε απηνχο ηνπο απνδέθηεο. Eπηπξφζζεηα, πέξαλ ηνπ φηη ε πςειή ζπγθέληξσζε ζθνπξφρξσκσλ πνιπθαηλνιψλ κπνξεί λα απνρξσκαηίζεη ξπάθηα θαη πνηάκηα (Mc Namara et al., 2008), ζάθραξα θαη θψζθνξνο κπνξνχλ λα δηεγείξνπλ αληηζηνίρσο ηε κηθξνβηνινγηθή αλαπλνή, ηε κείσζε ηεο ζπγθέληξσζεο νμπγφλνπ θαη λα νδεγήζνπλ ζηνλ επηξνθηζκφ (Mc Namara et al, 2008). Ζ απφζεζε ησλ πγξψλ απνβιήησλ απεπζείαο ζην έδαθνο κπνξεί λα επεξεάζεη θπζηθέο θαη ρεκηθέο ηδηφηεηεο, φπσο ην ph θαη ην πνξψδεο (Niaounakis and Halvadakis, 2006). Παξφια απηά, ην θχξην κεηνλέθηεκα γηα ηελ απεπζείαο ρξήζε ησλ πγξψλ απνβιήησλ ζηελ άξδεπζε είλαη ην πςειφ πεξηερφκελν ηνπο ζε θαηλνιηθέο ελψζεηο πνπ έρνπλ θπηνηνμηθή επίδξαζε θαη κπνξνχλ λα αλαζηείινπλ ηε θχηξσζε ησλ ζπφξσλ (Niaounakis and Halvadakis, 2006). 1

20 Καζψο ηα πγξά απφβιεηα ησλ ειαηνπξγείσλ (Olive Mill Wastewaters - ΟMW ή ΟΟΜW) παξάγνληαη κφλν ζηελ πεξηνρή ηεο Μεζνγείνπ, ε πνιηηηθή ηεο Δπξσπατθήο Έλσζεο δελ έρεη δψζεη θάπνηα θαηεπζπληήξηα γξακκή γηα ηε δηαρείξηζή ηνπο. Ζ νδεγία 91/271/ΔΔC ηνπ ζπκβνπιίνπ ηεο Δπξσπατθήο Έλσζεο πάλσ ζηελ Γηαρείξηζε Αζηηθψλ Τγξψλ Απνβιήησλ αθνξά ηελ πξνζηαζία ηνπ πεξηβάιινληνο απφ ηηο δπζκελείο επηδξάζεηο ησλ αζηηθψλ θαη βηνκεραληψλ ηξνθίκσλ πγξψλ απνβιήησλ. Ζ απνηειεζκαηηθή δηαρείξηζε ζα έπξεπε επνκέλσο λα εθαξκνζηεί πξηλ ηα πγξά απφβιεηα απνηεζνχλ ζε πδάηηλνπο απνδέθηεο, ελψ ηα κεηαρεηξηδφκελα πγξά απφβιεηα ζα έπξεπε λα επαλαρξεζηκνπνηεζνχλ φηαλ είλαη θαηάιιεια (Εaharaki and Komnitsas, 2009). χκθσλα κε ηα πξναλαθεξφκελα, ηα νκνγελνπνηεκέλα, ηα κε θηιηξαξηζκέλα θαη ηα κε θπγνθεληξηκέλα πγξά απφβιεηα δε ζα έπξεπε λα ππεξβαίλνπλ ηα φξηα 25 θαη 125 mg/l Ο 2 ησλ BOD θαη COD αληηζηνίρσο. Ζ κέγηζηε επηηξεπφκελε ζπγθέληξσζε θαηλνιψλ, νιηθψλ δηαιπηψλ ζηεξεψλ, νιηθνχ θσζθφξνπ θαη νιηθνχ αδψηνπ είλαη 1, 35, 2 θαη 15 mg/l, αληηζηνίρσο (Εaharaki and Komnitsas, 2009). Οη πξαθηηθέο πνπ ζπλήζσο εθαξκφδνληαη πεξηιακβάλνπλ ηελ απφζεζε ζην έδαθνο, ηελ εθβνιή ζε θνληηλά πνηάκηα, ιίκλεο ή ζάιαζζεο θαη ηελ απνζήθεπζε/εμάηκηζε ζε ιίκλεο εμάηκηζεο ή εμαηκηζνδεμακελέο, πξνθαιψληαο έηζη ζνβαξά πεξηβαιινληηθά πξνβιήκαηα, φπσο ε κφιπλζε πδάηηλσλ πεγψλ. Σν δεχηεξν ζεκαληηθφηεξν πξφβιεκα πνπ πξέπεη λα ηνληζηεί ζρεηίδεηαη κε ηελ έιιεηςε ελφο πιαηζίνπ γηα δηαρσξηζκφ ηνπ εδάθνπο απφ ηνπο πδάηηλνπο απνδέθηεο. Ζ παξνπζία νξγαληθήο νπζίαο φπσο θαη πνιιψλ αλφξγαλσλ ελψζεσλ (άδσην, θψζθνξνο, θάιην) πξνθαινχλ ζνβαξή κφιπλζε φηαλ ηα ΟΟΜW απνηίζεληαη ζε πδάηηλα ζψκαηα, αιιά φηαλ απνηίζεληαη ζην έδαθνο ε δηάβξσζε εκπνδίδεηαη θαη κπνξεί λα σθειεζεί ε γνληκφηεηα ηνπ εδάθνπο (Rinaldy et al., 2003, Kapellakis et al., 2008). ηελ Διιάδα δελ ππάξρνπλ ζπγθεθξηκέλνη θαλνληζκνί πνπ λα αθνξνχλ ηελ απφζεζε ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (OOMW). Oη θχξηεο αξρέο γηα ηε δηαρείξηζή ηνπο βαζίδνληαη ζηελ Διιεληθή Ννκνζεζία θαη ζην άξζξν 1650/86 Γηα ηελ Πξνζηαζία ηνπ Πεξηβάιινληνο, ζχκθσλα κε ην νπνίν νη ηδηνθηήηεο ησλ ειαηνπξγείσλ είλαη ππνρξεσκέλνη λα παξέρνπλ κηα κειέηε εθηίκεζεο ησλ πεξηβαιινληηθψλ επηπηψζεσλ. Ζ ελεκεξσκέλε εγθχθιηνο ΤΜ/5784/ (Αξηζκφο 4419/ ) αλαθέξεηαη ζηα πξνβιήκαηα ιφγσ ηεο απφζεζεο ησλ OOMW, ηελ αλάγθε γηα κηα απνηειεζκαηηθή 2

21 πξν-κεηαρείξηζε θαη ηελ απαηηνχκελε θξνληίδα πξνθεηκέλνπ λα απνθεπρζεί ε απφζεζε ζε δηάθνξεο πδάηηλεο πεγέο. Κάζε Ννκαξρία είλαη ππεχζπλε γηα ηελ πηνζέηεζε ησλ θαηάιιεισλ πξαθηηθψλ δηαρείξηζεο ησλ πγξψλ απνβιήησλ ελζαξξχλνληαο δηαθνξεηηθέο πξνζεγγίζεηο δηαρείξηζεο απνβιήησλ (Zaharaki and Komnitsas, 2009). Σν δήηεκα ηεο άδεηαο ιεηηνπξγίαο ελφο ειαηνπξγείνπ ππφθεηηαη ζε κέηξα πνπ ιακβάλνληαη γηα ηε κεηαρείξηζε ησλ πγξψλ απνβιήησλ, φπσο ε πξν-κεηαρείξηζε κε αζβέζηε πξηλ ηελ απφζεζε, πξνκεηαρείξηζε/θιαζκαηνπνίεζε κέζσ θπζηθήο ηδεκαηνπνίεζεο θαη μερσξηζηή δηαρείξηζε ησλ αηνκηθψλ θιαζκάησλ ή απφζεζε ζε θαηαζθεπαζκέλεο αλνηρηέο ιίκλεο. Παξφια απηά δελ ππάξρεη κηα ηερληθή ιχζε, ε νπνία κπνξεί λα εμαζθαιίζεη ηθαλνπνηεηηθή απνηειεζκαηηθφηεηα κεηαρείξηζεο κε έλα θφζηνο εθαξκνγήο κέζα ζηηο νηθνλνκηθέο δπλαηφηεηεο ηνπ θάζε ηδηνθηήηε ειαηνηξηβείνπ, δεδνκέλεο ηεο γεσγξαθηθήο ηνπ ζέζεο θαη ηνπ κεγέζνπο ηνπ ειαηνπξγείνπ ηνπ (Paraskeva and Diamadopoulos, 2006). ηελ Κξήηε, ηα OOMW δηαρένληαλ αλεμέιεγθηα κέρξη ην 1987 ζην πεξηβάιινλ. Πεξίπνπ 80-90% ησλ ζπλνιηθά παξαγφκελσλ πγξψλ απνβιήησλ απνηηζφηαλ ζε πνηάκηα (Voreadou, 1994). Aπφ ηφηε, νη ηνπηθέο δεκφζηεο αξρέο απαγφξεςαλ ηελ αλεμέιεγθηε απφζεζε ζε πδάηηλα ζψκαηα θαη ππνρξέσζαλ ηνπο ηδηνθηήηεο ησλ ειαηνηξηβείσλ λα θαηαζθεπάζνπλ κνλάδεο κεηαρείξηζεο θαη ιεθάλεο εμαηκηζνδηαπλνήο κε ρακειά θφζηε θαηαζθεπήο, ιεηηνπξγίαο θαη δηαηήξεζεο. Γηα λα απνθεπρζεί κηα πηζαλή δηαξξνή ησλ OOMW, έλα ζπκπαγέο ζηξψκα πεινχ ζα έπξεπε λα ηνπνζεηεζεί ζηνλ ππζκέλα ηεο ιίκλεο. Μεηά ηελ εμάηκηζε ησλ πγξψλ απνβιήησλ, ε ηιχο πνπ παξακέλεη κπνξεί λα ελζσκαησζεί ζην έδαθνο (Kapellakis et al., 2002, 2006). Παξάιιεια, πξέπεη λα ζεκεησζεί φηη γηα πνιιέο δεθαεηίεο ππήξραλ ειιείςεηο ζηε λνκνζεζία ζρεηηθά κε ηε δηαρείξηζε θαη ησλ ζηεξεψλ απνβιήησλ, ζπκπεξηιακβαλνκέλσλ θαη ησλ ζηεξεψλ απνβιήησλ απφ ηα ειαηνπξγεία. Απφ ην 1986 θαη κεηά κπήθε ζε εθαξκνγή ε νδεγία ηεο Δπξσπατθήο Έλσζεο (74/442/Δ.Δ., ), ε νπνία πξνηξέπεη ηα θξάηε-κέιε λα ιακβάλνπλ ηα ελδεδεηγκέλα κέηξα γηα ηελ νινθιεξσκέλε δηαρείξηζε ησλ ζηεξεψλ απνβιήησλ (Λπκπεξάηνο θαη ζπλ., 2000). Έηζη θαη ζηε ρψξα καο άξρηζαλ λα ιεηηνπξγνχλ ηα πξψηα ππξελειαηνπξγεία, ηα νπνία πξνζθέξνπλ κία ιχζε ζην πξφβιεκα. Παξ φια απηά, αθφκε θαη ζηηο κέξεο καο, ζε πνιιέο πεξηνρέο ηεο Δπξψπεο ππάξρεη απνπζία νινθιεξσκέλσλ κεζφδσλ δηαρείξηζεο ησλ απνβιήησλ ησλ 3

22 ειαηνπξγείσλ, νη νπνίεο λα κπνξνχλ λα εγγπεζνχλ αθελφο ηελ απνηειεζκαηηθή επεμεξγαζία απηψλ θαη αθεηέξνπ ηε βησζηκφηεηα ηεο ζρεηηθήο επέλδπζεο ή έζησ ην ρακειφ θφζηνο ηεο (θαηαζθεπαζηηθφ θαη ιεηηνπξγηθφ), ψζηε λα κελ επηβαξπλζεί ηειηθά ην ζπλνιηθφ θφζηνο παξαγσγήο ηνπ ειαηφιαδνπ. Όπσο θαη λα είλαη ε θαηάζηαζε κε ηε λνκνζεζία, ζα πξέπεη ζε θάζε πεξίπησζε ε δηαρείξηζε ηφζν ησλ πγξψλ φζν θαη ησλ ζηεξεψλ απνβιήησλ απφ ηα ειαηνπξγεία λα γίλεηαη κε ηέηνην ηξφπν, ψζηε λα δηαζθαιίδεηαη ε δεκφζηα πγεία. Δπίζεο, ζα πξέπεη λα ιακβάλνληαη φια ηα κέηξα γηα ηελ πξνζηαζία ησλ λεξψλ, ηνπ αέξα, ηνπ εδάθνπο, ηεο ρισξίδαο, ηεο παλίδαο, ηνπ ηνπίνπ, ησλ πεξηνρψλ γχξσ απφ απηά πνπ παξνπζηάδνπλ ηδηαίηεξν νηθνινγηθφ, πνιηηηζηηθφ ή θαη αηζζεηηθφ ελδηαθέξνλ θαη δελ ζα πξέπεη λα δεκηνπξγνχληαη ελνριήζεηο απφ νζκέο ή ζνξχβνπο. Δίλαη ινηπφλ επφκελν ζηελ επνρή καο λα γίλνληαη πξνζπάζεηεο, ψζηε λα αλαπηπρζνχλ νινθιεξσκέλεο θαη νηθνλνκηθά βηψζηκεο κέζνδνη επεμεξγαζίαο ησλ απνβιήησλ/παξαπξντφλησλ ησλ ειαηνπξγείσλ, ζε φιεο ζρεδφλ ηηο ρψξεο πνπ αληηκεησπίδνπλ απηφ ην έληνλν πεξηβαιινληηθφ πξφβιεκα (Μπιίθα, 2009). ηηο νινθιεξσκέλεο ηερληθέο ιχζεηο εληάζζνληαη ζπλδπαζκνί ησλ κεζφδσλ επεμεξγαζίαο πγξψλ απνβιήησλ, νη νπνίνη απνβιέπνπλ ζηελ φζν ην δπλαηφ πην νινθιεξσκέλε δηαρείξηζε ησλ απνβιήησλ (επεμεξγαζία θαη δηάζεζε ή αμηνπνίεζε). Δίλαη ζπζηήκαηα πην απνηειεζκαηηθά, φζνλ αθνξά ζηελ πξνζηαζία ηνπ πεξηβάιινληνο, αιιά απαηηνχλ απμεκέλε ηερλνγλσζία θαη ηερληθή ππνζηήξημε θαη πινπνηνχληαη ζηελ πξάμε κε ηε ζπλδξνκή ζπλήζσο ηδησηηθψλ ηερληθψλ εηαηξηψλ. Σα νινθιεξσκέλα ζπζηήκαηα επεμεξγαζίαο ζα πξέπεη λα είλαη επνκέλσο ηερληθά εθηθηά θαη νηθνλνκηθά βηψζηκα, ελψ ηα πξντφληα πνπ πξνθχπηνπλ απφ ηελ εθαξκνγή ηνπο ζα πξέπεη λα είλαη πςειήο πξνζηηζέκελεο αμίαο. Ζ ζηξαηεγηθή δηαρείξηζεο ησλ ΟΟΜW ζα έπξεπε επνκέλσο λα θαηεπζπλζεί πξνο έλα ζπλδπαζκφ ηεο απνηνμίλσζήο ηνπο θαη ηεο ρξήζεο ηνπο γηα ηελ παξαγσγή ρξήζηκσλ παξα πξντφλησλ (Roig et al., 2006, Oreopoulou and Russ, 2007). Με βάζε ιεηηνπξγίαο ην δνλνχκελν θπθιηθφ θφζθηλν (ζχζηεκα Δco Olive Cleaner), ην νπνίν ρξεζηκνπνηείηαη πηινηηθά απφ ην ειαηνπξγείν ησλ αδεξθψλ Αβέξε ζηε Γαιάηηζηα Υαιθηδηθήο πξνηείλεηαη ζηελ παξνχζα εξγαζία ε εθαξκνγή ελφο νινθιεξσκέλνπ ζπζηήκαηνο δηαρείξηζεο απνβιήησλ ειαηνπξγείνπ, ζχκθσλα κε ην 4

23 νπνίν παξάγνληαη πξντφληα πςειήο πξνζηηζέκελεο αμίαο θαη ηδηαίηεξε ζεκαζίαο είλαη ην γεγνλφο φηη φια ηα παξαπξντφληα επεμεξγαζίαο ζπκπεξηιακβαλνκέλνπ θαη ηνπ λεξνχ είλαη 100% αλαθπθιψζηκα. Έλα απφ ηα πξντφληα ηνπ ζπζηήκαηνο απηνχ είλαη έλα πξντφλ ηχπνπ πάζηαο ειηάο. Πην ζπγθεθξηκέλα, ην ζηεξεφ ππφιεηκκα θνζθίληζεο (OMWs) πνπ πξνθχπηεη απφ ηελ εθαξκνγή ηεο κεζφδνπ, ν πνιηφο ειηάο δειαδή πνπ ζπγθεληξψλεηαη θαηά ηνλ δηαρσξηζκφ θάζεσλ ησλ ΟOΜW, κπνξεί λα ζπιιερηεί θαηφπηλ δηαινγήο θαη κε πξνζζήθε άιαηνο λα κεηαηξαπεί ζε "πάζηα" ειηάο πςειήο πνηφηεηαο. Μπνξεί λα νδεγήζεη δειαδή ζε κηα λέα πεγή ηξνθίκνπ πςειήο δηαηξνθηθήο αμίαο (πινχζηα ζε πνιπθαηλφιεο θαη ρακειά ιηπαξά, ππφδεηγκα κεζνγεηαθήο δηαηξνθήο) θαη ρακεινχ θφζηνπο. Ζ παλειιαδηθή εθαξκνγή ηνπ ζπζηήκαηνο ζα κπνξνχζε λα απνθέξεη ρηιηάδεο ηφλνπο ελφο εθιεθηνχ ηξνθίκνπ πςειήο πνηφηεηαο, θαζηζηψληαο άκεζα δηαζέζηκν ζε θάζε Έιιελα έλα πξντφλ πνπ ζήκεξα πσιείηαη σο ληειηθαηέζελ (www.ecoolivecleaner.gr). Παξά ηελ ηζηνξηθή πνξεία θαη ηε ζεκαζία ηεο ειηάο γηα ηελ Διιάδα, ε αγνξά γηα ηελ πάζηα ειηάο ζήκεξα είλαη κηθξή. Απηφ βέβαηα κπνξεί λα δηθαηνινγεζεί, αθνχ ε εηζαγσγή ηνπ πξντφληνο έγηλε πξφζθαηα ζηελ αγνξά θαη σο απνηέιεζκα δελ είλαη γλσζηφ ζην επξχ θαηαλαισηηθφ θνηλφ θαη επηπιένλ γλσξίδνπκε φηη ν θαηαλαισηήο δελ αιιάδεη εχθνια ηηο ζπλήζεηέο ηνπ. Ζ πάζηα ειηάο (ή πνιηφο ειηάο) αθνχ πξνέξρεηαη απφ επεμεξγαζκέλν ειαηφθαξπν, εκπίπηεη ζηελ θαηεγνξία ησλ ηξνθίκσλ θπηηθήο πξνέιεπζεο δηαηεξεκέλσλ κε αιάηη, μχδη, ιάδη ή νηλφπλεπκα (Κψδηθαο Σξνθίκσλ, Πνηψλ θαη Αληηθεηκέλσλ Κνηλήο Υξήζεο, 2003). Σα ραξαθηεξηζηηθά ηεο νξίδνληαη απφ ηελ Δπξσπατθή λνκνζεζία πνπ αλαθέξεηαη ζηνλ ηνκέα ησλ ηξνθίκσλ (Καλνληζκφο 2081/92). Ο θαλνληζκφο απηφο νξίδεη φηη ε πάζηα ειηάο πξέπεη λα έρεη ραξαθηεξηζηηθφ ρξσκαηηζκφ πνπ δελ πξέπεη λα είλαη νχηε πνιχ πξάζηλνο νχηε πνιχ ζθνπξφρξσκνο. Ζ πάζηα πξέπεη λα είλαη παρχξξεπζηε, κε άξσκα ζπγθξίζηκν κε ην ραξαθηεξηζηηθφ άξσκα ηνπ ειαηνιάδνπ (Κπξηηζάθεο, 2007). Eίλαη δειαδή πξνθαλέο φηη ηφζν ε πάζηα ειηάο απφ επηηξαπέδηεο ειηέο φζν θαη ην πξντφλ ηχπνπ πάζηαο ειηάο πνπ πξνθχπηεη κέζσ ηνπ πξνηεηλφκελνπ νινθιεξσκέλνπ ζπζηήκαηνο, δηαηεξνχληαη ζε άικε κέζσ ηεο δηαδηθαζίαο ηεο δχκσζεο. 5

24 Ζ ζπληήξεζε ηξνθίκσλ ζπκπεξηιακβαλνκέλεο ηεο ρξήζεο δχκσζεο δηαθνξεηηθψλ θζαξηψλ αθαηέξγαζησλ πιηθψλ έρεη ρξεζηκνπνηεζεί επξέσο απφ ηνλ άλζξσπν απφ ηε Νενιηζηθή Πεξίνδν (πεξίπνπ ρξφληα π.υ) (Prajapati and Nair, 2003). H επηζηεκνληθή ινγηθή πίζσ απφ ηε δχκσζε μεθίλεζε κε ηελ ηαπηνπνίεζε ησλ κηθξννξγαληζκψλ ην 1965 απφ ηνπο Van Leeuwenhoek θαη Hooke (Gest, 2004). O Παζηέξ αλαθάιεζε ηε ζεσξία ηεο απζφξκεηεο δχκσζεο γχξσ ζην 1859 κέζσ ελφο θνκςά ζρεδηαζκέλνπ πεηξακαηηζκνχ (Wyman, 1862, Farley and Geison, 1974). O ξφινο ελφο κνλαδηθνχ βαθηεξίνπ, ηνπ Bacterium lactis (Lactococcus lactis), ζην δπκνχκελν γάια απνδείρζεθε γχξσ ζην 1877 απφ ηνλ Sir John Lister (Santer, 2010). Ο φξνο δχκσζε, πξνεξρφκελνο απφ ηε Λαηηληθή ιέμε fervere, νξίζηεθε απφ ην Louis Pasteur σο La vie sans l air (δσή ρσξίο αέξα). Απφ κηα βηνρεκηθή νπηηθή ζθνπηά, ε δχκσζε είλαη κηα κεηαβνιηθή δηεξγαζία παξαγσγήο ελέξγεηαο απφ νξγαληθέο ελψζεηο ρσξίο ηελ εκπινθή ελφο εμσγελνχο κέζνπ νμείδσζεο. Ζ δχκσζε παίδεη δηαθνξεηηθνχο ξφινπο ζηε βηνκεραλία νμείδσζεο. Οη θπξηφηεξνη ξφινη είλαη: (1) πληήξεζε ηξνθίκσλ κέζσ ζρεκαηηζκνχ αλαζηαιηηθψλ κεηαβνιηηψλ φπσο έλα νξγαληθφ νμχ (γαιαθηηθφ νμχ, νμηθφ νμχ, θνξκηθφ νμχ, πξνπηνληθφ νμχ), αηζαλφιε, βαθηεξηνζίλεο, θ.ι.π., ζπρλά ζε ζπλδπαζκφ κε κείσζε ηεο δξαζηεξηφηεηαο λεξνχ (κέζσ μήξαλζεο ή ρξήζεο άιαηνο) (Ross et al., 2002, Gaggia et al., 2011). (2) Βειηίσζε ηεο αζθάιεηαο ησλ ηξνθίκσλ κέζσ αλαζηνιήο ησλ παζνγφλσλ (Adams and Mitcell, 2002, Adams and Nicolaides, 2008) ή απνκάθξπλζε ησλ ηνμηθψλ ελψζεσλ (Hammes and Tichaczek, 1994). (3) Bειηίσζε ηεο ζξεπηηθήο αμίαο (Van Boekel et al., 2010, Poutanen et al., 2009). (4) Βειηίσζε ηεο νξγαλνιεπηηθήο πνηφηεηαο ησλ ηξνθίκσλ (Marilley and Casey, 2004, Smith et al., 2005, Lacroix et al., 2010, Sicard and Legras, 2011). Δίηε ζε παξαδνζηαθά δπκνχκελα ηξφθηκα ή σο λέεο επθαηξίεο, ε νξζνινγηθή ρξήζε ησλ κηθξννξγαληζκψλ ζηε δηαηξνθή καο αλνίγεη λέεο πξννπηηθέο. ηα πξφζθαηα ρξφληα, νη κηθξννξγαληζκνί ρξεζηκνπνηήζεθαλ ζε πεξηνρέο δηαθνξεηηθέο απφ ηε παξαδνζηαθή βηνκεραλία ηξνθίκσλ. Γηα παξάδεηγκα ν Lactococcus spp. ρξεζηκνπνηείηαη γηα ηνλ ζεκαληηθφ ηνπ ξφιν ζηνλ εκβνιηαζκφ ελψ θαη άιινη κηθξννξγαληζκνί ρξεζηκνπνηνχληαη επίζεο γηα ηελ εμεηδηθεπκέλε παξαγσγή βηνγελψλ ελψζεσλ (Βνurdichon et al., 2012). 6

25 Οη ζπκβαηηθέο κέζνδνη πνπ θάλνπλ ρξήζε θιαζηθψλ κηθξνβηνινγηθψλ ηερληθψλ πξνζθέξνπλ αθξίβεηα σο πξνο ηελ ηαπηνπνίεζε θαη δηαθνξνπνίεζε ζηειερψλ, ραξαθηεξίδνληαη απφ πνιππινθφηεηα, απαηηνχλ κεγάιν θφζηνο αλαισζίκσλ θαη εζηηάδνληαη ζηε κειέηε κνξθνινγηθψλ, θπζηνινγηθψλ θαη βηνρεκηθψλ ραξαθηεξηζηηθψλ. Δπηπξφζζεηα, ε ρξήζε δηαγλσζηηθψλ θηη API 20C, APIATB 32C, API 50CH, πνπ βαζίδνληαη ζηε κειέηε αλάπηπμεο ησλ κηθξννξγαληζκψλ παξνπζία ζπγθεθξηκέλσλ πεγψλ άλζξαθα θαη αδψηνπ, απινπνίεζε ηε δηαδηθαζία, δίλνληαο απνηειέζκαηα ηαπηνπνίεζεο κέζα ζε 48 ψξεο (Lafon-Lafourcade and Joyeux, 1979, Subden et al., 1980, Ison, 1987, Lin and Fung, 1987, Deak and Beuchat, 1988, Rohm et al., 1990). Δπηπιένλ δνθηκέο, φπσο ε κειέηε ησλ βηνρεκηθψλ δξαζηεξηνηήησλ ησλ κηθξννξγαληζκψλ (δνθηκή θαηαιάζεο, πξσηεάζεο, ιηπάζεο, εζηεξάζεο, μπιαλάζεο, πνιπγαιαθηνπξνλάζεο θ.α.) ζε ζπλδπαζκφ κε ηα δηαγλσζηηθά θηη απμάλνπλ ηελ αμηνπηζηία ηεο ηαπηνπνίεζεο (Heard and Fleet, 1990). Ο παξαδνζηαθφο ραξαθηεξηζκφο ησλ δπκψλ πνπ ζρεηίδνληαη κε ηε δχκσζε επηηξαπέδησλ ειηψλ βαζίδεηαη ζε κνξθνινγηθά ραξαθηεξηζηηθά θαη βηνρεκηθέο κεζφδνπο ζπγθξίλνληαο ηα απνηειέζκαηα κε δηάθνξεο ηαμηλνκηθέο θιείδεο (Barnett et al., 1990, Kurtzman et al., 2011). H δηαδηθαζία είλαη ζχλζεηε, θνζηνβφξα θαη ρξνλνβφξα, αλ θαη ε κεζνδνινγία επηηξέπεη ηελ απνκφλσζε θαη ην ραξαθηεξηζκφ κηαο κεγάιεο πνηθηιίαο γελψλ θαη εηδψλ παγθφζκηα γηα δηάθνξνπο ηχπνπο επεμεξγαζίαο επηηξαπέδηαο ειηάο (Balatsouras, 1967, Borcakli et al., 1993, Duran Quintana et al., 1986, Gonzalez Cancho, 1965, 1966a, 1966b, Gonzalez Canco et al., 1975, Hernandez et al., 2007, Kotzekidou, 1997, Marquina et al., 1992, 1997, Mrak et al, 1956, Pelagatti, 1978). Πξφζθαηα έρνπλ αξρίζεη λα ρξεζηκνπνηνχληαη κνξηαθέο κέζνδνη, νη νπνίεο παξέρνπλ κεγαιχηεξν βαζκφ αθξίβεηαο ζηελ ηειηθή ηαπηνπνίεζε κε ηαπηφρξνλε εμνηθνλφκεζε ρξφλνπ. Ο ραξαθηεξηζκφο ησλ δπκψλ κε κνξηαθέο ηερληθέο βαζίδεηαη θπξίσο ζηελ αλάιπζε αθνινπζηψλ γνληδίσλ ξηβνζσκηθνχ RNA (rrna) (Fernandez Gonzales et al., 2001). Oη κνξηαθέο ηερληθέο πνπ ρξεζηκνπνηνχληαη γηα ηε κειέηε ησλ θπινγελεηηθψλ ζρέζεσλ είλαη: 1) H αιπζηδσηή αληίδξαζε πνιπκεξάζεο (Polymerase Chain Reaction PCR), ε νπνία ρξεζηκνπνηείηαη γηα ηελ ελίζρπζε ή πνιιαπιαζηαζκφ ελφο ζπγθεθξηκέλνπ ηκήκαηνο DNA, ζπλνδεπφκελε απφ ηελ ειεθηξνθφξεζε, ε νπνία ζηνρεχεη ζην δηαρσξηζκφ, ηελ ηαπηνπνίεζε θαη ηνλ θαζαξηζκφ δηαθφξσλ κνξίσλ DNA 2) ε αλάιπζε 7

26 ηνπ πνιπκνξθηζκνχ κήθνπο ζξαπζκάησλ απφ έλδπκν πεξηνξηζκνχ (Restriction Fragments Length Polymorphism - RFLP), πνπ δεκηνπξγνχληαη κεηά ηελ πέςε ηνπ εληζρπκέλνπ rrna γνληδίνπ θαη ησλ ζπζρεηηδφκελσλ δηαγελεηηθψλ πεξηνρψλ ITS κε ηε ρξήζε ελδνλνπθιεαζψλ (Esteve Zarzoso et al., 1999), θαη 3) ε αλάιπζε αθνινπζηψλ ζπγθεθξηκέλσλ ηκεκάησλ DNA κεηά απφ ελίζρπζε κε PCR είηε ησλ D1/D2 πεξηνρψλ ηνπ 26S rrna γνληδίνπ εληζρπκέλνπ κε πξηκνδφηεο (primers) (Kurtzman and Robnett, 1998) ή ηεο 5.8S-ITS πεξηνρήο εληζρπκέλεο κε πξηκνδφηεο (Δsteve-Zarzoso et al., 1999). Oη πιεξνθνξίεο πνπ παίξλνληαη ζπγθξίλνληαη κε ηηο αληίζηνηρεο πνχ ππάξρνπλ ζε δηεζλείο βάζεηο πιεξνθνξηψλ (δεδνκέλσλ) φπσο ε Σξάπεδα γνληδίσλ (Genbank) απφ ην NCBI θαη ην yeast-id.com (Παλεπηζηήκην ηεο Βαιέλζηα θαη CSIC) γηα ηελ εχξεζε αιιεινπρηψλ θαη νκνινγίαο κεηαμχ απηψλ. Ζ αθξίβεηα θαη ε αμηνπηζηία ησλ κνξηαθψλ ηερληθψλ ηηο θάλεη ππνςήθηεο γηα λα ρξεζηκνπνηεζνχλ θαη γηα ηελ ηαπηνπνίεζε ησλ δπκψλ πνπ θάλεθε φηη επηθξαηνχλ ζηε δχκσζε ηνπ ζηεξενχ ππνιείκκαηνο θνζθίληζεο ησλ πγξψλ απνβιήησλ, θαηά ην κηθξνβηνινγηθφ ραξαθηεξηζκφ ηνπ πιηθνχ θαηά ηε δηάξθεηα ηεο δχκσζεο. Πην ζπγθεθξηκέλα, ε εθαξκνγή κνξηαθψλ ηερληθψλ, φπσο ε αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR), o πνιπκνξθηζκφο κήθνπο ζξαπζκάησλ απφ έλδπκν πεξηνξηζκνχ (RFLP), ε αλάιπζε αιιεινπρηψλ (Sequencing) θαη ε ζχγθξηζε ησλ απνηειεζκάησλ ζε δηεζλείο βάζεηο δεδνκέλσλ (yeast-id ή NCBI), νδεγεί ζηελ αμηφπηζηε ηαπηνπνίεζε ζηειερψλ, ηα νπνία ζα δηαζέηνπλ επηζπκεηέο ηερλνινγηθέο ηδηφηεηεο θαη ζα κπνξνχλ κειινληηθά λα ρξεζηκνπνηεζνχλ σο θαιιηέξγεηεο εθθίλεζεο γηα ηελ παξαγσγή ελφο πξντφληνο ηχπνπ πάζηα ειηάο κε θαιχηεξα νξγαλνιεπηηθά ραξαθηεξηζηηθά θαη επνκέλσο πςειφηεξεο πξνζηηζέκελεο αμίαο. 8

27 2. ΑΝΑΚΟΠΖΖ ΒΗΒΛΗΟΓΡΑΦΗΑ 2.1. Τγξά απόβιεηα ειαηνπξγείσλ Σν πξόβιεκα Σα πγξά απφβιεηα ησλ ειαηνπξγείσλ αληηπξνζσπεχνπλ έλα ζεκαληηθφ πεξηβαιινληηθφ πξφβιεκα εηδηθά ζηε Μεζφγεην, ηελ θχξηα ειαηνπαξαγσγηθή πεξηνρή ζηνλ θφζκν. ηε δηεζλή βηβιηνγξαθία γηα ηνλ πξνζδηνξηζκφ ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ δίλνληαη δηάθνξνη φξνη φπσο olive mill waste-water (OMW), νlive νil mill waste-water (OOMW), olive press waste-water, olive vegetation water, olive vegetable water (OVW) (Fiestas Ros de Ursinos and Borja-Padilla, 1992). Ο ραξαθηεξηζκφο ησλ πγξψλ απηψλ απνβιήησλ γίλεηαη κεηά απφ ηελ αλίρλεπζε δηάθνξσλ παξακέηξσλ φπσο βηνρεκηθψο απαηηνχκελν νμπγφλν (BOD - Βiochemical Oxygen Demand), ρεκηθψο απαηηνχκελν νμπγφλν (COD - Chemical Oxygen Demand) θαζψο θαη ην πεξηερφκελν ησλ ζπλνιηθψλ θαηλνιψλ. Ζ επξσπατθή λνκνζεζία φζνλ αθνξά ηηο πξαθηηθέο απφζεζεο ησλ πγξψλ απνβιήησλ ησλ ειαηνπξγείσλ (OMW ή ΟΟΜW) είλαη πεξηνξηζκέλε θαη πεξηιακβάλεη κφλν κεζφδνπο πξνζηαζίαο ηνπ πεξηβάιινληνο απφ ηηο δπζκελείο επηπηψζεηο ζηα εδάθε θαη ηα πδάηηλα ζψκαηα (Zaharaki and Komnitsas, 2009). Σα ειαηνπξγεία πξνθαινχλ κεγάιεο πνζφηεηεο πγξψλ απνβιήησλ, ηα νπνία είλαη ειαθξψο φμηλα θαη ζρεηίδνληαη κε πςειέο ηηκέο βηνρεκηθψο απαηηνχκελνπ νμπγφλνπ (BOD) θαη ρεκηθψο απαηηνχκελνπ νμπγφλνπ (COD), κέρξη δειαδή 100 θαη 220 g/l, αληηζηνίρσο. Ζ θπηνηνμηθή επίδξαζε ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (ΟΟΜW) απνδίδεηαη κεξηθψο ζην νξγαληθφ θιάζκα (θαηλνιηθά θαη ζρεηηθέο νπζίεο), ην νπνίν βξίζθεηαη ζε ζεκαληηθέο ζπγθεληξψζεηο θαη αλαζηέιιεη ηελ αλάπηπμε ζπγθεθξηκέλσλ κηθξννξγαληζκψλ. Σν πεξηερφκελν ζε θαηλνιηθά (θαηλνιηθά, θιαβνλνεηδή ή πνιπθαηλφιεο) καδί κε ηα κεγάιεο αιπζίδαο ιηπαξά νμέα παξάγνπλ κεζαλνγεληθή ηνμηθφηεηα θαη επνκέλσο ε επηινγή ηεο απφζεζεο ησλ ΟΟΜW ζην έδαθνο ζα πξέπεη λα εμεηαζηεί πξνζεθηηθά (Paredes et al., 1986, Hamdi, 1992, D Annibale, 2004, Mekki et al., 2007). Σν ραξαθηεξηζηηθφ ζθνχξν θαθέ ρξψκα ησλ απνβιήησλ νθείιεηαη ζηνλ πνιπκεξηζκφ ηνπ κηθξνχ κνξηαθνχ βάξνπο θαηλνιηθψλ θαη ζρεηίδεηαη ρεκηθά κε παξάγσγα ιηγλίλεο θαη ηαλλίλεο. Ο απνρξσκαηηζκφο ησλ πγξψλ απνβιήησλ 9

28 ειαηνηξηβεηψλ (ΟΟΜW) δελ κπνξεί λα είλαη απνηειεζκαηηθφο κε ηε ρξήζε παξαδνζηαθψλ βηνινγηθψλ κεζφδσλ κεηαρείξηζεο, φπσο απηνχο πνπ πεξηιακβάλνπλ ιίκλεο εμάηκηζεο ή εμαηκηζνδεμακελέο ή αλαεξφβηα ρψλεπζε (Sayadi and Ellouz, 1992, Jarboui et al., 2008). Σα πξνβιήκαηα πξνθχπηνπλ θπξίσο απφ ην γεγνλφο φηη ε παξαγσγή ειαηνιάδνπ είλαη έληνλε θαη επνρηαθή θαη επνκέλσο ε δηαδηθαζία ρεηξηζκνχ ζα πξέπεη λα είλαη αξθεηά εππξνζάξκνζηε γηα λα ιεηηνπξγήζεη κε έλα κε ζπλερή ηξφπν, δηαθνξεηηθά απαηηείηαη ε απνζήθεπζε ησλ πγξψλ απνβιήησλ. Δπηπιένλ, ηα ειαηνπξγεία είλαη νηθνγελεηαθέο επηρεηξήζεηο θαη κηθξνχ κεγέζνπο βηνκεραληθέο κνλάδεο, δηαζθνξπηζκέλεο θπξίσο γχξσ απφ ειαηνπαξαγσγηθέο πεξηνρέο, θάλνληαο έηζη ηε κεηαρείξηζε ησλ απνβιήησλ αλά κνλάδα νηθνλνκηθά δπζβάζηαθηε (Paraskeva and Diamadopoulos, 2006). Πξαθηηθά, φιεο νη επεμεξγαζίεο κεηαρείξηζεο πνπ έρνπλ αλαπηπρζεί γηα νηθηαθά θαη βηνκεραληθά πγξά απφβιεηα, έρνπλ δνθηκαζηεί πάλσ ζε OOMW αιιά θακηά απφ απηέο δελ απνδείρζεθε πιήξσο θαηάιιειε γηα λα πηνζεηεζεί γεληθά. Ζ ζηξαηεγηθή δηαρείξηζεο ησλ ΟΟΜW ζα έπξεπε επνκέλσο λα θαηεπζπλζεί πξνο έλα ζπλδπαζκφ ηεο απνηνμίλσζήο ηνπο θαη ηεο ρξήζεο ηνπο γηα ηελ παξαγσγή ρξήζηκσλ παξα πξντφλησλ (Roig et al., 2006, Oreopoulou and Russ, 2007) Υαξαθηεξηζηηθά ησλ πγξώλ απνβιήησλ ειαηνπξγείσλ Δίδε απνβιήησλ Σν ειαηφιαδν παξάγεηαη ζηα ειαηνηξηβεία είηε κε ηελ αζπλερή κέζνδν πίεζεο είηε κε ηε ζπλερή κέζνδν θπγνθέληξεζεο. ε φια ηα ζηάδηα επεμεξγαζίαο ηεο ειηάο κεγάιεο πνζφηεηεο θαζαξνχ λεξνχ θαηαλαιψλνληαη θαη πγξά απφβιεηα δηαθνξεηηθψλ πνηνηήησλ παξάγνληαη αλάινγα κε παξακέηξνπο φπσο ε πνηθηιία ηεο ειηάο, ε σξηκφηεηα ηνπ ειαηνθάξπνπ, ε κέζνδνο θαιιηέξγεηαο/επεμεξγαζίαο θαζψο θαη νη γεσινγηθέο-θιηκαηηθέο ζπλζήθεο. Παξφια απηά, ε παξαγσγή OOMW είλαη ηζρπξά εμαξηεκέλε απφ ην ζχζηεκα επεμεξγαζίαο. Πην ζπγθεθξηκέλα, ζηα ζπζηήκαηα πίεζεο ν παξαγφκελνο φγθνο πνηθίιεη απφ l/100kg ειαηνθάξπσλ, ελψ ζηα δηθαζηθά θαη ηξηθαζηθά θπγνθεληξηθά ζπζηήκαηα είλαη πεξίπνπ 10 θαη 100 l/100kg ειαηνθάξπσλ αληηζηνίρσο (Kapellakis et al., 2006) (Πίλαθαο 2.1.) Καηά ηελ εθαξκνγή ηεο κεζφδνπ ηεο πίεζεο ην ελδνθάξπην 10

29 (ππξήλαο), ην κεζνθάξπην (ζάξθα) θαη ην εμσθάξπην (θινηφο), κεηαθέξνληαη ζηνλ ειαηνππξήλα (ρήκα 2.1.) θαη φρη ζηα πγξά απφβιεηα (ΟΟΜW). Δπίζεο, ηα ηειεπηαία πξνέξρνληαη απφ ην λεξφ πνπ ρξεζηκνπνηείηαη γηα ηελ πιχζε (θξχν), θαζψο θαη ην λεξφ πνπ ρξεζηκνπνηείηαη ζηα ζηάδηα ηεο άιεζεο, ζεξκνκάιαμεο θαη πδξαπιηθήο πίεζεο ή βαξπηηθνχ δηαρσξηζκνχ (δεζηφ). ρήκα 2.1. Ρνή παξαιαβήο ειαηνιάδνπ ζηελ παξαδνζηαθή κέζνδν ηεο πίεζεο (Bνιηθάθε, 2008). Καηά ηελ εθαξκνγή ηεο κεζφδνπ θπγνθέληξεζεο δχν θάζεσλ ην ελδνθάξπην (ππξήλαο), ην κεζνθάξπην (ζάξθα) θαη ην εμσθάξπην (θινηφο), κεηαθέξνληαη ζην δηθαζηθφ ειαηνππξήλα ή ειαηνππξελφιπκα (ρήκα 2.2.) θαη φρη ζηα πγξά απφβιεηα. Σα ηειεπηαία πξνέξρνληαη απφ ην λεξφ πνπ ρξεζηκνπνηείηαη γηα ηελ πιχζε (θξχν), θαζψο θαη ην λεξφ πνπ ρξεζηκνπνηείηαη ζηα ζηάδηα ηεο άιεζεο, κάιαμεο θαη ηεο θάζεηεο θπγνθέληξηζεο γηα ηνλ ηειηθφ θαζαξηζκφ ηνπ ειαηνιάδνπ (δεζηφ). 11

30 ρήκα 2.2. Ρνή παξαιαβήο ειαηνιάδνπ ζε θπγνθεληξηθφ ζχζηεκα 2 θάζεσλ (Bνιηθάθε, 2008). Καηά ηελ εθαξκνγή ηεο κεζφδνπ ηεο θπγνθέληξεζεο ηξηψλ θάζεσλ ην ελδνθάξπην (ππξήλαο) θαηεπζχλεηαη (πξψηε νξηδφληηα θπγνθέληξεζε) ζηα ζηεξεά απφβιεηα (ειαηνππξήλαο), ελψ ην κεζνθάξπην (ζάξθα) θαη ην εμσθάξπην (θινηφο), κεηαθέξνληαη ζηελ πγξή θάζε θαη ζηε ζπλέρεηα ππνβάιινληαη ζε λέα θπγνθέληξεζε. Με ηελ ηξίηε (θάζεηε) θπγνθέληξεζε ζηελ ειαηψδε θάζε παξαιακβάλνπκε ην θαζαξφ ειαηφιαδν (ρήκα 2.3). Σα πγξά απφβιεηα πξνέξρνληαη απφ ην λεξφ πνπ ρξεζηκνπνηείηαη γηα ηελ πιχζε (θξχν), θαζψο θαη ην λεξφ πνπ ρξεζηκνπνηείηαη ζηα ζηάδηα ηεο άιεζεο, ηεο κάιαμεο, ηεο νξηδφληηαο θπγνθέληξεζεο θαη ηεο θάζεηεο θπγνθέληξηζεο γηα ηνλ ηειηθφ θαζαξηζκφ ηνπ ειαηνιάδνπ (δεζηφ). Ο κεγάινο φγθνο ησλ πγξψλ απνβιήησλ κε ηε κέζνδν απηή νθείιεηαη θπξίσο ζηηο κεγάιεο πνζφηεηεο λεξνχ πνπ απαηηνχληαη ζηνλ νξηδφληην θπγνθεληξεηή. 12

31 ρήκα 2.3. Ρνή παξαιαβήο ειαηνιάδνπ ζε θπγνθεληξηθφ ζχζηεκα 3 θάζεσλ (Bνιηθάθε, 2008). Πίλαθαο 2.1. Πνζφηεηεο απνβιήησλ σο ζπλάξηεζε ηεο επηιεγφκελεο κεζφδνπ εμαγσγήο ειαηνιάδνπ (Niaounakis and Halvadakis, 2006). Γηαδηθαζία παξαγσγήο Πίεζε Φπγνθέληξεζε δχν θάζεσλ Φπγνθέληξεζε ηξηψλ θάζεσλ Δίζνδνο Πνζόηεηα ζηελ Πνζόηεηα ζηελ Έμνδνο είζνδν έμνδν Διηέο 1 t Eιαηφιαδν 200 Kg ηεξεά απφβιεηα 400 Kg Νεξφ πιχζεο 0,1 0,12 m 3 Τγξά απφβιεηα l (ΟΜW) Διηέο 1 t Eιαηφιαδν 200 Kg ηεξεά απφβιεηα 800 Kg Νεξφ πιχζεο 0,1 0,12 m 3 Τγξά απφβιεηα l (ΟΜW) Διηέο 1 t Eιαηφιαδν 200 Kg Νεξφ πιχζεο 0,1 0,12 m 3 ηεξεά απφβιεηα Kg Nεξφ γηα ην ληεθάληεξ 0,5 1,0 m 3 Τγξά απφβιεηα (ΟΜW) l 13

32 Οη Μεζνγεηαθέο ρψξεο παξάγνπλ ην 97% ηεο ζπλνιηθήο παξαγσγήο ειαηνιάδνπ, ελψ νη ρψξεο ηεο Δπξσπατθήο Έλσζεο παξάγνπλ ην 80-84%. Ζ Ηζπαλία είλαη ε κεγαιχηεξε ειαηνπαξαγσγφο ρψξα, αθνινπζνχκελε απφ ηελ Ηηαιία θαη ηελ Διιάδα. Ο Πίλαθαο 2.2. δείρλεη κηα εθηίκεζε ηεο ζπλνιηθήο πνζφηεηαο ησλ παξαγφκελσλ πγξψλ απνβιήησλ εηεζίσο πνπ θπκαίλεηαη απφ 7 x 10 6 έσο πάλσ απφ 30 x 10 6 m 3. Aπηή ε κεγάιε απφθιηζε ζηα απνηειέζκαηα κπνξεί κεξηθψο λα εμεγεζεί απφ ην γεγνλφο φηη νη παξερφκελεο πιεξνθνξίεο είλαη κφλν εθηηκήζεηο, ιφγσ ηεο έιιεηςεο θαζαξψλ πιεξνθνξηψλ πνπ λα αθνξνχλ ηνλ φγθν ησλ απνβιήησλ πνπ παξάγνληαη (Kopsidas, 1992, Niaounakis and Halvadakis, 2006). Πίλαθαο 2.2. Δθηηκψκελνη φγθνη πγξψλ απνβιήησλ ειαηνπξγείνπ (ΟΟΜW) πξνθαινχκελνη απφ ηε δηαδηθαζία παξαγσγήο ειαηνιάδνπ (Niaounakis and Halvadakis, 2006). Υψξα ΟΟΜW, m 3 /έηνο Eιαηνππξήλαο, m 3 /έηνο Ηζπαλία 2.8 x x 10 6 Ηηαιία 2.4 x x 10 6 Διιάδα 1.4 x x 10 6 Σπλεζία 0.55 x x Φπζηθνρεκηθά ραξαθηεξηζηηθά Σα θπζηθνρεκηθά ραξαθηεξηζηηθά ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (ΟOMW) πεξηιακβάλνπλ έλα πιήζνο παξακέηξσλ, φπσο ηα BOD (Βiochemical Oxygen Demand) θαη COD (Chemical Oxygen Demand), ηα νιηθά ζηεξεά, ηηο νιηθέο θαηλφιεο, ηα νιηθά ζάθραξα, ηηο ηαλίλεο θαη ιηγλίλεο, ηα νιηθά ιίπε, ηα ειεχζεξα ιηπαξά νμέα, ηνλ νιηθφ νξγαληθφ άλζξαθα, ηνλ νιηθφ θψζθνξν, ην νιηθφ άδσην, κέηαιια θαη ηέθξα (Πίλαθαο 2.3). Γηα ηελ κέηξεζε ησλ πεξηζζφηεξσλ απφ απηέο ηηο παξακέηξνπο απαηηείηαη ε ρξήζε ηνμηθψλ δηαιπηψλ, κε απνηέιεζκα ηελ παξαγσγή απνβιήησλ, ηα νπνία ζα πξέπεη επίζεο λα απνηεζνχλ ζην πεξηβάιινλ. Γεληθά, πξφθεηηαη γηα πγξά απφβιεηα ζθνχξνπ ρξψκαηνο (κε απφρξσζε απφ θίηξηλνπξάζηλν έσο θαθέ-καχξν), ζνιά, κε ραξαθηεξηζηηθή έληνλε νζκή ε νπνία νθείιεηαη θπξίσο ζε πηεηηθά νμέα. Δπίζεο εκθαλίδνπλ φμηλν pζ θαη είλαη πινχζηα ζε αλφξγαλα θαη νξγαληθά πδαηνδηαιπηά ζπζηαηηθά (Μπαιαηζνχξαο, 1997). 14

33 Σν νξγαληθφ θιάζκα ησλ πγξψλ απνβιήησλ (OΟMW) πεξηιακβάλεη ζάθραξα, ηαλίλεο, πνιπθαηλφιεο, πνιπαιθνφιεο, πεθηίλεο θαη ιηπίδηα (Lancioti et al., 2005). Γεληθά, νη νξγαληθέο νπζίεο ησλ OΟMW κπνξνχλ λα δηαρσξηζηνχλ ζε ελψζεηο άκεζα δηαζπψκελεο (π.ρ. ζάθραξα, νξγαληθά νμέα, ακηλνμέα), βηναπνηθνδνκήζηκα πνιπκεξή (πξσηεΐλεο, εκηθπηηαξίλεο) θαη δχζθνια δηαζπψκελα ζπζηαηηθά φπσο κεγαινκνξηαθέο ιηπαξέο νπζίεο θαη θαηλνιηθέο ελψζεηο (Οηραιηψηεο θαη Εεξβάθεο, 1999). Οη Visioli θαη ζπλ. (1995) αλαθέξνπλ φηη ηα εθρπιίζκαηα απφ πγξά απφβιεηα ειαηνπξγείσλ δηαζέηνπλ ηζρπξή αληηνμεηδσηηθή δξάζε θαη ζα κπνξνχζαλ λα απνηειέζνπλ κηα θζελή πεγή θπζηθψλ αληηνμεηδσηηθψλ. Παξά ην φηη ην πην ζεκαληηθφ απφ πνζνηηθή άπνςε ηκήκα ηνπ νξγαληθνχ θιάζκαηνο θαηαιακβάλνπλ ηα ζάθραξα, απφ πνηνηηθή άπνςε νη πνιπθαηλφιεο θαη νη ιηπαξέο νπζίεο είλαη ηα πην ζεκαληηθά ζπζηαηηθά, δηφηη πξνζδίδνπλ ζηα πγξά απφβιεηα αλεπηζχκεηεο ηδηφηεηεο (ρξψκα, θπηνηνμηθφηεηα θ.α.). Έλαο απφ ηνπο πην ζεκαληηθνχο παξάγνληεο αλάιπζεο είλαη oη θαηλνιηθέο ελψζεηο γηα ηηο νπνίεο κεξηθέο κέζνδνη έρνπλ πεξηγξαθεί ζηε βηβιηνγξαθία. Οη πνιπθαηλφιεο, νη νπνίεο δελ είλαη εχθνια βηναπνηθνδνκήζηκεο, είλαη ηνμηθέο ζηνπο πεξηζζφηεξνπο κηθξννξγαληζκνχο θαη βξίζθνληαη ζε πςειέο ζπγθεληξψζεηο ζηα OOMW (κέρξη 80 g/l) (Oreopoulou and Russ, 2007). To πεξηερφκελν ζε θαηλνιηθά ησλ ΟΟΜW πνηθίιεη αλάινγα κε κεξηθνχο παξάγνληεο φπσο ν ηχπνο ηεο δηαδηθαζίαο παξαγσγήο, ν ηχπνο ησλ ειηψλ θαη ην ζηάδην σξηκφηεηαο. Σν ζχζηεκα εθρχιηζεο επεξεάδεη επίζεο ηε ζπγθέληξσζή ηνπο, κε ηε κεγαιχηεξε λα εκθαλίδεηαη ζηα πγξά απφβιεηα ηνπ ηξηθαζηθνχ ληεθάληεξ (Lesage-Meesen et al., 2001). Οη θαηλφιεο, δε βξίζθνληαη ζηνπο ειεχζεξνπο ηχπνπο ηνπο ζηηο ειηέο, αιιά ππάξρνπλ θπξίσο σο γιπθνζίδηα, ηαλίλεο, αλζνθπαλίλεο θαη ιηγλίλεο. Οη 50 θαηλφιεο πνπ έρνπλ ήδε ηαπηνπνηεζεί ζηα πγξά απφβιεηα ησλ ειαηνπξγείσλ αλήθνπλ ζε ηξεηο θχξηεο θαηεγνξίεο θαηλνιηθψλ ελψζεσλ: (α) παξάγσγα θηλλακηθνχ νμένο (β) παξάγσγα βελδντθνχ νμένο θαη (γ) ελψζεηο ζρεηηδφκελεο κε ηελ ηπξνδφιε (Miranda et al., 2001). Οη θαηλνιηθέο ελψζεηο ηνπ ειαηνιάδνπ αληηπξνζσπεχνπλ ην 27% ηνπ αζαπσλνπνίεηνπ θιάζκαηνο. Οη θχξηεο θαηλφιεο πνπ ηαπηνπνηνχληαη ζην ειαηφιαδν είλαη ην γαιιηθφ, ην θαθετθφ, ην βαληιιηθφ, ην p-θνπκαξηθφ, ην ζπξηλγθηθφ, ην θεξνπιηθφ, ην νκνβαληιιηθφ, ην p-πδξνμπβελδντθφ, θαη ην πξνηαθαηεξηθφ νμχ θαζψο θαη 15

34 ε ηπξνδφιε θαη πδξνμπηπξνδφιε. Άιιεο θαηλνιηθέο ελψζεηο πνπ έρνπλ ηαπηνπνηεζεί ζην ειαηφιαδν είλαη ε ειεπξσπαΐλε, ην ιηγθζηξνζίδην θαη νη αγιπθφλεο ηνπο. Οη πνιπθαηλφιεο πνπ βξίζθνληαη ζην ειαηφιαδν πξνέξρνληαη απφ ηνλ ειαηφθαξπν θαηά ηε δηάξθεηα ηεο δηαδηθαζίαο εθρχιηζεο, αιιά έλα κεγάιν κέξνο απηψλ ησλ ελψζεσλ ράλεηαη ζηελ πδαηηθή θάζε. Απηέο νη θαηλνιηθέο ελψζεηο απνηεινχληαη απφ κνλνθπθιηθά αξσκαηηθά κφξηα, φπσο πδξνμπιησκέλν θαη κεζνμπιησκέλν βελδντθφ, θαηλπινμηθφ, θαηλπιν-πξνπηνληθά νμέα θαζψο θαη ελψζεηο πςειφηεξνπ κνξηαθνχ βάξνπο πνπ παίξλνληαη κέζσ ηνπ πνιπκεξηζκνχ ηνπο. Απηέο νη ελψζεηο είλαη, φπσο πξναλαθέξζεθε, ππεχζπλεο γηα ην ζθνχξν ρξψκα, ηηο θπηνηνμηθέο επηδξάζεηο θαη ηελ αληηβαθηεξηαθή δξαζηεξηφηεηα (Kachouri and Hamdi, 2006). ε φηη αθνξά ην κνξηαθφ ηνπο βάξνο (ΜΒ), παξαηεξνχληαη δχν βαζηθέο θαηεγνξίεο (Tsagaraki et al., 2006). 1. Φαηλνιηθά κνλνκεξή, θιαβνλνεηδή, κε απηννμεηδνχκελεο ηαλίλεο θαη άιιεο ελψζεηο κε ΜΒ < 10kDa. 2. Μεζαίνπ θαη κεγάινπ κνξηαθνχ βάξνπο (ΜΒ > 10kDa) ζθνπξφρξσκα πνιπκεξή, ηα νπνία πξνέξρνληαη απφ ηνλ πνιπκεξηζκφ θαη ηελ απηννμείδσζε ησλ θαηλνιηθψλ ελψζεσλ ηεο πξψηεο νκάδαο. ηα θαηλνιηθά πνπ έρνπλ αληρλεπζεί ζα πξέπεη επνκέλσο λα πξνζηεζνχλ θαη νη πνιπκεξείο νπζίεο θαζηαλφκαπξνπ ρξψκαηνο πνπ δεζκεχνληαη δεπηεξνγελψο κέζσ ελδπκηθψλ αληηδξάζεσλ πνπ αξρίδνπλ ακέζσο κεηά ηελ έθζιηςε ηνπ ειαηνθάξπνπ (Saiz- Jimenez et al., 1986). H παξνπζία θαηλνιηθψλ ελψζεσλ νδεγεί ζε αληηκηθξνβηαθή δξαζηεξηφηεηα, ε νπνία παξεκπνδίδεη ηηο βηνινγηθέο δηεξγαζίεο θαηά ηε κεηαρείξηζε ησλ OΟMW (Fiestas Ros de Ursinos and Borja - Padilla, 1992). Eπίζεο, έρεη κηα θπηνηνμηθή δξάζε ζηε θπηξσηηθή ηθαλφηεηα ησλ ζπφξσλ (Flouri et al., 1990). Οη θαηλνιηθέο ελψζεηο επζχλνληαη αθφκε γηα ηελ εκθάληζε κηαο ειαθξάο νξκνληθήο δηαηαξαρήο πνπ νθείιεηαη ζην πεξηερφκελν ζε ακπζηζηθφ νμχ ( κg/l), ην νπνίν ειέγρεη ηελ απνθνπή ησλ θξνχησλ θαζψο θαη γηα αλσκαιίεο ζηε θχηξσζε θαη ηε γήξαλζε (Zucconi et al., 1985). Ζ παξνπζία θαηλνιηθψλ ελψζεσλ επζχλεηαη αθφκε γηα ηελ αχμεζε ηεο LD 50 ηνμηθφηεηαο γηα ηα ςάξηα ζην 8.7% κεηά απφ 24 ψξεο (Fiestas Ros de Ursinos, 1958). 16

35 Πίλαθαο 2.3. Υεκηθή ζχλζεζε ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ (OMW). Οη πιεξνθνξίεο απνθηήζεθαλ απφ ην Morillo θαη άιινπο (2009) απφ 8 αλεμάξηεηεο κειέηεο. Παξάκεηξνο Μέζνο όξνο Δύξνο Ξεξή νπζία % ph EC (ds m -1 ) (Ζιεθηξηθή αγσγηκφηεηα) Οξγαληθή νπζία (g l -1 ) ΣΟC (g l -1 ) (Οιηθφο νξγαληθφο άλζξαθαο) TN (g l -1 ) (Οιηθφ άδσην) C/N P 2 O 5 (g l -1 ) K 2 O (g l -1 ) Na (g l -1 ) Ca (g l -1 ) Mg (g l -1 ) Fe (g l -1 ) Cu (g l -1 ) Mn (g l -1 ) Zn (g l -1 ) Ππθλφηεηα(g cm -3 ) Ληπίδηα (g l -1 ) Φαηλφιεο (g l -1 ) Τδαηάλζξαθεο (g l -1 ) COD (g l -1 ) (Υεκηθψο απαηηνχκελν νμπγφλν) BOD5 (g l -1 ) (Βηνρεκηθψο απαηηνχκελν νμπγφλν) Μηθξνβηνινγηθά ραξαθηεξηζηηθά Μηθξνβηαθή ρισξίδα ησλ πγξώλ απνβιήησλ ειαηνπξγείνπ (OΟMW) Γηα ηελ θαηαλφεζε ησλ βηνινγηθψλ κεζφδσλ πνπ ρξεζηκνπνηνχληαη γηα ηελ επεμεξγαζία ησλ ιπκάησλ, είλαη απαξαίηεηε ε γλψζε ηνπ ξφινπ ησλ κηθξννξγαληζκψλ. Σα βαθηήξηα θαη ηα πξσηφδσα απνηεινχλ ηηο θπξηφηεξεο νκάδεο ζην ζχζηεκα ησλ κηθξννξγαληζκψλ πνπ ρξεζηκνπνηνχληαη γηα ηε δεπηεξνβάζκηα βηνινγηθή επεμεξγαζία. Ζ θαιιηέξγεηα πνπ ρξεζηκνπνηείηαη γηα ηνλ πξνζδηνξηζκφ ηνπ βηνρεκηθά απαηηνχκελνπ νμπγφλνπ είλαη θαζηδεκέλα αζηηθά ιχκαηα πνπ πεξηέρνπλ ζε επάξθεηα ηνπο ζπλήζεηο κηθξννξγαληζκνχο, νη νπνίνη είλαη απαξαίηεηνη γηα ηελ απνηθνδφκεζε ηνπ νξγαληθνχ πιηθνχ ησλ ιπκάησλ. Ζ ηξνθηθή αιπζίδα ζηα πδαηηθά ζπζηήκαηα είλαη δπλαηφλ λα δηαηαξαρζεί απφ ηε ξχπαλζε πνπ πξνθαιεί ε δηάζεζε αζηηθψλ ιπκάησλ (Σζψλεο, 2004). Δθηφο απφ ηα θπζηθνρεκηθά δειαδή ραξαθηεξηζηηθά, ζηα απφβιεηα ππάξρεη θαη κηθξνβηαθή ρισξίδα. ην ειαηνπξγηθφ απφβιεην ε κηθξνβηαθή ρισξίδα έρεη ηελ ηθαλφηεηα νμείδσζεο ησλ θαηλνιηθψλ ζπζηαηηθψλ ζε λέεο θαηλνιηθέο ελψζεηο. 17

36 Ζ αλίρλεπζε θαη ε κειέηε ησλ κηθξννξγαληζκψλ είλαη ηδηαίηεξα ελδηαθέξνπζα δηφηη παίδνπλ θαζνξηζηηθφ ξφιν ζηε ιεηηνπξγία ησλ αλαεξφβησλ αληηδξαζηήξσλ. ηα ειαηνπξγηθά απφβιεηα, ε γλψζε γηα ηε κηθξνβηαθή ρισξίδα είλαη ηδηαίηεξα πεξηνξηζκέλε. Ζ ζπγθέληξσζε κηθξννξγαληζκψλ ζηα OΟMW είλαη ηεο ηάμεο ησλ 10 5 cfu/ml. Οη πην θνηλνί είλαη βαθηήξηα ηνπ γέλνπο Pseudomonas ή κηθξννξγαληζκνί πνπ ραξαθηεξίδνληαη απφ ηελ ηθαλφηεηα ηνπο λα κεηαζρεκαηίδνπλ δχζθνια δηαζπψκελα ζπζηαηηθά, φπσο κεγαινκνξηαθέο ιηπαξέο νπζίεο θαη θαηλνιηθά ζπζηαηηθά. Δπίζεο ζπλαληάκε δχκεο ηνπ γέλνπο Saccharomyces θαη κχθεηεο Penicillium θαη Aspegillus. Άιινη κηθξννξγαληζκνί πνπ έρνπλ απνκνλσζεί απφ ειαηφθαξπν είλαη ζηειέρε κπθήησλ ησλ γελψλ Rhizopus, Alternaria, Fusarium θαη βαθηεξίσλ ησλ γελώλ Αerobacter, Escherichia, Bacillus, (Fiestas Ros de Ursinos and Borja-Padilla, 1992, Oikonomou et al., 1994 ). Καηά ηε δηαδηθαζία ηεο έθζιηςεο ηνπ ειαηνθάξπνπ (δηαδηθαζία έθπιπζεο ειαηνθάξπνπ, νξηδφληηνο δηαρσξηζηήξαο θαη ηειηθή εθξνή απνβιήησλ), ππάξρεη κεγάιε δηαθχκαλζε ζηνλ πιεζπζκφ ησλ κηθξννξγαληζκψλ ηφζν κεηαμχ ησλ ηξηψλ ζηαδίσλ φζν θαη κεηαμχ ησλ δεηγκαηνιεςηψλ ζε θάζε ζηάδην. ε γεληθέο γξακκέο αληρλεχηεθαλ εηεξφηξνθνη, λεκαηνεηδείο κχθεηεο θαη δχκεο, κε ην ζηάδην ηεο έθπιπζεο ηνπ ειαηνθάξπνπ λα παξνπζηάδεη ηνλ κεγαιχηεξν αξηζκφ κηθξννξγαληζκψλ κε επηθξαηνχληεο ηνπο εηεξφηξνθνπο κηθξννξγαληζκνχο. ηνλ νξίδνληην δηαρσξηζηήξα, φπνπ πξαγκαηνπνηείηαη κάιαμε ηνπ ειαηνπνιηνχ ζε θπκαηλφκελεο ζεξκνθξαζίεο απφ 22 έσο 32 ν C, νη θπζηθνρεκηθέο ζπλζήθεο (πιένλ φμηλν ph, ζεκαληηθή αχμεζε νιηθψλ ζηεξεψλ, αχμεζε ιηπψλ, αχμεζε ζεξκνθξαζίαο) είλαη ιηγφηεξν επλντθέο γηα ηελ αλάπηπμε ησλ κηθξνβηαθψλ πιεζπζκψλ (Amaral et al., 2008). ε πξφζθαηε έξεπλα κειεηήζεθαλ νη κηθξνβηαθνί πιεζπζκνί ζε έλαλ αληηδξαζηήξα αλαεξφβηαο ρψλεπζεο, ζηνλ νπνίν γηλφηαλ επεμεξγαζία ηνπ ζηεξενχ ππνιείκκαηνο απφ ειαηνηξηβείν δχν θάζεσλ. Ζ κειέηε απηή ζπλεηζέθεξε ζηελ θαηαλφεζε ησλ δηεξγαζηψλ πνπ ιακβάλνπλ ρψξα θαηά ηελ απνηθνδφκεζε ηνπ ζπγθεθξηκέλνπ παξαπξντφληνο ψζηε λα βειηηζηνπνηεζεί ε αλαεξφβηα επεμεξγαζία. Ζ ζπρλφηεξα απαληψκελε νκάδα άλεθε ζην θχιν Firmicutes (53,3%) κε ζεκαληηθφηεξνπο εθπξνζψπνπο ηα Clostridium spp, κηθξννξγαληζκνί, νη νπνίνη ιακβάλνπλ ελέξγεηα απφ ηελ κεηαηξνπή ησλ κεζπιηθψλ 18

37 νκάδσλ ησλ αξσκαηηθψλ ελψζεσλ ζε νμηθφ νμχ, απαξαίηεην βήκα γηα ηελ παξαγσγή ηνπ κεζαλίνπ. ε πνζνζηφ 23,4% αληρλεχηεθε ε βαθηεξηαθή νκάδα Chloroflexi θαη ζε κηθξφηεξν πνζνζηφ (8,5%) Gammaproteobacteria (γάκκα-πξνηενβαθηεξηα), κε θπξηφηεξν εθπξφζσπν είδε ηνπ γέλνπο Pseudomonas, Actinobacteria (Αθηηλνβαθηήξηα) (6,4%) θαη Bacteroidetes (Βαθηεξηνεηδή) (4,3%). Σα ηειεπηαία είλαη γλσζηφ φηη απνηθνδνκνχλ πνηθηιία νξγαληθψλ ελψζεσλ (Rincon et al., 2006). ε αεξφβηεο ζπλζήθεο ε απνηθνδφκεζε ησλ θαηλνιηθψλ ήηαλ κεγαιχηεξε θαηά ηηο πξψηεο κέξεο παξακνλήο ζηνλ αληηδξαζηήξα θαη ηα πνζνζηά απνηθνδφκεζεο ήηαλ 36% θαη 54% κεηά απφ 7 θαη 55 κέξεο αληίζηνηρα. Βξέζεθε φηη ζηε δηαδηθαζία απηή εληνπίζηεθαλ 14 δηαθνξεηηθά γέλε πνπ αλήθνπλ ζηα Gammaproteobacteria, ηα Actinobacteria θαη ηα Firmicutes (Morillo et al., 2008) Πνηθηινκνξθία βαθηεξίσλ ζηα πγξά απόβιεηα ειαηνπξγείσλ. ε πείξακα ησλ Mouncif θαη ζπλ. (1993) κεηξήζεθε ε κηθξνρισξίδα ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (OOMW) ζε δχν δηαθνξεηηθέο πεξηνρέο ηνπ Μαξφθν θαη ηα απνηειέζκαηα θαίλνληαη ζηνλ Πίλαθα 2.4. Οη κεηξήζεηο ζηα ηξπβιία ήηαλ απξφζκελα πςειέο. Απηφ απνδφζεθε ζηηο πεξηβαιινληηθέο ζπλζήθεο απηνχ ηνπ πγξνχ απνβιήηνπ. Πξάγκαηη, ην λεξφ πνπ ρξεζηκνπνηήζεθε γηα ηελ εθρχιηζε ηνπ ειαηνιάδνπ πξνήιζε απφ θπζηθά ξεχκαηα θαη πεγάδηα. Δπηπιένλ, ην απφβιεην ζπιιεγφηαλ ζπλήζσο ζε ιάθθνπο θαηαζθεπαζκέλνπο θνληά ζην ειαηνπξγείν θαη κπνξνχζε λα κείλεη κέρξη κηα πιήξε εμάηκηζε. Πίλαθαο 2.4. Μεηξήζεηο κηθξνβηαθψλ νκάδσλ ζε δείγκαηα ΟΟΜW απφ δηαθνξεηηθέο πεξηνρέο (Mouncif et al., 1993). Σ 10 5 M 10 4 Ν Ν E 10 6 Μεηξήζεηο ηξπβιίνπ Zύκεο Μύθεηεο Ληπνιπηηθνί κ.ν Γαιαθηηθά βαθηήξηα Κνινβαθηεξηνεηδή <1 <1 <1 <1 <1 Σπνξνγόλα βαθηήξηα <1 <1 <1 <1 <1 T: Πεξηνρή Σάδα Μ: Πεξηνρή Μαξαθέ N: Πεξηνρή Νηεκλάη Δ: Δξγνζηάζην επεμεξγαζίαο ειηψλ (ειαηνπξγείν) ζηελ πεξηνρή Μεθέλεο 19

38 Αιιά αθφκα θαη αλ ην κηθξνβηαθφ θνξηίν ήηαλ πςειφ, δελ ππήξραλ δπλεηηθά επηθίλδπλνη κηθξννξγαληζκνί. ηελ πξαγκαηηθφηεηα, νη κηθξννξγαληζκνί δείθηεο δελ βξέζεθαλ ζε θαλέλα δείγκα, θαζψο ε απνπζία θισζηξηδίσλ θαη εληεξνθφθθσλ ππνδειψλεη φηη ηα πγξά απφβιεηα ειαηνπξγείσλ δελ εκπιέθνληαη ζηελ πηζαλή κηθξνβηαθή κφιπλζε ηνπ πεξηβάιινληνο (Mouncif et al., 1993). Ζ πιεηνςεθία ηεο κηθξνρισξίδαο ησλ ΟOΜW πξνέξρεηαη απφ ην έδαθνο θαη «γιπθά» λεξά, ελψ βαθηήξηα θνπξάλσλ έρνπλ επίζεο ηαπηνπνηεζεί (Κavroulakis et al., 2011, Tsiamis et al., 2012). H πνηθηινκνξθία ησλ βαθηεξίσλ είλαη επίζεο ζε κεγάιν βαζκφ επεξεαζκέλε απφ ηε ζπγθεθξηκέλε πνηθηιία απφ ηελ νπνία πξνέξρνληαη ηα OOMW (Tsiamis et al., 2012). Μφλν έλα 15% ησλ βαθηεξηαθψλ πιεζπζκψλ ζηα OOMW πνπ παξήρζεζαλ απφ δηάθνξεο πνηθηιίεο ειαηνθάξπνπ ήηαλ θνηλφ, δείρλνληαο έηζη έλα κηθξνβηαθφ πξνθίι εμαξηψκελν απφ ηελ πνηθηιία (Tsiamis et al., 2012). ε φια ηα δείγκαηα ησλ OOMW πνπ εμεηάζηεθαλ απφ ηνπο Tsiamis θαη ζπλ. (2012), ε βαθηεξηαθή πνηθηιφηεηα απνηεινχληαλ απφ κέιε ησλ Firmicutes, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria θαη Bacterioidetes, ελψ ε εθαξκνγή ζχγρξνλσλ κνξηαθψλ ηερληθψλ (high density DNA microarray) απνθάιπςε κηα επξχηεξε πνηθηινκνξθία, ζηελ νπνία θπξηαξρνχλ κέιε φισλ ησλ ηάμεσλ απφ Proteobacteria, Firmicutes, Bacterioidetes, Chloroflexi, Cyanobacteria θαη Actinobacteria. Mέιε ησλ Acidobacteria, Planctobacteria, Gemmatimonadetes, Verrucomicrobia επηθξαηνχζαλ επίζεο ζηε βαθηεξηαθή ρισξίδα (Tsiamis et al., 2012, Goberna et al., 2010). Ζ πξαθηηθή θαιιηέξγεηαο ηεο ειηάο θαη ζπιινγήο ηνπ ειαηνθάξπνπ επεξεάδεη ζε κεγάιν βαζκφ ηνπο βαθηεξηαθνχο πιεζπζκνχο ζηα πγξά απφβιεηα ησλ ειαηνπξγείσλ (OOMW). H βαθηεξηαθή πνηθηιφηεηα γηα παξάδεηγκα ζηα OOMW απφ ηελ πνηθηιία Mastoidis θπξηαξρήζεθε απφ δπκσηηθά κέιε βαθηεξίσλ φπσο βαθηήξηα γαιαθηηθνχ νμένο (Lactobacillus θαη Οenococcus spp.) θαη νμηθνχ νμένο (Acetobacter θαη Gluconacetobacter spp.) θαζψο θαη θνπξαλψδε βαθηήξηα ζπζρεηηδφκελα κε ηελ νηθνγέλεηα Prevotellaceae θαη ηελ νκάδα Ruminococcus Eubacterium Clostridium (Kavroulakis et al., 2011). Ζ αχμεζε ηνπ πιεζπζκνχ ηνπο απνδίδεηαη ηφζν ζηε ζπζζψξεπζε θαη παξακνλή ησλ ειαηνθάξπσλ ζην δίρηπ ζπγθνκηδήο πνπ κπνξεί λα νδεγήζεη ζηελ εγθαηάζηαζε αλαεξφβησλ/κηθξναεξφθηισλ βαθηεξίσλ, φζν θαη ζηελ 20

39 επεμεξγαζία ηνπο ζηα ειαηνπξγεία, ε νπνία κπνξεί λα απμήζεη ην επίπεδν νμπγφλνπ, επλνψληαο ηελ αλάπηπμε βαθηεξίσλ νμηθνχ νμένο (Kavroulakis et al., 2011). Μέιε ησλ Betaproteobacteria (Οηθνγέλεηεο Comamonadaceae, Gallionelaceae, Hydrogenophilaceae, Methylophilaceae, Oxalobacteraceae, θαη Rhodocyclaceae), Gammaproteobacteria (Οηθνγέλεηεο Pasteurellaceae θαη Xanthomonadaceae) θαη Firmicutes (oηθνγέλεηεο Bacillaceae, Paenibacilliaceae, Peptococcaceae θαη Sporolactobacillaceae) ηαπηνπνηήζεθαλ ζηα πγξά απφβιεηα ειαηνπξγείσλ (OΟMW) ηεο πνηθηιίαο ειηάο Koξωλέϊθε (Kavroulakis et al., 2011). Χο απνηέιεζκα ηεο πξφσξεο ζπιινγήο θαη ηεο κεζφδνπ ζπγθνκηδήο (κε ην ρέξη), ηα δπκσηηθά βαθηήξηα ζηα OΟMW πξνεξρφκελα απφ ηελ επεμεξγαζία ηεο πνηθηιίαο Κνξωλέηθεο πεξηνξίζηεθαλ ζε ιίγα είδε, αληηπξνζσπεπηηθά ησλ νηθνγελεηψλ Peptococcaceae θαη Sporolactobacillaceae. H ηαπηνπνίεζε θνπξαλσδψλ βαθηεξίσλ ζηα OΟMW πνπ πξνέρνληαη απφ ηελ επεμεξγαζία ηεο πνηθηιίαο ειηάο Μastoidis, ιφγσ ηεο καθξάο (παξαηεηακέλεο) πεξηφδνπ ζπγθνκηδήο, πξνθαιεί ηδηαίηεξε αλεζπρία (Kavroulakis et al., 2011). Oη Vivas θαη ζπλ. (2009) βξήθαλ φηη ζηα πγξά απφβιεηα δηθαζηθψλ ειαηνπξγείσλ (TPOMW) θπξηαξρνχλ κέιε ηεο δηαίξεζεο Proteobacteria, αθνινπζνχκελα απφ Actinobacteria (Streptomyces), Firmicutes (Staphylococcus) θαη κε θαιιηεξγεκέλα ζηειέρε Acidobacteria σο δεπηεξεχνληα ζπζηαηηθά ηεο κηθξνρισξίδαο ησλ πγξψλ απνβιήησλ. Σα κέιε ησλ Hydrocarboniphaga, Pseudoxanthomonas θαη Stenotrophomonas (Gammaproteobacteria) ηαπηνπνηήζεθαλ, ελψ ηα Comamonas (Betaproteobacteria) ήηαλ ε θχξηα κηθξνβηαθή νκάδα πνπ αληρλεχηεθε. Δπηπιένλ, έλα Brevundimonas sp. ήηαλ ην κφλν αληηπξνζσπεπηηθφ κέζα ζηα Alphaproteobacteria (Vivas et al., 2009). Πξνθεηκέλνπ λα αληηκεησπηζηνχλ ηα πξνβιήκαηα δηάζεζεο (απφζεζεο) ζην πεξηβάιινλ πνπ ζρεηίδνληαη κε ην φμηλν ph θαη ηελ αλεπηζχκεηε νζκή, ε πξνζζήθε Ca(OH) 2 ζηα πγξά απφβιεηα ησλ δηθαζηθψλ ειαηνπξγείσλ (TPOMW), νδεγεί ζην ζρεκαηηζκφ ελφο αιθαιηθνχ δεπηεξνγελνχο απνβιήηνπ (αιθαιηθά TPOMW) (Ntougias et al., 2006). Aπηή ε αιιαγή ηνπ ph επλνεί ηα αιθαινάληνρα θαη αιθαιφθηια βαθηήξηα κε θάπνην βαζκφ αινθηιίαο (Ntougias et al., 2006). Αινάληνρα αιθαιφθηια πνπ ζρεηίδνληαη κε ηα γέλε Bacillus, Idiomarina, Halomonas θαη Νesterenkonia θαζψο θαη αιθαινάληνρα θαη/ή αινάληνρα βαθηήξηα ζπζρεηηδφκελα θπινγελεηηθά κε ηα γέλε 21

40 Corynobacterium, Novosphingobium, Ochrobactrum, Pseudomonas, Rhodobacter θαη Serratia έρνπλ ηαπηνπνηεζεί ζε αιθαιηθφ TPOMW (Ntougias et al., 2006). Ζ πιεηνςεθία απηψλ ησλ απνκνλψζεσλ ζα κπνξνχζε απνηειεζκαηηθά λα ρξεζηκνπνηήζεη θαηλνιηθέο ελψζεηο σο ηε κνλαδηθή πεγή άλζξαθα (Ntougias et al., 2006). Ζ κηθξνρισξίδα ηνπ ειαηνππξήλα θαίλεηαη λα κεηαβάιιεη ηα ιηπίδηα ησλ κεκβξαλψλ ηνπο κε έλα κε ηππηθφ ηξφπν πξνθεηκέλνπ λα πξνζαξκνζηεί ζε ζηξεζνγφλεο ζπλζήθεο, φπσο ε ρακειή δξαζηεξηφηεηα λεξνχ (α w ), ε ρακειή νμχηεηα θαη ε πςειή πεξηεθηηθφηεηα ζε πνιπθαηλφιεο ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (Jones et al., 2000). Tα είδε Staphylococcus spp. ζηα πγξά απφβιεηα ειαηνπξγείσλ ζα έπξεπε λα ζεσξεζνχλ σο πηζαλνί κνιπζκαηηθνί παξάγνληεο. Με βάζε κηθξνβηνινγηθέο κεηξήζεηο θαη ηαπηνπνίεζε API, ζηειέρε Enterobacter cloacae αληρλεχηεθαλ ζπρλά ζε αθαηέξγαζηα απφβιεηα, καδί κε κέιε ησλ εηδψλ Αeromonas hydrophila, Pseudomonas aeruginosa, θαη Serratia odorifera (Venieri et al., 2010), ελψ ην Citrobacter braakii ήηαλ θπξίαξρν θαηά ηε δηάξθεηα ηεο νμενγέλεζεο. Αηληηπξνζσπεπηηθά ησλ εηδψλ Burkholderia cepacia, Enterobacter clocae, θαη Photobacterium damselae αληρλεχηεθαλ επίζεο. Δπηπιένλ, κεγάινη πιεζπζκνί ησλ εηδψλ Acinetobacter, Pseudomνnas θαη Enterobacter spp. έρνπλ επίζεο αληρλεπηεί ζηα ΟΟMW (Venieri et al., 2010). Μάιηζηα, ηα ηειεπηαία είλαη πηζαλά παζνγφλα γηα ηνλ άλζξσπν. Απφ ηα παξαπάλσ πξνθχπηεη φηη κέιε ησλ Alphaproteobacteria, Betaproteobacteria θαη Actinobacteria είλαη νη θχξηνη αληηπξφζσπνη ησλ βαθηεξίσλ ζηα πγξά απφβιεηα ησλ ειαηνπξγείσλ (ηφζν ζηα OΟMW φζν θαη ζηα TPOMW). Παξά ην γεγνλφο φηη ε αλάιπζε ηεο θαηαλνκήο ησλ αιιεινπρηψλ βάζεσλ ηνπ 16S rrna γνληδίνπ πνπ δηαηεξνχληαη ζε δηεζλείο βάζεηο κπνξεί λα ακθηζβεηείηαη ιφγσ ηεο ελίζρπζεο κε ηελ PCR (Federici et al., 2011), ε έξεπλα ησλ βάζεσλ δεδνκέλσλ ηνπ 16S rrna γνληδίνπ απνθάιπςε ηελ παξνπζία 585 αιιεινπρηψλ βάζεσλ βαθηεξίσλ ηαπηνπνηεκέλσλ ζε πεξηβάιινληα πγξψλ απνβιήησλ ειαηνπξγείσλ. Ζ αλάιπζε απηψλ επηβεβαηψλεη ηελ ηνπνζέηεζε ηνπ κεγαιχηεξνπ κέξνπο ηεο κηθξνρισξίδαο ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ ζηα Alphaprobacteria, Betaprobacteria, Gammaprobacteria, Firmicutes θαη Actinobacteria (Eηθφλα 2.1.). Πεξηζζφηεξν απφ ην 50% ησλ αιιεινπρηψλ βάζεσλ ηνπ 16S rrna γνληδίνπ πνπ δηαηεξνχληαη ζηελ ηξάπεδα γνληδίσλ ηαπηίδνληαη κε είδε Betaproteobacteria θαη 22

41 Gammaproteobacteria, ελψ κε είδε ησλ Firmicutes, Alphaproteobacteria, Actinobacteria, θαη Bacteroidetes ηαπηίδνληαη πεξίπνπ ην 17, 12, 9 θαη 7% ησλ αιιεινπρηψλ, αληηζηνίρσο (Δηθφλα 2.1.). Ζ θαηαλνκή ησλ θχισλ ζε Alphaproteobacteria, Betaproteobacteria, Gammproteobacteria, Firmicutes, Actinobacteria θαη Bacteroidetes παξνπζηάδεηαη ζηελ Eηθφλα 2.1. Eηθόλα 2.1. Καηαλνκή βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πεξηβάιινληα πγξψλ απνβιήησλ ειαηνπξγείσλ (Ntougias et al., 2013). Με βάζε ηελ παξαπάλσ αλάιπζε, ζηειέρε ησλ νηθνγελεηψλ Enterobacteriaceae, Moraxallaceae, Xanthomonadaceae θαη Pseudomonaceae spp. είλαη νη θχξηνη αληηπξφζσπνη ηoπ γέλνπο Gammaproteobacteria (Δηθφλα 2.2.). Δπηπξφζζεηα, ηα ζηειέρε ησλ νηθνγελεηψλ Oxalobacteraceae θαη Comamonadaceae είλαη ηα θπξίαξρα Betaproteobacteria ζηα πγξά απφβιεηα ησλ ειαηνπξγείσλ (Δηθφλα 2.2.), ελψ ε νηθνγέλεηα Acetobacteraceae είλαη ε θπξίαξρε κέζα ζηo γέλνο Alphaproteobacteria. (Δηθφλα 2.3.). ηα πγξά απφβιεηα ειαηνπξγείσλ, νη νηθνγέλεηεο Bacillaceae, Clostridiaceae, Lactobacillaceae θαη Paenibacillaceae είλαη νη πην άθζνλεο κέζα ζηε Γηαίξεζε Firmicutes (Δηθφλα 2.3.), ελψ ηα Actinobacteria ήηαλ θπξίσο ηνπνζεηεκέλα ζηηο νηθνγέλεηεο Micrococcaceae, Microbacteriaceae θαη Propionibacteriaceae (Δηθφλα 2.4.). Σα Bacteroidetes ηαπηνπνηεκέλα ζηα πγξά απφβιεηα ειαηνπξγείσλ ζπζρεηίζηεθαλ 23

42 κε ηηο νηθνγέλεηεο Prevotellaceae, Porphyromonadaceae θαη Sphingobacteriaceae (Δηθφλα 2.4.). Πξαγκαηηθά, ην πεξηβάιινλ πγξψλ απνβιήησλ ειαηνπξγείσλ θπξηαξρείηαη απφ βαθηήξηα πνπ εμεηδηθεχνληαη ζηελ απνηθνδφκεζε ησλ ζπζηαηηθψλ πγξψλ απνβιήησλ ειαηνπξγείσλ (Kavroulakis et al., 2011, Tsiamis et al., 2012). Πεξίπνπ 20% ησλ βαθηεξίσλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ θαη ζε πεξηβάιινληα πνπ ζρεηίδνληαη κε ηα πγξά απφβιεηα ειαηνπξγείσλ ζρεηίδνληαη κε θνινβαθηεξηνεηδή (π.ρ. Citrobacter, Escherichia, Klebsiella, θαη Serratia spp.) θαη άιια εληεξηθά βαθηήξηα (Βrugere et al., 2009), φπσο ηα Porphyromonadaceae, Prevotellaceae, Lachnospiraceae, Eubacteriaceae, Peptococcaceae, Peptostreptococcaceae, θαη Ruminococcaceae spp. Σα παξαπάλσ επξήκαηα απαηηνχλ ηελ αλάγθε γηα αζθαιή δηάζεζε (απφζεζε) ησλ OΟMW (Ntougias et al., 2013). Δηλόλα 2.2. Καηαλνκή κέζα ζηα Gammaproteobacteria θαη Betaproteobacteria βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ (Ntougias et al., 2013). 24

43 Δηλόλα 2.3. Καηαλνκή κέζα ζηα Alphaproteobacteria θαη Firmicutes βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ (Ntougias et al., 2013). Δηλόλα 2.4. Καηαλνκή κέζα ζηα Actinobacteria θαη Bacteroidetes βαθηεξηαθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ (Ntougias et al., 2013). 25

44 Πνηθηινκνξθία δπκώλ θαη κπθήησλ ζηα πγξά απόβιεηα ειαηνπξγείσλ Άιινη ελδηαθέξνληεο κηθξννξγαληζκνί ιφγσ ησλ ηδηνηήησλ ηνπο, νη νπνίνη απνκνλψζεθαλ απφ ηα πγξά απφβιεηα ειαηνπξγείσλ ζε πείξακα ησλ Mouncif θαη ζπλ.. (1993), είλαη νη δχκεο θαη νη κχθεηεο. Απηνί νη κηθξννξγαληζκνί είλαη ελεξγνί ζηελ απνζχλζεζε ηεο νξγαληθήο νπζίαο θαη κπνξνχλ λα παίμνπλ έλαλ ξφιν ζηελ ππνβάζκηζε θαη απνηθνδφκεζε ησλ νξγαληθψλ ζπζηαηηθψλ νδεγψληαο ζε έλα θπζηθφ κεηαζρεκαηηζκφ ησλ νξγαληθψλ ζπζηαηηθψλ ζε αλφξγαλα. Οη ιηπνιπηηθνί κηθξννξγαληζκνί αληηπξνζσπεχνληαη απφ είδε δπκψλ θαη κπθήησλ Aspergillus terreus θαζψο θαη θάπνηα άιια είδε κηθξννξγαληζκψλ, ηα νπνία δελ κπνξνχζαλ λα αλαπηπρζνχλ ζην άγαξ. Οη δχκεο, νη κχθεηεο θαη ηα γαιαθηηθά βαθηήξηα ήηαλ επνκέλσο νη θχξηνη κηθξννξγαληζκνί πνπ βξέζεθαλ ζηα πγξά απφβιεηα ειαηνπξγείσλ. Θα πξέπεη λα ηνληζηεί εδψ φηη ηα OOMW έρνπλ πςειή πεξηεθηηθφηεηα ζε αλαζηνιείο κηθξνβηαθήο αλάπηπμεο, φπσο νη πνιπθαηλφιεο θαη νη ηαλίλεο. Σν γεγνλφο απηφ ηα θάλεη αλεπηζχκεηα γηα βηνινγηθέο κεηαρεηξίζεηο πεξηζζφηεξν θαη απφ ην φμηλν ph. Ζ αεξφβηα κεηαρείξηζε κε κεξηθά είδε κηθξννξγαληζκψλ ηα νπνία κπνξνχλ λα αλαπηπρζνχλ ζηα πγξά απφβιεηα ζα ήηαλ ε πην θαηάιιειε πξνζέγγηζε γηα λα πεξηνξηζηεί ην πξφβιεκα. Εχκεο θαη κχθεηεο κπνξνχλ λα ρξεζηκνπνηεζνχλ γηα απηφ ην ζθνπφ. Σα απνηειέζκαηα εξγαζίαο ησλ Mouncif θαη ζπλ. (1993) έδσζαλ ηηο απνδείμεηο φηη κηα βηνκεηαηξνπή ησλ πνιπθαηλνιψλ θαζψο θαη άιισλ αλαζηνιέσλ πξηλ απφ άιιεο βηνινγηθέο κεηαρεηξίζεηο ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ ζα βνεζνχζε ζηελ αλάπηπμε κηαο πην θαιά ειεγρφκελεο δηαδηθαζίαο. Δπίζεο, ν Borja-Padilla θαη άιινη (1992) ρξεζηκνπνίεζαλ ην κχθεηα Geotrichum Candidum, ν νπνίνο πξνζνκνηάδεη ζε δχκε, ζηελ αεξφβηα κεηαρείξηζε ησλ OOMW πξηλ ηε δηαδηθαζία βηνκεζαλνπνίεζεο. Οη Martinez-Nieto θαη ζπλ. (1992) έδεημαλ ηε δξαζηεξηφηεηα ηνπ ζηε βηναπνηθνδφκεζε ησλ πνιπθαηλνιψλ. Οη κεηξήζεηο δπκψλ ζηα δηαθνξεηηθά δείγκαηα απφ 6 ειαηνπξγεία ζην πείξακα ησλ Mouncif θαη ζπλ. (1993) ήηαλ πςειέο, φπσο αλαθέξεηαη ζηνλ Πίλαθα 2.4. Απηφ κπνξεί λα ππνδειψλεη φηη ηα πγξά απφβιεηα ζα κπνξνχζαλ λα απνηειέζνπλ έλα θαηάιιειν πγξφ παξαπξντφλ, ην νπνίν κπνξεί λα ρξεζηκνπνηεζεί γηα ηελ αλάπηπμε δπκψλ θαη κπθήησλ. Απηφ κπνξεί λα βνεζήζεη ζηελ δηαδηθαζία αεξφβηαο κεηαρείξηζεο ησλ ΟOΜW. 26

45 ε άιιε εξγαζία ησλ Μillan θαη ζπλ. (2000), νη κηθξνβηαθνί πιεζπζκνί απφ δηαθνξεηηθέο ιίκλεο απφζεζεο OMW θαίλεηαη ζηνλ Πίλαθα 2.5. Ο ζπλνιηθφο αξηζκφο δψλησλ κηθξννξγαληζκψλ ήηαλ πςειφο, θπκαηλφκελνο απφ 1.7 Υ 10 4 CFU/ml ζηε ιίκλε 3 ζε 6.7 Υ 10 6 ζηε ιίκλε 1. Σφζν ν ζπλνιηθφ αξηζκφο ησλ δψλησλ θπηηάξσλ φζν θαη ην πνζνζηφ ησλ δηαθνξεηηθψλ κηθξνβηαθψλ κνλάδσλ (κχθεηεο, δχκεο θαη βαθηήξηα) κεηαβιήζεθαλ απφ ηε κηα ιίκλε ζηελ άιιε. Σα ΟOΜW απφ ηε ιίκλε κε αξηζκφ 1 έδεημαλ ην πςειφηεξν πνζνζηφ δπκψλ θαη κπθήησλ. Οη ηξεηο νκάδεο ήηαλ παξνχζεο κε ζρεδφλ ίζεο πνζφηεηεο απφ ηα OOMW ζηε ιίκλε 3. Σα ΟOΜW απφ ηηο ιίκλεο 2 θαη 4 έδεημαλ κηα παξφκνηα ζχλζεζε, αλ θαη νη κεηξήζεηο βαθηεξίσλ θπξηάξρεζαλ ησλ δπκψλ θαη κπθήησλ. Πίλαθαο 2.5. Μεηξήζεηο κηθξνβηαθψλ θπηηάξσλ ζε δείγκαηα OOMW απφ δηαθνξεηηθέο ιίκλεο* (Millan et al., 2000) Λίκλεο Μχθεηεο 3.2 x x x x 10 4 Εχκεο 1.8 x x x x 10 4 Βαθηήξηα 1.7 x x x x 10 5 Οιηθέο κεηξήζεηο 6.7 x x x x 10 5 (*) Οη κεηξήζεηο εθθξάζηεθαλ σο cfu/ml Ζύκες Οη δχκεο είλαη κνλνθχηηαξνη επθαξπσηηθνί κηθξνννξγαληζκνί πνπ απνκνλψλνληαη απφ πνιιέο ηξνθέο, θαη βξίζθνληαη ζπρλά πέξα απφ ηα πγξά απφβιεηα ησλ ειαηνπξγείσλ (ΟΟΜW) θαη ζηελ επεμεξγαζία ησλ επηηξαπέδησλ ειηψλ, φπνπ κπνξνχλ λα παίμνπλ έλα δηπιφ ξφιν. Απφ ηε κηα, απηνί νη κηθξννξγαληζκνί κπνξνχλ λα πξνθαιέζνπλ αιινίσζε ησλ θαξπψλ ιφγσ ηεο παξαγσγήο δπζάξεζησλ νζκψλ θαη γεχζεσλ, ηε ζπζζψξεπζε CO 2 πνπ νδεγεί ζε θνπζθσκέλα θνξηία, ην ζφισκα ζηηο άικεο, ην καιάθσκα ησλ θαξπψλ θαζψο θαη ηελ ππνβάζκηζε ησλ γαιαθηηθψλ νμέσλ. Όια απηά είλαη εμαηξεηηθά επηδήκηα θαηά ηε δηάξθεηα ηεο απνζήθεπζεο θαη ζπζθεπαζίαο ησλ ειηψλ. Αιιά απφ ηελ άιιε πιεπξά, νη δχκεο έρνπλ επηζπκεηέο βηνρεκηθέο ηδηφηεηεο κε ζεκαληηθέο ηερλνινγηθέο εθαξκνγέο ζηα δπκνχκελα ιαραληθά, φπσο ε παξαγσγή ελδχκσλ ιηπάζεο, εζηεξάζεο, β- γιπθνζηδάζεο, θαηαιάζεο, ε παξαγσγή θνληθψλ παξαγφλησλ θ.α. Πξφζθαηα, ην 27

46 πξνβηνηηθφ δπλακηθφ ησλ δπκψλ ειηάο έρεη αξρίζεη λα αμηνινγείηαη, επεηδή πνιιά είδε είλαη ηθαλά λα αληέρνπλ ην πέξαζκα απφ ην γαζηξεληεξηθφ ζσιήλα θαη λα έρνπλ σθέιηκεο επηδξάζεηο ζην ζηνκάρη. Με ηνλ ηξφπν απηφ, νη δχκεο κπνξεί λα βειηηψζνπλ ηελ πγεία ησλ θαηαλαισηψλ κεηψλνληαο ηα επίπεδα ρνιεζηεξφιεο, αλαζηέιινληαο ηα παζνγφλα, ππνβαζκίδνληαο ηηο κε αθνκνηψζηκεο ελψζεηο, παξάγνληαο αληηνμεηδσηηθά θαη βηηακίλεο, πξνζθνιιψληαο ζηα εληεξηθά θχηηαξα ή δηαηεξψληαο ηελ αθεξαηφηεηα ηνπ επηζειηαθνχ θξάγκαηνο (εκπνδίνπ). Πνιιά είδε δπκψλ, επίζεο ζπλήζσο επξηζθφκελα ζηελ επεμεξγαζία ησλ επηηξαπέδησλ ειηψλ, φπσο ηα Wicherhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens θαη Kluyveromyces lactis έρνπλ αλαθεξζεί λα εθζέηνπλ κεξηθέο απφ απηέο ηηο ηδηφηεηεο. Έηζη, ε επηινγή ησλ πην θαηάιιεισλ ζηειερψλ γηα ρξήζε σο εθθηλεηέο (θαιιηέξγεηεο εθθίλεζεο) κφλα ή ζε ζπλδπαζκφ κε ηα γαιαθηηθά βαθηήξηα απνηεινχλ κηα ππνζρφκελε γξακκή έξεπλαο ζην θνληηλφ κέιινλ ε νπνία ζα κπνξνχζε λα βειηηψζεη ηελ πξνζηηζέκελε αμία ηνπ εκπνξεχζηκνπ πξντφληνο (Αrroyo Lopez et al., 2012c). Γηάθνξνη εξεπλεηέο έρνπλ κειεηήζεη κεηαμχ άιισλ ιηπνιπηηθέο, β-γιπθνζηδάζεο, θαηαιάζεο θαζψο θαη θνληθέο δξαζηεξηφηεηεο δηαθφξσλ εηδψλ δπκψλ γηα ρξήζε ηνπο σο θαιιηέξγεηεο εθθίλεζεο (Aponte et al., 2010, Bevilacqua et al., 2009, Hernandez et al., 2007, Marquina et al., 1992, Psani and Kotzekidou, 2006, Romo-Sanchez et al., 2010). Ζ κειέηε ησλ Romo-Sanchez θαη ζπλ. (2010) είλαη ε πξψηε πνπ πεξηγξάθεη ζπγθεθξηκέλα ζηειέρε δπκψλ απνκνλσκέλα απφ ειατθά νηθνζπζηήκαηα απφ ηελ πεξηνρή Castilla La Mancha ηεο Ηζπαλίαο, θαζψο θαη ηελ ηθαλφηεηά ηνπο γηα παξαγσγή ελδχκσλ βηνκεραληθνχ ελδηαθέξνληνο. Ζ εξγαζία απηή δείρλεη επίζεο ην δπλακηθφ απηψλ ησλ ζηειερψλ, ηα νπνία απνκνλψζεθαλ απφ παξαπξντφληα ηεο επεμεξγαζίαο ηεο ειηάο, φπσο ν ειαηνππξήλαο θαη ε ειαηνδχκε. Σα πιηθά απηά ζα κπνξνχζαλ λα ρξεζηκνπνηεζνχλ ζηε βηνκεραληθή βηνηερλνινγία γηα παξαγσγή ελδχκσλ, εκπνξηθέο παξαζθεπέο ή επεμεξγαζίεο δχκσζεο ζε δηαθνξεηηθνχο θνξείο ηεο βηνκεραλίαο. Ο ραξαθηεξηζκφο απηψλ ησλ πεγψλ κπνξεί επίζεο λα ζπλεηζθέξεη ζηελ αλάπηπμε κηαο κηθξνβηνινγηθήο ηξάπεδαο, παξέρνληαο πιεξνθνξίεο πάλσ ζε ηερλνινγηθέο ηδηφηεηεο θαη ραξαθηεξηζηηθά ελδχκσλ γηα δπλεηηθέο βηνκεραληθέο εθαξκνγέο (Πίλαθαο 2.6). 28

47 Μεηαρείξηζε Απεπζείαο αικηζκέλεο Ηζπαληθνχ ηχπνπ Πίλαθαο 2.6. Bηνρεκηθέο (πνηνηηθέο) δνθηκέο γηα ζηειέρε δπκψλ απνκνλσκέλα απφ δηαθνξεηηθέο πνηθηιίεο επηηαηξαπέδησλ ειηψλ θαη δηαθνξεηηθέο κεζφδνπο βηνκεραληθήο δχκσζεο (Βautista- Callego et al., 2011). Πνηθηιία Δίδε Πξσ- β-γιπθν Καηά- Ξπια- Ληπάζε ειηάο ηεάζε ζηδάζε ιάζε λάζε Δζηεξάζε Alorena *Saccharomyces cerevisiae Candida diddensiae Pichia membranifaciens Zygosaccharomyce mrakii Debaromyces hansenii Gordal Candida tropicalis Pichia galeiformis *Wickerhamomyces anomalus Manza- Candida tropicalis nilla Pichia galeiformis Candida thaimueangensis Wickerhamomyces anomalus Candida boidinii Saccharomyces cerevisiae Gordal Debaromyces etchelsii Pichia galeiformis Candida tropicalis *Wickerhamomyces anomalus Candida thaimueangensis Κluyveromyces lactis Candida sorbosivorans Torulaspora

48 delbrueckii Manza- Debaromyces nilla etchelsii Pichia galeiformis Candida tropicalis Wickerhamomyces anomalus Candida thaimueangensis Κluyveromyces lactis Hanseniaspora guilliermondii Pichia kudriavzenii *Δπηιέρζεθαλ γηα πνζνηηθέο αλαιχζεηο Σα ηαμηλνκηθά θξηηήξηα κέζσ ησλ θπζηνινγηθψλ θαη βηνρεκηθψλ ηδηνηήησλ ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ απφ πγξά απφβιεηα ειαηνπξγείσλ έδεημαλ ηελ θαηαλνκή ησλ εηδψλ, φπσο αλαθέξνληαη ζηνλ Πίλαθα 2.7. Μεξηθά είδε είλαη θνηλά ζηηο δπκψζεηο ειηψλ θαη κπνξεί λα παίμνπλ έλα ξφιν ζηε ηερλνινγία ησλ δπκνχκελσλ πξάζηλσλ ειηψλ, φπσο αλαθέξζεθε πξνεγνπκέλσο. Μεηαμχ ησλ γελψλ επξέσο θαηαλεκεκέλσλ ζε πςειέο ζπγθεληξψζεηο ζε άικεο, ηα Debaryomyces θαη Pichia είλαη ηα πην θνηλά. Όπσο κπνξεί λα θαλεί, ζηειέρε εηδψλ πνπ αλήθνπλ ζην γέλνο Debaryomyces εκθάληζαλ κεξηθέο ελδηαθέξνπζεο ηδηφηεηεο ζπκπεξηιακβαλνκέλεο ηεο αλάπηπμεο ζε πςειέο ζπγθεληξψζεηο NaCl κέρξη 12-15% θαη αλάπηπμε ζηνπο 37 ν C. Ζ ρξήζε ληηξηθψλ θαη νπξίαο επεξεάδνπλ ηελ πδξφιπζε ιηπηδίσλ (ιηπάζε). Σα άιια είδε πνπ αλήθνπλ ζην γέλνο Pichia είλαη ζε πςειφ βαζκφ αληηπξνζσπεπηηθά. Απηά ηα είδε είλαη γλσζηά απφ ηελ αλάπηπμή ηνπο ζηελ επηθάλεηα ηεο άικεο θαη ησλ δπκνχκελσλ πγξψλ. 30

49 Πίλαθαο 2.7. Καηαλνκή ζηειερψλ δπκψλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείσλ (Mouncif et al., 1993). ηέιερνο Aξηζκόο % Εύκεο Pichia P. carsoni Debaryomyces hansenii D. castelli Sacharomyces cerevisiae Candida zeylanoides C. oleophila C. versatilis Schizosaccharomyces malidevorans Rhotodorula mucilaginosa χκθσλα θαη κε ηνπο Ben Sassi θαη ζπλ. (2006), νη πιεζπζκνί δπκψλ εκθαλίδνληαη λα είλαη πςεινί ζηα πγξά απφβιεηα ειαηνπξγείσλ. Οη δχκεο Geotrichum (G. candidum), Candida (C. membranifaciens, C. michaelii, C. incospicua, θαη C. tropicalis), Pichia (P. fermentans θαη P. holstii), Rhodotorula (R. mucilaginosa) θαη Saccharomyces (S.cerevisiae) έρνπλ πξφζθαηα απνκνλσζεί απφ OOMW (Bleve et al, 2011). Οη δχκεο Candida boidinii, Pichia holstii (ζπλ. Νakazawea holstii), P. membranifaciens, θαη Saccharomyces cerevisiae ήηαλ νη θπξίαξρεο δχκεο απφ ηελ πεξηνρή Apulia ηεο Ηηαιίαο, δείρλνληαο πςειέο πεθηηλνιπηηθέο θαη μπιαλνιπηηθέο δξαζηεξηφηεηεο. Απηέο νη απνκνλψζεηο δπκψλ ζα κπνξνχζαλ απνηειεζκαηηθά λα κεηψζνπλ ηα νιηθά θαηλνιηθά, νδεγψληαο ζε κηα κείσζε νιηθψλ θαηλνιηθψλ ελψζεσλ φπσο p-θνπκαξηθφ, ην βαληιηθφ θαη ην θαθεηθφ νμχ (Sinigaglia et al., 2010). Σα Pichia (P. guilliermondii-ζπλ. Meyerozyma guillermondii) θαη Candida (C. diddensiae θαη C. ernobii) spp ήηαλ επίζεο νη θχξηεο δχκεο ζηα OOMW απφ ηα ειαηνπξγεία ηνπ Μαξφθν (Ben Sassi et al., 2008). Tα Pichia caribbica (ζπλ. Meyerozyma caribbica), P. holstii (ζπλ. Νakazawea holstii), θαη Zygosaccharomyces fermentanii (ζπλ. Lachancea fermenatnii) ήηαλ νη θπξίαξρεο δχκεο ζηα πγξά απφβιεηα δηθαζηθψλ ειαηνπξγείσλ (TPOMW), ελψ νη Z. Florentinus (ζπλ. Zygotorulaspora florentina), Lachancea thermotolerans (ζπλ. Kluyveromyces thermotolerans), Saccharomyces cerevisiae θαη S. rosinii (ζπλ. Kazachstania rosinii) βξίζθνληαλ ζε κηθξφηεξα πνζνζηά ζηνλ πιεζπζκφ ησλ δπκψλ (Romo-Sanchez et al., 2010). Μεξηθέο απφ ηηο απνκνλψζεηο δπκψλ απφ ηα TPOMW 31

50 εκθάληζαλ δξαζηεξηφηεηεο θπηηαξηλάζεο, β-γιπθαλάζεο, β-γιπθνζηδάζεο, πεξνμεηδάζεο θαη πνιπγαιαθηνπξνλάζεο, νη νπνίεο ζα κπνξνχζαλ λα ζπλεηζθέξνπλ ζηελ ππνβάζκηζε θαη απνηθνδφκεζε ζχλζεησλ ελψζεσλ, ζπκπεξηιακβαλνκέλσλ ησλ θαηλνιηθψλ ηνπ ειαηνππξήλα (Romo-Sanchez et al., 2010). Bαζηζκέλνη ζηηο πιεξνθνξίεο πνπ παξέρνληαη απφ ηνπο Romo-Sanchez θαη ζπλ. (2010), ε πνηθηινκνξθία δπκψλ ζηνλ ειαηνππξήλα εκθαλίδεηαη λα είλαη αλάινγε ηεο πνηθηιίαο. Μύθετες Ζ κηθξνρισξίδα ησλ πγξψλ απνβιήησλ αληηπξνζσπεχεηαη επίζεο απφ κχθεηεο θαη δχκεο πνπ πξνζνκνηάδνπλ κε κχθεηεο. Απηνί νη κηθξννξγαληζκνί είλαη αλζεθηηθνί ζε δπζκελείο πεξηβαιινληηθέο ζπλζήθεο φπσο ην φμηλν ph, πςειέο ζπγθεληξψζεηο άιαηνο θαη ελψζεηο ρακειήο ζξεπηηθήο αμίαο. ε πείξακα ησλ Mouncif θαη ζπλ. (1993), ηα Penicillum sp, Geotrichum candidum θαη Aspergillus niger ήηαλ ηα πην ζπρλά (Πίλαθαο 2.8.). Πίλαθαο 2.8. Καηαλνκή ζηειερψλ κπθήησλ ζε δείγκαηα πγξψλ απνβιήησλ ειαηνπξγείσλ (Mouncif et al., 1993). ηέιερνο Aξηζκόο % Μύθεηεο Penicillum sp Aspergillus sp Geotrichum sp ηελ εξγαζία ησλ Μillan θαη ζπλ. (2000) πνπ πξναλαθέξζεθε, 50 ζηειέρε λεκαησδψλ κπθήησλ απνκνλψζεθαλ ζπλνιηθά απφ ηηο δηαθνξεηηθέο ιίκλεο (Πίλαθαο 2.9.). Απηά βξέζεθαλ λα αλήθνπλ ζε 12 δηαθνξεηηθά γέλε. Σνπιάρηζηνλ 8 δηαθνξεηηθά είδε κπθήησλ κπφξεζαλ λα απνκνλσζνχλ απφ ηα OOMW ζηε ιίκλε 1. Απηή ε ιίκλε πεξηείρε επίζεο ην πςειφηεξν κηθξνβηαθφ θνξηίν (Πίλαθαο 2.5.). Γηα ηηο ππφινηπεο ιίκλεο, ν αξηζκφο ησλ εηδψλ πνπ απνκνλψζεθαλ θπκάλζεθε απφ 3 ζε 5. Σα είδε πνπ πην ζπρλά απνκνλψζεθαλ ήηαλ Fusarium spp (11), Chalara paradoxa (9), Paecilomyces sp. (8), Penicillium (7) θαη Scopulariopsis (6). Kαζέλα απφ απηά βξηζθφηαλ ηνπιάρηζηνλ ζε 3 απφ ηηο 4 ιίκλεο πνπ κειεηήζεθαλ, ελψ ην Paecilomyces εληνπίζηεθε θαη ζηηο 4 ιίκλεο πνπ κειεηήζεθαλ (Πίλαθαο 2.9.). 32

51 Πίλαθαο 2.9. Μχθεηεο απνκνλσκέλνη απφ δηαθνξεηηθέο ιίκλεο. Γηαθξίλεηαη ν αξηζκφο ζηειερψλ πνπ απνκνλψζεθε απφ θάζε ιίκλε (Millan et al., 2000). Λίκλεο Acremonium butyri 1 Alternaria 1 Aspergillus 1 Chalara paradoxa Fusarium Lecytophora 2 Paecilomyces Penicillium Phycomyces 2 Phoma 1 Rhinocladiella 1 Scopulariopsis Έξεπλα ηνπ Δζληθνχ Κέληξνπ Πιεξνθνξηψλ Βηνηερλνινγίαο (NCBI) απνθάιπςε ηελ παξνπζία 106 δηαηεξεκέλσλ αιιεινπρηψλ βάζεσλ DNA απφ κχθεηεο, νη νπνίνη είραλ απνκνλσζεί απφ πεξηβάιινλ πγξψλ απνβιήησλ ειαηνπξγείνπ. Ζ αλάιπζε ησλ αιιεινπρηψλ απηψλ επηβεβαηψλεη ηελ ηνπνζέηεζε (θαηάηαμε) ηεο πιεηνςεθίαο ησλ κπθήησλ απφ ηα πγξά απφβιεηα ειαηνπξγείσλ ζε Γινκεξνκχθεηεο (Glomeromycota), Βαζηδηνκχθεηεο (Basidiomycota), Αζθνκχθεηεο (Ascomycota), θαζψο θαη κχθεηεο πνπ δελ έρνπλ θαηαγξαθεί θαη ηαμηλνκεζεί (Δηθφλα 2.5). Οη Βαζηδηνκχθεηεο θαηαιακβάλνπλ πνζνζηφ κεγαιχηεξν ηνπ 60% απφ ην ζχλνιν ησλ κπθήησλ πνπ είλαη απνζεθεπκέλνη ζηελ Σξάπεδα γνληδίσλ. Μέιε ησλ Γινκεξνκπθήησλ θαη ησλ κε ηαμηλνκεκέλσλ κπθήησλ αληηζηνηρνχλ ζην 19 θαη 17% αληίζηνηρα ησλ αληίζηνηρσλ θαηαγξαθψλ, ελψ ηα κέιε ησλ Αζθνκπθήησλ απνηεινχλ κφλν ην 3% ηνπ ζπλφινπ. (Karpouzas et al., 2009, Ipsilantis et al., 2009). Mέιε ησλ γελψλ κπθήησλ Acremonium, Alternaria, Aspergillus, Chalara, Fusarium, Lecythophora, Paecilomyces, Penicillium, Phoma, Phycomyces, Rhinocladiella, θαη Scopulariopsis έρνπλ ηαπηνπνηεζεί ζε ιίκλεο δηάζεζεο θαη απφζεζεο πγξψλ απνβιήησλ ειαηνπξγείσλ (φπσο πξναλαθέξζεθε), έρνληαο ηελ ηθαλφηεηα λα απνηνμηλψλνπλ ηα απφβιεηα απηά (Μillan et al., 2000). Παξφια απηά, ε ηαπηνπνίεζε απηψλ ησλ κπθήησλ βαζίζηεθε ζηε κνξθνινγία ηνπο θαη φρη ζε κνξηαθέο ηερληθέο. Μέιε ησλ γελψλ κπθήησλ 33

52 Cerrena, Byssochlamys (ζπλ. Paecilomyces), Lasiodiplodia, θαη Bionectria είλαη απηφρζνλε κηθξνρισξίδα (ηαπηνπνηεκέλε κε κνξηαθέο ηερληθέο) ησλ ΟΟMW, ε νπνία έρεη ηελ ηθαλφηεηα λα απνηθνδνκεί ηα θαηλνιηθά ηνπο ζπζηαηηθά (Mann et al., 2010). Δηλόλα 2.5. Καηαλνκή κπθεηνινγηθψλ θχισλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ (Ntougias et al., 2013). Mε βάζε ηηο παξαπάλσ κειέηεο, είδε πνπ πξνζνκνηάδνπλ κε Pichia, Candida θαη Saccharomyces είλαη νη θπξίαξρεο δχκεο ζηα πγξά απφβιεηα ειαηνπξγείνπ (OΟMW). H κείσζε ηφζν ησλ θαηλνιηθψλ, φζν θαη ησλ ζαθράξσλ είλαη ε θχξηα κεηαβνιηθή ιεηηνπξγία ησλ δπκψλ ζηα πγξά απφβιεηα ειαηνπξγείσλ, ελψ θαίλεηαη λα ζπλεηζθέξνπλ ιηγφηεξν ζηνλ απνρξσκαηηζκφ ησλ ΟΟΜW ζε ζχγθξηζε κε ην κχθεηα ιεπθήο ζήςεο (Βen Sassi et al., 2008). Eπηπιένλ, ην φμηλν ph ησλ πγξψλ απηψλ απνβιήησλ κπνξεί λα απνηειεί πιενλέθηεκα γηα απηή ηελ νκάδα κηθξννξγαληζκψλ γηα λα αληαγσληζηεί ηα βαθηήξηα. Νεκαηψδεηο κχθεηεο, φπσο νη Aspergillus θαη Penicillium spp., βξίζθνληαη ζπρλά ζηα πγξά απφβιεηα ειαηνπξγείσλ (Μillan et al., 2000, Aissam et al., 2007), ελψ ν κχθεηαο ιεπθήο ζήςεο έρεη απνκνλσζεί ζε κηθξφηεξν βαζκφ. Φαίλεηαη φηη νη πςειέο ζπγθεληξψζεηο άιαηνο θαη ζαθράξσλ ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ θαζψο θαη ην 34

53 φμηλν ph, επλννχλ ηελ αλάπηπμε ησλ σζκoάληνρσλ δπκψλ ζηα ΟMW (Giannoutsou et al., 2004) Μέζνδνη ηαπηνπνίεζεο δπκώλ Οη ζπκβαηηθέο κέζνδνη πνπ θάλνπλ ρξήζε θιαζηθψλ κηθξνβηνινγηθψλ ηερληθψλ πξνζθέξνπλ αθξίβεηα σο πξνο ηελ ηαπηνπνίεζε θαη δηαθνξνπνίεζε ζηειερψλ, ραξαθηεξίδνληαη απφ πνιππινθφηεηα, απαηηνχλ κεγάιν θφζηνο αλαισζίκσλ θαη εζηηάδνληαη ζηε κειέηε κνξθνινγηθψλ, θπζηνινγηθψλ θαη βηνρεκηθψλ ραξαθηεξηζηηθψλ. Δπηπξφζζεηα, ε ρξήζε δηαγλσζηηθψλ θηη API 20C, APIATB 32C, API 50CH, πνπ βαζίδνληαη ζηε κειέηε αλάπηπμεο ησλ κηθξννξγαληζκψλ παξνπζία ζπγθεθξηκέλσλ πεγψλ άλζξαθα θαη αδψηνπ, απινπνίεζε ηε δηαδηθαζία, δίλνληαο απνηειέζκαηα ηαπηνπνίεζεο κέζα ζε 48 ψξεο (Lafon-Lafourcade and Joyeux, 1979, Subden et al., 1980, Ison, 1987, Lin and Fung, 1987, Deak and Beuchat, 1988, Rohm et al., 1990). Δπηπιένλ δνθηκέο, φπσο ε κειέηε ησλ βηνρεκηθψλ δξαζηεξηνηήησλ ησλ κηθξννξγαληζκψλ (δνθηκή θαηαιάζεο, πξσηεάζεο, ιηπάζεο, εζηεξάζεο, μπιαλάζεο, πνιπγαιαθηνπξνλάζεο θ.α.) ζε ζπλδπαζκφ κε ηα δηαγλσζηηθά θηη απμάλνπλ ηελ αμηνπηζηία ηεο ηαπηνπνίεζεο (Heard and Fleet, 1990). Παξφια απηά, πξφζθαηα έρνπλ αξρίζεη λα ρξεζηκνπνηνχληαη επξέσο κνξηαθέο κέζνδνη, νη νπνίεο παξέρνπλ έλα κεγαιχηεξν βαζκφ αθξίβεηαο ζηελ ηειηθή ηαπηνπνίεζε απφ φηη νη θιαζηθέο βηνρεκηθέο κέζνδνη. Ζ αλάιπζε αθνινπζηψλ γνληδίσλ ξηβνζσκηθνχ RNA (rrna) απνηειεί κηα κνξηαθή κεζνδνινγία πνπ ρξεζηκνπνηείηαη γηα ην ραξαθηεξηζκφ ησλ δπκψλ (Fernandez Gonzales et al., 2001). Oη κνξηαθέο ηερληθέο πνπ ρξεζηκνπνηνχληαη γηα ηε κειέηε ησλ θπινγελεηηθψλ ζρέζεσλ είλαη: 1) H αιπζηδσηή αληίδξαζε πνιπκεξάζεο (Polymerase Chain Reaction PCR), ε νπνία ρξεζηκνπνηείηαη γηα ηελ ελίζρπζε ή πνιιαπιαζηαζκφ ελφο ζπγθεθξηκέλνπ ηκήκαηνο DNA, φπσο ε θιαζηθή PCR, ε Μultiplex ή Πνιιαπιή PCR, ε RT PCR ή Reverse Trancriptase PCR, ε Αληίζηξνθε ή Inverse PCR, ε In situ PCR, ε Real Time PCR ή PCR πξαγκαηηθνχ ρξφλνπ θαη ε Nested PCR. H PCR αθνινπζείηαη απφ ηελ ειεθηξνθφξεζε, ε νπνία ρξεζηκνπνηείηαη επξχηαηα γηα ην δηαρσξηζκφ, ηελ ηαπηνπνίεζε θαη ηνλ θαζαξηζκφ δηαθφξσλ κνξίσλ DNA (Ζιεθηξνθφξεζε ζε πεθηή αγαξφδεο ή ειεθηξνθφξεζε ζε πεθηή πνιπαθξπιακηδίνπ), 2) ε αλάιπζε ηνπ πνιπκνξθηζκνχ κήθνπο ζξαπζκάησλ 35

54 (Restriction Fragments Length Polymorphism - RFLP) πνπ δεκηνπξγνχληαη κεηά ηελ πέςε ηνπ εληζρπκέλνπ rrna γνληδίνπ θαη ησλ ζπζρεηηδφκελσλ δηαγελεηηθψλ πεξηνρψλ ITS κε ηε ρξήζε ελδνλνπθιεαζψλ (έλδπκα) πεξηνξηζκνχ, νη νπνίεο ηέκλνπλ ην δίθισλν DNA ζε νξηζκέλε πεξηνρή (εηδηθή παιίλδξνκε αιιεινπρία βάζεσλ 4-8 λνπθιενηηδίσλ) ηελ νπνία αλαγλσξίδνπλ, δηαζπψληαο 2 θσζθνδηεζηεξηθνχο δεζκνχο (έλα γηα θάζε θιψλν) (Esteve Zarzoso et al., 1999) θαη 3) ηελ αλάιπζε αθνινπζηψλ ζπγθεθξηκέλσλ ηκεκάησλ DNA κεηά απφ ελίζρπζε κε PCR είηε ησλ D1/D2 πεξηνρψλ ηνπ 26S rrna γνληδίνπ εληζρπκέλνπ κε πξηκνδφηεο (primers) (Kurtzman and Robnett, 1998) ή ηεο 5.8S- ITS πεξηνρήο εληζρπκέλεο κε πξηκνδφηεο (Δsteve-Zarzoso et al., 1999). Oη πιεξνθνξίεο πνπ παίξλνληαη ζπγθξίλνληαη κε ηηο αληίζηνηρεο πνχ ππάξρνπλ ζε δηεζλείο βάζεηο πιεξνθνξηψλ (δεδνκέλσλ) φπσο ε Σξάπεδα γνληδίσλ (Genbank) απφ ην NCBI θαη ην yeast-id.com (Παλεπηζηήκην ηεο Βαιέλζηα θαη CSIC) γηα ηελ εχξεζε αιιειινπρηψλ θαη νκνινγίαο κεηαμχ απηψλ. Οη κνξηαθέο ηερληθέο είλαη γξήγνξεο, εχθνιεο ζηελ εθηέιεζε θαη πην αθξηβείο, πεξηνξίδνληαο κέξνο ηεο ππνθεηκεληθφηεηαο πνπ ζπλήζσο ζπλνδεχεη ηα απνηειέζκαηα ησλ βηνρεκηθψλ δνθηκψλ (Αrroyo Lopez et al., 2012c). πλνπηηθά ζα έιεγε θαλείο φηη ε ζχγρξνλε πξνζέγγηζε ζην ζέκα ηεο δηαθνξνπνίεζεο θαη ηαμηλφκεζεο ησλ ζηειερψλ βαζίδεηαη ζε ηερληθέο ηεο κνξηαθήο βηνινγίαο πνπ αλαιχνπλ ηνλ πνιπκνξθηζκφ κηηνρνλδξηαθνχ/γνληδησκαηηθνχ DNA θαη είλαη αλεμάξηεηεο ηεο θπζηνινγηθήο θαηάζηαζεο ηεο δχκεο ζε αληίζεζε κε ηηο θαηλνηππηθέο δνθηκέο πνπ βαζίδνληαη ζηελ αλάιπζε πξντφλησλ κεηαβνιηζκνχ ηνπ κηθξννξγαληζκνχ Μέζνδνη κεηαρείξηζεο ησλ πγξώλ απνβιήησλ ειαηνπξγείσλ (ΟΟΜW) Ζ εθαξκνγή ησλ κε επεμεξγαζκέλσλ ΟΟΜW πάλσ ζηα εδάθε θαη ηηο θαιιηέξγεηεο σο ιίπαζκα είλαη κηα θνηλή πξαθηηθή, ιφγσ ηεο νξγαληθήο νπζίαο θαη ησλ ζξεπηηθψλ ζηνηρείσλ πνπ πεξηέρνληαη ζε απηφ θαη ηα νπνία ζα κπνξνχζαλ λα βειηηψζνπλ ηα μεξά εδάθε. Παξφια απηά, ην πξφβιεκα ηεο απφζεζεο ησλ ΟΟΜW ζην πεξηβάιινλ δελ είλαη πιήξσο ιπκέλν, απφ ηε ζηηγκή πνπ ηα ιχκαηα πνπ παξάγνληαη πξνθαινχλ δπζκελείο επηδξάζεηο ζηελ πδξφβηα δσή, αιιαγή ηνπ ρξψκαηνο ησλ θπζηθψλ λεξψλ, ηνμηθφηεηα θαη νζκέο. Μηα ηζνξξνπεκέλε κέζνδνο απφζεζεο πεξηιακβάλεη ειεγρφκελε εθαξκνγή ζην έδαθνο θαηάιιεια ραξαθηεξηζκέλσλ πγξψλ απνβιήησλ. Έλα άιιν ζεκαληηθφ ζηνηρείν είλαη φηη ε πξνκεηαρείξηζε ησλ ΟΟΜW ζα κπνξνχζε λα βειηηψζεη ηελ πνηφηεηα ηνπο, 36

55 φπσο θαη λα απνκαθξχλεη ηελ πεξηζζφηεξε απφ ηελ ηνμηθφηεηά ηνπο (Saviozzi et al., 2001, Lopez-Pineiro et al., 2007, Saadi et al., 2007). Mεξηθέο επηινγέο κεηαρείξηζεο έρνπλ αμηνινγεζεί ζπκπεξηιακβαλνκέλσλ θπζηθψλ (δηάιπζε, εμάηκηζε, θαζίδεζε, θηιηξάξηζκα, επίπιεπζε), θπζηθνρεκηθψλ (νπδεηεξνπνίεζή, θξνθίδσζε, θαηαθξήκληζε, πξνζξφθεζε, ρεκηθή νμείδσζε, ηνληναληαιιαγή), βηνινγηθψλ (αεξφβηα θαη αλαεξφβηα επεμεξγαζία, βηνθίιηξα), ζεξκηθψλ ηερλνινγηψλ (θπζηθν-ζεξκηθή φπσο εμάηκηζε απφζηαμε ησλ ΟΟΜW θαη μήξαλζε ηνπ ειαηνπνιηνχ, κε αλαζηξέςηκε ζεξκνρεκηθή φπσο θαχζε θαη ππξφιπζε θαη ζπλδπαζκέλε θπζηθή θαη βηνινγηθή, φπσο νη ιεθάλεο εμαηκηζνδηαπλνήο), αιιά θακία δελ κπνξεί απφ κφλε ηεο λα επηιχζεη θαηά 100% ην πξφβιεκα (Εaharaki and Komnitsas, 2009). Οη ππάξρνπζεο κεηαρεηξίζεηο γηα ηελ απνηνμίλσζε ησλ ΟΟΜW, ηα νπνία ραξαθηεξίδνληαη απφ πςειφ νξγαληθφ θνξηίν θαη ηνμηθφηεηα, πεξηιακβάλνπλ φπσο πξναλαθέξζεθε θπζηθέο, θπζηθνρεκηθέο, βηνινγηθέο θαη ζεξκηθέο ηερλνινγίεο. Απηέο νη ηερλνινγίεο φηαλ ρξεζηκνπνηνχληαη κεκνλσκέλα έρνπλ πνιιά κεηνλεθηήκαηα, φπσο ρακειή απνδνηηθφηεηα ή πςειφ θφζηνο. Γηα ην ιφγν απηφ, ζπλδπαζκέλεο (κηθηέο) ή βειηησκέλεο ελαιιαθηηθέο κέζνδνη (νινθιεξσκέλεο) έρνπλ αλαπηπρζεί θαη δείρλνπλ ελζαξξπληηθά απνηειέζκαηα, φπσο ε κείσζε ησλ COD ζην 83% θαη έλα πνιχ πςειφ βαζκφ επεμεξγαζίαο. Σν λνκνζεηηθφ πιαίζην ηεο Δπξσπατθήο Έλσζεο δελ παξέρεη εηδηθέο θαηεπζπληήξηεο γξακκέο γηα ηε δηαρείξηζε ησλ OOMW, ιφγσ ηεο παξαγσγήο ηνπο κφλν ζηελ πεξηνρή ηεο Μεζνγείνπ. ηηο πεξηζζφηεξεο ρψξεο νη ηδηνθηήηεο ειαηνπξγείσλ είλαη ππεχζπλνη γηα ηε δηαρείξηζε ησλ πγξψλ απνβιήησλ κε ηε ρξήζε πξαθηηθψλ φπσο απφζεζε ζε πνηάκηα ή ιίκλεο δεκηνπξγψληαο κε ηνλ ηξφπν απηφ ζνβαξά πεξηβαιινληηθά πξνβιήκαηα (Εaharaki and Komnitsas, 2009) Μηθηέο κέζνδνη επεμεξγαζίαο Ζ κέγηζηε δπλαηή κείσζε ησλ ξχπσλ ησλ OOMW κπνξεί κφιηο θαη κεηά βίαο λα επηηεπρζεί κε ηε πηνζέηεζε κηαο κφλν κεζφδνπ επεμεξγαζίαο, φπσο αλαθέξζεθε πξνεγνπκέλσο. Ζ απνηειεζκαηηθή δηαρείξηζε ησλ ΟΟΜW πεξηιακβάλεη ηελ πξνκεηαρείξηζε ηνπο πξηλ ηελ εθαξκνγή ηεο επηιεγκέλεο επεμεξγαζίαο. Πεηξακαηηθά απνηειέζκαηα δείρλνπλ φηη πξηλ ηελ αλαεξφβηα ππνβάζκηζε ησλ ΟΟΜW, ε ππεξδηήζεζε 37

56 επηηξέπεη κεγάιε απνκάθξπλζε ησλ ιηπηδίσλ θαη ησλ πνιπθαηλνιψλ αιιά έρεη θησρή επηιεθηηθφηεηα, ελψ ε θπγνθέληξεζε είλαη πξνηηκφηεξε απφ ηελ θαζίδεζε ιφγσ ησλ κηθξφηεξσλ φγθσλ ηεο θάζεο δηαρσξηζκνχ (Hamdi and Ellouz, 1993). πλδπάδνληαο ηελ νδφλσζε θαη ηελ αεξφβηα κεηαρείξηζε, κηα ζπλνιηθή κείσζε ηνπ ρεκηθψο απαηηνχκελνπ νμπγφλνπ (COD) ζην 82,5% κπνξεί λα επηηεπρζεί, πνζνζηφ ην νπνίν είλαη πςειφηεξν απφ ην αληίζηνηρν πνπ επηηπγράλεηαη φηαλ θάζε κηα απφ ηηο παξαπάλσ ηερλνινγίεο ρξεζηκνπνηείηαη απφ κφλε ηεο. Μηα παξφκνηα κείσζε ηνπ COD παξαηεξείηαη φηαλ ε αεξφβηα κεηαρείξηζε πξνεγείηαη ηεο νδφλσζεο (Benitez et al., 1999). Οη κηθηέο κέζνδνη επεμεξγαζίαο πγξψλ απνβιήησλ ειαηνπξγείνπ απνηεινχλ νπζηαζηηθά ζπλδπαζκνχο κεζφδσλ, νη νπνίνη ζηνρεχνπλ ζηελ απνξξχπαλζε ησλ απνβιήησλ. Σέηνηεο κέζνδνη ζεσξνχληαη νη παξαθάησ: Μηθηή κέζνδνο κε ρξήζε ρεκηθήο νμείδσζεο Fenton θαη ζπγθνκπνζηνπνίεζεο, Μηθηή κέζνδνο Δ.Ζ.Ο. ΔΝVITEC κε ρξήζε πδξφιπζεο θαη ζεξκηθήο νμείδσζεο ππφ πίεζε, Σερληθή εβίιιεο (απνξξχπαλζε κέζσ θπζηθνρεκηθψλ θαη βηνινγηθψλ κεζφδσλ), Μέζνδνο Sediflot Agrek κε ρξήζε ήπησλ δηεξγαζηψλ δηαρείξηζεο, Μέζνδνο Saem (απνξξχπαλζε κέζσ θπζηθνρεκηθψλ δηεξγαζηψλ), Mέζνδνο Soller Majorka (απνξξχπαλζε κέζσ θπζηθνρεκηθψλ θαη βηνινγηθψλ κεζφδσλ) (αξεγηαλλίδεο θαη ζπλ., 2007) Οινθιεξσκέλεο κέζνδνη επεμεξγαζίαο ηηο νινθιεξσκέλεο ηερληθέο ιχζεηο εληάζζνληαη ζπλδπαζκνί ησλ πξνεγνχκελσλ κεζφδσλ επεμεξγαζίαο πγξψλ απνβιήησλ, νη νπνίνη απνβιέπνπλ ζηελ φζν ην δπλαηφ πην νινθιεξσκέλε δηαρείξηζε ησλ απνβιήησλ (επεμεξγαζία θαη δηάζεζε ή αμηνπνίεζε). Δίλαη ζπζηήκαηα πην απνηειεζκαηηθά, φζνλ αθνξά ζηελ πξνζηαζία ηνπ πεξηβάιινληνο, αιιά απαηηνχλ απμεκέλε ηερλνγλσζία θαη ηερληθή ππνζηήξημε θαη πινπνηνχληαη ζηελ πξάμε κε ηε ζπλδξνκή ζπλήζσο ηδησηηθψλ ηερληθψλ εηαηξηψλ. Ζ εθαξκνγή νινθιεξσκέλσλ κεζφδσλ επεμεξγαζίαο κεηψλεη γεληθά ην θνξηίν COD θαηά 80-99% (Paraskeva et al., 2006). Σα νινθιεξσκέλα ζπζηήκαηα επεμεξγαζίαο ζα πξέπεη λα είλαη επνκέλσο ηερληθά εθηθηά θαη νηθνλνκηθά βηψζηκα, ελψ ηα πξντφληα πνπ πξνθχπηνπλ απφ ηελ εθαξκνγή ηνπο ζα πξέπεη λα είλαη πςειήο πξνζηηζέκελεο αμίαο. Ζ δηαθνξά ηνπο απφ ηηο κηθηέο κεζφδνπο επεμεξγαζίαο είλαη φηη δελ ζηνρεχνπλ κφλν ζηελ απνξξχπαλζε αιιά θαη ζηελ παξαγσγή πξντφλησλ πςειήο πξνζηηζέκελεο αμίαο ελψ 38

57 θαλέλα παξαπξντφλ θαηά ηε δηάξθεηα ηεο επεμεξγαζίαο δελ απνξξίπηεηαη θαη φια επαλαρξεζηκνπνηνχληαη. Σέηνηεο κέζνδνη ζεσξνχληαη νη παξαθάησ: Οινθιεξσκέλε κέζνδνο κε αλάθηεζε θπζηθψλ αληηνμεηδσηηθψλ θαη παξαγσγή θνκπφζηαο εδαθνβειηησηηθνχ (Πξφγξακκα MINOS), νινθιεξσκέλε κέζνδνο αμηνπνίεζεο πγξψλ απνβιήησλ ειαηνπξγείσλ κε ζπκπαξαγσγή πνιπθαηλνιψλ κε ιπνθηιίσζε θαη ιηπάζκαηνο (Mέζνδνο Πεηξσηνχ), θαζψο θαη έλα λέν ππφ κειέηε νινθιεξσκέλν ζχζηεκα δηαρείξηζεο πγξψλ απνβιήησλ ειαηνπξγείνπ απφ ην Δξγαζηήξην Μεραληθήο ηνπ Σνκέα Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ., ην νπνίν πεξηιακβάλεη ζπκπαξαγσγή ζθφλεο ειηάο, πξντφληνο ηχπνπ πάζηαο ειηάο θαη ελζπιαθσκέλσλ πνιπθαηλνιψλ Γηαρείξηζε ΟOΜW κε ζπκπαξαγσγή ζθόλεο ειηάο, πξντόληνο ηύπνπ πάζηαο ειηάο θαη ελζπιαθσκέλσλ πνιπθαηλνιώλ. Σν κπήθε ζε πεηξακαηηθή εθαξκνγή ζην ειαηνπξγείν ησλ αδεξθψλ Αβέξε ζηε Γαιάηηζηα Υαιθηδηθήο ε κέζνδνο κε ηελ επσλπκία Eco Olive Cleaner κε ηελ νπνία κεηά απφ πνιιέο ηξνπνπνηήζεηο έγηλε δπλαηή ε απνκάθξπλζε ησλ ζηεξεψλ ππνιεηκκάησλ (πνιηφο ειηάο) πνπ παξαζχξνληαη ζηα λεξά ηνπ ληεθάληεξ (www.ecoolivecleaner.gr & ). Με ηε ρξήζε δειαδή ελφο θπθιηθνχ θνζθίλνπ, ην νπνίν δνλείηαη ζπλερψο, δηαρσξίδεηαη ην ζηεξεφ απφ ην πγξφ θιάζκα ησλ OOMW. Δηθόλα 2.6. Μέζνδνο δνλνχκελνπ θπθιηθνχ θνζθίλνπ (α) θαη ε αξρή ιεηηνπξγίαο ηεο (β) (www.ecoolivecleaner.gr & ). 39

58 Ζ ρξήζε ηνπ δνλνχκελνπ θπθιηθνχ θφζθηλνπ έρεη πνιιά θαη ζεκαληηθά νθέιε: Υακειφ Κφζηνο αγνξάο θαη εχθνιε ηνπνζέηεζε, εληφο ηνπ ειαηνηξηβείνπ (10 η.κ.). Αθαίξεζε θαηά 99% ησλ ζηεξεψλ (πνιηφο ειηάο) ηαπηφρξνλα κε ηελ ειαηνπνίεζε. Σα ζηεξεά ζπζηαηηθά απνηεινχλ ην βαζηθφηεξν κνιπληή ησλ πγξψλ απνβιήησλ (ΟΟΜW) σο πξνο ην πεξηβάιινλ (πςειφ νξγαληθφ θνξηίν, κεγάιν πνζνζηφ ιαδηνχ -10%-) θαζψο θξάδνπλ ηνπο πφξνπο ηνπ εδάθνπο, πξνθαινχλ δπζνζκία θ.α. Παξαγσγή 50 έσο 140 θηιά πνιηνχ ειηάο OMWs αλά ηφλν OMW, κε πεξηεθηηθφηεηα ζε ιάδη 8-10% (απνδεθηφο γηα επεμεξγαζία ζε ππξελεινπξγείν). Αχμεζε ηνπ παξαγφκελνπ ειαηνππξήλα ηνπ ειαηνηξηβείνπ, θαηά 20 έσο 35%. ηηο δεμακελέο επίπιεπζεο παγηδεχεηαη ειάρηζηε πνζφηεηα ιαδηνχ. Καηά ηελ παξακνλή ησλ πγξψλ απνβιήησλ ζηηο δεμακελέο θαζίδεζεο δε ζρεκαηίδεηαη ίδεκα θαη ζπλεπψο κεηψλεηαη ε δπζνζκία θαη γίλεηαη επθνιφηεξε ε εμάηκηζε. Σν λεξφ κε ειάρηζηα πιένλ αησξνχκελα ζηεξεά θαη απαιιαγκέλν απφ ιάδη, γίλεηαη θαηάιιειν, ππφ πξνυπνζέζεηο, γηα πφηηζκα άκεζα ζε αγξνχο, ειαηψλεο, δελδξνθαιιηέξγεηεο (ιεχθεο) θ.α. Σα επεμεξγαζκέλα πγξά απφβιεηα είλαη έλα θπηηθφ ιίπαζκα, κε κνλαδηθφ θπηνηνμηθφ παξάγνληα ηηο πνιπθαηλφιεο. Σν λεξφ κπνξεί λα μαλαρξεζηκνπνηεζεί γηα ηελ ηξνθνδφηεζε ηνπ ληεθάληεξ θαη επηηπγράλεηαη κείσζε ηνπ απαηηνχκελνπ λεξνχ ζηελ δηαδηθαζία ειαηνπνίεζεο θαηά 50% ηνπιάρηζηνλ. Με ηελ θαηάιιειε δειαδή πξνζαξκνγή ελφο δνλνχκελνπ θφζθηλνπ, γίλεηαη κεραληθφο δηαρσξηζκφο, ρσξίο ρξήζε ρεκηθψλ νπζηψλ, ησλ ζηεξεψλ ππνιεηκκάησλ (πνιηφο ειηάο) απφ ηα πγξά («δνπκί» ή «ρπκφο» ειηάο θαη λεξά). Σν ζχζηεκα εθαξκφδεηαη εληφο ηνπ ρψξνπ ηνπ ειαηνηξηβείνπ, ηαπηφρξνλα κε ηε δηαδηθαζία ειαηνπνίεζεο ηεο ειηάο, δίρσο θφζηνο κεηαθνξάο ησλ απνβιήησλ. Ζ εθαξκνγή ηνπ ζπζηήκαηνο επηηπγράλεη ηνλ άκεζν δηαρσξηζκφ ησλ ζηεξεψλ ππνιεηκκάησλ (πνιηφο ειηάο) απφ ηα πγξά απφβιεηα, απνδίδνληαο εκπνξηθά 40

59 αμηνπνηήζηκα ππνπξντφληα. Σα θαζαξηζκέλα πγξά απφβιεηα απνθηνχλ λέεο δπλαηφηεηεο ρξήζεο θαη γίλεηαη πνιχ επθνιφηεξε ε δηάζεζή ηνπο (www.ecoolivecleaner.gr & ). πλνςίδνληαο ηα απνηειέζκαηα ησλ πεηξακάησλ πνπ έιαβαλ ρψξα ζην Δξγαζηήξην Μεραληθήο ηεο Καηεχζπλζεο Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ. γηα ην ζηεξεφ ππφιεηκκα θνζθίληζεο πγξψλ απνβιήησλ ειαηνπξγείνπ (OMWS) θαη δεδνκέλνπ φηη δελ ππάξρνπλ δεκνζηεπκέλεο βηβιηνγξαθηθέο αλαθνξέο πνπ λα ραξαθηεξίδνπλ θπζηθνρεκηθά θαη κηθξνβηνινγηθά απηφ ην πιηθφ, κπνξεί λα αλαθεξζεί φηη: Σν ζηεξεφ ππφιεηκκα ζεσξείηαη θαη απηφ, φπσο θαη ηα πγξά απφβιεηα απφ ηα νπνία πξνέθπςε, έλα πδαξέο ζηεξεφ. Ζ πγξαζία ηνπ βξέζεθε φηη είλαη πεξίπνπ 75%, ελψ ζε άιιεο έξεπλεο έρνπλ αλαθεξζεί θαη πςειφηεξεο ηηκέο (85%). Πξφθεηηαη γηα έλα πιηθφ κε αξθεηά πςειή πεξηεθηηθφηεηα ζε ιίπνο (πεξίπνπ 22%). Ζ πεξηεθηηθφηεηά ηνπ ζε πξσηεΐλεο είλαη αξθεηά ρακειή αιιά ζηαζεξή (1,3-1,4%). Ζ νμχηεηα, εθθξαζκέλε ζε ειατθφ νμχ, θπκαίλεηαη απφ 1,19 έσο 1,36% θαη ζρεηίδεηαη κε ηελ ηνμηθή επίδξαζε ηνπ πιηθνχ ζην πεξηβάιινλ. Ζ πεξηεθηηθφηεηά ηνπ ζε θαηλνιηθέο ελψζεηο κπνξεί λα δηαθέξεη αθνχ εμαξηάηαη θπξίσο απφ ηελ πεξηεθηηθφηεηα ηνπ ειαηνθάξπνπ ζε απηέο. Απνηειείηαη απφ δχν θχξηα ζπζηαηηθά: ζσκαηίδηα πνιηνχ, κε κέζε δηάκεηξν 0,9 mm, θαη ιεπηά ζσκαηίδηα, κε κέζε δηάκεηξν 0,5 mm. H γεσκεηξηθή κέζε δηάκεηξνο ησλ ζσκαηηδίσλ ηνπ είλαη 0,8 mm. Παξνπζηάδεη κε-λεπηψλεηα ζπκπεξηθνξά, ε νπνία νθείιεηαη ζηελ παξνπζία ζπζηαηηθψλ πςεινχ κνξηαθνχ βάξνο. Ζ ηηκή ηνπ θαηλνκεληθνχ ημψδνπο ηνπ κεηψλεηαη κε ηελ αχμεζε ηνπ ξπζκνχ παξακφξθσζεο θαη κε ηελ αχμεζε ηεο ζεξκνθξαζίαο. Ζ πεξηεθηηθφηεηά ηνπ ζε πγξαζία κεηαβάιιεηαη κε αιιαγή ηεο ζεξκνθξαζίαο θαη επεξεάδεηαη απφ ηελ ελεξγφηεηα λεξνχ. Σν καζεκαηηθά κνληέια πνπ εξκελεχνπλ θαιχηεξα ηα πεηξακαηηθά δεδνκέλα ησλ ηζφζεξκσλ θακππιψλ είλαη ηα κνληέια Halsey, Peleg θαη Smith. 41

60 Ο πνιηφο ειηάο πνπ ζπγθεληξψλεηαη θαηά ηνλ δηαρσξηζκφ, κπνξεί λα αμηνπνηεζεί κε ηξεηο (3) ηξφπνπο: Να ζπιιερηεί θαη λα επαλεπεμεξγαζηεί εληφο 6-8 σξψλ, απνδίδνληαο θαλνληθφ ειαηφιαδν πεξί ηα 5 θηιά αλά ηφλν ειηάο. Να νδεγεζεί καδί κε ηνλ ειαηνππξήλα γηα εμαγσγή ππξελέιαηνπ, πεξί ηα 10 θηιά αλά ηφλν ειηάο. Παλειιαδηθή εθαξκνγή ηνπ ζπζηήκαηνο, ζα ζήκαηλε επηπιένλ παξαγσγή ηφλσλ ππξελειαίνπ πνπ ζήκεξα ράλνληαη θαη ξππαίλνπλ ην πεξηβάιινλ. Μπνξεί λα ζπιιερηεί θαηφπηλ δηαινγήο θαη κε πξνζζήθε άιαηνο λα κεηαηξαπεί ζε "πάζηα" ειηάο πςειήο πνηφηεηαο. Μπνξεί λα νδεγήζεη δειαδή ζε κηα λέα πεγή ηξνθίκνπ πςειήο δηαηξνθηθήο αμίαο (πινχζηα ζε πνιπθαηλφιεο θαη ρακειά ιηπαξά, ππφδεηγκα κεζνγεηαθήο δηαηξνθήο) θαη ρακεινχ θφζηνπο. Ζ παλειιαδηθή εθαξκνγή ηνπ ζπζηήκαηνο ζα κπνξνχζε λα απνθέξεη ρηιηάδεο ηφλνπο ελφο εθιεθηνχ ηξνθίκνπ πςειήο πνηφηεηαο, θαζηζηψληαο άκεζα δηαζέζηκν ζε θάζε έιιελα έλα πξντφλ πνπ ζήκεξα πσιείηαη σο «ληειηθαηέζελ». Όζνλ αθνξά ηελ αμηνπνίεζε ησλ πγξψλ απνβιήησλ, ζε πξψην ζηάδην, κπνξεί λα ηξνθνδνηεζεί ην ληεθάληεξ κε θαζαξηζκέλα πγξά απφβιεηα («δνπκί» ειηάο) αληί λεξνχ. Με ηνλ ηξφπν απηφ επηηπγράλεηαη κεγάιε νηθνλνκία ζε λεξφ θαη ζέξκαλζε θαη κεηψλεηαη δξαζηηθά ην θφζηνο ιεηηνπξγίαο ηνπ ειαηνηξηβείνπ. Δπηπιένλ επηηπγράλεηαη κείσζε ηνπ ηειηθνχ φγθνπ απνβιήησλ θαηά ~40%. Με ηε ρξήζε ησλ θαζαξηζκέλσλ πγξψλ απνβιήησλ («δνπκί» ειηάο) ζην ληεθάληεξ κπνξεί λα αθνινπζήζεη αλάκημε ηνπ πεξηζζεχκαηνο κε ηνλ ειαηνππξήλα, επηηπγράλνληαο απνηέιεζκα ιεηηνπξγίαο φκνην κε ηα δηθαζηθά ληεθάληεξ. Μεηαηξέπεηαη δειαδή ε ιεηηνπξγία ηνπ ηξηθαζηθνχ ληεθάληεξ ζε δηθαζηθφ, ρσξίο ην γλσζηφ πςειφ θφζηνο αληηθαηάζηαζεο, απαγνξεπηηθφ γηα ηελ πιεηνςεθία ησλ ειαηνηξηβείσλ (θέξδνο πεξίπνπ επξψ). Σα θαζαξηζκέλα πγξά απφβιεηα πνπ πξνθχπηνπλ κε ηε κέζνδν απηή δηεπθνιχλνπλ ηελ εθαξκνγή άιισλ κεζφδσλ γηα ηελ πεξαηηέξσ αμηνπνίεζε ή επεμεξγαζία ηνπο φπσο: 42

61 Γέζκεπζε πνιπθαηλνιψλ Ναvνδηήζεζε Avηίζηξoθε φζκσζε Δμάηκηζε θιπ Μηαο θαη ηα θαζαξηζκέλα πγξά απφβιεηα δελ πεξηέρνπλ πνιηφ ειηάο θαη θαηά ζπλέπεηα ιάδη, κπνξεί λα ζπγθεληξσζνχλ ζηηο γλσζηέο εμαηκηζνδεμακελέο κε πνιχ κηθξφηεξα πξνβιήκαηα δπζνζκίαο. Έηζη, επηηπγράλεηαη ηαρχηεξε εμάηκηζε θαη απνθεχγεηαη ην θφζηνο γηα ηελ απνκάθξπλζε ηεο ζηεγλήο ιάζπεο θάζε ρξφλν απφ ηηο δεμακελέο (www.ecoolivecleaner.gr & ). Έξεπλεο θαη κειέηεο αξθεηψλ ρξφλσλ απφ παλεπηζηεκηαθνχο θαζεγεηέο θαη δηεπζπληέο Ηλζηηηνχησλ ειηάο πνπ αζρνινχληαη κε ηε δηάζεζε ησλ πγξψλ απνβιήησλ (θ. Kαιoγεξάθnο, θ. Νηθνιαΐδεο, θ. Υαξηδνπιάθεο θ.α.) ζπκθσλνχλ ζηελ άπνςε πσο ν νηθνλνκηθφηεξνο θαη επθνιφηεξνο ηξφπνο δηάζεζήο ηνπο, είλαη ν επηθαλεηαθφο δηαζθνξπηζκφο αλάκεζα ζηα ειαηφδεληξα, πάληα κε ηελ ηήξεζε θάπνησλ δνζνινγηψλ, φπσο γίλεηαη θαη ζηα ιηπάζκαηα. Μεηά ηνλ θαζαξηζκφ ηνπο, ηα πγξά απφβιεηα απνθηνχλ ρεκηθή ζχζηαζε πγξνχ ιηπάζκαηνο θαη κπνξνχλ λα θαιχςνπλ ηηο αλάγθεο ιίπαλζεο ησλ ειαηφδεληξσλ θαη φρη κφλν. Σν έδαθνο ιεηηνπξγεί ζαλ βηνδηαζπάζηεο θαη εμνπδεηεξψλεη ηα ηνμηθά ζηνηρεία (πνιπθαηλφιεο) εληφο 30 εκεξψλ, ζην κέξνο εθείλν ηεο επηθάλεηαο πνπ αεξίδεηαη, δειαδή έσο 20εθ. βάζνο. Έηζη, ε εθαξκνγή ηνπ ζπζηήκαηνο ζε ζπλδπαζκφ κε ηνλ επηθαλεηαθφ δηαζθνξπηζκφ ησλ θαζαξηζκέλσλ πγξψλ απνβιήησλ, δίλεη επηπιένλ νθέιε ζηνλ ειαηνηξηβέα θαη είλαη πιήξσο ελαξκνληζκέλε κε ην πλεχκα ηεο πξάζηλεο αεηθφξνπ αλάπηπμεο (www.ecoolivecleaner.gr & ). Με βάζε ιεηηνπξγίαο ην δνλνχκελν θπθιηθφ θφζθηλν (ζχζηεκα Δco Olive Cleaner), ην νπνίν φπσο πξναλαθέξζεθε ρξεζηκνπνηείηαη πηινηηθά απφ ην ειαηνπξγείν ησλ αδεξθψλ Αβέξε ζηε Γαιάηηζηα Υαιθηδηθήο, κειεηάηαη απφ ην Δξγαζηήξην Μεραληθήο ηνπ Σνκέα Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ. ε δπλαηφηεηα εθαξκνγήο ελφο νινθιεξσκέλνπ ζπζηήκαηνο δηαρείξηζεο απνβιήησλ ειαηνπξγείνπ, ζχκθσλα κε ην νπνίν παξάγνληαη πξντφληα πςειήο πξνζηηζέκελεο αμίαο θαη ηδηαίηεξε ζεκαζίαο είλαη ην γεγνλφο φηη φια ηα παξαπξντφληα επεμεξγαζίαο 43

62 ζπκπεξηιακβαλνκέλνπ θαη ηνπ λεξνχ ζα είλαη 100% αλαθπθιψζηκα. Πην ζπγθεθξηκέλα, ε θνζθίληζε ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ (OMW) κέζσ ηνπ δνλνχκελνπ θπθιηθνχ θνζθίλνπ, ζα δίλεη αξρηθά έλα ζηεξεφ (OMW-S) θαη έλα πγξφ θιάζκα (OMW- L). Σν ηειεπηαίν ζα κπνξεί ζηε ζπλέρεηα λα ζπκππθλσζεί θαη κέζσ μήξαλζεο ςεθαζκνχ θαη ελζπιάθσζεο πνιπθαηλνιψλ λα παξαιεθζνχλ ελζπιαθσκέλεο πνιπθαηλφιεο. Σν ζηεξεφ θιάζκα κπνξεί είηε λα ππνζηεί δχκσζε κε ελζσκάησζε NaCl γηα παξαζθεπή πξντφληνο ηχπνπ πάζηαο ειηάο, είηε κέζσ μήξαλζεο κε ςεθαζκφ λα παξαιεθζεί ζθφλε ειηάο, ε νπνία ζα κπνξεί λα ελζσκαησζεί ζε ηξφθηκα. Σα πξντφληα απηά ζα κπνξνχζαλ λα πξνζηεζνχλ ζηα ήδε ππάξρνληα, ηα νπνία παξνπζηάδνληαη ζηνλ Πίλαθα Πίλαθαο Xξήζεηο ησλ ππνπξντφλησλ ησλ ειαηνπξγείσλ (Μπιίθα, 2009). Φξήζε Πιενλεθηήκαηα Μεηνλεθηήκαηα Πεγή Δχθνιε θαη άκεζε Γπζνζκία Ramos et al. (1995) εθαξκνγή ζην έδαθνο Λίπαζκα (γηα ηνπο ειαηψλεο) Γεκηνπξγία θνκπφζη θαη βηναπνθαηάζηαζε Τςειήο πνηφηεηαο πξντφλ, πινχζην ζε άδσην Ρχπαλζε ππφγεηνπ πδξνθφξνπ νξίδνληα Εεκηέο ζηα ειαηφδεληξα Μεγάιε πεξίνδν σξίκαλζεο Μέηξα γηα λα απνηξαπεί ε δπζνζκία Παξαγσγή βηναεξίνπ Απνδνηηθή κέζνδνο Απαηηείηαη εμεηδηθεπκέλνο εμνπιηζκφο Τςειφ θφζηνο Εσνηξνθή Υακειφ θφζηνο Υακειή πεξηεθηηθφηεηα ζε πξσηετλε Kαχζηκα, εκπνξηθφο μπιάλζξαθαο Αλάθηεζε ελέξγεηαο Δλεξγφο άλζξαθαο Φηιηθφο πξνο ην πεξηβάιινλ θαη βηνδηαζπψκελνο Τςειή απνδνηηθφηεηα Τςειή ηθαλφηεηα πξνζξφθεζεο Έιιεηςε ιπζίλεο Τςειή πεξηεθηηθφηεηα ζε θπηηαξίλε Πηθξή γεχζε Υακειή ζεξκαληηθή αμία Αηκνζθαηξηθή ξχπαλζε Τςειή ζρέζε θφζηνπο/αμίαο The Olive Oil Sources (2001) Improlive, UCM (2000) Carter, (2001) Tekin et al., (2000) Clemente et al., (1997) Haddadin et al., (1999) Alexander (2001) Torre et al., (1995) Bacaoui et al., (1998) 44

63 2.3. Δπαλαρξεζηκνπνίεζε θαη εθαξκνγή ππνπξντόλησλ Σα ηειεπηαία ρξφληα, ην ελδηαθέξνλ ηεο επηζηεκνληθήο θνηλφηεηαο έρεη επηθεληξσζεί ζηε επαλαρξεζηκνπνίεζε ζπζηαηηθψλ αγξνηνβηνκεραληθψλ απνβιήησλ ή θαη ηελ εμαγσγή απφ απηά πνιχηηκσλ ζπζηαηηθψλ, ηα νπνία έρνπλ ζεκαληηθέο εθαξκνγέο ζε πνιιέο αλζξσπνγελείο δξαζηεξηφηεηεο. Οη εγθαηαζηάζεηο πνπ ρξεζηκνπνηνχληαη γηα ηελ εμαγσγή ηνπ ειαηφιαδνπ, φπσο πξναλαθέξζεθε, παξάγνπλ κεγάιεο πνζφηεηεο πγξψλ θαη ζηεξεψλ απνβιήησλ νη νπνίεο πξνθαινχλ πνιχ κεγάια πξνβιήκαηα ζε πεξηβαιινληηθφ επίπεδν. Με ηελ εμέιημε ηεο ηερλνινγίαο, ππάξρνπλ πιένλ πνιιέο εθαξκνγέο γηα επαλαρξεζηκνπνίεζε ησλ πγξψλ θαη ζηεξεψλ απνβιήησλ (Δηθφλα 2.7., Πίλαθαο 2.11.), θάπνηεο απφ ηηο νπνίεο ήδε εθαξκφδνληαη θαη θάπνηεο είλαη αθφκε ζε πηινηηθφ ε εξγαζηεξηαθφ επίπεδν, νη νπνίεο φκσο δελ παχνπλ λα είλαη πνιιά ππνζρφκελεο, πξνθαιψληαο ελδηαθέξνλ γηα ηελ θαηλνηνκία ηνπο (Morillo et al., 2009). Δηθόλα 2.7. Γπλαηέο ρξήζεηο θαη κηθξνβηαθή αμηνπνίεζε ησλ απνβιήησλ ειαηνπξγείνπ (Morillo et al., 2009). 45

64 Βηνκεηαηξνπή ζε ρξήζηκα πξντόληα Πνιιέο εθαξκνγέο έρνπλ απνδνζεί επνκέλσο ζηα OΟMW, κε ή ρσξίο επηπιένλ κεηαρείξηζε, γηα ηελ απφθηεζε πξντφλησλ πξνζηηζέκελεο αμίαο (Πίλαθαο 2.11). Σα OOMW έρνπλ δνθηκαζηεί σο κέζν αλάπηπμεο γηα ηελ παξαγσγή δηαθνξεηηθψλ νξγαληθψλ πξντφλησλ απφ κχθεηεο, δχκεο ή βαθηήξηα, ηελ ίδηα ζηηγκή πνπ θάπνηεο απφ απηέο ηηο κπθεηνινγηθέο θαη κηθξνβηαθέο βηνκάδεο κεηαβνιίδνπλ θπηνηνμηθέο νπζίεο. Ο ειαηνππξήλαο (OOC), ιφγσ ηεο πεξηεθηηθφηεηάο ηνπ ζε ζξεπηηθά ζπζηαηηθά (πδαηάλζξαθεο θαη πξσηεΐλεο), ηεο θαιήο ηθαλφηεηαο δηαηήξεζεο θαη ηεο ηθαλφηεηαο θνπζθψκαηνο, κπνξεί λα γίλεη έλα εμαηξεηηθφ ππφζηξσκα γηα δχκσζε ζηεξεάο θαηάζηαζεο κε λεκαηψδεηο κχθεηεο θαη δχκεο (Laufenberg et al., 2004). Σν Alperujo (πγξφο ειαηνππξήλαο δηθαζηθψλ ειαηνπξγείσλ) θαίλεηαη λα είλαη έλα ππνζρφκελν ππφζηξσκα γηα αλάπηπμε δπκψλ. Παξφια απηά ην πνιπθαηλνιηθφ θιάζκα ζε φια απηά ηα πγξά απφβιεηα είλαη επηβιαβέο γηα ηε κηθξνβηαθή αλάπηπμε. ε κεξηθέο πεξηπηψζεηο, εληαηηθέο πξν-κεηαρεηξίζεηο (ρεκηθέο, θπζηθέο ή βηνινγηθέο) απαηηνχληαη θαη κεξηθέο θνξέο, απαηηείηαη κηα δχκσζε κε επηιεγκέλνπο κηθξννξγαληζκνχο, κφλνπο ή ζε κηθηή θαιιηέξγεηα, θαζψο θαη κηα δηαδηθαζία πξνζαξκνγήο. Ζ απνκφλσζε, νη θαζαξηζκνί ή ε αλάθηεζε ησλ πξντφλησλ είλαη επίζεο πςεινχ θφζηνπο. Δπνκέλσο, ε βηνκεηαηξνπή είλαη νηθνλνκηθά ειθπζηηθή κφλν αλ πςειήο αμίαο πξντφληα παξάγνληαη. Ζ βηνηερλνινγηθή παξαγσγή θπζηθνχ αξψκαηνο, φπσο νη ιαθηφλεο απφ ιηπαξά νμέα, ρξήδνπλ ηδηαίηεξεο πξνζνρήο ιφγσ ηεο απμαλφκελνπ νηθνλνκηθνχ ελδηαθέξνληνο γηα θπζηθά αξψκαηα (Laufenberg et al., 2004). Δμσπνιπζαθραξίηεο (Ruiz-Bravo et al., 2001) θαη β-γιπθάλεο (Tomati et al., 2004) έρνπλ βξεζεί πξφζθαηα λα έρνπλ ζεκαληηθέο θαξκαθνινγηθέο ηδηφηεηεο. Σα ΟΟMW έρνπλ ρξεζηκνπνηεζεί σο ππφζηξσκα γηα ηελ θαιιηέξγεηα ζπγθεθξηκέλσλ κηθξννξγαληζκψλ πξνθεηκέλνπ λα απνθηεζεί κηα ρξήζηκε κηθξνβηαθή βηνκάδα ή γηα ηε κεξηθή βηναπνηθνδφκεζε ησλ ππνιεηκκάησλ. Σέηνηεο εθαξκνγέο έρνπλ κηα καθξηά ηζηνξία, θαη ήδε 50 ρξφληα πξηλ ν Fiestas Ros de Ursinos (1961) αλέθεξε ηελ παξαγσγή βηνκάδαο δπκψλ κε ππφζηξσκα OΟMW γηα ρξήζε ζε βηνκεραληθέο εθαξκνγέο. Μεξηθνί εδψδηκνη κχθεηεο (καληηάξηα), εηδηθά είδε Pleurotus, κπνξνχλ επίζεο λα αλαπηπρζνχλ ρξεζηκνπνηψληαο OΟMW σο ηελ πεγή ησλ ζξεπηηθψλ ζπζηαηηθψλ κέζσ ηεο εθαξκνγήο δηαθνξεηηθψλ ζηξαηεγηθψλ (Kalmis et al., 2008, 46

65 Sanjust et al., 1991, Zervakis et al., 1996). Απηνί νη εξεπλεηέο αλέθεξαλ επίζεο βηνρεκηθέο αιιαγέο θαη απνηνμίλσζε ησλ ππνζηξσκάησλ ιφγσ ηεο ελεξγνχο έθθξηζεο ιηγληλνιπηηθψλ ελδχκσλ θαη ηεο κεξηθή απνηθνδφκεζεο ηνπ νξγαληθνχ θιάζκαηνο απφ κχθεηεο. Οη Kalmis θαη ζπλ. (2008) πξφζθαηα αλέθεξαλ ηελ θαιιηέξγεηα ηνπ κχθεηα Pleurotus ostreatus ζε ππφζηξσκα πνπ πεξηέρεη άρπξν ζηηαξηνχ θαη έλα κίγκα απεζηαγκέλνπ λεξνχ θαη OΟMW (25% OΟMW, v/v), σο κηα πεξηβαιινληηθά θηιηθή ιχζε γηα ην ζθνπφ ηεο εκπνξηθήο παξαγσγήο καληηαξηψλ. Παξφκνηεο πξνζεγγίζεηο έρνπλ αμηνπνηεζεί απφ κεξηθέο κηθξέο εηαηξείεο γηα πεξηζζφηεξν απφ κηα δεθαεηία (Ramos- Cormenzana et al., 1995). Aλαθνξά επίζεο ζα πξέπεη λα γίλεη γηα ηελ πηζαλφηεηα ρξήζεο ηεο κηθξνβηαθήο βηνκάδαο πνπ παξάγεηαη απφ ηηο δπκψζεηο ησλ ΟΟMW είηε σο έλα πξφζζεην δσνηξνθψλ ή γηα βειηίσζε ηεο αγξνλνκηθήο ηνπο ρξήζεο. Γηα παξάδεηγκα, νη Laconi θαη ζπλ. (2007) πέηπραλ κηα έληνλε απνηθνδφκεζε ησλ πεξηζζφηεξσλ κνιπζκαηηθψλ νπζηψλ ησλ OOMW θαη ηελ παξαγσγή βηνκάδαο, ε νπνία ζα κπνξνχζε λα ρξεζηκνπνηεζεί σο ζπζηαηηθφ δσνηξνθήο κε ηε ρξήζε κηαο ρεκηθήο βηνινγηθήο κεζφδνπ (αιθαιηθή - νμεηδσηηθή κεηαρείξηζε γηα κείσζε ηνπ πεξηερνκέλνπ ζε πνιπθαηλφιεο, αθνινπζνχκελεο απφ δχκσζε κε έλα κίγκα κπθήησλ). Όζνλ αθνξά ηελ αγξνλνκηθή ρξήζε ησλ απνβιήησλ, ε ηδέα ηεο επαλαρξεζηκνπνίεζεο κηθξνβηαθά κεηαρεηξηζκέλνπ OΟMW σο ιίπαζκα έρεη επίζεο πξνηαζεί (Vassiliev et al., 1997). Γηα ην ζθνπφ απηφ, έλα ζηέιερνο ηνπ νμενγεληθνχ κχθεηα Aspergillus niger αλαπηχρζεθε είηε ζε ειεχζεξε είηε ζε αθηλεηνπνηεκέλε κνξθή ησλ OOMW κε πξνζζήθε θσζθνξηθψλ γηα ηε δηαιπηνπνίεζή ηνπο. Μεηά ηε δχκσζε, ηα πινχζηα ζε θψζθνξν OOMW δνθηκάζηεθαλ σο ιίπαζκα πάλσ ζε Trifolium repens L. θαη Triticum durum ζπζηήκαηα, νδεγψληαο ζηελ ελίζρπζε ηεο αλάπηπμεο ησλ θπηψλ (Cereti et al., 2004). Δπηπιένλ, ηα αλζεθηηθά ζηηο θαηλφιεο ζηειέρε Enterobacteriaceae απνκνλσκέλα απφ OOMW έρνπλ ηελ ηθαλφηεηα λα βηνκεηαηξέπνπλ ηε μπιφδε ζε αηζαλφιε (Asli et al., 2002). Eπηπξφζζεηα, ην Clostridium bifermentans TYR6 είλαη έλα αλαεξφβην βαθηήξην, ην νπνίν απνκνλψζεθε απφ ηα OOMW θαη κπνξεί λα κεηαηξέςεη ην θηλλακηθφ νμχ ζε 3- θαηλπινπξνπηνληθφ νμχ (Chamkha et al., 2001). Aπμεκέλεο δξαζηεξηφηεηεο ζχλζεζεο β- γιπθάλεο έρνπλ εθθξαζηεί επίζεο απφ είδε κπθήησλ πνπ αλαπηχζζνληαη ζε OOMW. Δπηπιένλ, ηα ζηειέρε Paracoccus thiocyanatus θαη Halothiobacillus neapolitanus είλαη ζεην-νμεηδσηηθά βαθηήξηα, ηα νπνία έρνπλ απνκνλσζεί απφ αιθαιηθφ θφκπνζη απφ πγξά 47

66 απφβιεηα δηθαζηθψλ ειαηνπξγείσλ (TPOMW) θαη κπνξνχλ λα ρξεζηκνπνηεζνχλ ζηελ νμίληζε ηνπ θφκπνζη (Garcia et al., 2011). ηα πξφζθαηα ρξφληα ζεκαληηθή πξνζνρή δφζεθε πξνο ηελ θαηεχζπλζε παξαγσγήο ελέξγεηαο απφ ιηγλνθπηηαξηλνχρα απφβιεηα. Όπσο αλαθέξζεθε παξαπάλσ, ε αλαεξφβηα πέςε είλαη κηα ελαιιαθηηθή πξαθηηθή γηα ηε κεηαρείξηζε ησλ πγξψλ απνβιήησλ δηθαζηθψλ ειαηνπξγείσλ (TPOMW), ε νπνία παξάγεη βηναέξην (Borja et al., 2006, Antizar-Ladislao and Turrion-Gomez, 2008). Όπσο έρεη αλαθεξζεί θαη ζε άιια αγξνβηνκεραληθά απφβιεηα, φπσο πνχιπα παηάηαο (Zhu et al., 2008), ή θνπξηά βννεηδψλ (Gungor-Demicri and Demirer, 2004), νη αλαεξφβηεο δηεξγαζίεο πνπ εθαξκφδνληαη ζηα ΟOΜW, είηε ζε έλα είηε ζε δχν ζηάδηα, πξέπεη λα επηιεγνχλ ζχκθσλα κε ηελ C/N αλαινγία ησλ ππνιεηκκάησλ πξνθεηκέλνπ λα επηηεπρζεί κηα ηθαλνπνηεηηθή αεξφβηα απνηθνδφκεζε. Σα πγξά απφβιεηα ησλ δηθαζηθψλ ειαηνπξγείσλ (TPOMW) είλαη βηναπνηθνδνκήζηκα κέζσ αλαεξφβηαο πέςεο ζε κεζνθηιηθέο ζεξκνθξαζίεο ζε αληηδξαζηήξεο, κε απνηειεζκαηηθφηεηα απνκάθξπλζεο θαηλνιηθψλ ηεο ηάμεο ηνπ 72-89% θαη έλα ζπληειεζηή κέζεο απφδνζεο 0.31 dm 3 CH 4 / g COD πνπ απνκαθξχλεηαη (Borja et al., 2006). Παξφκνηα παξαγσγή πδξνγφλνπ θαη κεζαλίνπ έρεη αλαθεξζεί κε ηε ρξήζε ζεξκνθηιηθψλ αληηδξαζηήξσλ ζηνπο 55 ν C (Gavala et al., 2005) θαη ζε κεζνθηιηθή αλαεξφβηα κεηαρείξηζε ησλ TPOMW ζε ζπλερή πεηξάκαηα, ζηα νπνία πεξίπνπ 0.28 dm 3 CH 4 / g COD απνκαθξχλζεθε, θαη ε παξαγσγή πδξνγφλνπ δηπιαζηάζηεθε κε έλα αθφινπζν ζηάδην γηα παξαγσγή κεζαλίνπ, δίλνληαο ηε δπλαηφηεηα παξαγσγήο 1.6 mmol H 2 / g TPOMW (μεξή νπζία) (Βorja et al., 2006). Eπηπξφζζεηα, ε πςειή πεξηεθηηθφηεηα ζε νξγαληθή νπζία θάλεη ηα OOMW κηα ελδηαθέξνπζα ελαιιαθηηθή πεγή παξαγσγήο αηζαλφιεο, φπσο έλα βηνθαχζηκν (Li et al., 2007). Aθφκα θαη αλ ε πεξηεθηηθφηεηα ζε αλαγσγηθά ζάθραξα απηψλ ησλ απνβιήησλ είλαη ρακειή, δηαθνξεηηθά είδε πνιπζαθραξηηψλ κπνξνχλ λα κεηαηξαπνχλ ζε αηζαλφιε κέζσ δηαθνξεηηθψλ αληηδξάζεσλ πνπ εκθαλίδνληαη ζε δχν μερσξηζηά ζηάδηα: ην πξψην είλαη κηα ελδπκαηηθή πδξφιπζε κε ρξήζε εκπνξηθψλ ελδχκσλ, ε νπνία αθνινπζείηαη απφ ηε κεηαηξνπή αλαγσγηθψλ ζαθράξσλ ζε αηζαλφιε κέζσ δχκσζεο απφ δχκεο (αιθννιηθή δχκσζε) (Zanichelli et al., 2007). Mεηαμχ ησλ πνιιψλ παξακέηξσλ πνπ κπνξνχλ λα επεξεάζνπλ ηε δηαδηθαζία ηεο αιθννιηθήο δχκσζεο, ε παξνπζία αλαζηαιηηθψλ ελψζεσλ ζηα ΟOΜW είλαη βαζηθή. Οη Bambalov θαη ζπλ. (1989), κε ηε ρξήζε κηαο ζπιινγήο 48

67 κεξηθψλ ζηειερψλ δπκψλ δηαθφξσλ εηδψλ, επηβεβαίσζαλ φηη ην θξέζθν OOMW ήηαλ κε επηζπκεηφ απφ ηηο δχκεο γηα ηελ αλάπηπμή ηνπο θαζψο θαη γηα ηελ παξαγσγή αηζαλφιεο. Ζ απνκάθξπλζε ηνπ θαηλνιηθνχ θιάζκαηνο κε ηε ρξήζε κηαο ηερληθήο πξνζξφθεζεο/εθξφθεζεο θαίλεηαη λα είλαη κηα απαξαίηεηε δηαδηθαζία γηα ηελ παξαγσγή αηζαλφιεο απφ ηα OOMW (Zanichelli et al., 2007). Ζ επηινγή κηθξννξγαληζκψλ ηθαλψλ αλάπηπμεο ζε πγξά απφβιεηα γηα ρξήζε σο ελαιιαθηηθή πεγή θαπζίκσλ είλαη κηα ζπλερηδφκελε πξφθιεζε γηα ηνπο επηζηήκνλεο. ηα ηειεπηαία ρξφληα, ηα κηθξνάιγε θαίλεηαη λα είλαη θαηάιιεια γηα απηφ ην ζθνπφ, ιφγσ ηεο επθνιίαο θαιιηέξγεηάο ηνπο θαη ηεο κεγάιεο πηζαλφηεηαο ρξήζεο ηνπο σο ελαιιαθηηθή βηνκάδα γηα παξαγσγή βηνελέξγεηαο. Φαίλεηαη επνκέλσο φηη νη δηαδηθαζίεο βηνινγηθήο κεηαηξνπήο ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ (Πίλαθαο 2.11.) ζε πνηθίια πξνζηηζέκελεο αμίαο πξντφληα κέζσ πγξήο θαηαβχζηζεο θαη/ή δχκσζε ζηεξεάο θαηάζηαζεο (SSF) έρνπλ απνθηήζεη ηδηαίηεξν ελδηαθέξνλ γηα πνιιά εξγαζηήξηα. Πίλαθαο Μειέηεο βηνκεηαηξνπήο πγξψλ (OOMW) θαη ζηεξεψλ (ειαηνππξήλαο) απνβιήησλ ηξηθαζηθψλ θαη δηαθαζηθψλ ειαηνπξγείσλ ζε ρξήζηκα πξντφληα (Fernandez - Βolanos et al., 2006). Υπνπξνϊόληα Πεξηγξαθή Πξνϊόληα Αλαθνξά δηαδηθαζίαο/βηνθαηαιύηεο OOMW Clostridium spp. (ζξεπηηθφ Βνπηαλφιε (2.8 8 Wahner et al., 1988 κέζν 50% v/v κε OOMW) g/l) OOMW Arthrobacter spp. Iλδνινμηθφ νμχ Σomati et al., 1990 OOMW Pseudomonas aeruginosa (ΟΟΜW σο ε κφλε πεγή Βηνεπηθαλεηνδξαζηηθφ: ξακλνιηπίδην Mercade and Manresa, (1994) άλζξαθα) OOMW Propionibacterium shermanii ζε OOMW πνπ έρεη ππνζηεί δχκσζε κε Bηηακίλε Β 12 Munoz (1998) OOMW Σξηθαζηθή ειαηνππξήλα Σξηθαζηθή ειαηνππξήλα Aspergillus niger Αλαζπλδπαζκέλν ζηέιερνο Escherichia coli P-260, κε έθθξαζε ηνπ ελδχκνπ 4- ΖPA πδξνιάζεο ηνπ Klebsiella pneumoniae SSF: Rhizomucor pusillus, R. rhizopodiformis Aπνιηγληλνπνίεζε (κε 4 κχθεηεο), ζαθραξνπνίεζε χλζεζε ρξσζηηθψλ, αιθαινεηδψλ θαη πνιπκεξψλ, ησλ νπνίσλ ε βάζε δνκήο είλαη κηα θηλφλε Ληπάζε (γηα εθαξκνγή ζηελ αξηνπνηία θαη θαξκαθεπηηθή) Αθαηέξγαζηε πξσηεΐλε εκπινπηηζκέλε απφ 5.9 Martin et al., 1998 Cordova et al., 1998 Haddadin et al.,

68 OOMW OOMW ΟΟΜW OOMW κε Trichoderma spp. θαη ζρεκαηηζκφ βηνκάδαο κε ηα Candida utilis θαη Saccharomyces cerevisiae Funalia trogli ATCC Trametes versicolor ATCC Xanthomonas campestris, ζε έλα κέζν κε OOMW (50-60% v/v) Paenibacillus jamilae CP- 7, ζε αεξφβηεο ζπλζήθεο ζε έλα κέζν κε OOMW (80% v/v) Azotobacter chroococcum (OOMW σο κφλε πεγή άλζξαθα) Αλάπηπμε κπθειίνπ έσο 40.3%. Πεγή δσνηξνθήο Oξκφλεο αλάπηπμεο θπηψλ: γηββεξηιηθφ νμχ, ακπζηζηθφ νμχ θαη ηλδνινμηθφ νμχ θαη θπηνθηλίλε Kφκκη μαλζάλεο γηα ρξήζε ζε ηξφθηκα θαη άιιεο εθαξκνγέο φπσο σο ππθλσηηθφ θαη ημσδνπνηεηήο Eμσπνιπζαθραξίηεο, αληηθαξθηληθνί παξάγνληεο κε αλνζνηξνπνπνηεηηθέο ηδηφηεηεο Βηνπιαζηηθφ (βhydroxybutyrate and β- hydroxyvalerate) β γιπθάλε ΟΟΜW (αδηάιπην) Botryosphaeria rhodina β (1 3), β (1 6) OOMW SSF: Panus tigrinus Λαθθάζε θαη Mn ππεξνμεηδάζε ηνπ Σξηθαζηθή ειαηνππξήλα ΟΟΜW Σξηθαζηθή ειαηνππξήλα Γηθαζηθή ειαηνππξήλα Σξηθαζηθή ειαηνππξήλα OOMW Yurekli et al., 1999 Lopez et al., 2001 Ruiz-Bravo et al., 2001 Pozo et al., 2002 Crognale et al., 2003 Fenice et al., 2003 SSF: Aspergillus oryzae Α-ακπιάζε Ramachandran et al., 2004 Αλάπηπμε κπθειίνπ Ξπιάλε θαη β-γιπθάλε Tomati et al., 2004 Lentinula edodes (ιεληηλάλε) κε θαξκαθεπηηθέο ηδηφηεηεο σο αληηθαξθηληθνί SSF: Ceratocystis moniliformis, Moniliella suaveolens, Thichoderma harzianum Αλάπηπμε έμη δηαθνξεηηθψλ θαηλνηππηθά νκάδσλ καγηάο πναξάγνληεο Eληζρπηηθά γεχζεο δ- θαη γ- δεθαιαθηφλεο Παξαγσγή λένπ ελδχκνπ Laufenberg et al., 2004 Giannoutsou et al., 2004 SSF: Aspergillus oryzae Οπδέηεξε πξσηεάζε Sandhya et al., 2005 Αλαεξφβηα ρψλεπζε γηα Bηνδηαζπψκελα Dionisi et al., 2005 ηελ παξαγσγή πηεηηθψλ πνιπκεξή ιηπαξψλ νμέσλ ζαλ ππφζηξσκα γηα ηελ παξαγσγή γξακκηθψλ πνιπκεξψλ (PHA S ή polyhydroxyalkanoates) 50

69 Παξαζθεπή πξντόληνο ηύπνπ πάζηα ειηάο Με ηε ρξήζε ηνπ δνλνχκελνπ θπθιηθνχ θφζθηλνπ (κέζνδνο Eco Olive Cleaner), ην ζηεξεφ ππφιεηκκα θνζθίληζεο (OMW-S) πνπ ζπγθεληξψλεηαη θαηά ηνλ δηαρσξηζκφ ηνπ απφ ην αληίζηνηρν πγξφ ππφιεηκκα (ΟΜW-L), κπνξεί λα αμηνπνηεζεί κε ηε κεηαηξνπή ηνπ ζε "πάζηα" ειηάο πςειήο πνηφηεηαο, κηα λέα πεγή ηξνθίκνπ πςειήο δηαηξνθηθήο αμίαο. Σνλ θχξην ξφιν ζηε δχκσζε ηνπ πιηθνχ απηνχ θαίλεηαη λα παίδνπλ νη δχκεο, φπσο πξνέθπςε θαηά ηε δηεμαγσγή ησλ πεηξακάησλ ηεο παξνχζαο εξγαζίαο, θαζψο δελ ππάξρνπλ δεκνζηεπκέλα βηβιηνγξαθηθά δεδνκέλα γηα ηε δχκσζε ηνπ ζπγθεθξηκέλνπ πιηθνχ. Σα ηειεπηαία ρξφληα πξαγκαηνπνηήζεθε ε εηζαγσγή ζηελ ειιεληθή αγνξά, ελφο λένπ πξντφληνο, ηνπ νπνίνπ ε βαζηθή πξψηε χιε ήηαλ κελ επξέσο γλσζηή αιιά σο πξντφλ είλαη θαηλνχξγην. Σν πξντφλ απηφ είλαη ε πάζηα ειηάο. Παξά ηελ ηζηνξηθή πνξεία θαη ηε ζεκαζία ηεο ειηάο γηα ηελ Διιάδα, ε αγνξά γηα ηελ πάζηα ειηάο ζήκεξα είλαη κηθξή. Απηφ βέβαηα κπνξεί λα δηθαηνινγεζεί, αθνχ ε εηζαγσγή ηνπ πξντφληνο έγηλε πξφζθαηα ζηελ αγνξά θαη σο απνηέιεζκα δελ είλαη γλσζηφ ζην επξχ θαηαλαισηηθφ θνηλφ θαη επηπιένλ γλσξίδνπκε φηη ν θαηαλαισηήο δελ αιιάδεη εχθνια ηηο ζπλήζεηέο ηνπ. Ζ πάζηα ειηάο είλαη έλα πξντφλ πνπ παξάγεηαη απφ επεμεξγαζκέλν ειαηφθαξπν. ε αληίζεζε κε ηνλ βηνκεραληθφ ηνκέα ειαηνιάδνπ θαη επεμεξγαζκέλνπ ειαηνθάξπνπ, ν ηνκέαο ηεο πάζηαο ειηάο βξίζθεηαη, φπσο πξναλαθέξζεθε, αξθεηά πίζσ φζνλ αθνξά ηε βηνκεραληθή παξαγσγή θαη ηελ πξνψζεζή ηεο ζηελ αγνξά. Σν πξντφλ εκθαλίζηεθε ζε παγθφζκηα θιίκαθα κφιηο πξηλ 4-5 ρξφληα θαη ε πιεηνλφηεηα ησλ παξαγσγηθψλ κνλάδσλ πάζηαο ειηάο βαζίδεηαη ζε εκπεηξηθέο κεζφδνπο (Κπξηηζάθεο, 2007). Ζ πάζηα ειηάο (ή πνιηφο ειηάο) αθνχ πξνέξρεηαη απφ επεμεξγαζκέλν ειαηφθαξπν, εκπίπηεη ζηελ θαηεγνξία ησλ ηξνθίκσλ θπηηθήο πξνέιεπζεο δηαηεξεκέλσλ κε αιάηη, μχδη, ιάδη ή νηλφπλεπκα (Κψδηθαο Σξνθίκσλ, Πνηψλ θαη Αληηθεηκέλσλ Κνηλήο Υξήζεο, 2003). Σα ραξαθηεξηζηηθά ηεο νξίδνληαη απφ ηελ Δπξσπατθή λνκνζεζία πνπ αλαθέξεηαη ζηνλ ηνκέα ησλ ηξνθίκσλ (Καλνληζκφο 2081/92). Ο θαλνληζκφο απηφο νξίδεη φηη ε πάζηα ειηάο πξέπεη λα έρεη ραξαθηεξηζηηθφ ρξσκαηηζκφ πνπ δελ πξέπεη λα είλαη νχηε πνιχ πξάζηλνο νχηε πνιχ ζθνπξφρξσκνο. Ζ πάζηα πξέπεη λα είλαη παρχξξεπζηε, κε άξσκα ζπγθξίζηκν κε ην ραξαθηεξηζηηθφ άξσκα ηνπ ειαηνιάδνπ (Κπξηηζάθεο, 2007). 51

70 ηνηρεία πνπ αθνξνχλ κηα ηππηθή δηαδηθαζία παξαζθεπήο πάζηαο ειηάο αλαθέξνληαη ζηε βηβιηνγξαθία (Κπξηηζάθεο, 2007, Αξβαληηνγηάλλεο θαη ζπλ., 2001). Σα ελδηαθέξνληα απφ ρεκηθή άπνςε ζηάδηα κηαο ηππηθήο δηαδηθαζίαο παξαζθεπήο πάζηαο ειηάο είλαη ε αθαιάησζε ηνπ επεμεξγαζκέλνπ ειαηφθαξπνπ ακέζσο κεηά ηελ παξαιαβή ηνπ θαη ε ζεξκηθή επεμεξγαζία ζηελ νπνία ππνβάιιεηαη ην πξντφλ. Πξηλ ηε ζπζθεπαζία παξεκβάιιεηαη έλα ζηάδην ζέξκαλζεο, θαη ζε κεηαγελέζηεξν ζηάδην ην ζπζθεπαζκέλν πξντφλ παζηεξηψλεηαη γηα ηελ εμαζθάιηζε ειάρηζηνπ κηθξνβηαθνχ θνξηίνπ. Δίλαη ζεκαληηθφ λα ηνληζζεί θαη πάιη φηη ε πιεηνλφηεηα ησλ παξαγσγηθψλ κνλάδσλ πάζηαο ειηάο βαζίδεηαη ζε εκπεηξηθέο κεζφδνπο. Σα πξναλαθεξζέληα ζηάδηα κπνξεί λα δηαθέξνπλ σο πξνο ηε δηάξθεηα ή αθφκα θαη λα παξαιείπνληαη αλάινγα κε ηελ ηερλνινγία πνπ ρξεζηκνπνηεί ε θάζε παξαγσγηθή κνλάδα. Απηφ πηζαλψο λα δηαθνξνπνηεί ηα πξντφληα θαη ηα ραξαθηεξηζηηθά ηνπο απφ εηαηξεία ζε εηαηξεία. Πην ζπγθεθξηκέλα, ηα ζηάδηα παξαζθεπήο ηεο πάζηαο ειηάο είλαη: 1) Παξαιαβή ησλ επεμεξγαζκέλσλ ειηψλ 2) Αθαιάησζε 3) Ομίληζε πιηθψλ 4) Δθππξήλσζε 5) Πνιηνπνίεζε ειηάο 6) Θέξκαλζε πνιηνχ 7) Πξνζζήθε πξφζζεησλ πιψλ 8) πζθεπαζία 9) Πιχζε κε λεξφ 10) Παζηεξίσζε (ζεξκνθξαζία 78 ν C γηα πεξίπνπ 20 ιεπηά) 11) Φχμε 12) ηέγλσκα 13) Δηηθεηάξηζκα 14) Παιεηνπνίεζε 15) Απνζήθεπζε. Όζνλ αθνξά ηε ρεκηθή ζχζηαζε ηεο πάζηαο ειηάο δελ ππάξρνπλ βηβιηνγξαθηθά ζηνηρεία γηα ηε ρεκηθή ηεο ζχζηαζε ηεο θαη πιεξνθνξίεο κπνξεί λα αληιεζνχλ απφ ηα πξντφληα πνπ απνηεινχλ ηε βάζε γηα ηελ παξαζθεπή ηεο, δειαδή ηνλ επεμεξγαζκέλν ειαηφθαξπν θαη ην ειαηφιαδν. χκθσλα κε ζηνηρεία πνπ παξνπζηάδνπλ νη ζπζθεπαζίεο δηαθφξσλ εηαηξηψλ εκπνξίαο πάζηαο ειηάο, ην ειαηφιαδν πξνζηίζεηαη ζην πξντφλ ζε πνζνζηά πνπ 52

71 θπκαίλνληαη απφ 1,4-2,5% γηα ηηο πάζηεο απφ καχξεο ειηέο θαη ειηέο Καιακψλ θαη απφ 5-8 % γηα ηηο πάζηεο απφ πξάζηλεο ειηέο. Απφ ηελ εμέηαζε ηεο ιηπαξήο θάζεο θαη πην ζπγθεθξηκέλα ησλ ιηπφθηισλ ζπζηαηηθψλ ζθνπαιέλην, α-ηνθνθεξφιε, θαξνηελνεηδή θαη ρισξνθχιιεο ησλ δεηγκάησλ ζε εξγαζία ηεο Αλλίβα (2007), δηαπηζηψζεθε φηη νη δηαθνξέο πνπ παξνπζηάδεη ζηελ πεξηεθηηθφηεηα ζε θάζε ζπζηαηηθφ είλαη κηθξέο θαη νθείινληαη ζηνλ εκπνξηθφ ηχπν θαη ηε ζχλζεζε ηνπ ηειηθνχ πξντφληνο. Αθφκα, κεηά απφ ζχγθξηζε δεηγκάησλ ηεο ίδηαο εηαηξείαο, παξαηεξήζεθε φηη ε αξρηθή πεξηεθηηθφηεηα ηνπ πξντφληνο ζηα εμεηαζζέληα ζπζηαηηθά (εθηφο ησλ ρισξνθπιιψλ) θαίλεηαη λα δηαηεξείηαη κέρξη θαη ηελ εκεξνκελία ιήμεο ηνπ (φηαλ απηφ απνζεθεχεηαη ζε ζπλζήθεο πνπ επηθξαηνχλ ζηα ξάθηα ππεξαγνξψλ θαη ζε αεξνζηεγή ζπζθεπαζία). Ζ πάζηα ειηάο θαίλεηαη λα είλαη έλα νξζά ηππνπνηεκέλν θαη πνηνηηθφ πξντφλ, ην νπνίν κπνξεί λα απνηειέζεη κηα θαιή πεγή πξφζιεςεο επεξγεηηθψλ ζπζηαηηθψλ. Δπηζεκαίλεηαη φηη ην πεξηερφκελν ηνπ πξντφληνο ζε αιάηη επηβάιιεη ηελ πξνζνρή ησλ θαηαλαισηψλ ζε ζρέζε κε δηαηξνθηθέο απαηηήζεηο/ζπζηάζεηο (Αλλίβα, 2007) Μειινληηθέο ηάζεηο Ζ αμηνπνίεζε ησλ παξαπξντφλησλ εθρχιηζεο ειαηνιάδνπ ζα απαηηήζνπλ ηελ εθκεηάιιεπζε πνιιψλ ζπζηαηηθψλ. Παξά ηηο κειέηεο πνπ έρνπλ γίλεη θαη ηα ππνζρφκελα απνηειέζκαηα, ε έξεπλα πάλσ ζηνπο πηζαλνχο ηξφπνπο ρξεζηκνπνίεζήο ηνπο, νη νπνίεο ζπκπεξηιακβάλνπλ φια ηα επίπεδα αμίαο, απφ πςειή αμία (αληηνμεηδσηηθά, αληηηθά, αληηθαξθηληθά) ζε ζρεηηθά ρακειήο αμίαο (θφκπνζη, δσνηξνθή), δελ έρεη νινθιεξσζεί αθφκε. Δίλαη μεθάζαξν φηη ε επίηεπμε κηαο επαξθνχο αμηνπνίεζεο απηψλ ησλ παξαπξντφλησλ ζα απαηηήζεη ηελ πιήξε ρξεζηκνπνίεζή ηνπο, ε νπνία ζα βνεζήζεη ζηελ αχμεζε ηεο αμίαο φισλ ησλ εμσηεξηθψλ εηζξνψλ (Waldron, 2005). Μεηά ηελ επηηπρία ζηε βηνκεραληθή αμηνπνίεζε ηεο πδξνμπηπξνζφιεο (Fernandez- Bolanos et al., 2006), ηα επφκελα πεδία έξεπλαο αθνξνχζαλ ηελ αλάθηεζε άιισλ βηνελεξγψλ θαη πςειήο αμίαο ελψζεσλ, κε ηδηαίηεξε ζεκαζία γηα ηελ αλζξψπηλε πγεία, φπσο ηα θιαβνλνεηδή, νη ιηγλάλεο θαη άιιεο θαηλνιηθέο ελψζεηο, ζηεξφιεο, ηνθνθεξφιεο, ζθνπαιέλην θαη ηξηηεξπεληθέο αιθνφιεο θαη νμέα (Newmark, 1999, Cassidy et al., 2000, Rodriguez-Rodriguez et al., 2004). Απηή ε κεγάιε πνηθηιία ζπζηαηηθψλ ζα απαηηήζεη 53

72 δηαθνξεηηθέο ηερλνινγίεο γηα ηελ απνκφλσζε θαη ηνλ θαζαξηζκφ ηνπο. H εθρχιηζε ηνπ ππεξθξίζηκνπ πγξνχ CO 2 θαη ε κνξηαθή απφζηαμε απνηεινχλ δχν απφ ηηο πην επηζπκεηέο ηερλνινγίεο. O αληηδξαζηήξαο ζηε βηνκεραληθή αμηνπνίεζε ηεο πδξνμπηπξνζφιεο ζα κπνξνχζε επίζεο λα ελζσκαηψζεη κηα παγίδα πηεηηθψλ, ε νπνία ζα επέηξεπε ηελ αλάθηεζε θαη άιισλ πνιχηηκσλ ελψζεσλ. Οη θπζηθέο πηεηηθέο ελψζεηο πνπ παξάγνληαη απφ θξέζθνπο θαξπνχο θαηά ηε δηάξθεηα ησλ ζηαδίσλ ζχλζιηςεο θαη κάιαμεο ελζσκαηψλνληαη ζην ειαηφιαδν, εληζρχνληαο ην άξσκά ηνπ (Perez et al., 2003). Aπηφ ην άξσκα ραξαθηεξίδεηαη απφ έλα επξχ θάζκα ηάμεσλ πηεηηθψλ (αιδευδεο, θεηφλεο, εζηέξεο, αιθνφιεο θαη πδξνγνλάλζξαθεο), ελψ νη κεηαβνιίηεο C 5 θαη C 6 (trans-2-henal, trans-2- hexen-1-ol, cis-3-hexyl acetate, cis-2-pentenal, θ.ι.π.), κέζσ ηνπ κνλνπαηηνχ ηεο ιηπνμπγελάζεο, είλαη νη θχξηνη παξάγνληεο γηα ην επράξηζην ρξψκα ησλ θαξπψλ (Ranalli et al., 2004). Eπίζεο, κεξηθά αξσκαηηθά ζπζηαηηθά (καθξπάο αιχζζνπ α,β αθφξεζηεο αιδευδεο) έρνπλ ραξαθηεξηζηεί σο αληηκηθξνβηαθνί παξάγνληεο (Kubo et al., 1995). To ελδηαθέξνλ ζε απηήλ ηελ πηζαλή ρξήζε απηψλ ησλ θπζηθψλ ελψζεσλ γηα ηελ παξεκπφδηζε ηεο κηθξνβηαθήο αλάπηπμεο ή γηα νζκέο θαη αξψκαηα έρεη απμεζεί αμηνζεκείσηα σο απάληεζε ζηελ πίεζε ησλ θαηαλαισηψλ γηα κείσζε ή πεξηνξηζκφ ησλ ρεκηθά ζχλζεησλ ελψζεσλ. Απηή ε αλάθηεζε απφ παξαπξντφληα επεμεξγαζίαο ειαηνιάδνπ ζα αλνίμεη ην δξφκν γηα ηε ρξήζε ηνπο. Μηα ελδηαθέξνπζα ελαιιαθηηθή πξφηαζε ζα είλαη θαη ε βηνηερλνινγηθή παξαγσγή αξσκαηηθψλ ελψζεσλ απφ απηά ηα ππνιείκκαηα. Καηά ηνπο Fernandez -Bolano θαη ζπλ. (2006), ην αδηάιπην ζην λεξφ πιηθφ ηνπ πξνκεηαρεηξηδφκελνπ κε αηκφ alperujo (πγξφο ειαηνππξήλαο δηθαζηθψλ ειαηνπξγείσλ) απφ ηε ζηηγκή πνπ πεξηνξίζηεθαλ ηα πξνβιήκαηα κε ηηο θαηλνιηθέο ελψζεηο (Laufenberg et al., 2004), ζα είλαη έλα εμαηξεηηθφ ππφζηξσκα γηα ηελ παξαγσγή ιαθηνλψλ κέζσ δχκσζεο ζηεξεάο θαηάζηαζεο (SSF). Απηφ νθείιεηαη ζην πςειφ πεξηερφκελν ζε νιετθφ νμχ, ην νπνίν είλαη έλα πξφδξνκν ππφζηξσκα πνπ ρξεζηκνπνηείηαη απφ πνιπάξηζκνπο κχθεηεο θαη δχκεο. Απφ ηε ζηηγκή πνπ ζπζηαηηθά πξνεξρφκελα απφ ην θπηηαξηθφ ηνίρσκα κπνξνχλ λα έρνπλ επίζεο ζξεπηηθά θαη θπζηνινγηθά νθέιε, έρνπλ πξφζθαηα πξνζειθχζεη ην ελδηαθέξνλ ηεο επηζηεκνληθήο θνηλφηεηαο. Γχζπεπηνη νιηγνζαθραξίηεο (νιηγνθξνπθηάλεο, μπιν-νιηγνζαθραξίηεο, γαιαθην-νιηγνζαθραξίηεο), ηε ζηηγκή πνπ 54

73 ζεσξνχληαη πξνβηνηηθά (Roberfroid and Slavin, 2000) ή νιηγνγαιαθηνπξνληθφ νμχ κε βαζκφ πνιπκεξηζκνχ 2-7, κε αληηκηθξνβηαθή δξαζηεξηφηεηα (Guggenbichler et al., 1997), επίζεο έρνπλ κηα ζεκαληηθή πηζαλφηεηα εθαξκνγήο. Απφ ην πδξφιπκκα ηνπ κεηαρεηξηζκέλνπ κε αηκφ Αlperujo, νη νιηγνζαθραξίηεο, νη νπνίνη έρνπλ ήδε αληρλεπηεί (Fernandez - Bolanos et al., 2004), ζα έπξεπε λα ραξαθηεξηζηνχλ ρεκηθά θαη λα αμηνινγεζνχλ θπζηνινγηθά. Ζ αλαδήηεζε νιηγαιαθηνπξνληθψλ νμέσλ ζα κπνξνχζε λα είλαη επίζεο έλα ελδηαθέξνλ δήηεκα. Δπηπιένλ, θάπνηα επηπξφζζεηε κεηαρείξηζε (ρεκηθή ή ελδπκαηηθή) ζα κπνξνχζε λα ιάβεη ρψξα γηα βειηίσζε ηεο ιεηηνπξγηθφηεηάο ηνπ. Σν παξακέλσλ αδηάιπην ππφιεηκκα απφ ην κεηαρεηξηδφκελν κε αηκφ alperujo ζα κπνξνχζε λα ρξεζηκνπνηεζεί επηπιένλ σο έλα κέζν γηα παξαγσγή εμσπνιπζαθραξηηψλ ή β- γιπθαλψλ, νη νπνίεο έρνπλ ζπζρεηηζηεί κε αλνζνινγηθή ιεηηνπξγηθφηεηα θαη αληηθαξθηληθέο ηδηφηεηεο (Ruiz-Bravo et al., 2001, Tomati et al., 2004). Πξαθηηθά, γηα ηελ πιήξε ρξεζηκνπνίεζε παξαπξντφλησλ επεμεξγαζίαο ειηψλ φιεο απηέο νη επεμεξγαζίεο δε ζα έπξεπε λα ρσξηζηνχλ αιιά λα ρξεζηκνπνηεζνχλ ζε ζπλδπαζκφ κεηαμχ ηνπο. Δίλαη ζεκαληηθφ λα αμηνινγεζνχλ νη νηθνλνκηθέο ζπλζήθεο, πξνθεηκέλνπ λα παξαρζνχλ πξντφληα αζθαιή θαη κε δπλαηφηεηα αλαπαξαγσγήο (βαζηθφ λα κε πεξηιακβάλνληαη εληνκνθηφλα θαη άιια αγξνρεκηθά) θαη λα κπνξνχλ λα αλαπηπρζνχλ ζε κηα κεγάιε θιίκαθα (Tomas-Barberan et al., 2005, Waldron, 2005). Σα παξαπξντφληα εθρχιηζεο ειαηνιάδνπ, φπσο αλαθέξζεθε πξνεγνπκέλσο, απνηεινχλ κηα ελδηαθέξνπζα πεγή θπηνρεκηθψλ θαη θπζηθψλ αληηνμεηδσηηθψλ. Ζ εθαξκνγή ηνπο ζηα ηξφθηκα, ε νπνία απμάλεη ηηο ηδηφηεηεο πνπ πξνάγνπλ ηελ πγεία, είλαη έλαο ππνζρφκελνο ηνκέαο έξεπλαο. Σα ιεηηνπξγηθά ηξφθηκα είλαη κηα πεξηνρή γξήγνξεο αλάπηπμεο, φπνπ έξεπλεο πάλσ ζηε βηνδξαζηηθφηεηα, ηε βηνδηαζεζηκφηεηα θαη ηε ηνμηθνινγία ησλ θπηνρεκηθψλ θαη ηε ζηαζεξφηεηά ηνπο θαη αιιειεπηδξάζεηο κε άιια ζπζηαηηθά ηξνθίκσλ πξέπεη πξνζεθηηθά λα εμεηαζζνχλ κε in vitro θαη in vivo κειέηεο (Schieber et al., 2001). ε απηφ ην πιαίζην, ε απφθηεζε απνκνλσκέλσλ θαη θαζαξηζκέλσλ ελψζεσλ, κε πςειφ βαζκφ θαζαξφηεηαο, ζα δηεπθνιχλεη ηελ επίιπζε απηψλ ησλ δεηεκάησλ θαη ζα βνεζήζεη ζηελ επίδεημε ηεο βηνινγηθήο ηνπο δξαζηεξηφηεηαο. Δπνκέλσο, αλ ε αλάθηεζε θαη ε παξαγσγή λέσλ πξντφλησλ απφ ηα παξαπξντφληα ησλ ειαηνπξγείσλ, πξνζηηζέκελε ζηηο ελαιιαθηηθέο πξνηάζεηο, είλαη επηηπρείο, ζα 55

74 κπνξνχλ λα επηιπζνχλ ηα πεξηβαιινληηθά πξνβιήκαηα, θαζψο θαη λα απμεζεί ε αληαγσληζηηθφηεηα ηνπ ειαηνπξγηθνχ ηνκέα θαη λα επεθηαζεί ζηνπο ηνκείο ησλ ηξνθίκσλ, ηεο θαξκαθεπηηθήο θαη ησλ θαιιπληηθψλ. 56

75 3. ΑΝΣΗΚΔΗΜΔΝΗΚΟ ΚΟΠΟ ΣΖ ΜΔΛΔΣΖ Ζ έξεπλα ζηφρεπε: ηελ παξαγσγή ελφο πξντφληνο ηχπνπ πάζηαο ειηάο κε πξψηε χιε ην ζηεξεφ ππφιεηκκα θνζθίληζεο ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ (OMWs), ην νπνίν ζα είλαη νξγαλνιεπηηθά απνδεθηφ απφ ηνπ θαηαλαισηέο θαη κηθξνβηνινγηθά αζθαιέο. Σν πξντφλ απηφ ζα απνηειεί κέξνο ηεο πξνψζεζεο ελφο νινθιεξσκέλνπ ζπζηήκαηνο επεμεξγαζίαο πγξψλ απνβιήησλ ειαηνπξγείνπ, ελφο ζπζηήκαηνο δειαδή ηερληθά εθηθηνχ θαη νηθνλνκηθά βηψζηκνπ, φπνπ φια ηα παξαπξντφληα επαλαρξεζηκνπνηνχληαη αθφκα θαη ην λεξφ ζε πνζνζηφ 100% θαη παξάιιεια παξαιακβάλνληαη πξντφληα πςειήο πξνζηηζέκελεο αμίαο. Αληηθεηκεληθφο ζθνπφο ηεο κειέηεο ήηαλ ε απνκφλσζε θαη ηαπηνπνίεζε ηεο απηφρζνλεο κηθξνρισξίδαο πνπ είλαη ππεχζπλε γηα ηε θπζηθή δχκσζε ηνπ ζηεξενχ ππνιείκκαηνο θνζθίληζεο ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ, κεηά ηελ πξνζζήθε άιαηνο (6% ΝaCl). Με ηνλ ηξφπν απηφ κπνξνχλ λα απνθηεζνχλ ελδηαθέξνληα ζηειέρε, ηα νπνία ζα δηαζέηνπλ επηζπκεηέο ηερλνινγηθέο ηδηφηεηεο θαη ζα κπνξνχζαλ κειινληηθά λα ρξεζηκνπνηεζνχλ σο θαιιηέξγεηεο εθθίλεζεο γηα ηελ παξαγσγή ελφο πξντφληνο ηχπνπ πάζηαο ειηάο πςειήο πξνζηηζέκελεο αμίαο. 57

76 4. ΤΛΗΚΑ ΚΑΗ ΜΔΘΟΓΟΗ 4.1. Παξαζθεπή δεηγκάησλ Σα δείγκαηα ζηεξενχ ππνιείκκαηνο θνζθίληζεο πγξψλ απνβιήησλ ειαηνπξγείνπ (solid residue of Olive Mill Wastewaters) ή (ΟΜW S ) ηα νπνία εμεηάζηεθαλ, ιήθζεθαλ απφ ην ειαηνπξγείν ησλ αδειθψλ Αβέξε (Δκκ. Αβέξεο & ΗΑ Ο.Δ.), ζηε Γαιάηηζηα Υαιθηδηθήο, ην νπνίν ιεηηνπξγεί κε θπγνθεληξηθφ ζχζηεκα 3-θάζεσλ. ην ηέινο ηεο γξακκήο είλαη πξνζαξκνζκέλν έλα ζχζηεκα κε δνλνχκελα θφζθηλα (Eηθφλα 4.1), φπνπ γίλεηαη κεραληθφο δηαρσξηζκφο ηνπ πνιηνχ ειηάο (ΟΜW Solid ή OMWs) απφ ηα ππφινηπα πγξά ησλ πγξψλ απνβιήησλ (ΟΜW Liquid ή ΟΜW L ). Σα πγξά πνπ απνκαθξχλνληαη είλαη απαιιαγκέλα απφ αησξνχκελα ζηεξεά θαη ιάδη. α β Δηθόλα 4.1. (α). Μεραληθφ δνλνχκελν θφζθηλν δηαρσξηζκνχ πγξψλ απνβιήησλ, (β) εηθνληθή αλαπαξάζηαζε ηνπ ζπζηήκαηνο δηαρσξηζκνχ πγξψλ απνβιήησλ. ην αξηζηεξφ δνρείν θαηεπζχλνληαη ηα πγξά (OMW L ) θαη ζην δεμί δνρείν ηα ζηεξεά κέξε ησλ πγξψλ απνβιήησλ (OMWs) (www.ecoolivecleaner.gr & ). Σα δείγκαηα ιήθζεθαλ απφ ην ζεκείν ζην νπνίν θαηαιήγεη ν πνιηφο ειηάο ΟMWs απφ ην κεραληζκφ δηαρσξηζκφ ησλ πγξψλ απνβιήησλ (OMW). Ζ πξψηε παξηίδα πνπ απνηέιεζε ην δείγκα Α ιήθζεθε ζηηο 20 Ννεκβξίνπ 2012 θαη ππνβιήζεθε ζε κηθξνβηνινγηθέο αλαιχζεηο κε θχξην ζθνπφ ηελ ηαπηνπνίεζε ηεο επηθξαηνχζαο κηθξνρισξίδαο θαη θπζηθνρεκηθέο αλαιχζεηο γηα ηε κειέηε ηεο δπλαηφηεηαο αμηνπνίεζεο ηνπ πιηθνχ. Ζ δεχηεξε παξηίδα πνπ απνηέιεζε ην δείγκα Β ιήθζεθε ζηηο 27 Ννεκβξίνπ 2012 θαη απνζεθεχηεθε ππφ θαηάςπμε πξνθεηκέλνπ λα 58

77 ρξεζηκνπνηεζεί γηα ηελ παξαζθεπή πξντφληνο ηχπνπ πάζηα ειηάο θαη ηνλ νξγαλνιεπηηθφ έιεγρφ ηνπ. Σα δείγκαηα Α θαη Β ιήθζεθαλ δειαδή απφ ην ίδην πιηθφ (ΟΜWs), αιιά ρξεζηκνπνηήζεθαλ γηα δηαθνξεηηθνχο ζθνπνχο. πλνιηθά, ειήθζεζαλ 40 ιίηξα ΟΜW S, ηα νπνία απνζεθεχηεθαλ ππφ θαηάςπμε γηα ηελ παξαζθεπή ηνπ πξντφληνο ηχπνπ πάζηα ειηάο (δείγκα Β) θαη άιια 40 ιίηξα απφ ην ίδην πιηθφ (δείγκα Α) ηα νπνία ηνπνζεηήζεθαλ ζε έμη γπάιηλα δνρεία ρσξεηηθφηεηαο 6 lt κε πεξηεθηηθφηεηα ζε ΝaCl 6%, ηξία γηα ηηο κηθξνβηνινγηθέο θαη ηξία γηα ηηο θπζηθνρεκηθέο αλαιχζεηο. H επψαζε ζηα γπάιηλα δνρεία έγηλε ζηνπο 25 o C γηα 14 εκέξεο κεηά απφ ελζσκάησζε 6% ΝaCl, γηαηί έρεη δηαπηζησζεί βηβιηνγξαθηθά φηη απηέο είλαη νη θαιχηεξεο ζπλζήθεο γηα ηε δχκσζε επηηξαπέδησλ ειηψλ (Panagou et al., 2008), πξνθεηκέλνπ ηφζν λα εκπνδηζηεί ε αλάπηπμε άιισλ κηθξννξγαληζκψλ πέξαλ απηψλ πνπ είλαη ππεχζπλνη γηα ηε δχκσζε φζν θαη λα εμαζθαιηζηεί ε ζπληήξεζε ηνπ πξντφληνο Πεηξακαηηθόο ζρεδηαζκόο Σα δχν δείγκαηα (δείγκα Α & δείγκα Β) πνπ ειήθζεζαλ απφ ην ειαηνπξγείν Δκκ. Αβέξεο & ΗΑ Ο.Δ. ππνβιήζεθαλ ζε δηαθνξεηηθέο κεηαρεηξίζεηο, φπσο θαίλεηαη ζπλνπηηθά ζην πεηξακαηηθφ ζρέδην πνπ αθνινπζεί: Mηθροβηοιογηθές θαη υσσηθοτεκηθές αλαιύσεης (Γείγκα Α) 1. Μειέηε ηεο εμέιημεο ηωλ ελδνγελώλ κηθξνριωξίδωλ θαηά ηε δηάξθεηα ηεο δύκωζεο Έγηλε δεηγκαηνιεςεία ζε θάζε ρξφλν (0, 2, 5, 7, 10 θαη 14 εκέξεο), ζε ηξείο επαλαιήςεηο (κία επαλάιεςε αλά πεξηέθηε) γηα ηε κέηξεζε ησλ παξαθάησ κηθξνρισξίδσλ: εληεξνβαθηήξηα, ςεπδνκνλάδεο, ζηαθπιφθνθθνη, γαιαθηηθά βαθηήξηα, δχκεο, κχθεηεο θαη νιηθή κεζφθηιε ρισξίδα. 2. Απνκόλωζε επηθξαηνύζαο κηθξνριωξίδαο. Μεηά ην ηέινο ηεο επψαζεο απνκνλψζεθαλ, θαζαξίζηεθαλ θαη δηαηεξήζεθαλ 10 ηπραίεο απνηθίεο απφ ηηο δχκεο (ηξπβιία κε PDA άγαξ), απφ δείγκαηα 0, 2 θαη 5 εκεξψλ δχκσζεο ηνπ 2 νπ πεξηέθηε απφ ηνπο 3 γηα ηηο κηθξνβηνινγηθέο αλαιχζεηο (ζπλνιηθά 30 απνηθίεο). 3. Μειέηε ηεο κνξθνινγίαο ηωλ απνκνλώζεωλ. Μειεηήζεθε ε κνξθνινγία ηνπ θπηηάξνπ ησλ 30 απνκνλψζεσλ δπκψλ κε εθαξκνγή απιήο ρξψζεο θαη κηθξνζθφπεζεο. 59

78 4. Μειέηε βηνρεκηθώλ δξαζηεξηνηήηωλ επηθξαηνύζαο κηθξνριωξίδαο. Μειεηήζεθαλ νη δξαζηεξηφηεηεο θαηαιάζεο, πξσηεάζεο, μπιαλάζεο, ιηπάζεο, εζηεξάζεο, πνιπγαιαθηνπξνλάζεο θαη β γιπθνζηδάζεο ησλ 30 ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ θαη αθνινχζεζε κνξηαθή ηαπηνπνίεζή ηνπο. 5. Ταπηνπνίεζε επηθξαηνύζαο κηθξνριωξίδαο κε κνξηαθέο κεζόδνπο. Oη κνξηαθέο ηερληθέο πνπ ρξεζηκνπνηήζεθαλ γηα ηελ ηαπηνπνίεζε ησλ 30 ζηειερψλ δπκψλ (επηθξαηνχζα κηθξνρισξίδα) κεηά ηελ απνκφλσζή ηνπο ήηαλ: α) H αιπζηδσηή αληίδξαζε πνιπκεξάζεο (Polymerase Chain Reaction PCR) κε ειεθηξνθφξεζε ησλ πξντφλησλ ηεο ζε πεθηή αγαξφδεο, β) ε αλάιπζε πνιπκνξθηζκνχ κε έλδπκα πεξηνξηζκνχ (Restriction Fragments Length Polymorphism - RFLP). Έγηλε δειαδή πέςε ησλ πξντφλησλ ηεο PCR κε ηε ρξήζε ελδνλνπθιεαζψλ (έλδπκα) πεξηνξηζκνχ θαη αλάιπζή ηνπο ζε ζξαχζκαηα δηαθνξεηηθνχ κεγέζνπο. γ) ε αλάιπζε αθνινπζηψλ ή αιιεινχρεζε (sequencing) ησλ εληζρπκέλσλ κε PCR ηκεκάησλ (Ζ αλάιπζε αθνινπζηψλ έγηλε ζε 6 επηιεγκέλα ηπραία ζηειέρε απφ ηηο 6 νκάδεο πνπ δεκηνπξγήζεθαλ κε βάζε ηηο θνηλέο βηνρεκηθέο δξαζηεξηφηεηεο ησλ 30 ζηειερψλ - 1 ζηέιερνο /νκάδα). 6. Μειέηε θπζηθνρεκηθώλ ραξαθηεξηζηηθώλ θαηά ηε δηάξθεηα ηεο δύκωζεο. Έγηλε δεηγκαηνιεςεία ζε θάζε ρξφλν (0, 2, 5, 7, 10 θαη 14 εκέξεο), ζε ηξεηο επαλαιήςεηο (κηα επαλάιεςε αλα πεξηέθηε) γηα ηε κέηξεζε ησλ ραξαθηεξηζηηθψλ: ph, πγξαζία, νιηθά θαηλνιηθά ζπζηαηηθά, νμχηεηα, δηαιπηά ζηεξεά. Παρασθεσή θαη οργαλοιεπτηθός έιεγτος προϊόλτος τύποσ πάστας ειηάς (Γείγκα Β) 1. Δλζωκάηωζε 6% ΝaCl. Tα OMWs δπκψζεθαλ ζε 6% ΝaCl γηα 14 εκέξεο ζηνπο 25 ν C. 2. Έθπιπζε ηνπ πιηθνύ. Μεηά ηελ πάξνδν 14 εκεξψλ θαη ηελ νινθιήξσζε ηεο δηαδηθαζίαο εθπίθξαλζεο, αθνινχζεζε απνκάθξπλζε ηνπ ρισξηνχρνπ λαηξίνπ πνπ είρε πξνζξνθεζεί απφ ην OMWs κε έθπιπζε κε ηξερνχκελν λεξφ. 3. Παξαζθεπή πξνϊόληνο ηύπνπ πάζηαο ειηάο. Μεηά ηελ εθπίθξαλζε θαη ηελ έθπιπζε ηνπ πνιηνχ ειηάο OMWs, αθνινχζεζε ε παξαζθεπή ελφο πξντφληνο ηχπνπ πάζηα 60

79 ειηάο κε βάζε ηα ζηάδηα πνπ αθνινπζνχληαη γηα ηελ παξαγσγή πάζηαο ειηάο απφ επεμεξγαζκέλεο ειηέο. 4. Οξγαλνιεπηηθόο έιεγρνο. Ο έιεγρνο αθνξνχζε ηε ζχγθξηζε ησλ πνηνηηθψλ ραξαθηεξηζηηθψλ κεηαμχ ηεο πάζηαο πνπ παξαζθεπάζηεθε απφ OMWs, ηεο πάζηαο πνπ παξαζθεπάζηεθε απφ επηηξαπέδηεο ειηέο πνπ ζπιιέρζεθαλ απφ ην Αγξφθηεκα ηνπ Α.Π.Θ. θαη δηαηεξήζεθαλ ζε άικε, θαζψο θαη κηαο πάζηαο ειηάο ηνπ εκπνξίνπ κε παξφκνηα ζπζηαηηθά 4.3. Αλαιπηηθή πεξηγξαθή ηεο κεζνδνινγίαο ησλ κεηξήζεσλ Μηθξνβηνινγηθέο θαη θπζηθνρεκηθέο αλαιύζεηο Μειέηε ηεο εμέιημεο ησλ ελδνγελώλ κηθξνρισξίδσλ θαηά ηε δηάξθεηα ηεο δύκσζεο Οη κεηξήζεηο ησλ δηαθφξσλ κηθξνρισξίδσλ πξαγκαηνπνηήζεθαλ κε ηε κέζνδν ησλ ηξπβιίσλ. Πην ζπγθεθξηκέλα, κεηά απφ αλάδεπζε ηνπ πεξηέθηε, δπγίζηεθαλ ππφ αζεπηηθέο ζπλζήθεο 25 gr ηνπ δηαηεξνχκελνπ OMWs ζε 6% NaCl θαη κεηαθέξζεθαλ ζε θηάιε κε 225 ml αξαησηηθνχ πγξνχ Ringer ¼ (Panagou et al., 2008), ζρεκαηίδνληαο ηελ πξψηε αξαίσζε (1/10). Μεηά απφ θαιή αλάκημε, παξαζθεπάζηεθε ε δεχηεξε αξαίσζε (1/100), κεηαθέξνληαο 1ml ηεο πξψηεο ζε 9 ml ηνπ αξαησηηθνχ πγξνχ Ringer ¼ θαη ζηε ζπλέρεηα κε ηνλ ίδην ηξφπν παξαζθεπάζηεθαλ νη ππφινηπεο δηαδνρηθέο δεθαδηθέο αξαηψζεηο. Έλα ml ηεο θάζε αξαίσζεο κεηαθέξζεθε ζε ηξπβιίν θαη αλακίρζεθε κε ην θαηάιιειν ππφζηξσκα (12-15ml) ζεξκνθξαζίαο ν C, ή 0,1 ml επηζηξψζεθε ζε ζηεξεφ ζξεπηηθφ ππφζηξσκα, αλάινγα κε ηελ επηζπκεηή κέηξεζε. Αθνινχζεζε επψαζε ζηηο άξηζηεο ζπλζήθεο αλάπηπμεο γηα ηηο επηκέξνπο κηθξνρισξίδεο. Μεηά ην ηέινο ηεο επψαζεο έγηλε θαηακέηξεζε ησλ απνηθηψλ. Ο αξηζκφο ησλ απνηθηψλ πνπ κεηξήζεθε πνιιαπιαζηαδφκελνο κε ην αληίζηξνθν ηεο θάζε αξαίσζεο έδσζε ηνλ αξηζκφ κηθξννξγαληζκψλ ζε cfu/gr (colony forming units/gr). Oη κηθξνρισξίδεο πνπ εμεηάζηεθαλ, ηα ππνζηξψκαηα πνπ ρξεζηκνπνηήζεθαλ, ε κέζνδνο εκβνιηαζκνχ θαη νη ζπλζήθεο επψαζεο δίλνληαη ζηνλ Πίλαθα

80 Απνκόλσζε επηθξαηνύζαο κηθξνρισξίδαο Μεηά ην ηέινο ηεο επψαζεο απνκνλψζεθαλ 10 ηπραίεο απνηθίεο απφ ηα ηξπβιία κε PDA άγαξ (δχκεο), απφ δείγκαηα 0, 2 θαη 5 εκεξψλ δχκσζεο. Οη απνηθίεο παίξλνληαλ ππφ αζεπηηθέο ζπλζήθεο κε θξίθν εκβνιηαζκνχ, κεηαθέξνληαλ ζε ζξεπηηθφ δσκφ Sabouraud Dextrose Broth (SDB) θαη επσάδνληαλ ζηνπο 30 ν C γηα 24 ψξεο. Αθνινπζνχζε θαζαξηζκφο κε επίζηξσζε πνζφηεηαο ελφο θξίθνπ ζε Sabouraud Dextrose Agar (SDA) κε θάζεηεο γξακκέο (streak), γηα λα εμαζθαιηζηεί ε αλάπηπμε κεκνλσκέλσλ απνηθηψλ θαη επψαζε ζηνπο 30 ν C γηα 24 ψξεο. Μεκνλσκέλεο απνηθίεο κεηαθέξνληαλ κε θξίθν ζε πιάγην άγαξ (SDA) θαη επσάδνληαλ μαλά ζηνπο 30 ν C γηα 24 ψξεο. Οη 30 θαζαξέο απνκνλψζεηο δηαηεξνχληαλ ζηα κπνπθαιάθηα κε ην πιάγην άγαξ ππφ ςχμε. Πίλαθαο 4.1. Μηθξνρισξίδεο πνπ κειεηήζεθαλ, αληίζηνηρα ππνζηξψκαηα, κέζνδνη εκβνιηαζκνχ θαη ζπλζήθεο επψαζεο. Μηθξνρισξίδα Τπόζηξσκα Μέζνδνο εκβνιηαζκνύ Οιηθή κεζφθηιε ρισξίδα Ομπγαιαθηηθά βαθηήξηα Εχκεο Μχθεηεο Δληεξνβαθηήξηα Φεπδνκνλάδεο ηαθπιφθνθθνη Plate Count Agar (PCA) (Oxoid, Ltd) De Man, Rogosa & Sharp Agar (MRS)* (Oxoid, Ltd) Potato Dextrose Agar (PDA)** (Oxoid, Ltd) Potato Dextrose Agar (PDA)** (Oxoid, Ltd) Violet Red Bile Glucose Agar (VRBGA) (Oxoid, Ltd) Violet Red Bile Glucose Agar (VRBGA) (Oxoid, Ltd) Baird Parker (BP) Agar (Oxoid, Ltd) πλζήθεο επώαζεο Βηβιηνγξαθηθή αλαθνξά Αλάκημε 30 ν C, 72 ψξεο Panagou et al. (2008) Αλάκημε / 2 o ζηξψκα 30 ν C, 72 ψξεο Panagou et al. (2008) Reuter (1985) Aλάκημε 25 ν C, 5 εκέξεο Panagou et al. (2008) Aλάκημε 25 ν C, 5 εκέξεο Panagou et al. (2008) Αλάκημε / 2 o ζηξψκα Αλάκημε/ 2 o ζηξψκα 37 ν C, 24 ψξεο (αλαεξφβηεο ζπλζήθεο)*** Panagou et al. (2008) 37 ν C, 24 ψξεο Panagou et al. (2008) επίζηξσζε 37 ν C, 48 ψξεο Thatcher et al. (1968) *Πξνζηέζεθαλ θαη 0,2 ml πηκαξπζίλεο (0,5% w/v) /ηξπβιίν θαη ξπζκίζηεθε ην ph ζην 5,7 ** Ρχζκηζε ηνπ ph ζην 3,5 κε πξνζζήθε 1,4 ml ηαξηαξηθνχ νμένο (10% v/v) /100 ml ππνζηξψκαηνο ***Gas-Pak system, BBL, Cockeysville, Marylant, USA 62

81 Μειέηε ηεο κνξθνινγίαο ηεο επηθξαηνύζαο κηθξνρισξίδαο κε κηθξνζθόπεζε Σα ζηειέρε δξαζηεξηνπνηήζεθαλ κε αλαθαιιηέξγεηα ζε SDA (επψαζε ζηνπο 30 ν C γηα 48h). ηε ζπλέρεηα κεηαθέξζεθαλ θχηηαξα κε θξίθν ζε αληηθεηκελνθφξν πιάθα θαη ελαησξήζεθαλ ζε κία ζηαγφλα λεξφ. Αθνινχζεζε ην ζηέγλσκα ησλ πιαθψλ θαη κεηά ε δηαδηθαζία ηεο κνληκνπνίεζεο, θαηά ηελ νπνία νη πιάθεο πέξαζαλ ηξεηο θνξέο πάλσ απφ θιφγα. Αθνινχζσο, εθαξκφζηεθε απιή ρξψζε. Πην ζπγθεθξηκέλα, νη πιάθεο δηαπνηίζηεθαλ κε ηε ρξσζηηθή Crystal Violet γηα 1 ιεπηφ θαη ζηε ζπλέρεηα κε Lugol (δηάιπκα ησδίνπ θαη ησδηνχρνπ θαιίνπ) γηα άιιν έλα ιεπηφ. ηε ζπλέρεηα έγηλε μέπιπκα κε λεξφ θαη ηνπνζέηεζε ησλ πιαθψλ ζε δηεζεηηθφ ραξηί γηα λα ζηεγλψζνπλ. Σν επφκελν ζηάδην αθνξνχζε ηελ παξαηήξεζε ησλ απνηθηψλ ζην κηθξνζθφπην πξνθεηκέλνπ λα ραξαθηεξηζηνχλ ηα θχηηαξα ησλ δπκψλ απφ κνξθνινγηθή άπνςε. Αθνχ ηνπνζεηήζεθε κηα ζηαγφλα θεδξειαίνπ ζε θάζε απνηθία θαη κε ρξήζε ηνπ ειαηνδπηηθνχ θαθνχ κεγέζπλζεο x 100 κειεηήζεθαλ ηα θχηηαξα ησλ δπκψλ Μειέηε βηνρεκηθώλ δξαζηεξηνηήησλ επηθξαηνύζαο κηθξνρισξίδαο Μειεηήζεθαλ δξαζηεξηφηεηεο θαηαιάζεο, πξσηεάζεο, μπιαλάζεο, ιηπάζεο, εζηεξάζεο, πνιπγαιαθηνπξνλάζεο θαη β γιπθνζηδάζεο. Πξνθεηκέλνπ λα κειεηεζνχλ νη βηνρεκηθέο δξαζηεξηφηεηεο ησλ 30 ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ, έγηλε αλαθαιιηέξγεηά ηνπο ζε SDA Γξαζηεξηόηεηα (παξαγσγή) θαηαιάζεο Πνζφηεηα θπηηάξσλ απφ ηα αλαθαιιηεξγεκέλα ζε SDA ζηειέρε, κεηαθεξφηαλ κε θξίθν ζε αληηθεηκελνθφξν πιάθα θαη αλακηγλπφηαλ κε κηα ζηαγφλα ππεξνμεηδίνπ ηνπ πδξνγφλνπ 3%. Ζ εκθάληζε θπζαιίδσλ ιφγσ ηεο παξαγσγήο νμπγφλνπ απφ ηε δηάζπαζε H 2 O 2, δήισλε ηελ χπαξμε ηνπ ελδχκνπ θαηαιάζε (Whittenbury, 1964) Γξαζηεξηόηεηα πξσηεάζεο Γηα λα ειεγρζεί ε δξαζηεξηφηεηα πξσηεάζεο, πνζφηεηα θαιιηέξγεηαο κεηαθεξφηαλ κε θξίθν εκβνιηαζκνχ ζε ηξπβιία κε Yeast Extract Peptone Dextrose (YEPD ή YPD) 63

82 άγαξ πνπ πεξηείραλ 20 g/ L θαδεΐλε. Σα ηξπβιία ηνπνζεηνχληαλ γηα επψαζε ζηνπο 30 ν C γηα 5 εκέξεο. Γηαπγήο δψλε γχξσ απφ ηελ αλάπηπμε ησλ δπκψλ δειψλεη πδξφιπζε ηεο θαδεΐλεο θαη επνκέλσο δξαζηεξηφηεηα πξσηεάζεο (Strauss et al., 2001) Γξαζηεξηόηεηα μπιαλάζεο Γηα λα ειεγρζεί ε δξαζηεξηφηεηα μπιαλάζεο, πνζφηεηα θαιιηέξγεηαο κεηαθεξφηαλ κε θξίθν εκβνιηαζκνχ ζε ηξπβιία κε Yeast Extract (YEA) άγαξ, πνπ πεξηείρε 5 g/l μπιάλε, 5 g/l βαθηεξηνινγηθήο πεπηφλεο θαη 5 g/l NaCl. Σα ηξπβιία ηνπνζεηνχληαλ γηα επψαζε ζηνπο 30 ν C γηα 5 εκέξεο. Γηαπγήο δψλε γχξσ απφ ηελ αλάπηπμε ησλ δπκψλ δειψλεη πδξφιπζε ηεο μπιάλεο θαη επνκέλσο δξαζηεξηφηεηα μπιαλάζεο (Hernandez et al., 2007) Γξαζηεξηόηεηεο ιηπάζεο θαη εζηεξάζεο Γηα λα ειεγρζνχλ νη δξαζηεξηφηεηεο ιηπάζεο θαη εζηεξάζεο, ηα ζηειέρε αλαθαιιηεξγήζεθαλ ζε 8 ml Yeast Malt Broth (YMB), επσάζηεθαλ ζηνπο 30 ν C γηα 5 εκέξεο θαη αλαθηλνχληαλ θαζεκεξηλά γηα 1 ιεπηφ. Μεηά ηελ επψαζε, θχηηαξα ρσξίζηεθαλ κε θπγνθέληξεζε ζε 9000 g γηα 15 ιεπηά. Σα θχηηαξα πιχζεθαλ δχν θνξέο ζε απνζηεηξσκέλν ξπζκηζηηθφ δηάιπκα θσζθνξηθψλ (50 mm / ph 7,0) γηα ηελ απνκάθξπλζε ηνπ κέζνπ θαιιηέξγεηαο θαη ηειηθά επαλαησξήζεθαλ ζε 2 ml ηνπ ίδηνπ απνζηεηξσκέλνπ ξπζκηζηηθνχ. Απηφ ην θπηηαξηθφ ελαηψξεκα ρξεζηκνπνηήζεθε γηα ηνλ πξνζδηνξηζκφ ησλ δξαζηεξηνηήησλ εζηεξάζεο θαη ιηπάζεο κε εκβνιηαζκφ ζε άγαξ πνπ πεξηείρε ηξηβνπηπξίλε (1% w/v) γηα ηελ εζηεξάζε θαη ξνδακίλε - ειαηφιαδν γηα ηε ιηπάζε, ζχκθσλα κε ηηο δηαδηθαζίεο πνπ πεξηγξάθεθαλ απφ ηνπο Hernandez θαη ζπλ. (2007) θαη Rodriguez Gomez θαη ζπλ. (2010). Γηα ηελ ελζσκάησζε ηεο ηξηβνπηπξίλεο ζην ππφζηξσκα ρξεζηκνπνηήζεθε νκνγελνπνηεηήο γηα 30 πεξίπνπ ιεπηά. Μεηά ηνλ εκβνιηαζκφ ησλ ηξπβιίσλ κε 10 κl απφ θάζε ελαηψξεκα δπκψλ, ηα ηξπβιία ηνπνζεηήζεθαλ ζηνπο 37 ν C γηα 48 ψξεο. Ζ δξαζηεξηφηεηα εζηεξάζεο αληρλεχηεθε κε ην ζρεκαηηζκφ κηαο δηαπγνχο δψλεο γχξσ απφ ηηο απνηθίεο. Όζνλ αθνξά ην ππφζηξσκα ξνδακίλεο ειαηνιάδνπ, παξαζθεπάζηεθαλ 1000ml ηνπ βαζηθνχ κέζνπ αλάπηπμεο (8g/L Nutrient Broth - NB, 4 g/l NaCl θαη 10 g/l άγαξ), ελψ 64

83 ρξεζηκνπνηήζεθε επίζεο νκνγελνπνηεηήο γηα ηελ θαιχηεξε αλάκημε ηνπ ειαηνιάδνπ. Σν ειαηφιαδν πνπ ρξεζηκνπνηήζεθε (35ml/L) ήηαλ ππξελέιαην πνιχ ρακειήο νμχηεηαο (0,03%). ηε ζπλέρεηα, έγηλε ξχζκηζε ηνπ ph ηνπ ππoζηξψκαηνο ζην 7.0. θαη αθνινχζεζε απνζηείξσζε. Μεηά ηελ απνζηείξσζε, ζην ππφζηξσκα πξνζηέζεθαλ 10 ml ηνπ δηαιχκαηνο ξνδακίλεο (0,01%0), απνζηεηξσκέλνπ κε δηήζεζε (0,22 κm). Μεηά ηνλ εκβνιηαζκφ ησλ ηξπβιίσλ κε 10 κl απφ θάζε ελαηψξεκα δπκψλ, ηα ηξπβιία ηνπνζεηήζεθαλ ζηνπο 37 ν C γηα 48 ψξεο. Γηα ηελ αλίρλεπζε ηεο δξαζηεξηφηεηαο ιηπάζεο, έγηλε παξαηήξεζε ησλ ηξπβιίσλ κε ππεξηψδεο θσο ζηα 350 nm. Ζ δξαζηεξηφηεηα ιηπάζεο αληρλεχηεθε κε ην ζρεκαηηζκφ κηαο θζνξίδνπζαο θσηεηλήο δψλεο γχξσ απφ ηηο απνηθίεο Γξαζηεξηόηεηα πνιπγαιαθηνπξνλάζεο Γηα λα ειεγρζεί ε δξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο, πνζφηεηα θαιιηέξγεηαο κεηαθεξφηαλ κε θξίθν εκβνιηαζκνχ ζε ηξπβιία κε ππφζηξσκα, πνπ πεξηείρε 12,5 g/l πνιπγαιαθηνπξνληθφ νμχ, 6,8 g/l θσζθνξηθφ θάιην (ph 3,5), 6,7 g/l Yeast Nitrogen Base (ΤΝΒ), 10 g/l γιπθφδε θαη 20 g/l άγαξ. Σα ηξπβιία ηνπνζεηνχληαλ γηα επψαζε ζηνπο 25 ν C γηα 3 εκέξεο. Γηαπγήο δψλε γχξσ απφ ηελ αλάπηπμε ησλ δπκψλ δειψλεη δξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο (Charoenhai et al., 1997) Γξαζηεξηόηεηα β γιπθνζηδάζεο Γηα λα ειεγρζεί ε δξαζηεξηφηεηα β-γιπθνζηδάζεο, πνζφηεηα θαιιηέξγεηαο κεηαθεξφηαλ κε θξίθν εκβνιηαζκνχ ζε ηξπβιία κε ππφζηξσκα, πνπ πεξηείρε 6,7 g/l Yeast Nitrogen Base (ΤΝΒ), 5 g/l εζθνπιίλε θαη 20 g/l άγαξ. Σν ππφζηξσκα πεξηείρε επίζεο 20ml/L ελφο απνζηεηξσκέλνπ δηαιχκαηνο 1% (w/v) ηξηζζελνχο ζηδήξνπ θηηξηθνχ ακκσλίνπ, ην νπνίν πξνζηέζεθε κεηά ηελ ξχζκηζε ηνπ ph ζην 5,0 θαη ηελ απνζηείξσζε ηνπ κέζνπ. Σα ηξπβιία ηνπνζεηνχληαλ γηα επψαζε ζηνπο 25 ν C γηα 8 εκέξεο. Έλα κε εκβνιηαζκέλν ηξπβιίν ρξεζηκνπνηήζεθε σο κάξηπξαο. ηειέρε κε δξαζηεξηφηεηα β- γιπθνζηδάζεο πδξνιχνπλ ηελ εζθνπιίλε θαη έλα ζθνχξν θαθέ ρξψκα αλαπηχζζεηαη ζην άγαξ (Rosi et al., 1994). 65

84 Σαπηνπνίεζε επηθξαηνύζαο κηθξνρισξίδαο κε κνξηαθέο κεζόδνπο Aπνκόλσζε DNA Γηα ηελ απνκφλσζε ηνπ DNA ησλ θπηηάξσλ 30 ζηειερψλ δπκψλ ( , , ) πνπ απνκνλψζεθαλ απφ δείγκαηα 0, 2 θαη 5 εκεξψλ δχκσζεο αληίζηνηρα (2 νο πεξηέθηεο ή επαλάιεςε) θαη κεηά απφ αλαθαιιηέξγεηα ησλ ζηειερψλ γηα 48 ψξεο ζηνπο 21 ν C ζε Τeast Malt Broth (YMB) θαη ρξεζηκνπνηψληαο ζηήιεο κε κεκβξάλεο ππξηηίνπ, έιαβαλ ρψξα νη παξαθάησ δηαδηθαζίεο (Ηnvitrogen PureLink Genomic DNA kit): 1) Ρχζκηζε δχν πδαηφινπηξσλ ζηνπο 37 ν C θαη 55 o C, αληίζηνηρα. 2) Παξαζθεπή θξέζθνπ ξπζκηζηηθνχ δηαιχκαηνο δπκνιάζεο (Sigma-Aldrich) ζε 1Μ ζνξβηηφιε, 10 mm ΔDTA λαηξίνπ (sodium EDTA) θαη 14 mm β- κεξθαπηναηζαλφιε. 3) Γηάιπζε ησλ θπηηάξσλ ζε 500 κl ξπζκηζηηθνχ δηαιχκαηνο δπκνιάζεο, πξνζζήθε 15 κνλάδσλ (7,5 units /κl) ηνπ ελδχκνπ δπκνιάζε (ιπηηθάζε) θαη επψαζε ζηνπο 37 ν C γηα 1 ψξα. 4) Φπγνθέληξεζε ζε 3000 g γηα 10 ιεπηά ζε ζεξκνθξαζία δσκαηίνπ γηα ηελ θαηαθξήκληζε ησλ ζθαηξνπιαζηψλ θαη απφξξηςε ηνπ ππεξθεηκέλνπ. 5) Δπαλαδηάιπζε ησλ ζθαηξνπιαζηψλ ζε 180κl ξπζκηζηηθνχ δηαιχκαηνο πέςεο, πξνζζήθε 20 κl πξσηετλάζεο Κ θαη θαιή αλάκημε (vortexing). 6) Δπψαζε ζηνπο 55 ν C γηα 45 ιεπηά. 7) Πξνζζήθε 20 κl RNase A ζην δηάιπκα, ζχληνκε αλάκημε θαη επψαζε ζε ζεξκνθξαζία δσκαηίνπ γηα 2 ιεπηά. 8) Πξνζζήθε 200κl ξπζκηζηηθνχ δηαιχκαηνο ιχζεο/δέζκεπζεο γελσκηθνχ (Genomic Lysis/Binding Buffer) θαη ζχληνκε αλάκημε γηα ηελ απφθηεζε ελφο νκνηνγελνχο ππεξθείκελνπ δηαιχκαηνο. Σν ηειεπηαίν νπζηαζηηθά πεξηέρεη DNA θαη ζπζηαηηθά θπηηαξηθνχ ηνηρψκαηνο, αθνχ κεηά ηελ θαηεξγαζία κε ηνπο ζαπσλνπνηεηέο έρνπλ θαηαζηξαθεί ε θπηηαξηθή θαη ε ππξεληθή κεκβξάλε. 9) Πξνζζήθε 200κl αηζαλφιεο % ζην δηάιπκα θαη θαιή αλάκημε κέζσ vortexing γηα 5 δεπηεξφιεπηα γηα ηελ παξαγσγή ελφο νκνηνγελνχο δηαιχκαηνο. Ζ αιθνφιε πξνζηίζεηαη πξνθεηκέλνπ λα εληζρχζεη ηε δέζκεπζε ηνπ DNA ζηηο κεκβξάλεο ππξηηίνπ. 66

85 Μεηά ην ηέινο ησλ παξαπάλσ ελεξγεηψλ αθνινχζεζαλ γξήγνξα νη δηαδηθαζίεο δέζκεπζεο ηνπ DNA φπσο απηέο θαίλνληαη παξαθάησ: 1) Σνπνζέηεζε κηαο ζηήιεο πεξηζηξνθήο (spin column) ζε έλα ζσιήλα ζπιινγήο (collection tube) απφ ηε ζπζθεπαζία. 2) Πξνζζήθε ηνπ δηαιχκαηνο (πεξίπνπ 640 κl) πνπ παξαζθεπάζηεθε κε ξπζκηζηηθφ δηάιπκα ιχζεο/δέζκεπζεο γελσκηθνχ θαη αηζαλφιε ζηε ζηήιε πεξηζηξνθήο. 3) Φπγνθέληξεζε ηεο ζηήιεο ζηηο g γηα έλα ιεπηφ ζε ζεξκνθξαζία δσκαηίνπ. 4) Απφξξηςε ηνπ ζσιήλα ζπιινγήο θαη ηνπνζέηεζε ηεο ζηήιεο πεξηζηξνθήο ζε έλα θαζαξφ ζσιήλα ζπιινγήο, πνπ παξέρεηαη καδί κε ην θηη. Σν επφκελν ζηάδην αθνξνχζε ην πιχζηκν ηνπ DNA κέζσ ησλ παξαθάησ δηαδηθαζηψλ: 1) Πξνζζήθε 500κl ηνπ πξψηνπ ξπζκηζηηθνχ δηαιχκαηνο πιχζεο ζηε ζηήιε. 2) Φπγνθέληξεζε ηεο ζηήιεο ζε ζεξκνθξαζία δσκαηίνπ ζε g γηα έλα ιεπηφ. 3) Απφξξηςε ηνπ ζσιήλα ζπιινγήο θαη ηνπνζέηεζε ηεο ζηήιεο ζε έλα θαζαξφ ζσιήλα ζπιινγήο παξερφκελν απφ ην θηη. 4) Πξνζζήθε 500 κl ηνπ δεχηεξνπ ξπζκηζηηθνχ δηαιχκαηνο πιχζεο ζηε ζηήιε. 5) Φπγνθέληξεζε ηεο ζηήιεο ζε κέγηζηε ηαρχηεηα γηα 3 ιεπηά ζε ζεξκνθξαζία δσκαηίνπ θαη απφξξηςε ηνπ ζσιήλα ζπιινγήο. Μεηά θαη ηε νινθιήξσζε ηνπ πιπζίκαηνο, αθνινχζεζε ε έθινπζε ηνπ DNA κε: 1) Σνπνζέηεζε ηεο ζηήιεο ζε έλα απνζηεηξσκέλν 1,5 ml ζσιήλα κηθξνθπγνθέληξεζεο. 2) Πξνζζήθε 80 κl ξπζκηζηηθνχ δηαιχκαηνο έθινπζεο γελσκηθνχ ζηε ζηήιε. 3) Δπψαζε ζε ζεξκνθξαζία δσκαηίνπ γηα έλα ιεπηφ θαη θπγνθέληξεζε ηεο ζηήιεο ζε ζεξκνθξαζία δσκαηίνπ ζε g γηα έλα ιεπηφ. O ζσιήλαο πεξηέρεη θαζαξφ γελσκηθφ DNA. Αθνχ νινθιεξψζεθε ε δηαδηθαζία ηεο έθινπζεο, ην θαζαξφ πιένλ DNA απνζεθεχηεθε ζηνπο -20 ν C γηα δηαηήξεζε. 67

86 Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) H αιπζηδσηή αληίδξαζε πνιπκεξάζεο (Polymerase Chain Reaction PCR) ρξεζηκνπνηείηαη, φπσο πξναλαθέξζεθε, γηα ηελ αλαπαξαγσγή ελφο ζπγθεθξηκέλνπ ηκήκαηνο DNA. ηελ παξνχζα εξγαζία θαη ζχκθσλα κε ηνπο Esteve-Zarzoso θαη ζπλ. (1999) θαζψο θαη ηνπο Bautista-Galego θαη ζπλ. (2011), γηα θάζε αληίδξαζε ηειηθνχ φγθνπ 50 κl ρξεζηκνπνηήζεθαλ κl δηο απεζηαγκέλν λεξφ, 5 κl buffer 10X, 0.75 κl ΜgCl 2 (100mM), 2 κl dntps mix (40 mm), 2 κl απφ θάζε πξηκνδφηε, 0.5 κl Taq πνιπκεξάζεο (Δηαηξεία Bioron) θαη 1 κl DNA (100 ng). Γηα ηελ ελίζρπζε ηεο 5.8S-ITS πεξηνρήο, ρξεζηκνπνηήζεθαλ νη πξηκνδφηεο (primers) ITS 1 θαη ITS 4 (White et al., 1990). Δηθόλα 4.2. Α) Σν δεχγνο ησλ πξηκνδνηψλ (primers) πνπ ρξεζηκνπνηήζεθε Β) rrna γνλίδηα πνπ δείρλνπλ ηε ζέζε ησλ πξηκνδνηψλ ITS1 θαη ITS4 (White et al., 1990). Ζ αλαπαξαγσγή ηνπ ζπγθεθξηκέλνπ ηκήκαηνο DNA έγηλε ζε ζεξκνθπθινπνηεηή (Αpplied Biosystems 2720 Thermal Cycler) κε ην παξαθάησ πξφγξακκα: Αξρηθή απνδηάηαμε - denaturation κε 2 ιεπηά ζηνπο 94 ν C θαη ζηε ζπλέρεηα 30 θχθινη κε 15 δεπηεξφιεπηα ζηνπο 94 ν C (ηειηθή απνδηάηαμε), 30 δεπηεξφιεπηα ζηνπο 56 ν C (πβξηδηζκφο ή ζχλδεζε πξηκνδνηψλ - annealing) θαη 1 ιεπηφ ζηνπο 72 ν C (αξρηθή επέθηαζε extension). Ζ ηειηθή επέθηαζε (extension) έγηλε γηα 7 ιεπηά ζηνπο 72 ν C. 68

87 ηε ζπλέρεηα αθνινχζεζε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο 1.5% ζηα V γηα 30 ιεπηά πεξίπνπ, γηα λα εμαζθαιηζηεί ν δηαρσξηζκφο ησλ δίθισλσλ κνξίσλ DNA (ζηεξίδεηαη ζην γεγνλφο φηη ηα πεξηζζφηεξα καθξνκφξηα είλαη ειεθηξηθά θνξηηζκέλα θαη φηαλ βξεζνχλ ζε έλα ειεθηξηθφ πεδίν θηλνχληαη κε ηαρχηεηα πνπ εμαξηάηαη απφ ηε ζρέζε ηνπ ειεθηξηθνχ ηνπο θνξηίνπ πξνο ηε κάδα ηνπο). Ζ θσηνγξάθεζε ηεο πεθηήο έγηλε κε ηε ρξήζε ππεξηψδνπο αθηηλνβνιίαο Ultravue transilluminator 312 nm (Uvitec) κέζσ ηνπ ςεθηαθνχ ζπζηήκαηνο απεηθφληζεο KODAK EPAS 290 θαη ε επεμεξγαζία ησλ εηθφλσλ κε ην ινγηζκηθφ 1D Image Analysis Software Version Πνιπκνξθηζκόο κήθνπο ζξαύζκαηνο από έλδπκν πεξηνξηζκνύ γελσκηθνύ DNA (RFLP). ε απηφ ην πείξακα πξαγκαηνπνηήζεθαλ πέςεηο κε 3 δηαθνξεηηθά έλδπκα πεξηνξηζκνχ γηα 30 ζηειέρε δπκψλ. Πίλαθαο 4.2. πζηαηηθά ησλ αληηδξάζεσλ πέςεο κε ηα έλδπκα πεξηνξηζκνχ EcoRI, HaeIII θαη HinfI. Τιηθά EcoRI HaeIII HinfI ddh 2 O 11.7 κl 22.6 κl κl Βuffer (NEB3) 1.5 κl 3 κl 2.5 κl Έλδπκν 1 κl 2 κl 0.15 κl DNA 0.8 κl (ng) 2.4 κl (ng) 2.5 κl (ng) Όγθνο αληίδξαζεο 15 κl 30 κl 25 κl Oη ζπλζήθεο γηα φιεο ηηο αληηδξάζεηο ήηαλ 1ψξα θαη 45ιεπηά επψαζε ζηνπο 37 ν C. ηε ζπλέρεηα αθνινχζεζε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο 2.5% ζηα V γηα 1 ψξα πεξίπνπ. Ζ θσηνγξάθεζε ηεο πεθηήο έγηλε φπσο θαη ζηελ PCR. Θέσεης αλαγλώρησες τωλ ελδύκωλ χκθσλα κε ην πξφγξακκα Nebcutter, ηα ηκήκαηα πνπ πξνθχπηνπλ κεηά ηελ πέςε ηνπ γνληδίνπ 5.8S rrna κε ηα έλδπκα EcoRI, HaeIII θαη HinfI, φπσο θαη νη ζέζεηο αλαγλψξηζεο ησλ αιιεινπρηψλ βάζεσλ γηα ζηειέρε 841 βάζεσλ θαη γηα ζηειέρε 425 βάζεσλ θαίλνληαη ζηνπο Πίλαθεο 4.3. θαη

88 Πίλαθαο 4.3. Οη ζέζεηο αλαγλψξηζεο αιιεινπρηψλ βάζεσλ θαζψο θαη ηα ηκήκαηα πνπ πξνθχπηνπλ κεηά ηελ πέςε ηνπ γνληδίνπ 5.8S rrna κε ηα έλδπκα EcoRI, HaeIII θαη HinfI ζχκθσλα κε ην πξφγξακκα Nebcutter γηα ζηειέρε 841 δεπγψλ βάζεσλ (bp) (http://www.neb.uk.com/tools/index.aspx?req=nebcutter) Έλδπκν Ποισκορυησκοί θαη κέγεζος αστώλ (οη ζέσεης αλαγλώρησες σε παρέλζεσε) EcoRI 363 bp,478 bp (478 bp) HaeIII 132 bp, 172 bp, 226 bp, 311bp (132 bp 304 bp 615 bp) HinfI 8 bp, 120 bp, 351 bp, 362 bp (120 bp 482 bp bp) Πίλαθαο 4.4. Οη ζέζεηο αλαγλψξηζεο αιιεινπρηψλ βάζεσλ θαζψο θαη ηα ηκήκαηα πνπ πξνθχπηνπλ κεηά ηελ πέςε ηνπ γνληδίνπ 5.8S rrna κε ηα έλδπκα EcoRI, HaeIII θαη HinfI ζχκθσλα κε ην πξφγξακκα Nebcutter γηα ζηειέρε 425 δεπγψλ βάζεσλ (bp) (http://www.neb.uk.com/tools/index.aspx?req=nebcutter) Έλδπκν Ποισκορυησκοί θαη κέγεζος αστώλ (οη ζέσεης αλαγλώρησες σε παρέλζεσε) EcoRI Γελ πέπηεη ην γνλίδην 5.8S rrna HaeIII 115 bp, 310 bp (115 bp) HinfI 82 bp, 162 bp, 181 bp (162 bp 244 bp) Αλάιπζε αθνινπζίαο (Sequence analysis) Σα 30 ζηειέρε δπκψλ ρσξίζηεθαλ, φπσο πξναλαθέξζεθε, ζε 6 νκάδεο κε βάζε α) ηηο βηνρεκηθέο ηνπο ηδηφηεηεο θαη β) ηα απνηειέζκαηα ηεο PCR θαη ηεο RFLP. Έλαο αληηπξφζσπνο απφ θάζε νκάδα επηιέρζεθε ηπραία λα ζηαιεί γηα αλάιπζε αθνινπζίαο (sequence analysis ή sequencing). Μεηά ηελ ελίζρπζε ηνπ επηιεγκέλνπ ηκήκαηνο ηνπ DNA κε ηελ ηερληθή ηεο PCR, έγηλε θαζαξηζκφο ησλ πξντφλησλ κε ηε ρξήζε ηνπ QIAquick PCR Purification kit Protocol (QIAGEN) σο εμήο: 1. Πξνζζήθε πεληαπιάζηνπ φγθνπ (200κl) ξπζκηζηηθνχ δηαιχκαηνο (buffer PBI) ζε θάζε πξντφλ ηεο PCR (40 κl). Σν ξπζκηζηηθφ απηφ δηάιπκα εληζρχεη ηελ πξνζθφιιεζε ηνπ DNA ζηε ζηήιε. 2. Έιεγρνο ηνπ ρξψκαηνο κέζα ζε θάζε ζηήιε. Θα πξέπεη λα είλαη θίηξηλν, φκνην δειαδή κε ην ρξψκα ηνπ ξπζκηζηηθνχ δηαιχκαηνο PBI. Γηαθνξεηηθά ξπζκίδεηαη κε πξνζζήθε νμηθνχ λαηξίνπ. 70

89 3. Φπγνθέληξεζε γηα 1 ιεπηφ. 4. Απφξξηςε ηνπ ππεξθεηκέλνπ απφ ηηο ζηήιεο, αθνχ ην DNA έρεη πξνζθνιιεζεί. 5. Πξνζζήθε ζε θάζε ζηήιε 750 κl ξπζκηζηηθνχ δηαιχκαηνο πιχζεο (wash buffer) θαη θπγνθέληξεζε γηα 1 ιεπηφ. 6. Απφξξηςε ηνπ ππεξθεηκέλνπ θαη επαλαθπγνθέληξεζε γηα 1 ιεπηφ γηα λα ζηεγλψζεη ην DNA (λα θχγεη ε αηζαλφιε). 7. Πξνζζήθε 35 κl ξπζκηζηηθνχ δηαιχκαηνο έθινπζεο (elution buffer) ζε θάζε ζηήιε θαη κεηά ηελ πάξνδν ελφο ιεπηνχ γίλεηαη θπγνθέληξεζε. 8. Παξαιαβή ηειηθά 35 κl θαζαξηζκέλνπ DNA απφ ην θάζε ζηέιερνο. Αθνινχζσο, 10 κl απφ ην θαζαξηζκέλν DNA θάζε ζηειέρνπο ζηάιζεθαλ γηα αλάιπζε αθνινπζίαο ζην εξεπλεηηθφ θέληξν CEMIA (CEllular and Molecular Immunological Applications) πνπ εδξεχεη ζηελ πεξηνρή ηεο Λάξηζαο, καδί κε 30 κl απφ θάζε πξηκνδφηε (primers ITS1 θαη ΗTS4). ηε ζπλέρεηα, νη αιιεινπρίεο (ηα απνηειέζκαηα αιιεινχρεζεο) ζπγθξίζεθαλ γηα ηελ εχξεζε νκνινγίαο κε ηα ζηνηρεία ηεο βάζεο δεδνκέλσλ ηεο Σξάπεδαο γελεηηθνχ πιηθνχ ηνπ Δζληθνχ Κέληξνπ Βηνηερλνινγηθψλ Δθαξκνγψλ (ΝCBI) (Βethesda, Maryland, USA) (www.ncbi ) κε ηε ρξήζε ηνπ αιγφξηζκνπ BLAST. Oη αιιεινπρίεο ησλ λνπθιενηηδίσλ πνπ απνθηήζεθαλ ζε απηή ηελ εξγαζία απνζεθεχηεθαλ ζηελ παξαπάλσ βάζε δεδνκέλσλ κε ζπγθεθξηκέλνπο θσδηθνχο αξηζκνχο Μειέηε θπζηθνρεκηθώλ ραξαθηεξηζηηθώλ θαηά ηε δηάξθεηα ηεο δύκσζεο Πξνζδηνξηζκόο ph Ζ κέηξεζε ηνπ ph έγηλε κε απεπζείαο εκβάπηηζε ηνπ ειεθηξνδίνπ ζην κέζν ηνπ δείγκαηνο κε ηαπηφρξνλε ηνπνζέηεζε ηνπ ζεξκνκέηξνπ γηα κέηξεζε ηεο ζηηγκηαίαο ζεξκνθξαζίαο κε ειεθηξφδην πάινπ (ph meter Crison GLP 21 + ) Πξνζδηνξηζκόο πγξαζίαο Γηα ηνλ πξνζδηνξηζκφ ηεο πγξαζίαο ησλ OMWs ρξεζηκνπνηήζεθε ε κέζνδνο ηεο μήξαλζεο. Ζ κέζνδνο απηή, ε νπνία είλαη έκκεζε, ζηεξίδεηαη ζηνλ πξνζδηνξηζκφ ηεο εθαηνζηηαίαο απψιεηαο ηνπ βάξνπο ηνπ δείγκαηνο είηε κεηά απφ έλα θαζνξηζκέλν ρξνληθφ δηάζηεκα είηε κέρξη επίηεπμεο ζηαζεξνχ βάξνπο, φπσο ζπκβαίλεη ζηελ παξνχζα 71

90 εξγαζία. Θεσξείηαη φηη έρεη επηηεπρζεί ζηαζεξφ βάξνο φηαλ ε δηαθνξά κεηαμχ δχν δηαδνρηθψλ μεξάλζεσλ, ρξνληθνχ δηαζηήκαηνο 1h, είλαη κηθξφηεξε ησλ 2 mg (Karmas et al., 1988). Aξρηθά 3 g δείγκαηνο ηνπνζεηήζεθαλ ζε πξνδπγηζκέλε θάςα ζε δπγφ αθξηβείαο Denver instrument MXX-612 (Colorado, USA). H ηειεπηαία καδί κε ην δείγκα ηνπνζεηήζεθαλ ζε θιίβαλν (Sanyo Gallenkamp BR185HNI/NCC) ζε ζεξκνθξαζία 80 ν C κέρξη ηελ επίηεπμε ζηαζεξνχ βάξνπο. Αθνινχζσο, ην δείγκα αθέζεθε λα ςπρζεί ζε μεξαληήξα κε επαξθή πνζφηεηα CaCO 2 γηα 30 min γηα λα κελ επαλαπξνζιάβεη πγξαζία. ηε ζπλέρεηα, αθνινχζεζε δχγηζε ηνπ δείγκαηνο καδί κε ηελ θάςα. Ζ πεξηεθηηθφηεηα ζε πγξαζία ππνινγίζηεθε απφ ηελ παξαθάησ εμίζσζε: Όπνπ m θ : βάξνο θελήο θάςαο (g) m δ m η : βάξνο δείγκαηνο (g) : βάξνο δείγκαηνο θαη θάςαο κεηά ηε μήξαλζε (g) Πξνζδηνξηζκόο νιηθώλ θαηλνιηθώλ ελώζεσλ Γηα ηνλ πξνζδηνξηζκφ ησλ νιηθψλ θαηλνιηθψλ ελψζεσλ ζην OMWs ρξεζηκνπνηήζεθε ε κέζνδνο Folin-Ciocalteu (Skerget et al., 2005). Ζ κέζνδνο απηή ζηεξίδεηαη ζε αληίδξαζε νμεηδναλαγσγήο κε νμεηδσηηθφ παξάγνληα ην αληηδξαζηήξην Folin-Ciocalteu θαη ε ζπγθέληξσζε ησλ θαηλνιηθψλ ελψζεσλ πξνζδηνξίδεηαη θαζκαηνθσηνκεηξηθά. πγθεθξηκέλα, 1 gr δείγκαηνο εθρπιίζηεθε κε 10 ml εθρπιηζηηθνχ κέζνπ (80% κεζαλφιε). Σν κίγκα αλαθηλήζεθε ζε αλαθηλεηή Heidolph MRІІ (Γεξκαλία) γηα 30min. Αθνινχζεζε δηήζεζε εληφο θσληθήο θηάιεο. Σν ππφιεηκκα επαλεθρπιίζηεθε κε ηελ παξαπάλσ δηαδηθαζία γηα άιια 30 min θαη ην λέν δηήζεκα πξνζηέζεθε ζην αξρηθφ, ψζηε ν ηειηθφο φγθνο ήηαλ 20 ml. ηε ζπλέρεηα, ην αληηδξαζηήξην Folin-Ciocalteu αξαηψζεθε ζε αλαινγία 1:10 κε απεζηαγκέλν λεξφ θαη ζε 2,5 ml αξαησκέλνπ αληηδξαζηεξίνπ πξνζηέζεθαλ 250 κl εθρπιίζκαηνο θαη 250 κl απεζηαγκέλνπ λεξνχ. Μεηά απφ 30 s (ην αξγφηεξν κέρξη 8 min) πξνζηέζεθαλ 2 ml δηαιχκαηνο Na 2 CO 3 (75 g/l) θαη ην κίγκα αλαδεχηεθε θαη 72

91 Απορρόυηση στα 760 nm ηνπνζεηήζεθε ζε πδαηφινπηξν ζηνπο 50 ν C γηα 5 min. Μεηά ηε ςχμε ηνπ κίγκαηνο κεηξήζεθε ε απνξξφθεζή ηνπ ζηα 760 nm ζε θαζκαηνθσηφκεηξν (ULTROSPEC II LKB BIOCHROM - USA). Χο κάξηπξαο ρξεζηκνπνηήζεθε δηάιπκα πνπ ζηε ζέζε ησλ 250 κl εθρπιίζκαηνο πξνζηέζεθαλ 250 κl απεζηαγκέλνπ λεξνχ. Οη ηηκέο απνξξφθεζεο ηνπ κίγκαηνο (εθρχιηζκα & αληηδξαζηήξην) αληηζηνηρίζηεθαλ κε mg ηζνδχλακνπ γαιιηθνχ νμένο (mg GAE) κε ηε βνήζεηα ηεο εμίζσζεο ηεο θακπχιεο αλαθνξάο δηαιπκάησλ γαιιηθνχ νμένο γλσζηψλ ζπγθεληξψζεσλ (y =0,0002x-0,0006, R 2 =0,9845) (ρήκα 4.1). Οη ζπγθεληξψζεηο ησλ δηαιπκάησλ απηψλ ήηαλ 1000 mg/l, 833,3 mg/l, 666,6 mg/l, 500 mg/l, 333,33 mg/l, 166,66 mg/l θαη 90,9 mg/l. 0,3 0,25 0,2 0,15 0,1 0,05 0 Kαμπύλη αναυοράς GA y = 0,0002x - 0,0006 R² = 0, μg GA/ml ρήκα 4.1. Κακπχιε αλαθνξάο δηαιπκάησλ γαιιηθνχ νμένο γλσζηψλ ζπγθεληξψζεσλ Σα απνηειέζκαηα εθθξάζηεθαλ σο mg ηζνδχλακνπ GAE αλά g λσπνχ βάξνπο, κε ηε βνήζεηα ηεο παξαθάησ εμίζσζεο: Όπνπ V : φγθνο ηνπ εθρπιίζκαηνο (ml) 20 : ηειηθφο φγθνο εθρπιίζκαηνο (ml) m : βάξνο δείγκαηνο (g) GAE mg :ηηκέο ηνπ γαιιηθνχ νμένο απφ ηελ θακπχιε αλαθνξάο Σειηθά, κε δεδνκέλε ηελ πγξαζία ησλ δεηγκάησλ, ηα θαηλνιηθά εθθξάζηεθαλ σο mg γαιιηθνχ νμένο / g μεξνχ βάξνπο. 73

92 Πξνζδηνξηζκόο νιηθήο νμύηεηαο Γηα ηνλ πξνζδηνξηζκφ ηεο νμχηεηαο εθαξκφζζεθε ε κέζνδνο εμνπδεηέξσζεο κε θαλνληθφ δηάιπκα βάζεο (AOAC, 1990). Αξρηθά, 20 gr δείγκαηνο ΟΜWs νκνγελνπνηήζεθαλ κε 60 ml απεζηαγκέλν λεξφ θαη δηεζήζεθαλ κε απιφ δηεζεηηθφ ραξηί. Ο πξνζδηνξηζκφο ηεο νιηθήο νμχηεηαο ζην κέζν πξαγκαηνπνηήζεθε ζε 10 ml ηνπ δηεζήκαηνο, κεηά απφ πξνζζήθε 3-4 ζηαγφλσλ ρξσκαηηθνχ δείθηε θαηλνινθζαιεΐλεο θαη ηηηινδφηεζε κε αιθαιηθφ δηάιπκα 0,1 Ν NaΟΖ κέρξη ηελ αιιαγή ηνπ ρξψκαηνο ηνπ δείθηε ζε ξνδ ρξνηά πνπ δηαηεξήζεθε γηα πεξίπνπ 30 sec. Ζ αιιαγή απηή είλαη απνηέιεζκα ηεο εμνπδεηέξσζεο ηεο νιηθήο ειεχζεξεο νμχηεηαο, δειαδή ην ζχλνιν ησλ ειεχζεξσλ θαξβνμπινκάδσλ ησλ νμέσλ, πνπ πεξηέρνληαη ζην δηάιπκα. Αθνινχζεζε ν ππνινγηζκφο ηεο % νιηθήο νμχηεηαο ζε νμηθφ νμχ κε βάζε ηα ml ηνπ δηαιχκαηνο NaOH πνπ θαηαλαιψζεθαλ, ηελ θαλνληθφηεηα ηνπ δηαιχκαηνο NaOH, ην Μ.Β. ηνπ νμηθνχ νμένο θαη ην βάξνο ηνπ δείγκαηνο, ε νπνία εθθξάζηεθε σο εμήο: Πξνζδηνξηζκόο δηαιπηώλ ζηεξεώλ ζπζηαηηθώλ Ο πξνζδηνξηζκφο ζηεξίρζεθε δειαδή ζηελ δηάζιαζε πνπ πθίζηαηαη κηα θσηεηλή δέζκε, φηαλ δηέξρεηαη απφ έλα δηαθαλέο πγξφ θαη ζηελ αληηζηνηρία ηνπ δείθηε δηάζιαζεο θαη ηεο πεξηεθηηθφηεηαο ηνπ πγξνχ ζε δηαιπηά ζηεξεά ζπζηαηηθά. Ζ δηαδηθαζία πνπ αθνινπζήζεθε έρεη σο εμήο: ε δηαζιαζίκεηξν ηχπνπ Abbe (REICHERT MARK II PLUS / Γεξκαλία) θαζαξίζηεθαλ ηα πξίζκαηα κε βακβάθη εκπνηηζκέλν κε αιθνφιε. ηε ζπλέρεηα έγηλε αξαίσζε ηνπ δείγκαηνο κε λεξφ ζε αλαινγία 1:1. ην θάησ πξίζκα ηνπνζεηήζεθαλ 2 ζηαγφλεο δείγκαηνο θαη θαιχθζεθαλ κε ην επάλσ πξίζκα ψζηε ηα 2 πξίζκαηα λα βξίζθνληαη ζε άκεζε επαθή. Αθνινχζσο, κεηαθηλήζεθε ε θσηεηλή δέζκε ψζηε λα θσηίδεη ηελ θιίκαθα ηνπ νξγάλνπ. Απφ ηε δηφπηξα παξαηεξήζεθε ην νπηηθφ πεδίν θαη ε δηφπηξα κεηαθέξζεθε έηζη ψζηε ε ραξαγκέλε ζην πξίζκα δηαθεθνκκέλε γξακκή λα ζπκπέζεη κε ηε γξακκή δηαρσξηζκνχ ηνπ θσηεηλνχ απφ ην ζθνηεηλφ πεδίν. ηελ αξηζηεξή πιεπξά ηεο θιίκαθαο έγηλε ε αλάγλσζε ησλ βαζκψλ δηαζιαζηκέηξνπ ζε κνλάδεο δείθηε δηαζιάζεσο. 74

93 Παξαζθεπή θαη νξγαλνιεπηηθόο έιεγρνο πξντόληνο ηύπνπ πάζηαο ειηάο Δλζσκάησζε NaCl 6% Έρεη δηαπηζησζεί βηβιηνγξαθηθά φηη νη θαιχηεξεο ζπλζήθεο γηα ηε δχκσζε ησλ επηηξαπέδησλ ειηψλ είλαη 25 ν C θαη 6% αιάηη (Panagou et al., 2008), πξνθεηκέλνπ ηφζν λα εκπνδηζηεί ε αλάπηπμε άιισλ κηθξννξγαληζκψλ πέξαλ απηψλ πνπ είλαη ππεχζπλνη γηα ηε δχκσζε φζν θαη λα εμαζθαιηζηεί ε ζπληήξεζε ηνπ πξντφληνο Έθπιπζε ηνπ πιηθνύ Μεηά ηελ πάξνδν 14 εκεξψλ θαη ηελ νινθιήξσζε ηεο δηαδηθαζίαο εθπίθξαλζεο, αθνινχζεζε απνκάθξπλζε ηνπ ρισξηνχρνπ λαηξίνπ πνπ είρε πξνζξνθεζεί απφ ηνλ πνιηφ ειηάο OMW κε έθπιπζε κε ηξερνχκελν λεξφ. Λφγσ ηεο ζπαηάιεο λεξνχ ζηηο βηνκεραλίεο επεμεξγαζίαο ειηψλ, έγηλε ε πξνζπάζεηα απνκάθξπλζε ηνπ NaCl απφ ηνλ πνιηφ ειηάο κε φζν ην δπλαηφλ κηθξφηεξε θαηαλάισζε λεξνχ. Σν δείγκα ηνπνζεηήζεθε ζε θφζθηλν. Ζ ηξνθνδνζία λεξνχ έγηλε απφ ην πάλσ θφζθηλν ζε αλαινγία 1:5. πιιέρζεθε ην θιάζκα πνπ εθπιχζεθε θαη δπγίζηεθε ην ελαπνκείλαλ θιάζκα γηα ηνλ ππνινγηζκφ ησλ απσιεηψλ. Αθνινχζεζε κέηξεζε % Brix ζε δηαζιαζίκεηξν εσο φηνπ θηάζεη ζηελ επηζπκεηή ηηκή < 0,5% κε δηαδνρηθά μεπιχκαηα Παξαζθεπή πξντόληνο ηύπνπ πάζηαο ειηάο Μεηά ηελ εθπίθξαλζε ηνπ δπκνχκελνπ OMWs θαη ηελ έθπιπζή ηνπ κε λεξφ, ηα ζηάδηα πνπ αθνινπζήζεθαλ γηα ηελ παξαζθεπή πξντφληνο ηχπνπ πάζηαο ειηάο νκνηάδνπλ κε ηα ζηάδηα παξαγσγήο πάζηαο απφ επεμεξγαζκέλεο ειηέο θαη είλαη: α) Καζαξηζκφο θαη πξνζζήθε πξφζζεησλ πιψλ β) Αλάκημε πνιηνχ ειηάο θαη πξφζζεησλ πιψλ γ) Καζαξηζκφο πεξηεθηψλ θαη ηνπνζέηεζε ηνπ κίγκαηνο ζε απηνχο δ) Παζηεξίσζε ε) Φχμε ζη) ηέγλσκα δ) Απνζήθεπζε. Αξρηθά, έγηλε θαζαξηζκφο θαη ιεπηνηεκαρηζκφο ησλ επηκέξνπο πξφζζεησλ ζπζηαηηθψλ. Αθνινχζεζε αλάκημε ησλ ζπζηαηηθψλ κε ηνλ πνιηφ ειηάο OMWs, φπσο απηφο είρε πξνθχςεη απφ ηε δηαδηθαζία ηεο εθπίθξαλζεο θαη ηεο έθπιπζεο κε λεξφ. Παξφκνηα δηαδηθαζία αθνινπζήζεθε θαη γηα ηελ παξαζθεπή πάζηαο ειηάο απφ επηηξαπέδηεο ειηέο (πνηθηιία Υνλδξνιηά Υαιθηδηθήο) πνπ ζπιιέρζεθαλ απφ ην Αγξφθηεκα ηνπ Α.Π.Θ. (ζε ζηάδην ζπιιεθηηθήο σξηκφηεηαο παξφκνην κε απηφ ησλ θαξπψλ πνπ επεμεξγάζηεθαλ ζην ειαηνπξγείν απφ ην νπνίν έγηλε ε δεηγκαηνιεςεία) θαη 75

94 δηαηεξεκέλεο ζε άικε. Έπεηηα, ηα δείγκαηα ηνπνζεηήζεθαλ ζε κπιέληεξ γηα νκνγελνπνίεζε θαη απφθηεζε νκνηφκνξθεο πθήο. Μεηά ηελ νκνγελνπνίεζε κεηξήζεθε ην ph ησλ πξντφλησλ ζε ειεθηξνληθφ περάκεηξν (ph meter Crison GLP 21 + ) (πάζηα απφ OMWs, πάζηα απφ επηηξαπέδηεο ειηέο θαη πάζηα ειηάο εκπνξίνπ). Σα πξντφληα ηνπνζεηήζεθαλ ζε απνζηεηξσκέλνπο πεξηέθηεο. Δλ ζπλερεία, νη πεξηέθηεο ηνπνζεηήζεθαλ ζε πδαηφινπηξν ζηνπο 85 ν C γηα παζηεξίσζε. Γίλνληαλ κέηξεζε ηεο ζεξκνθξαζίαο ζην θέληξν θάζε πεξηέθηε αλά ηαθηά ρξνληθά δηαζηήκαηα κέρξη ζηαζεξνπνίεζεο ηεο ζεξκνθξαζίαο ζηνπο 85 ν C. Μεηά ηε ζηαζεξνπνίεζε ηεο ζεξκνθξαζίαο, νη πεξηέθηεο αθέζεθαλ ζην πδαηφινπηξν γηα κηζή αθφκε ψξα ψζηε λα παζηεξησζνχλ. Αθνχ νινθιεξψζεθε ε δηαδηθαζία ηεο παζηεξίσζεο, αθνινχζεζε γξήγνξε ςχμε κε ηξερνχκελν λεξφ βξχζεο κέρξηο φηνπ νη πεξηέθηεο λα απνθηήζνπλ ζεξκνθξαζία δσκαηίνπ. Ζ γξήγνξε ςχμε έγηλε γηα ηε δηαηήξεζε ησλ ζξεπηηθψλ ζπζηαηηθψλ ηνπ πξντφληνο. Αθνινχζεζε ηνπνζέηεζή ηνπο ζε ςπγείν ζεξκνθξαζίαο 4 ν C φπνπ θαη δηαηεξήζεθαλ κέρξη ηελ νξγαλνιεπηηθή αμηνιφγεζε. Σα ζπζηαηηθά ησλ πξντφλησλ πνπ παξαζθεπάζηεθαλ αλαθέξνληαη αλαιπηηθά ζηνλ Πίλαθα 4.5. Πίλαθαο 4.5. χζηαζε παζηψλ ειηάο απφ επηηξαπέδηεο ειηέο (πάζηα Α), απφ πνιηφ ειηάο OMWs (πάζηα Β) θαη εκπνξίνπ (πάζηα Γ). Δπί ηηο 100 (%) πζηαηηθά Πάζηα Α Πάζηα Β Πάζηα Γ OMWs Πνιηφο πξάζηλσλ θαη καχξσλ ειηψλ Πνιηφο πξάζηλσλ ειηψλ (εκπνξίνπ) Λάδη 4,7 4,7 4,7 Ξχδη Πηπεξηά Φισξίλεο 7,5 7,5 7,5 Ρίγαλε 0,8 0,8 0,8 χλνιν

95 Οξγαλνιεπηηθόο έιεγρνο Ο νξγαλνιεπηηθφο έιεγρνο ηνπ παξαζθεπαδφκελνπ πξντφληνο έγηλε απφ πξνπηπρηαθνχο θαη κεηαπηπρηαθνχο θνηηεηέο θαζψο θαη απφ δηδαθηηθφ θαη εξγαζηεξηαθφ πξνζσπηθφ ηνπ ηνκέα Δπηζηήκεο θαη Σερλνινγίαο Σξνθίκσλ ηνπ Α.Π.Θ (ζπλνιηθά 15 άηνκα). Ο έιεγρνο αθνξνχζε ηε ζχγθξηζε ησλ πνηνηηθψλ ραξαθηεξηζηηθψλ κεηαμχ ηεο πάζηαο πνπ παξαζθεπάζηεθε απφ ΟΜWs, ηεο πάζηαο πνπ παξαζθεπάζηεθε απφ επηηξαπέδηεο ειηέο ζπιιερζείζεο απφ ην Αγξφθηεκα ηνπ Α.Π.Θ. θαη δηαηεξεκέλεο ζε άικε θαη κηαο πάζηαο ειηάο ηνπ εκπνξίνπ κε παξφκνηα ζπζηαηηθά. Ζ νξγαλνιεπηηθή αμηνιφγεζε πξαγκαηνπνηήζεθε ζε αηνκηθφ ζάιακν πνπ παξείρε ήζπρε θαη άλεηε αηκφζθαηξα. Γηα ην ηεζη απνδνρήο, νη δνθηκαζηέο δεηήζεθαλ λα κπξίζνπλ, λα γεπηνχλ θαη λα θαηαηάμνπλ ηα δείγκαηα κε βάζε ηελ έληαζε ζην ρξψκα, ηε γεχζε, ηε ζπλεθηηθφηεηα, ην ρπκψδεο, ην άξσκα, ηελ νζκή θαη ηελ πηθξάδα. Ζ αμηνιφγεζε ησλ ραξαθηεξηζηηθψλ ησλ ηξηψλ παζηψλ θαη ε ζπλνιηθή απνδνρή εθηίκεζε ηνπο κε επηινγή ηεο πιένλ απνδεθηήο απφ ηνπο δνθηκαζηέο, ήηαλ νη ζηφρνη ηνπ ειέγρνπ. Οη ηξεηο πάζηεο ηνπνζεηήζεθαλ ζε λένπο, θαζαξνχο πεξηέθηεο θαη δφζεθαλ ζηνπο δνθηκαζηέο κε θσδηθέο νλνκαζίεο (A, B, Γ) ρσξίο λα γίλεη γλσζηή ε ζχλζεζε θαη ε πξνέιεπζε ηεο θάζε κίαο. Απφ ηα απνηειέζκαηα πνπ πξνέθπςαλ απφ ηα θπιιάδηα πνπ ζπκπιήξσζαλ νη δνθηκαζηέο, αμηνινγήζεθε ε πιένλ απνδεθηή πάζηα. Οη πάζηεο ζπλνδεχηεθαλ κε θξπγαληέο θαη λεξφ. Γηα ηνλ νξγαλνιεπηηθφ έιεγρν ρξεζηκνπνηήζεθε ε δνθηκή αμηνιφγεζεο κε θιίκαθα, ε νπνία θαηαηάζζεηαη ζηηο πεξηγξαθηθέο κεζφδνπο (Descriptive tests). Οη ηειεπηαίεο πνζνηηθνπνηνχλ ηηο αληηιεπηέο εληάζεηο ησλ νξγαλνιεπηηθψλ ραξαθηεξηζηηθψλ ελφο πξντφληνο. Ζ δνθηκή απηή ρξεζηκνπνηείηαη επξέσο ζηνλ πνηνηηθφ έιεγρν ηξνθίκσλ (Lawless & Heymann, 2010). Απηή ε δνθηκή νλνκάδεηαη αιιηψο Πνζνηηθή Πεξηγξαθηθή Αλάιπζε (Quantitative Descriptive Analysis) ή ελ ζπληνκία QDA (Stone & Sidel, 2004). Oη δηαδηθαζίεο πνπ εθαξκφδνληαη ζηελ παξαπάλσ κέζνδν πξνέξρνληαη απφ ηηο παξαδφζεηο ή ηελ έξεπλα ζπκπεξηθνξάο θαηαλαισηψλ θαη ρξεζηκνπνηνχλ πεηξακαηηθά ζρέδηα θαη ζηαηηζηηθέο αλαιχζεηο, φπσο ε αλάιπζε παξαιιαθηηθφηεηαο. Απηφ εμαζθαιίδεη αλεμάξηεηεο θξίζεηο δνθηκαζηψλ θαη ζηαηηζηηθφ έιεγρν, ζε αληίζεζε κε ηελ νκαδηθή ζπδήηεζε θαη ηηο δηαδηθαζίεο νκνθσλίαο ηεο κεζφδνπ πξνθίι γεχζεο (Lawless 77

96 & Heymann, 2010). Ζ θιίκαθα πνπ ρξεζηκνπνηήζεθε είλαη πνζνηηθήο δηαβάζκηζεο ηεο έληαζεο ελφο ραξαθηεξηζηηθνχ (category rating scale), ζηελ νπνία ην κειεηνχκελν γλψξηζκα δηαβαζκίδεηαη ζε θαηεγνξίεο θαηάηαμεο απμαλφκελεο έληαζεο πνπ νλνκάδνληαη ραξαθηεξηζκνί (θιίκαθα απφ 1 έσο 9). Οη ραξαθηεξηζκνί απηνί είλαη ζε δηπνιηθέο θιίκαθεο ζηηο νπνίεο αληίζεηνη ραξαθηεξηζκνί ελφο πξντφληνο νξίδνπλ ηα δπν άθξα ηεο θιίκαθαο (Πεηξίδεο, 2000), π.ρ. γηα ην ρξψκα. ΥΡΩΜΑ θνχξν ελδηάκεζν αλνηρηφ Δπίζεο, ρξεζηκνπνηήζεθε θιίκαθα αξέζθεηαο ή πξνηίκεζεο (hedonic scale) γηα ηελ ζπλνιηθή απνδνρή - εθηίκεζε ηνπ πξντφληνο. Ζ θιίκαθα είλαη δηπνιηθή θαη έρεη ζην θέληξν κηα νπδέηεξε δηαβάζκηζε. Aπηή ε κέζνδνο δειαδή παξέρεη κηα ηζνξξνπεκέλε θιίκαθα 9 ζεκείσλ γηα ηελ πξνηίκεζε ή αξέζθεηα κε κηα θεληξηθή νπδέηεξε θαηεγνξία θαη πξνζπαζεί λα παξάγεη εηηθέηεο ζεκείσλ ειέγρνπ κε επηξξήκαηα πνπ αληηπξνζσπεχνπλ θπζηνινγηθά φκνηα βήκαηα ή φκνηεο αιιαγέο ζε ηφλν αξέζθεηαο. Με άιια ιφγηα είλαη κηα θιίκαθα κε ηδηφηεηεο ράξαθα, ηεο νπνίαο ηα ίζα δηαζηήκαηα επηδέρνληαη ζηαηηζηηθέο αλαιχζεηο (Lawless & Heymann, 2010) Μνπ αξέζεη εμαηξεηηθά Μνπ αξέζεη πάξα πνιχ Μνπ αξέζεη κέηξηα Μνπ αξέζεη ειαθξψο Οχηε κνπ αξέζεη, νχηε δελ κνπ αξέζεη Γελ κνπ αξέζεη ειαθξψο Γελ κνπ αξέζεη κέηξηα Γελ κνπ αξέζεη πάξα πνιχ Γελ κνπ αξέζεη θαζφινπ Tα ραξαθηεξηζηηθά πνπ αμηνινγήζεθαλ θαη νη δηαβαζκίζεηο πνπ δφζεθαλ γηα επηινγή ζε θαζέλα απφ απηά ήηαλ: 78

97 1) Υξψκα (ζθνχξν ελδηάκεζν αλνηρηφ) 2) Γεχζε (απαιή κέηξηα έληνλε) 3) πλεθηηθφηεηα (ιεπηφ κέηξην αδξφ) 4) Υπκψδεο (αθπδαησκέλν κέηξην πδαξέο) 5) Άξσκα (κε αξσκαηηθφ ήπην πινχζην) 6) Οζκή (Με νζκεξφ ήπην έληνλν) 7) Πηθξάδα (ρσξίο πηθξάδα ήπηα έληνλε) ηαηηζηηθή αλάιπζε Ο πεηξακαηηθφο ζρεδηαζκφο βαζίζηεθε ζε έλα πιήξσο ηπραηνπνηεκέλν ζχζηεκα κε ηξεηο επαλαιήςεηο (πεξηέθηεο). Ζ ζηαηηζηηθή αλάιπζε ησλ δεδνκέλσλ, κε βάζε ηφζν ηηο κηθξνβηνινγηθέο (κεηαηξνπή ζε ινγαξίζκνπο - log 10 ) θαη θπζηθνρεκηθέο αλαιχζεηο (Γείγκα Α), φζν θαη ηηο κεηξήζεηο νξγαλνιεπηηθήο πνηφηεηαο ηνπ πξντφληνο (Γείγκα Β) πξαγκαηνπνηήζεθε κε ηε ρξήζε ηνπ ζηαηηζηηθνχ ινγηζκηθνχ πξνγξάκκαηνο PASW Statistics 18 (SPSS 18). πγθεθξηκέλα, ε ζηαηηζηηθή επεμεξγαζία ησλ απνηειεζκάησλ ηνπ πεηξάκαηνο δηεμήρζε κέζσ ηεο αλάιπζεο ηεο Παξαιιαθηηθφηεηαο (Two-Way analysis of variance ANOVA, δηπιήο θαηεχζπλζεο αλάιπζε δεδνκέλσλ) ησλ παξαγφλησλ πνπ επεξεάδνπλ ην πείξακα θαη ηεο ζχγθξηζεο ησλ κέζσλ φξσλ κε βάζε ηε Γνθηκή - Κξηηήξην Duncan (Duncan s multiple range test ηέζη πνιιαπινχ εχξνπο θαηά Duncan) θαη ηελ Διάρηζηε εκαληηθή Γηαθνξά Διάρηζηε Σππηθή Απφθιηζε (LSD) γηα λα ζεσξεζνχλ δχν ηηκέο φηη δηαθέξνπλ θαη θαζνξίζηεθε ζε Δπίπεδν εκαληηθφηεηαο - πηζαλφηεηα 5% (P 0.05) ησλ ειέγρσλ. 79

98 Log (cfu/g) 5. ΑΠΟΣΔΛΔΜΑΣΑ ΚΑΗ ΤΕΖΣΖΖ 5.1. Μηθξνβηνινγηθά ραξαθηεξηζηηθά ΟΜWs Ο κηθξνβηνινγηθφο έιεγρνο πεξηειάκβαλε ηε κειέηε ηεο νιηθήο κεζφθηιεο αεξφβηαο κηθξνρισξίδαο (OMX), ηελ χπαξμε γαιαθηηθψλ βαθηεξίσλ, δπκψλ θαη κπθήησλ, εληεξνβαθηεξίσλ θαη ςεπδνκνλάδσλ θαη ηέινο ζηαθπινθφθθσλ. Ο παξαπάλσ έιεγρνο έδεημε φηη ςεπδνκνλάδεο θαη ζηαθπιφθνθθνη απνπζίαδαλ απφ ην OMWs θαηά ηε δηάξθεηα ηεο δχκσζήο ηνπ κε 6% NaCl. Σα εληεξνβαθηήξηα εμαθαλίζηεθαλ θαηά ηελ 5 ε εκέξα ηεο δχκσζεο ελψ ε απνπζία γαιαθηηθψλ βαθηεξίσλ θαη ε έληνλε αλάπηπμε ησλ δπκψλ έδεημαλ ηηο ηειεπηαίεο σο ηελ ππεχζπλε νκάδα κηθξννξγαληζκψλ γηα ηε δχκσζε. Ο πιεζπζκφο ησλ κπθήησλ κεησλφηαλ ζπλερψο θαηά ηε δηάξθεηα ηεο δχκσζεο ελψ ε νιηθή κεζφθηιε ρισξίδα παξέκελε ζρεδφλ ζηαζεξή (κηθξή αχμεζε) θαηά ηε δηάξθεηα ηεο δχκσζεο. Οη θακπχιεο αλάπηπμεο φισλ ησλ κηθξννξγαληζκψλ πνπ κειεηήζεθαλ θαίλoληαη παξαθάησ (ρήκα 5.1.) ελψ ζηνλ Πίλαθα 5.1 παξνπζηάδνληαη νη πιεζπζκνί ησλ κηθξννξγαληζκψλ πνπ κεηξήζεθαλ θαηά ηε δηάξθεηα ηεο δχκσζεο Εντεροβακτήρια Ψευδομονάδες Σταφυλόκοκκοι Ζφμες Μφκητες ΟΜΧ Γαλακτικά βακτήρια Ημζρεσ ηφμωςθσ ρήκα 5.1. Κακπχιεο αλάπηπμεο κηθξννξγαληζκψλ ζην OMWs θαηά ηε δηάξθεηα ηεο δχκσζεο 14 εκεξψλ. 80

99 Πίλαθαο 5.1. Πιεζπζκνί κηθξννξγαληζκψλ * (log (cfu/g)) κεηά απφ 0, 2, 5, 7, 10 θαη 14 εκέξεο απφ ηελ έλαξμε δχκσζεο ησλ ΟΜWs κε 6% NaCl ΤΠΟΣΡ. ΜΗΚΡ. 0 ΖΜΔΡ 2 ΖΜΔΡ 5 ΖΜΔΡ 7 ΖΜΔΡ 10ΖΜΔΡ 14ΖΜΔΡ VRBGA Δληεξνβ. 3,89 a ±0,06 2,79 b ±0,42 VRBGA Χεπδ. BP Σηαθ. MRS PDA Γαιαθηηθά βαθηήξηα Εύκεο 5,03 e ±0,10 5,44 d ±0,02 5,97 b ±0,05 6,25 a ±0,00 5,69 c ±0,07 5,97 b ±0,16 Μύθεηεο 4,46 a ±0,14 3,72 b ±0,02 3,54 bc ±0,04 3,39 dc ±0,03 3,33 d ±0,06 2,75 e ±0,18 PCA ΟΜΦ 5,27 d ±0,26 5,81 c ±0,13 6,12 ab ±0,02 6,28 a ±0,02 5,92 cb ±0,01 5,99 cb ±0,15 * Oη ηηκέο είλαη κέζνη φξνη ηξηψλ επαλαιήςεσλ ± ηελ ηππηθή απφθιηζε (S.D.) (-) Γελ αληρλεχηεθαλ κηθξννξγαληζκνί ζηελ 1ε αξαίσζε (1/10). a e: κέζνη φξνη ζηελ ίδηα ζεηξά πνπ δηαθέξνπλ ζεκαληηθά (P<0,05), έρνπλ δηαθνξεηηθνχο εθζέηεο Δθηίκεζε ηνπ πιεζπζκνύ ηεο νιηθήο κεζόθηιεο αεξόβηαο ρισξίδαο Μεηά ηελ επψαζε ησλ ηξπβιίσλ ζηνπο 30 ν C γηα 72 ψξεο, έγηλε θαηακέηξεζε ησλ απνηθηψλ πνπ είραλ ζρεκαηηζηεί θαη παξαηεξήζεθε φηη ε νιηθή κεζφθηιε κηθξνρισξίδα απμήζεθε ζηαδηαθά κέρξη ηελ 7 ε εκέξα ηεο δχκσζεο, φπνπ εκθαλίζηεθε ε κέγηζηε ηηκή (6,28 log (cfu/g)). ηε ζπλέρεηα ν πιεζπζκφο ηεο κεηψζεθε κέρξη ηελ ηειηθή ηηκή 5,99 log (cfu/g) ζην ηέινο ηεο δχκσζεο. Φαίλεηαη πάλησο φηη ν πιεζπζκφο παξέκεηλε ζρεηηθά ζηαζεξφο ρσξίο κεγάιεο θαη απφηνκεο κεηαβνιέο θαηά ηε δχκσζε, αθνχ ε κεγαιχηεξε δηαθνξά αλάκεζα ζηηο κέζεο ηηκέο είλαη πεξίπνπ κηα ινγαξηζκηθή κνλάδα. H νιηθή κεζφθηιε ρισξίδα πηζαλφλ λα απνηεινχληαλ απφ δηάθνξεο κηθξνρισξίδεο φπσο π.ρ. gram αξλεηηθά βαθηήξηα, νη νπνίεο αληαγσλίδνληαη κε ηηο δχκεο γηα ζξεπηηθά ζηνηρεία Δθηίκεζε ηνπ πιεζπζκνύ ησλ γαιαθηηθώλ βαθηεξίσλ Μεηά ηελ επψαζε ησλ ηξπβιίσλ ζηνπο 30 ν C γηα 5 εκέξεο, έγηλε θαηακέηξεζε ησλ απνηθηψλ πνπ είραλ ζρεκαηηζηεί θαη απφ ηα απνηειέζκαηα πξνέθπςε φηη δελ αλαπηχρζεθαλ γαιαθηηθά βαθηήξηα ζην OMWs θαηά ηε δηάξθεηα ησλ 14 εκεξψλ θπζηθήο δχκσζεο ηνπ ζε άικε 6%. Απηφ πηζαλφλ λα νθείιεηαη ζηελ αλαζηαιηηθή επίδξαζε πνπ αζθνχλ νη θαηλνιηθέο ελψζεηο ζηα γαιαθηηθά βαθηήξηα. Απφ κειέηεο πνπ έρνπλ γίλεη πάλσ ζηε ζπζρέηηζε 81

100 θαηλνιηθψλ νπζηψλ θαη γαιαθηηθψλ βαθηεξίσλ ζηελ επεμεξγαζία πξάζηλσλ επηηξαπέδησλ ειηψλ, έρεη δηαπηζησζεί φηη ε δξάζε ησλ ηειεπηαίσλ πεξηνξίδεηαη ζεκαληηθά ζε πςειέο ζπγθεληξψζεηο θαηλνιηθψλ ή παξνπζία ζπγθεθξηκέλσλ θαηλνιηθψλ (Fleming et al., 1969, Duran et al., 1993, Garrido Fernandez et al., 1997). Μηα άιιε πηζαλή αηηία είλαη ε πξαθηηθή θαιιηέξγεηαο θαη ζπιινγήο ησλ ειαηνθάξπσλ. Πην ζπγθεθξηκέλα, νη παξαπάλσ δηαδηθαζίεο επεξεάδνπλ ζε κεγάιν βαζκφ ηνπο βαθηεξηαθνχο πιεζπζκνχο ζηα OMW. H βαθηεξηαθή πνηθηιφηεηα γηα παξάδεηγκα ζηα OMW απφ ηελ πνηθηιία Mastoidis θπξηαξρήζεθε απφ δπκσηηθά κέιε βαθηεξίσλ φπσο βαθηήξηα γαιαθηηθνχ νμένο (Lactobacillus θαη Οenococcus spp.) θαη νμηθνχ νμένο (Acetobacter θαη Gluconacetobacter spp.) (Kavroulakis et al., 2011). Ζ αχμεζε ηνπ πιεζπζκνχ ηνπο απνδίδεηαη ηφζν ζηε ζπζζψξεπζε θαη παξακνλή ησλ ειαηνθάξπσλ ζην δίρηπ ζπγθνκηδήο πνπ κπνξεί λα νδεγήζεη ζηελ εγθαηάζηαζε αλαεξφβησλ/κηθξναεξφθηισλ βαθηεξίσλ, φζν θαη ζηελ επεμεξγαζία ηνπο ζηα ειαηνπξγεία, ε νπνία κπνξεί λα απμήζεη ην επίπεδν νμπγφλνπ, επλνψληαο ηελ αλάπηπμε βαθηεξίσλ νμηθνχ νμένο (Kavroulakis et al., 2011). Δπίζεο, σο απνηέιεζκα ηεο πξφσξεο ζπιινγήο θαη ηεο κεζφδνπ ζπγθνκηδήο (κε ην ρέξη), ηα δπκσηηθά βαθηήξηα ζηα OMW πξνεξρφκελα απφ ηελ επεμεξγαζία ηεο πνηθηιίαο Κνξσλέηθεο πεξηνξίζηεθαλ ζε ιίγα αληηπξνζσπεπηηθά ησλ νηθνγελεηψλ Peptococcaceae θαη Sporolactobacillaceae (Νtougias et al., 2013). Δθηφο δειαδή απφ ηελ αλαζηαιηηθή επίδξαζε ησλ θαηλνιηθψλ ελψζεσλ, ε απνπζία βαθηεξίσλ γαιαθηηθνχ νμένο ζην ΟΜWs κπνξεί επίζεο λα εμεγεζεί ηφζν απφ ηελ πηζαλή κε ζπζζψξεπζε ειηψλ (πνηθηιία Υνλδξνειηά Υαιθηδηθήο) ζην δίθηπ ζπγθνκηδήο, φζν θαη απφ ηελ θαηάιιειε επεμεξγαζία ηνπο ζην ειαηνπξγείν Δθηίκεζε ηνπ πιεζπζκνύ δπκώλ θαη κπθήησλ Μεηά ηελ επψαζε ησλ ηξπβιίσλ ζηνπο 25 ν C γηα 5 εκέξεο, έγηλε θαηακέηξεζε ησλ απνηθηψλ δπκψλ πνπ είραλ ζρεκαηηζηεί θαη ε αλάπηπμε ησλ κηθξννξγαληζκψλ θαηά ηε δηάξθεηα ηεο δχκσζεο θαίλεηαη ζην ρήκα 5.1. Πην ζπγθεθξηκέλα, ν πιεζπζκφο ησλ δπκψλ αξρηθά απμήζεθε απφ ηελ ηηκή 5,03 log (cfu/g) θαη ζηαδηαθά κέρξη ηελ 7 ε εκέξα θαηά ηελ νπνία εκθάληζε ηε κέγηζηε ηηκή (6,25 log (cfu/g)). ηε ζπλέρεηα κεηψζεθε κέρξη ηελ ηειηθή ηηκή 5,97 log (cfu/g) (Πίλαθαο 5.1.). Παξαηεξείηαη δειαδή φηη ν 82

101 πιεζπζκφο ησλ δπκψλ παξέκεηλε ζε πςειά επίπεδα θαζ φιε ηε δηάξθεηα ηεο δχκσζεο θαη ρσξίο κεγάιεο απμνκεηψζεηο (νη πεξηζζφηεξεο κεηξήζεηο είλαη εληφο ηεο ίδηαο ινγαξηζκηθήο κνλάδαο), γεγνλφο πνπ ππνδειψλεη φηη νη δχκεο ήηαλ νη ππεχζπλνη κηθξννξγαληζκνί δχκσζεο ηνπ πιηθνχ. Όπσο αλαθέξζεθε θαη πξνεγνπκέλσο, ην φμηλν ph ησλ πγξψλ απνβιήησλ (OMW) φπσο θαη ηνπ ζηεξενχ ππνιείκκαηνο πνπ πξνθχπηεη απφ ηελ θνζθίληζή ηνπο (OMWs) κπνξεί λα απνηειεί πιενλέθηεκα γηα απηή ηελ νκάδα κηθξννξγαληζκψλ γηα λα αληαγσληζηεί ηα βαθηήξηα. Φαίλεηαη φηη νη πςειέο ζπγθεληξψζεηο άιαηνο θαη ζαθράξσλ ησλ πγξψλ απνβιήησλ ειαηνπξγείσλ θαζψο θαη ην φμηλν ph, επλννχλ ηελ αλάπηπμε ησλ σζκoάληνρσλ δπκψλ ζηα ΟMW (Giannoutsou et al., 2004). χκθσλα θαη κε ηνπο Ben Sassi θαη ζπλ. (2006), νη πιεζπζκνί δπκψλ εκθαλίδνληαη λα είλαη πςεινί ζηα πγξά απφβιεηα ειαηνπξγείσλ. Mεηαμχ άιισλ δχκεο ηνπ γέλνπο Pichia (P. membranifaciens, P. fermentans θαη P. holstii), θαη ηνπ γέλνπο Saccharomyces (S.cerevisiae) έρνπλ απνκνλσζεί απφ ΟΜW (Bleve et al., 2011, Sinigaglia et al., 2010). Οη κεηξήζεηο επίζεο δπκψλ ζηα δηαθνξεηηθά δείγκαηα απφ 6 ειαηνπξγεία ζε πείξακα ησλ Mouncif θαη ζπλ. (1993) ήηαλ πςειέο, φπσο αλαθέξεηαη ζηνλ Πίλαθα 2.7. πνπ παξνπζηάζηεθε ζε πξνεγνχκελν θεθάιαην. Απηφ κπνξεί λα ππνδειψλεη φηη ηα OMW, φπσο θαη ηo OMWs, ζα κπνξνχζαλ λα απνηειέζνπλ έλα θαηάιιειν παξαπξντφλ ην νπνίν κπνξεί λα ρξεζηκνπνηεζεί γηα ηελ αλάπηπμε δπκψλ. Απηφ κπνξεί λα βνεζήζεη ζηελ δηαδηθαζία αεξφβηαο κεηαρείξηζεο ησλ ΟΜW. Μεξηθά κάιηζηα είδε είλαη πνιχ θνηλά ζηηο δπκψζεηο ειηψλ θαη κπνξεί λα παίμνπλ έλα ξφιν ζηε ηερλνινγία ησλ δπκνχκελσλ πξάζηλσλ ειηψλ. Μεηαμχ ησλ γελψλ επξέσο θαηαλεκεκέλσλ ζε πςειέο ζπγθεληξψζεηο ζε άικεο, ηα Debaryomyces θαη Pichia είλαη ηα πην θνηλά. Ζ παξνπζία δπκψλ θαηά ηε δηάξθεηα απεπζείαο εκβάπηηζεο ζε άικε πξάζηλσλ επηηξαπέδησλ ειηψλ είλαη πνιχ ζπρλή θαη εηδηθά εηδψλ ησλ γελψλ Pichia θαη Debaryomyces πνπ πξναλαθέξζεθαλ, αιιά θαη ηνπ γέλνπο Candida (Arroyo-Lopez et al., 2006, Garrido - Fernandez et al., 1997). Oη θαξπνί πνπ πξννξίδνληαη γηα απηφλ ηνλ ηχπν επεμεξγαζίαο δε κεηαρεηξίδνληαη κε ΝaOH, κε απνηέιεζκα ηα γαιαθηηθά βαθηήξηα λα αλαραηηίδνληαη κεξηθψο ιφγσ ηεο παξνπζίαο θαηλνιηθψλ ελψζεσλ, φπσο πξναλαθέξζεθε (Duran et al., 1993, Garrido Fernandez et al., 1997). Έηζη, νη δχκεο κπνξνχλ λα θηάζνπλ πιεζπζκνχο ηνπ 10 6 cfu/ml (Arroyo-Lopez et al., 2006, Hernandez 83

102 et al., 2007, Hurtado et al., 2008), παξφκνηεο δειαδή κε απηέο πνπ βξέζεθαλ ζηελ εξγαζία ησλ Bautista Gallego θαη ζπλ. (2011). Όζνλ αθνξά ηνπο κχθεηεο, ε ζπλερήο κείσζή ηνπο θαηά ηε δηάξθεηα ηεο δχκσζεο (ρήκα 5.1.) ηνπ OMWs πηζαλφλ λα νθείιεηαη ζην αληαγσληζκφ ηνπο γηα ζξεπηηθά ζηνηρεία κε ηηο δχκεο, νη νπνίεο θαίλεηαη λα θπξηαξρνχλ. Ζ θπζηθή κηθξνρισξίδα ησλ πγξψλ απνβιήησλ αληηπξνζσπεχεηαη δειαδή θαη απφ κχθεηεο, νη νπνίνη είλαη επίζεο αλζεθηηθνί ζε δπζκελείο πεξηβαιινληηθέο ζπλζήθεο, φπσο ην φμηλν ph θαη νη πςειέο ζπγθεληξψζεηο άιαηνο αιιά πζηεξνχλ ζηνλ αληαγσληζκφ κε ηηο δχκεο. Σα Penicillum sp, Geotrichum candidum θαη Aspergillus niger είλαη ηα πην ζπρλά είδε κπθήησλ πνπ έρνπλ απνκνλσζεί απφ ηα πγξά απφβιεηα (Mouncif et al., 1993) Δθηίκεζε ηνπ πιεζπζκνύ ησλ εληεξνβαθηεξίσλ θαη ςεπδνκνλάδσλ Μεηά ηελ επψαζε ησλ ηξπβιίσλ ζηνπο 37 ν C γηα 24 ψξεο ζε αλαεξφβηεο ζπλζήθεο (Gas-Pak system, BBL, Cockeysville, Marylant, USA), έγηλε θαηακέηξεζε ησλ απνηθηψλ εληεξνβαθηεξίσλ πνπ είραλ ζρεκαηηζηεί. ηε ζπλέρεηα, ηα ηξπβιία επσάζηεθαλ αεξνβίσο ζηνπο 37 ν C γηα άιιεο 24 ψξεο. Σα απνηειέζκαηα έδεημαλ φηη δελ αλαπηχρζεθαλ ςεπδνκνλάδεο ζην ζηεξεφ ππφιεηκκα θνζθίλεζεο πγξψλ απνβιήησλ ειαηνπξγείνπ (ΟΜWs) θαηά ηε δηάξθεηα ησλ 14 εκεξψλ θπζηθήο δχκσζήο ηνπ ζε 6% NaCl. Ο αξρηθφο πιεζπζκφο 3,89 log(cfu/g) ησλ εληεξνβαθηεξίσλ κεηψζεθε ζεκαληηθά ζε 2,79 log (cfu/g) ηε 2 ε εκέξα ηεο δχκσζεο θαη κεδελίζηεθε ηελ 5 ε εκέξα, ρσξίο λα παξαηεξεζεί μαλά αλάπηπμή ηνπο κέρξη ην ηέινο απηήο (ρήκα 5.1). Ζ απνπζία ςεπδνκνλάδσλ πηζαλφλ λα νθείιεηαη ζηελ πξαθηηθή θαιιηέξγεηαο θαη ζπιινγήο ησλ ειαηνθάξπσλ φπσο θαη ζηηο κεζφδνπο επεμεξγαζίαο ζην ειαηνπξγείν. Όζνλ αθνξά ηα εληεξνβαθηήξηα, ε ζπλδπαζκέλε δξάζε ρακεινχ ph (φμηλν πεξηβάιινλ) θαη αιαηηνχ, θαζψο θαη ε αληαγσληζηηθή δξάζε ησλ δπκψλ πξνθάιεζαλ πξνθαλψο ηελ εμαθάληζή ηνπο 5 εκέξεο κεηά ηελ έλαξμε ηεο δχκσζεο ηνπ ΟΜWs ζε 6% NaCl. Αθφκα φκσο θαη αλ ην κηθξνβηαθφ θνξηίν ησλ πγξψλ απνβιήησλ ειαηνπξγείνπ είλαη πςειφ, φπσο απνδείρζεθε ζε έξεπλα ησλ Mouncif θαη ζπλ. (1993), δελ ππάξρνπλ δπλεηηθά επηθίλδπλνη κηθξννξγαληζκνί. ηελ πξαγκαηηθφηεηα, ε απνπζία θισζηξηδίσλ θαη εληεξνθφθθσλ ππνδειψλεη φηη ηα πγξά απφβιεηα ειαηνπξγείσλ θαη επνκέλσο θαη ην 84

103 ζηεξεφ ππφιεηκκα πνπ πξνθχπηεη απφ ηελ θνζθίληζή ηνπο (OMWs), δελ εκπιέθνληαη ζηελ πηζαλή κηθξνβηαθή κφιπλζε ηνπ πεξηβάιινληνο (Mouncif et al., 1993). ε άιιε κειέηε ησλ Ntougias θαη ζπλ. (2013) αλαθέξζεθε φηη πεξίπνπ 20% ησλ βαθηεξίσλ ηαπηνπνηεκέλσλ ζε πγξά απφβιεηα ειαηνπξγείσλ θαη ζε παξφκνηα πεξηβάιινληα ζρεηίδνληαη κε θνινβαθηεξηνεηδή (π.ρ. Citrobacter, Escherichia, Klebsiella, θαη Serratia spp.) θαη άιια εληεξηθά βαθηήξηα (Βrugere et al., 2009), φπσο ηα Porphyromonadaceae, Prevotellaceae, Lachnospiraceae, Eubacteriaceae, Peptococcaceae, Peptostreptococcaceae, θαη Ruminococcaceae spp. Σα επξήκαηα απηά απαηηνχλ ηελ αλάγθε γηα αζθαιή δηάζεζε (απφζεζε) ησλ OMW (Ntougias et al., 2013). Με βάζε ηελ αλάιπζε θαηά Ntougias θαη ζπλ. (2013), ηα είδε Enterobacteriaceae, Moraxallaceae, Xanthomonadaceae θαη Pseudomonaceae spp. είλαη νη θχξηνη αληηπξφζσπνη ηoπ γέλνπο Gammaproteobacteria, ην νπνίν ζπκκεηέρεη κε πνζνζηφ 29.7% ζηα βαθηήξηα πνπ ηαπηνπνηήζεθαλ ζε πεξηβάιινληα πγξψλ απνβιήησλ ειαηνπξγείσλ. Με βάζε επίζεο κηθξνβηνινγηθέο κεηξήζεηο θαη ηαπηνπνίεζε API, ζηειέρε Enterobacter cloacae αληρλεχηεθαλ ζπρλά ζε αθαηέξγαζηα απφβιεηα, καδί κε κέιε ησλ εηδψλ Αeromonas hydrophila, Pseudomonas aeruginosa, θαη Serratia odorifera (Venieri et al., 2010), ελψ ην Citrobacter braakii ήηαλ θπξίαξρν θαηά ηε δηάξθεηα ηεο νμενγέλεζεο. Αληηπξνζσπεπηηθά ησλ εηδψλ Burkholderia cepacia, Enterobacter clocae, θαη Photobacterium damselae αληρλεχηεθαλ επίζεο. Δπηπιένλ, πςειέο κεηξήζεηο ησλ εηδψλ Acinetobacter, Pseudomνnas θαη Enterobacter spp. έρνπλ επίζεο αληρλεπηεί ζηα ΟMW (Venieri et al., 2010). Μάιηζηα, ηα ηειεπηαία είλαη πηζαλά παζνγφλα γηα ηνλ άλζξσπν. Έρεη επίζεο αλαθεξζεί ζηε βηβιηνγξαθία ε παξνπζία εληεξνβαθηεξίσλ (Enterobacter spp., Citrobacter spp. θαη Klebsiella spp.) ζην πξνθαηαξθηηθφ ζηάδην δχκσζεο (7-14 εκέξεο) ησλ επηηξαπέδησλ ειηψλ. Σα ηειεπηαία καδί κε ηα αξλεηηθά θαηά Gram βαθηήξηα (Pseudomonas spp., Aeromonas spp., Flavobacterium spp.) απνηεινχλ θαη ηελ θπξίαξρε ελδνγελή ρισξίδα ηνπ θαξπνχ (González Cancho, 1960, Fernández Diez et al., 1985, Tassou, 1993). Μάιηζηα, ππάξρεη θίλδπλνο εθηξνπήο ηεο δχκσζεο, εμαηηίαο ησλ βαθηεξίσλ απηψλ θαη πξφθιεζε αεξηνπάζεζεο, κηαο ζνβαξήο αζζέλεηαο πνπ πξνζδίδεη απαξάδεθηα γεπζηηθά ραξαθηεξηζηηθά ζην πξντφλ (Bordolla y Alcala et al. 85

104 1959, 1960). Όκσο κεηά ηελ πάξνδν ησλ 2-3 πξψησλ εκεξψλ, ν πιεζπζκφο ησλ κηθξννξγαληζκψλ απηψλ παξνπζίαζε ζηαδηαθή κείσζε, ελψ κεηά απφ εκέξεο δελ θαηακεηξνχληαη πιένλ ζηελ άικε Δθηίκεζε ηνπ πιεζπζκνύ ησλ ζηαθπινθόθθσλ Μεηά ηελ επψαζε ησλ ηξπβιίσλ ζηνπο 37 ν C γηα 24 ψξεο, έγηλε θαηακέηξεζε ησλ απνηθηψλ πνπ είραλ ζρεκαηηζηεί θαη απφ ηα απνηειέζκαηα πξνθχπηεη φηη δελ αλαπηχρζεθαλ ζηαθπιφθνθθνη ζην OMWs θαηά ηε δηάξθεηα ησλ 14 εκεξψλ θπζηθήο δχκσζεο ηνπ ζε NaCl 6%. O Vivas θαη ζπλ. (2009) βξήθαλ φηη ηα πγξά απφβιεηα δηθαζηθψλ ειαηνπξγείσλ (TPOMW) θπξηαξρήζεθαλ απφ κέιε ηεο δηαίξεζεο Proteobacteria, αθνινπζνχκελα απφ Actinobacteria (Streptomyces), Firmicutes (Staphylococcus) θαη κε θαιιηεξγεκέλα ζηειέρε Acidobacteria σο δεπηεξεχνληα ζπζηαηηθά ηεο κηθξνρισξίδαο ησλ πγξψλ απνβιήησλ. Φαίλεηαη δειαδή φηη έρεη παξαηεξεζεί αλάπηπμε ζηαθπινθφθθσλ θαη ηα είδε Staphylococcus spp. ζηα πγξά απφβιεηα ειαηνπξγείσλ ζα έπξεπε λα ζεσξεζνχλ σο πηζαλνί κνιπζκαηηθνί παξάγνληεο. Με δεδνκέλν φκσο φηη δελ ππάξρνπλ βηβιηνγξαθηθέο αλαθνξέο γηα παξνπζία ζηαθπινθφθθσλ ζε πγξά απφβιεηα ηξηθαζηθψλ ειαηνπξγείσλ, πξνθαλψο ε κέζνδνο επεμεξγαζίαο ζην ειαηνπξγείν εμεγεί ηελ απνπζία ζηαθπινθφθθσλ απφ ην ζηεξεφ ππφιεηκκα θνζθίληζήο ηνπο (OMWs), ην νπνίν θαη κειεηάηαη ζηελ παξνχζα εξγαζία Μνξθνινγηθά ραξαθηεξηζηηθά ηεο επηθξαηνύζαο κηθξνρισξίδαο Αθνχ ηνπνζεηήζεθε κηα ζηαγφλα θεδξειαίνπ ζε θάζε απνηθία θαη κε ρξήζε ηνπ θαθνχ κεγέζπλζεο x 100 κειεηήζεθαλ ηα θχηηαξα ησλ δπκψλ θαη δηαπηζηψζεθε φηη κε εμαίξεζε ηα ζηειέρε θαη δελ ππήξμαλ ηδηαίηεξεο κνξθνινγηθέο δηαθνξέο. Σα πεξηζζφηεξα δειαδή είραλ σνεηδέο ζθαηξηθφ ζρήκα κε αξθεηέο εθβιαζηήζεηο θαη εκθαλίδνληαλ σο θξίθνη ζε κεγάιεο αιπζίδεο θαη ζπζζσκαηψκαηα. Αληίζεηα, ηα ζηειέρε (2 ν δείγκα 0 εκεξψλ αχμσλ αξηζκφο 2) θαη (2 ν δείγκα 0 εκεξψλ αχμσλ αξηζκφο 7) ήηαλ πην κηθξά, πην επηκήθε, είραλ ηε κνξθή ξαβδίσλ ή θφθθσλ ξπδηνχ θαη ήηαλ αξθεηά κεκνλσκέλα. Τπήξραλ θαη ζε απηά εθβιαζηήζεηο αιιά ήηαλ πην δπζδηάθξηηεο. 86

105 5.3. Βηνρεκηθέο δξαζηεξηόηεηεο επηθξαηνύζαο κηθξνρισξίδαο Σα 30 ζηειέρε δπκψλ πνπ κειεηήζεθαλ ζηελ παξνχζα εξγαζία σο πξνο ηηο βηνρεκηθέο ηνπο ηδηφηεηεο παξνπζίαζαλ δηαθνξεηηθέο αληηδξάζεηο ζηηο δνθηκέο ζηηο νπνίεο ππνβιήζεθαλ. Πην ζπγθεθξηκέλα, ηα απνηειέζκαηα ησλ βηνρεκηθψλ απηψλ δνθηκψλ κε θξηηήξην αμηνιφγεζεο ηελ αληίδξαζε ησλ ζηειερψλ ζε απηέο, θιηκαθνχκελε απφ αξλεηηθή (-) έσο πνιχ έληνλε (+++), θαίλνληαη ζπλνπηηθά ζηνλ παξαθάησ πίλαθα ελψ αλαιχνληαη πεξηζζφηεξν αλά δξαζηεξηφηεηα ζηε ζπλέρεηα. Πίλαθαο 5.2. Αξηζκφο ζηειερψλ δπκψλ θαη έληαζε αληίδξαζεο ζηηο βηνρεκηθέο δνθηκέο Γξαζηεξηόηεηεο Καηαιάζε Πξωηεάζε Ξπιαλάζε Πνιπγ/άζε Ληπάζε Δζηεξάζε β-γιπθνζηδάζε (++++) πνιχ έληνλε (+++) έληνλε (++) κέηξηα (+) αζζελήο (-) αξλεηηθή Γξαζηεξηόηεηα θαηαιάζεο ε φια ηα ζηειέρε παξαηεξήζεθε εκθάληζε θπζαιίδσλ, ήηαλ δειαδή ζχκθσλα κε ηε βηβιηνγξαθία (Whittenbury, 1964), ζεηηθά ζηε δνθηκή θαηαιάζεο. Παξφια απηά, ηα ζηειέρε 2.0.1, , , θαη παξνπζίαζαλ αξγή θαη πνιχ αζζελή εκθάληζε θπζαιίδσλ. 87

106 Ενηυματικι δραςτθριότθτα 3,5 3 2,5 2 1,5 1 0,5 0 Δραςτθριότθτα καταλάςθσ Στελζχθ ρήκα 5.2. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο θαηαιάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην κέγεζνο ησλ θπζαιίδσλ). Σα ζεηηθά ζηειέρε ζηελ θαηαιάζε είλαη επηζπκεηά ζηηο ειηέο επεηδή ζπλεηζθέξνπλ ζηε δηαηήξεζή ηνπο, πξνζηαηεχνληαο απφ ηελ νμείδσζε ησλ αθφξεζησλ ιηπαξψλ νμέσλ θαη ην ζρεκαηηζκφ ππεξνμεηδίνπ (Hernandez et al., 2007). Αληίζηνηρε πξνζηαζία πξνθαλψο εμαζθαιίδνπλ θαη ζην OMWs θαη γηα ην ιφγν απηφ είλαη επηζπκεηή ε παξνπζία ηνπο Γξαζηεξηόηεηα πξσηεάζεο Απφ ηα 30 ζηειέρε δπκψλ πνπ εμεηάζηεθαλ κφλν δχν ήηαλ ζεηηθά ζηε δνθηκή πξσηεάζεο. Πην ζπγθεθξηκέλα, ηα ζηειέρε (2 o δείγκα 0 εκεξψλ αχμσλ αξηζκφο 1) θαη (2 o δείγκα 0 εκεξψλ αχμσλ αξηζκφο 7) εκθάληζαλ δηαπγή δψλε γχξσ απφ ηηο απνηθίεο, φπσο θαη αλαθέξεηαη ζηε ζρεηηθή βηβιηνγξαθία (Strauss et al, 2001). Ζ αθηίλα ηεο δψλεο γηα ην πξψην ζηέιερνο (2.0.1) ήηαλ 3,5 cm θαη γηα ην δεχηεξν (2.0.7) 4cm. Σα απνηειέζκαηα θαίλνληαη θαιχηεξα ζηνλ παξαθάησ ζρήκα. 88

107 Ενηυματικι δραςτθριότθτα 4,5 4 3,5 3 2,5 2 1,5 1 0,5 0 Δραςτθριότθτα πρωτεάςθσ Στελζχθ ρήκα 5.3. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο πξσηεάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή, 3,1-4,0: πνιχ ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο). Γχν απνκνλψζεηο W.anomalus ζε πείξακα ησλ Bautista Gallego θαη ζπλ. (2011) εκθάληζαλ κηα κηθξή δξαζηεξηφηεηα πξσηεάζεο. Οη Βatista-Gallego θαη ζπλ. (2011) αλέθεξαλ επίζεο φηη ζπγθεθξηκέλα ζηειέρε ηνπ P. galeiformis έδεημαλ κηα αμηνζεκείσηε εμσθπηηαξηθή δξαζηεξηφηεηα πξσηεάζεο, Ζ ηδηφηεηα απηή είλαη αλεπηζχκεηε γηα ηηο επηηξαπέδηεο ειηέο δηφηη ζα κπνξνχζε λα πξνθαιέζεη καιάθσκα ησλ ειαηνθάξπσλ (Hernandez et al, 2007). Σν ίδην αλεπηζχκεηε ζα κπνξνχζε λα ραξαθηεξηζηεί θαη γηα ην δπκσκέλν OMWs γηαηί oδεγεί ζε κείσζε ηνπ πεξηερνκέλνπ ζε πξσηεΐλεο (Giannoutsou et al., 2004) Γξαζηεξηόηεηα μπιαλάζεο Ζ δξαζηεξηφηεηα μπιαλάζεο απνδεηθλχεηαη κε ηελ εκθάληζε κηαο δηαπγνχο δψλεο γχξσ απφ ηηο απνηθίεο (Hernandez et al, 2007) θαη φια ηα ζηειέρε (30) ζην πείξακα εκθαλίζηεθαλ αξλεηηθά ζηε δνθηκή απηή. Mηα άιιε δειαδή αλεπηζχκεηε ηδηφηεηα ησλ ζπζρεηηδφκελσλ κε ειηέο ζηειερψλ δπκψλ είλαη ε παξαγσγή ηνπ ελδχκνπ ηεο μπιαλάζεο, ην νπνίν ζα κπνξνχζε λα πξνθαιέζεη ην καιάθσκα ησλ θαξπψλ ζηηο επηηξαπέδηεο ειηέο, φπσο νη πξσηεάζεο πνπ 89

108 Ενηυματικι δραςτθριότθτα αλαθέξζεθαλ πξνεγνπκέλσο. Ο Hernandez θαη ζπλ. (2007) βξήθαλ, φπσο πξναλαθέξζεθε, κεξηθά ζηειέρε απφ Rhodotorula minuta, W. Anomalus θαη D. Hansenii ζηε δχκσζε πξάζηλσλ επηηξαπέδησλ ειηψλ κε απηήλ ηελ ηδηφηεηα. Σν ίδην αλεπηζχκεηε ζα κπνξνχζε λα ραξαθηεξηζηεί θαη γηα ην δπκσκέλν OMWs γηαηί νδεγεί ζε απνηθνδφκεζε ησλ πνιπζαθραξηηψλ ηνπ θπηηαξηθνχ ηνηρψκαηνο θαη θαηά ζπλέπεηα ηελ ππνβάζκηζε ησλ νξγαλνιεπηηθψλ ηδηνηήησλ ηνπ πξντφληνο Γξαζηεξηόηεηεο ιηπάζεο θαη εζηεξάζεο H δξαζηεξηφηεηα ιηπάζεο αληρλεχηεθε κε ην ζρεκαηηζκφ ελφο θζνξίδνληνο θσηεηλνχ ζηεθαληνχ γχξσ απφ ηηο απνηθίεο, ελψ ε δξαζηεξηφηεηα εζηεξάζεο αληρλεχηεθε κε ην ζρεκαηηζκφ κηαο δηαπγνχο δψλεο γχξσ απφ ηηο απνηθίεο (Hernandez et al, 2007, Rodriquez-Gomez et al, 2010). Όια ηα ζηειέρε ήηαλ αξλεηηθά ζηε δνθηκή ιηπάζεο ελψ φζνλ αθνξά ηε δξαζηεξηφηεηα εζηεξάζεο, ππήξμαλ ζηειέρε πνπ εκθάληζαλ πνξηνθαιί δψλε γχξσ απφ ηηο απνηθίεο (ζεηηθή αληίδξαζε) θαη άιια πνπ δελ εκθάληζαλ (αξλεηηθή αληίδξαζε). (ρήκα 5.4). 2,5 2 Δραςτθριότθτα εςτεράςθσ 1,5 1 0,5 0 Στελζχθ ρήκα 5.4. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο εζηεξάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (αλαθέξνληαη κφλν ηα ζεηηθά ζηε δνθηκή ζηειέρε) (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο). 90

109 Οη δξαζηεξηφηεηεο εζηεξαζψλ θαη ιηπαζψλ είλαη επηζπκεηέο ζηηο επηηξαπέδηεο ειηέο επεηδή κπνξνχλ λα βειηηψζνπλ ην άξσκα ησλ θαξπψλ κέζσ ζρεκαηηζκνχ πηεηηθψλ ελψζεσλ, νη νπνίεο κπνξνχλ λα δεκηνπξγεζνχλ απφ ηνλ θαηαβνιηζκφ ειεχζεξσλ ιηπαξψλ νμέσλ (Hernandez et al., 2007, Rodriquez-Gomez et al., 2010). Oη Αponte θαη ζπλ. (2010) αλέθεξαλ ηελ παξνπζία ελφο ζεκαληηθνχ αξηζκνχ πηεηηθψλ ελψζεσλ θαηά ηε δηάξθεηα ηεο δχκσζεο επηηξαπέδησλ ειηψλ ηεο πνηθηιίαο Sicilian ζηηο νπνίεο επηθξαηνχλ θπξίσο δχκεο. Οη πεξηζζφηεξεο απφ απηέο ηηο ελψζεηο πξνέξρνληαη απφ ηελ απνηθνδφκεζε ησλ πνιπαθφξεζησλ ιηπαξψλ νμέσλ κέζσ ηνπ δξφκνπ ηεο ιηπνμπγελάζεο. Βξήθαλ πδξνγνλάλαζξαθεο, φπσο νθηάλην, θαη αιδευδεο φπσο νθηαλάιε, επηαλάιε θαη δχν κεδελάιεο. Σα ιηπαξά νμέα δειαδή ζα κπνξνχζαλ λα είλαη νη πξφδξνκεο ελψζεηο γηα ην ζρεκαηηζκφ δηάθνξσλ ελψζεσλ φπσο ε 2-βνπηαλφιε (Hernandez et al., 2007, Rodriguez-Gomez et al., ). Χο εθ ηνχηνπ, ν C. boidinii ζρεηίζηεθε κε κηα ζεκαληηθή ηξνπνπνίεζε ησλ αξρηθψλ ραξαθηεξηζηηθψλ ηνπ ιίπνπο ζηηο ειηέο θαηά ηε δηάξθεηα ηεο επεμεξγαζίαο ησλ ψξηκσλ ειηψλ απμάλνληαο ηελ ειεχζεξε ιηπαξή νμχηεηα ζην εθρπιηζκέλν ειαηφιαδν (Rodriquez Gomez et al., 2010). Oη Zullo θαη Ciafardini (2008) αλέθεξαλ φηη ε παξνπζία γιπθφδεο ζην κέζν κπνξεί λα επεξεάζεη αξλεηηθά ηε ιηπνιπηηθή δξαζηεξηφηεηα ησλ δπκψλ. Οη Hernandez θαη ζπλ. (2007), φπσο πξναλαθέξζεθε, κειέηεζαλ ηε δξαζηεξηφηεηα εζηεξάζεο θαη ιηπάζεο κεξηθψλ δπκψλ απνκνλσκέλσλ απφ πξάζηλεο επηηξαπέδηεο ειηέο. Σα πεξηζζφηεξα απφ ηα ζηειέρε δπκψλ πνπ εξεπλήζεθαλ έδεημαλ δξαζηεξηφηεηα ηεο εζηεξάζεο, αιιά κφλν ζε κεξηθέο πεξηπηψζεηο είραλ δξαζηεξηφηεηα ιηπάζεο. Έηζη, ν πιεζπζκφο ησλ δπκψλ κπνξεί επνκέλσο λα ζπλεηζθέξεη ζηελ αχμεζε ηνπ πεξηερνκέλνπ ζε ειεχζεξα ιηπαξά νμέα ζηηο ειηέο θαηά ηε δηάξθεηα ηεο δχκσζεο. Oη ειηέο είλαη θαξπνί κε πςειέο ζπγθεληξψζεηο ιηπαξψλ θαη ε παξνπζία ιηπνιπηηθψλ δπκψλ ζα κπνξνχζε λα ηξνπνπνηήζεη ηελ δηαηξνθηθή ζχλζεζε ηνπ ηειηθνχ πξντφληνο (Arroyo-Lopez et al., 2008). ηελ κειέηε ησλ Romo-Sanchez θαη ζπλ. (2010) θαλέλα απφ ηα ζηειέρε δελ έδεημε δξαζηεξηφηεηα ιηπάζεο, νχηε θαη νη Zullo θαη Ciafardini (2008) θαη νη Hernandez θαη ζπλ. (2007) βξήθαλ απηήλ ηε δξαζηεξηφηεηα ζε δχκεο πνπ απνκνλψζεθαλ ζε ειαηφιαδν ηεο πνηθηιίαο Leccino θαη δχκεο απφ άικεο ειηψλ, αληηζηνίρσο. Απηφ είλαη πνιχ ζεκαληηθφ, απφ ηε ζηηγκή πνπ νη δχκεο πνπ παξάγνπλ ιηπάζεο κπνξνχλ λα βειηηψζνπλ ηελ πνηφηεηα ηνπ πξντφληνο ιφγσ ηεο 91

110 Ενηυματικι δραςτθριότθτα αχμεζεο ηφζν ησλ δηγιπθεξηδίσλ φζν θαη ηα επίπεδα νμχηεηαο κέζσ ηεο πδξφιπζεο ησλ ηξηγιπθεξηδίσλ (Cardenas et al., 2001, Zullo and Ciafardini, 2008). Άιιεο κειέηεο έδεημαλ φηη νη δχκεο απφ ην Alpeorujo (πγξφ απφβιεην δηθαζηθψλ ειαηνπξγείσλ), ζπλήζσο εκθαλίδνπλ κηα αχμεζε ζηε ιηπνιπηηθή δξαζηεξηφηεηα κεηά ηε δχκσζε, θαη ν εκπινπηηζκφο ησλ ιηπηδίσλ θαη ε παξαγσγή αξψκαηνο είλαη δχν παξάγνληεο πνπ βειηηψλνπλ ηηο νξγαλνιεπηηθέο ηδηφηεηεο ελφο πξντφληνο, ην νπνίν κπνξεί λα ρξεζηκνπνηεζεί σο δσνηξνθή (Giannoutsou et al., 2004). Πξνθαλψο, νη δξαζηεξηφηεηεο εζηεξαζψλ θαη ιηπαζψλ είλαη επηζπκεηέο θαη ζην OMWs, απφ ηε ζηηγκή πνπ ζπλεηζθέξνπλ ζηε βειηίσζε ηνπ αξψκαηνο θαη γεληθφηεξα ζηε βειηίσζε ησλ νξγαλνιεπηηθψλ ηνπ ηδηνηήησλ Γξαζηεξηόηεηα πνιπγαιαθηνπξνλάζεο Σα ηξπβιία βγήθαλ απφ ηνλ επσαζηηθφ ζάιακν θαη κειεηήζεθε ε ηθαλφηεηα ησλ ζηειερψλ λα παξάγνπλ δηαπγή δψλε γχξσ απφ ηηο απνηθίεο ζχκθσλα κε ηνπο Charoenchai et al. (1997). Σα απνηειέζκαηα ηεο βηνρεκηθήο απηήο δνθηκήο θαίλνληαη παξαθάησ (ρήκα 5.13), φπνπ είλαη πξνθαλέο φηη ηα ζηειέρε , θαη εκθαλίδνπλ ηελ πην έληνλε δξαζηεξηφηεηα, αθνινπζνχκελα απφ ηα , θαη Δραςτθριότθτα πολυγαλακτουρονάςθσ Στελζχθ ρήκα 5.5. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο πνιπγαιαθηνπξνλάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-2,0: αζζελήο, 2,1-4,0: κέηξηα, 4,1-6,0: ηζρπξή) (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ην πάρνο ηεο δψλεο). 92

111 Tα πεξηζζφηεξα ζηειέρε ζε εξγαζία ησλ Romo - Sanchez θαη ζπλ. (2010) έδεημαλ κηθξή έσο κεδακηλή δξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο. Ζ παξαηεξνχκελε δξαζηεξηφηεηα ζρεηίζηεθε κε απνκνλψζεηο Pichia θαη/ή Candida. Απηφ ην έλδπκν επεξεάδεη ηελ πνηφηεηα ηνπ ειαηνιάδνπ, θαη ε ρξήζε ηνπ επηηξέπεηαη ζε κεξηθέο ρψξεο επεηδή απμάλεη αμηνζεκείσηα ηα επίπεδα αληηνμεηδσηηθψλ θαηλνιηθψλ ελψζεσλ, παξέρνληαο κηα πξνζηαηεπηηθή επίδξαζε θαη επηκεθχλνληαο ην ρξφλν δσήο ηνπ ιαδηνχ. Δίλαη επίζεο ζεκαληηθφ απφ κηα ηερλνινγηθή άπνςε, απφ ηε ζηηγκή πνπ απμάλεη ηελ απφδνζε κέζσ ηεο πδξφιπζεο ησλ πνιπζαθραξηηψλ ηνπ θπηηαξηθνχ ηνηρψκαηνο ησλ ειηψλ (De Faveri et al., 2008). Απφ ηελ άιιε, ε δξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο ραξαθηεξίδεηαη σο κε επηζπκεηή ηδηφηεηα ζηελ επεμεξγαζία επηηξαπέδησλ ειηψλ. πγθεθξηκέλα, ζηειέρε ρξσκαηηζηψλ δπκψλ (R. glutinis, R. minuta θαη R. rubra) κπνξνχλ λα αλαπηπρζνχλ ζε άικεο ειηψλ θαη λα παξάγνπλ πνιπγαιαθηνπξνλάζεο, νη νπνίεο κπνξεί επίζεο λα πξνθαιέζνπλ καιάθσκα ησλ θαξπψλ θαηά ηε δηάξθεηα ηεο απνζήθεπζεο (Vaughn et al., 1969). Πξνθαλψο, ε δξαζηεξηφηεηα πνιπγαιαθηνπξνλάζεο είλαη αλεπηζχκεηε θαη ζην OMWs, απφ ηε ζηηγκή πνπ ζρεηίδεηαη κε ηελ απνηθνδφκεζε ησλ πνιπζαθραξηηψλ ηνπ θπηηαξηθνχ ηνηρψκαηνο θαη θαηά ζπλέπεηα ηελ ππνβάζκηζε ησλ νξγαλνιεπηηθψλ ηδηνηήησλ ηνπ πξντφληνο Γξαζηεξηόηεηα β γιπθνζηδάζεο Mεηά απφ 8 εκέξεο απφ ηελ ηνπνζέηεζε ησλ εκβνιηαζκέλσλ κε θχηηαξα δπκψλ ηξπβιίσλ ζηνλ επσαζηηθφ ζάιακν ησλ 25 ν C έγηλε έιεγρνο ηεο δξαζηεξηφηεηαο β- γιπθνζηδάζεο ησλ ζηειερψλ, ε νπνία αληρλεχηεθε κέζσ ηεο εκθάληζεο ζθνχξνπ θαθέ ρξσκαηηζκνχ γχξσ απφ ηηο απνηθίεο (Rossi et al, 2004). Γηα ηε δνθηκή ρξεζηκνπνηήζεθε ν γιπθνδίηεο εζθνπιίλε, ην κφξην ηνπ νπνίνπ έρεη δνκή παξφκνηα κε ην κφξην ηεο ειεπξσπαΐλεο. Ζ ηειεπηαία είλαη ππεχζπλε γηα ηε πηθξή γεχζε ζηηο ειηέο θαη επνκέλσο ζην OMWs. Ζ δξάζε δειαδή ηνπ ελδχκνπ β-γιπθνζηδάζε ζπλδέεηαη κε ηελ πδξφιπζε θαη ηε δηάζπαζε ηεο ειεπξσπαΐλεο θαη ζπλεπψο ηελ απνκάθξπλζε ηεο πηθξήο γεχζεο. Απφ ηα απνηειέζκαηα ηεο πξνθχπηεη φηη φια ηα ζηειέρε ήηαλ ζεηηθά ζηε δνθηκή β- γιπθνζηδάζεο θαη ηα 2.0.3, , , θαη εκθάληζαλ ηε κεγαιχηεξε αληίδξαζε, φπσο θαίλεηαη θαη ζην ρήκα

112 Eνηυματικι δραςτθριότθτα 4,5 4 3,5 3 2,5 2 1,5 1 0,5 0 Δραςτθριότθτα β-γλυκοςιδάςθσ Στελζχθ ρήκα 5.6. Γηαγξακκαηηθή απεηθφληζε ηεο δξαζηεξηφηεηαο β-γιπθνζηδάζεο ησλ ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ (0-1,0: αζζελήο, 1,1-2,0: κέηξηα, 2,1-3,0: ηζρπξή, 3,1-4,0: πνιχ ηζρπξή). (Ζ ελδπκαηηθή δξαζηεξηφηεηα ραξαθηεξίζηεθε κε βάζε ηελ έληαζε ηνπ ζθνχξνπ ρξψκαηνο γχξσ απφ ηηο απνηθίεο). Oη κηθξννξγαληζκνί κε δξαζηεξηφηεηεο β-γιπθνζηδάζεο είλαη επηζπκεηνί επεηδή κπνξνχλ λα ρξεζηκνπνηεζνχλ γηα ηελ πδξφιπζε ηνπ γιπθνδίηε ηεο ειεπξσπαΐλεο (Αrroyo Lopez et al, 2008), απνκαθξχλνληαο ηε θπζηθή πηθξάδα πνπ ππάξρεη ζηηο ειηέο (Arroyo-Lopez et al, 2008). Σν ίδην επηζπκεηή ζα κπνξνχζε λα ραξαθηεξηζηεί θαη γηα ην δπκσκέλν OMWs γηαηί νδεγεί ζηελ εθπίθξαλζε ηνπ πξντφληνο. Πεξίπνπ κηζά απφ ηα ζηειέρε πνπ δνθηκάζηεθαλ ζε πείξακα ησλ Romo - Sanchez θαη ζπλ.(2010), έδεημαλ δξαζηεξηφηεηα β-γιπθνζηδάζεο θαη ε πςειφηεξε πνπ εκθαλίζηεθε αλήθε ζε είδε ηνπ γέλνπο Pichia. Απηφ ην έλδπκν εκπιέθεηαη ζηελ ππνβάζκηζε ηεο ειεπξσπαΐλεο, ηεο θχξηαο θαηλνιηθήο έλσζεο ζηηο ειηέο, ζε έλαλ εηεξνζηδηθφ εζηέξα ηνπ ειελνιηθνχ νμένο θαη ηήο 3,4-δηπδξνμχθαηλπιαηζαλφιεο. Καη ηα δχν είλαη ηδηαίηεξα ζεκαληηθά απφ ηελ άπνςε ηεο ηθαλφηεηαο θαθεηηάζκαηνο θαη ηεο έληνλεο πηθξήο γεχζεο (Ciafardini et al., 1994, Ciafardini and Zullo, 2002). Οη ειηέο, νη νπνίεο πξννξίδνληαη γηα ηελ παξαγσγή πξάζηλσλ ειηψλ Ηζπαληθνχ ηχπνπ, κεηαρεηξίδνληαη ζπλήζσο θαηά ηελ επεμεξγαζία ηνπο κε βάζε (NaOH) γηα λα απνηθνδνκήζνπλ ρεκηθά ην γιπθνδίηε ειεπξσπαΐλε, ν νπνίνο είλαη ππεχζπλνο γηα ηελ πηθξή γεχζε ζηηο ειηέο, φπσο θαη πξναλαθέξζεθε. Οη Garrido-Fernandez θαη Vaughn 94

113 (1978) κάιηζηα αλέθεξαλ ήδε φηη ζπγθεθξηκέλνη κηθξννξγαληζκνί ζπζρεηηδφκελνη κε ηηο επηηξαπέδηεο ειηέο ήηαλ ηθαλνί λα ρξεζηκνπνηήζνπλ ηελ ειεπξσπαΐλε ρσξίο ζεκαληηθή θαζπζηέξεζε ζηελ αλάπηπμή ηνπο. Αξγφηεξα, νη Ciafardini θαη ζπλ. (1994) αλέθεξαλ επίζεο απηήλ ηελ ηθαλφηεηα γηα πνηθίια ζηειέρε Lactobacillus. H παξνπζία δπκψλ ηθαλψλ λα θαηαλαιψζνπλ βηνινγηθά θαηλνιηθέο ελψζεηο (ελ κέξεη ιφγσ ηεο δξαζηεξηφηεηαο β-γιπθνζηδάζεο) ζα κπνξνχζε λα κεηψζεη ηηο κεγάιεο πνζφηεηεο απνβιήησλ ειαηνπξγείσλ πνπ παξάγνληαη θαηά ηε κεηαρείξηζε κε άιθαιη γηα ην μεπίθξηζκα ηνπ θαξπνχ, νδεγψληαο ηαπηφρξνλα ζε έλα πην θπζηθφ πξντφλ. Oη Psani θαη Kotzekidou (2006) αλέθεξαλ ηελ παξνπζία πνηθίισλ ζηειερψλ D. Hansenii θαη Τ. delbrueckii ηθαλψλ λα αλαπηπρζνχλ παξνπζία ειεπξσπαΐλεο σο ηε κφλε πεγή άλζξαθα. Ο Βatista-Gallego θαη ζπλ. (2011) βξήθαλ πνηθίια ζηειέρε ηνπ W. Anomalus, ηα νπνία έδεημαλ ηζρπξέο δξαζηεξηφηεηεο β-γιπθνζηδάζεο ζε δνθηκέο ηξπβιίσλ κε άγαξ, ελψ ν Romo-Sanchez θαη ζπλ. (2010) θαη ν Silva θαη ζπλ. (2011) αλέθεξαλ απηήλ ηελ ηδηφηεηα γηα δηάθνξα ζηειέρε ηνπ Pichia caribbica θαη Candida oleophila, αληηζηνίρσο, ηα νπνία απνκνλψζεθαλ απφ ηε δχκσζε ειηάο Σαπηνπνίεζε επηθξαηνύζαο κηθξνρισξίδαο κε κνξηαθέο κεζόδνπο Ο Πίλαθαο 5.3. ζπγθεληξψλεη ηα πην ζπρλά αλαθεξφκελα είδε δπκψλ επηηξαπέδησλ ειηψλ πνπ ηαπηνπνηήζεθαλ απνθιεηζηηθά κε κνξηαθέο κεζφδνπο. ε απηφλ ηνλ πίλαθα κπνξνχκε λα δνχκε πσο κεξηθά είδε (S. cerevisiae, W. anomalus, C. boidinii, C. diddensiae, P. galeiformis, P. membranifaciens θαη K. lactis) ζπρλά αλαθέξνληαη ζε πνιιέο δεκνζηεχζεηο θαη κπνξνχλ λα ζεσξεζνχλ σο κέξνο ηεο ζπλήζνπο κηθξνρισξίδαο δπκψλ πνπ βξίζθεηαη ζε επηηξαπέδηεο ειηέο. 95

114 Πίλαθαο 5.3. Σα θπξίαξρα είδε δπκψλ πνπ ηαπηνπνηνχληαη κε κνξηαθέο κεζφδνπο ζπρλά απνκνλσκέλα απφ επηηξαπέδηεο ειηέο ζχκθσλα κε ηνλ ηχπν πξνεηνηκαζίαο, ηελ πνηθηιία ηεο ειηάο θαη ηε ρψξα (Αrroyo-Lopez et al., 2012c). Φώξα Πνηθηιία ειηάο Τύπνο επεμεξγαζίαο Ηζπαλία Alorena de παζκέλεο, Malaga απεπζείαο εκβαπηηζκέλεο ζε άικε πξ. ειηέο Gordal and Manzanilla Arbequina Hojiblanca and Manzanilla Gordal and Manzanilla Arbequina and Cornicabra απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο Απνζήθεπζε ψξηκσλ ειηψλ Ηζπαληθνχ ηχπνπ Φξέζθνη θαξπνί, ειαηνδχκε θαη ειαηνππξήλαο Πνξηνγαιία *NMBA απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο Manzanilla παζκέλεο, απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο Γαιιία *NMBA απεπζείαο εκβαπηηζκέλεο ζε άικε καχξεο ειηέο Διιάδα Κνλζεξβνιηά απεπζείαο εκβαπηηζκέλεο ζε άικε καχξεο ειηέο Τα πην ζπρλά Αλαθνξέο αλαθεξόκελα είδε δπκώλ S. cerevisiae, Arroyo Lopez et L. occidentalis, al. (2006), G. candidum, C. apicola C.diddensiae, Abriouel et al. P. galeiformis, (2011) P. membranifaciens Bautista-Gallego et al. (2011) C. tropicalis, Bautista-Gallego P. galeiformis, et al. (2011) W.anomalus C. boidinii, C. sorbosa, C. diddensiae, C. membranifaciens, K. lactis, P. membranifaciens, W. anomalus, P. kluyveri, R.glutinis C. boidinii, H. guilliermondii, S. cerevisiae, Hurtado et al. (2008, 2009) Arroyo Lopez et al. (2006) P. galeiformis P. membranifaciens Rodriguez Gomez et al, (2010) D. etchellsii, C. tropicalis, P. galeiformis, K. lactis P. caribbica, L. fermentati, N. holstii P. membranifaciens, P. fermentans, S. cerevisiae, C. oleophila C. matritensis, Z. mrakii, S. cerevisiae W. anomalus, C. boidinii, D. etchellsii P. pulcherrima, D. hansenii, A. pollutans, P. membranifaciens, W. anomalus, C. olivae Bautista-Gallego et al. (2011) Romo-Sanchez et al. (2010) Silva et al. (2011) Alves et al. (2012) Coton et al. (2006) Nisiotou et al. (2010) 96

115 Ηηαιία Κνλζεξβνιηά Brandofino, Castriciana, Nocellara del Belice, and Passalunara Nocellara dell Etna, Tonda di Cagliari, Pizz e Carroga απεπζείαο εκβαπηηζκέλεο ζε άικε καχξεο ειηέο απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο απεπζείαο εκβαπηηζκέλεο ζε άικε πξάζηλεο ειηέο P. membranifaciens Doulgeraki et al. (2012) C. parapsilopsis, P. guilliermondii, P. Kluyveri S. cerevisiae, W.anomalus, C. diddensiae, I. orientalis Aponte et al. (2010) Muccilli et al. (2011) P. guilliermondii Tofalo et al. (2012) *NMBA, δελ αλαθέξζεθε απφ ζπγγξαθείο 97

116 Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) Οη παξαθάησ εηθφλεο δείρλνπλ ην πξντφλ ηεο αληίδξαζεο PCR 30 ζηειερψλ δπκψλ πνπ απνκνλψζεθαλ απφ ην OMWs θαη εληζρχζεθαλ κε ηελ PCR. Δηθόλα 5.1. Πξντφληα ελίζρπζεο PCR ησλ ζηειερψλ (2), (3), (4), (5), (6), (7), (8) θαη κάξηπξαο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder/ Ηnvitrogen) (1). Απφ ηελ Δηθφλα 5.1. θαίλεηαη φηη ηα ζηειέρε θαη ην αλήθνπλ πηζαλφλ ζην ίδην είδνο, αθνχ έρνπλ παξφκνην αξηζκφ δεπγψλ βάζεσλ (841 base pairs). Αληίζεηα, ηα ζηειέρε θαη έρνπλ κηθξφηεξν αξηζκφ δεπγψλ βάζεσλ απφ ηα πξνεγνχκελα (425 base pairs), νπφηε αλήθνπλ πηζαλφλ ζε θάπνην άιιν είδνο δπκψλ. ε αληίζηνηρε εξγαζία ησλ Bautista - Gallego θαη ζπλ. (2011) ζηελ νπνία ρξεζηκνπνηήζεθαλ νη ίδηνη πξηκνδφηεο (primers) ITS 1 θαη ΗTS 4, βξέζεθε φηη ηα πξντφληα ελίζρπζεο PCR 8 ζηειερψλ 850 βάζεσλ (bp) απνκνλσκέλσλ απφ ηελ πνηθηιία ειηάο Αlorena ηαπηνπνηήζεθαλ ζε πνζνζηφ 100% ζην είδνο Saccharomyces cerevisiae. Αληίζεηα, ηα πξντφληα ελίζρπζεο PCR 15 ζηειερψλ 450 βάζεσλ (bp) απνκνλσκέλσλ απφ ηελ πνηθηιία 98

117 ειηάο Manzanilla, αλήθαλ ζε θάπνην άιιν είδνο δπκψλ θαη πην ζπγθεθξηκέλα ηαπηνπνηήζεθαλ ζε πνζνζηφ 100% ζην είδνο Pichia galeiformis. Δηθόλα 5.2. Πξντφληα ελίζρπζεο PCR ησλ ζηειερψλ (2), (3), (4), (5), (6), (7), (8), (9) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (1). H Δηθφλα 5.2. δείρλεη φηη ηα ζηειέρε 2.0.8, θαη αλήθνπλ πηζαλφλ ζην ίδην είδνο, αθνχ έρνπλ παξφκνην αξηζκφ δεπγψλ βάζεσλ (841 bp) (Όκνηα κε θαη απφ Δηθφλα 5.1.). Ζ απεηθφληζε θαη ησλ ππφινηπσλ 15 ζηειερψλ απφ ηα 30 πνπ απνκνλψζεθαλ έδεημε ηα ίδηα απνηειέζκαηα κε απηά ηεο Δηθφλαο 5.2. Δπνκέλσο, κε εμαίξεζε ηα ζηειέρε θαη , ηα νπνία απνηεινχληαη απφ 425 βάζεηο, φια ηα ππφινηπα απνηεινχληαη απφ 841 βάζεηο θαη θαίλεηαη λα αλήθνπλ ζην ίδην είδνο. 99

118 Πνιπκνξθηζκόο κήθνπο ζξαύζκαηνο από έλδπκν πεξηνξηζκνύ γελσκηθνύ DNA (RFLP). Γηα λα δηεπθξηληζηεί εάλ εκθαλίδνληαη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna πξαγκαηνπνηήζεθε πέςε κε ηξία έλδπκα πεξηνξηζκνχ. Γηα απηφ ην ιφγν, ην γνλίδην 5.8S rrna (πξντφλ PCR 841bp 28 ζηειέρε θαη πξντφλ PCR 425 bp 2 ζηειέρε) ππέζηεζαλ πέςε κε ηα έλδπκα πεξηνξηζκνχ EcoRI, ΖaeIII θαη HinfI θαη ζηε ζπλέρεηα αλαιχζεθαλ ζε πεθηή αγαξνδεο. Α) Σα απνηειέζκαηα ρξήζεο ηνπ EcoRI θαίλνληαη ζηηο παξαθάησ εηθφλεο: Δηθόλα 5.3. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7) θαη (8). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ EcoRI (δηαδξνκέο 2-8) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκή 1). H Δηθφλα 5.3. δείρλεη φηη ηα ζηειέρε θαη αλήθνπλ πηζαλφλ ζην ίδην είδνο επηβεβαηψλνληαο ηα απνηειέζκαηα ηεο PCR, αθνχ εληνπίζηεθαλ νη ίδηνη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna θαηά ηελ πέςε κε ην έλδπκν EcoRI ζηε ζέζε 100

119 αλαγλψξηζεο 474. Γεκηνπξγήζεθαλ δειαδή δχν ηκήκαηα κεγέζνπο 363 θαη 478 δεπγψλ βάζεσλ (base pairs). Tα ζηειέρε θαη αλήθνπλ κάιινλ ζε θάπνην άιιν είδνο δπκψλ αθνχ ζε απηά ην γνλίδην 5.8S rrna δελ πέπηεηαη απφ ην έλδπκν EcoRI θαη δελ εκθαλίδνληαη πνιπκνξθηζκνί. Ζ απεηθφληζε θαη ησλ ππφινηπσλ 23 ζηειερψλ απφ ηα 30 πνπ απνκνλψζεθαλ έδεημε ηα ίδηα απνηειέζκαηα κε ηα ζηειέρε θαη Δπνκέλσο, κε εμαίξεζε ηα ζηειέρε θαη , ηα ππφινηπα 28 θαίλεηαη λα αλήθνπλ ζην ίδην είδνο Β) Σα απνηειέζκαηα ρξήζεο ηνπ ΖaeIII θαίλνληαη ζηηο παξαθάησ εηθφλεο: Δηθόλα 5.4. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7) θαη (8), (9), (10) θαη (11). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HaeIII (δηαδξνκέο 2-11) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκέο 1, 12). ηε δηαδξνκή 13 απεηθνλίδεηαη ην πξντφλ ελίζρπζεο PCR H Δηθφλα 5.4. δείρλεη φηη ηα ζηειέρε , θαη αλήθνπλ πηζαλφλ ζην ίδην είδνο, αθνχ εληνπίζηεθαλ νη ίδηνη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna θαηά 101

120 ηελ πέςε κε ην έλδπκν HaeIII ζηηο ζέζεηο αλαγλψξηζεο 132, 304 θαη 615bp. Γεκηνπξγήζεθαλ δειαδή ηέζζεξα ηκήκαηα κεγέζνπο 132, 172, 226 θαη 311 δεπγψλ βάζεσλ (base pairs). ηελ Δηθφλα 5.4. δηαθξίλεηαη επίζεο θαζαξά (δηαδξνκή 13), ην πξντφλ ελίζρπζεο ηεο PCR, απφ ηελ πέςε ηνπ νπνίνπ κε ην HaeIII πξνήιζαλ ηα ηέζζεξα ηκήκαηα ζηα ππφινηπα ζηειέρε. Δηθόλα 5.5. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (1), (2), (3), (4), (5) θαη (6), (7), (8), (9) θαη (10). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HaeIII (δηαδξνκέο 1-10) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Ηnvitrogen) (δηαδξνκή 11) H Δηθφλα 5.5. δείρλεη φηη ηα ζηειέρε , , θαη αλήθνπλ πηζαλφλ ζην ίδην είδνο, αθνχ εληνπίζηεθαλ νη ίδηνη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna θαηά ηελ πέςε κε ην έλδπκν HaeIII ζηηο ζέζεηο αλαγλψξηζεο 132, 304 θαη 615bp. Γεκηνπξγήζεθαλ δειαδή ηέζζεξα ηκήκαηα κεγέζνπο 132, 172, 226 θαη 311 δεπγψλ βάζεσλ (base pairs). Tα ζηειέρε θαη αλήθνπλ κάιινλ ζε θάπνην άιιν είδνο δπκψλ αθνχ θαηά ηελ πέςε κε ην έλδπκν HaeIII ζηε ζέζε αλαγλψξηζεο 115 bp, δεκηνπξγνχληαη δχν ζξαχζκαηα κεγέζνπο 115 bp θαη 310 bp. Ζ απεηθφληζε θαη ησλ ππφινηπσλ 10 ζηειερψλ απφ ηα 30 πνπ απνκνλψζεθαλ έδεημε ηα ίδηα απνηειέζκαηα κε 102

121 ηα ζηειέρε , , θαη (Δηθφλα 5.5.) θαζψο θαη ηα θαη (Δηθφλα 5.4.). Δπνκέλσο, κε εμαίξεζε ηα ζηειέρε θαη , ηα ππφινηπα 28 θαίλεηαη αλήθνπλ ζην ίδην είδνο. Γ) Σα απνηειέζκαηα ρξήζεο ηνπ ΖinfI θαίλνληαη ζηηο παξαθάησ εηθφλεο: Δηθόλα 5.6. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7)., (8), (9), (10)., (11), (12), (13) θαη (14). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HinfI (δηαδξνκέο 2-14) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder / Invitrogen) (δηαδξνκή 1). H Δηθφλα 5.6. δείρλεη φηη πηζαλφλ ηα ζηειέρε , , , θαη αλήθνπλ ζην ίδην είδνο, αθνχ εληνπίζηεθαλ νη ίδηνη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna θαηά ηελ πέςε κε ην έλδπκν HinfI ζηηο ζέζεηο αλαγλψξηζεο 120, 482 θαη 490bp. Γεκηνπξγήζεθαλ δειαδή ηέζζεξα ηκήκαηα κεγέζνπο 8, 120, 351 θαη 362 δεπγψλ βάζεσλ (base pairs). Tα ζηειέρε θαη αλήθνπλ ζε θάπνην άιιν είδνο δπκψλ αθνχ θαηά ηελ πέςε ηνπο κε ην έλδπκν HinfI δίλνπλ δηαθνξεηηθνχο πνιπκνξθηζκνχο ζε ζρέζε κε ηα ππφινηπα (82 bp, 162 bp θαη 181 bp). 103

122 Αμίδεη λα ζεκεησζεί φηη ηα δχν ζξαχζκαηα κεγέζνπο 351 bp θαη 362 bp δελ κπνξνχλ λα δηαθξηζνχλ ζηελ εηθφλα γηαηί βξίζθνληαη πνιχ θνληά κεηαμχ ηνπο. Δπίζεο, ην πξψην ζξαχζκα κεγέζνπο 8 bp επίζεο δελ κπνξεί λα θαλεί ζηελ εηθφλα ιφγσ ηνπ πνιχ κηθξνχ κεγέζνπο ηνπ. Δηθόλα 5.7. Hιεθηξνθφξεζε ζε πεθηή αγαξφδεο 2,5% (w/v) ησλ πξντφλησλ ελίζρπζεο ηεο πεξηνρήο ηνπ γνληδίνπ 5.8S rrna ησλ ζηειερψλ (2), (3), (4), (5), (6), (7)., (8), (9), (10), (11), (12), (13) θαη (14). Θξαχζκαηα PCR ησλ παξαπάλσ ζηειερψλ κεηά απφ πέςε κε ην έλδπκν πεξηνξηζκνχ HinfI (δηαδξνκέο 2-13) θαη κάξηπξεο DNA κνξηαθνχ κεγέζνπο 100 bp (100bp DNA ladder /Invitrogen) (δηαδξνκή 1) H Δηθφλα 5.7. δείρλεη φηη ηα ζηειέρε , , θαη αλήθνπλ ζην ίδην είδνο επηβεβαηψλνληαο ηα απνηειέζκαηα ηεο PCR, αθνχ εληνπίζηεθαλ νη ίδηνη πνιπκνξθηζκνί ζην γνλίδην 5.8S rrna θαηά ηελ πέςε κε ην έλδπκν HinfI ζηηο ζέζεηο αλαγλψξηζεο 120, 482 θαη 490 bp. Γεκηνπξγήζεθαλ δειαδή ηέζζεξα ηκήκαηα κεγέζνπο 8, 120, 351 θαη 362 δεπγψλ βάζεσλ (base pairs). Ζ απεηθφληζε θαη ησλ ππφινηπσλ 6 ζηειερψλ απφ ηα 30 πνπ απνκνλψζεθαλ έδεημε ηα ίδηα απνηειέζκαηα κε ηα ζηειέρε , , , θαη (Δηθφλα 5.6.) θαζψο θαη ηα , θαη (Δηθφλα 5.7.). 104

123 Αλάιπζε αθνινπζίαο (Sequence analysis) Σα 30 ζηειέρε δπκψλ ρσξίζηεθαλ, φπσο πξναλαθέξζεθε, ζε 6 νκάδεο (Πίλαθαο 5.5.) κε βάζε: α) ηηο βηνρεκηθέο ηνπο ηδηφηεηεο θαη β) ηα απνηειέζκαηα ηεο PCR θαη ηεο RFLP. Έλαο αληηπξφζσπνο απφ θάζε νκάδα επηιέρζεθε ηπραία λα ζηαιεί γηα αλάιπζε αθνινπζίαο (sequence analysis ή sequencing) ζην εξεπλεηηθφ θέληξν CEMIA (CEllular and Molecular Immunological Applications) πνπ εδξεχεη ζηελ πεξηνρή ηεο Λάξηζαο. Γεδνκέλνπ φηη φια ηα ζηειέρε ήηαλ ζεηηθά ζηελ θαηαιάζε θαη ζηε β-γιπθνζηδάζε, θαζψο θαη αξλεηηθά ζηε ιηπάζε θαη ηε μπιαλάζε, ε δηαθνξνπνίεζε ησλ ζηειερψλ κε βάζε ηηο βηνρεκηθέο δξαζηεξηφηεηεο ζηεξίρζεθε ζηα έλδπκα πξσηεάζε, εζηεξάζε θαη πνιπγαιαθηνπξνλάζε, ζηα νπνία ηα ζηειέρε αληέδξαζαλ δηαθνξεηηθά (Πίλαθαο 5.4.). Πίλαθαο 5.4. Γηαθνξνπνίεζε ζηειερψλ δπκψλ κε βάζε ηηο βηνρεκηθέο δνθηκέο Έλδπκα Πξσηεάζε Πνιπγαιαθηνπξνλάζε Δζηεξάζε _ + _ _ _ _ + _ _ _ _ + _ _ + _ _ _ _ _ + _ _ + _ _ + _ _ + _ _ _ _ + _ _ _ _ _

124 Πίλαθαο 5.5. Οκαδνπνίεζε ζηειερψλ δπκψλ κε βάζε ηηο βηνρεκηθέο δνθηκέο Οκάδεο 1ε 2ε 3ε 4ε 5ε 6ε Σα ππνγξακκηζκέλα ζηειέρε ηνπ Πίλαθα 5.5. επηιέρζεθαλ ηπραία λα ζηαινχλ γηα αλάιπζε αθνινπζίαο κεηά θπζηθά ηνλ θαζαξηζκφ ηνπο. Ζ αιιεινπρία ησλ βάζεσλ ηνπ γνληδίνπ 5.8S rrna πνπ απνκνλψζεθε ζηελ παξνχζα κειέηε απφ ηα ζηειέρε , , & (4 ζηειέρε) ζπγθξίζεθε κε ηα αληίζηνηρα ηκήκαηα (βάζεηο) ηεο αιιεινπρίαο βάζεσλ άιισλ 5.8S rrna γνληδίσλ πνπ απνκνλψζεθαλ απφ άιινπο κηθξννξγαληζκνχο κε ηε ρξήζε ηνπ πξνγξάκκαηνο Blastn (http://blast.ncbi.nlm.nih.gov/blast.cgi). Σα απνηειέζκαηα έδεημαλ φηη θαζέλα απφ ηα παξαπάλσ ζηειέρε παξνπζηάδεη 99% νκνινγία κε ηηο αληίζηνηρεο αιιεινπρίεο άιισλ 10 κηθξννξγαληζκψλ πνπ αλήθνπλ ζην είδνο Saccharomyces cerevisiae. Ζ αιιεινπρία ησλ βάζεσλ ηνπ γνληδίνπ 5.8S rrna πνπ απνκνλψζεθε ζηελ παξνχζα κειέηε απφ ηα ζηειέρε θαη ζπγθξίζεθε κε ηα αληίζηνηρα ηκήκαηα (βάζεηο) ηεο αιιεινπρίαο βάζεσλ άιισλ 5.8S rrna γνληδίσλ πνπ απνκνλψζεθαλ απφ άιινπο κηθξννξγαληζκνχο κε ηε ρξήζε ηνπ πξνγξάκκαηνο Blastn (http://blast.ncbi.nlm.nih.gov/blast.cgi). Σα απνηειέζκαηα έδεημαλ φηη θαζέλα απφ ηα παξαπάλσ ζηειέρε παξνπζηάδεη 99% νκνινγία κε ηηο αληίζηνηρεο αιιεινπρίεο άιισλ 9 κηθξννξγαληζκψλ πνπ αλήθνπλ ζε είδε ηνπ γέλνπο Pichia θαη 95% νκνινγία κε έλαλ κηθξννξγαληζκφ πνπ αλήθεη ζην είδνο Pichia membranifaciens. Πην ζπγθεθξηκέλα, πξαγκαηνπνηήζεθε αλάιπζε αιιεινπρίαο ζην γνλίδην 5.8S rrna ζε 4 ζηειέρε δπκψλ 841 βάζεσλ (bp) γηα ηελ ηαπηνπνίεζή ηνπο. Ζ αιιεινπρία βάζεσλ ζην παξαπάλσ γνλίδην γηα ην ζηέιερνο θαη ε ζχγθξηζή ηεο κε αληίζηνηρεο ζηε 106

125 βάζε δεδνκέλσλ θαίλνληαη ζηα παξαθάησ ζρήκαηα, ελψ παξφκνηα είλαη ε αιιεινπρία βάζεσλ θαη γηα ηα ππφινηπα 27 ζηειέρε 841 βάζεσλ (bp). Query 19 TTTTGAATGGAtttttttGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACA 78 Sbjct 5 TTTTGAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACA 64 Query 79 AGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGT 138 Sbjct 65 AGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGT 124 Query 139 TTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAA 198 Sbjct 125 TTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAA 184 Query 199 ACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCAT 258 Sbjct 185 ACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCAT 244 Query 259 TCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTT 318 Sbjct 245 TCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTT 304 Query 319 TGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACG 378 Sbjct 305 TGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACG 364 Query 379 GATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTG 438 Sbjct 365 GATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTG 424 Query 439 CAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGG 498 Sbjct 425 CAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGG 484 Query 499 GCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTC 558 Sbjct 485 GCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTC 544 Query 559 TTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGttttttttCCAAAGAGAGGT 618 Sbjct 545 TTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGT 604 Query 619 TTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGC 678 Sbjct 605 TTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGC 664 Query 679 TAATCtttttttATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCR 738 Sbjct 665 TAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCG 724 Query 739 AACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATA 798 Sbjct 725 AACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATA 784 Query 799 TCATA 803 Sbjct 785 TCATA 789 ρήκα 5.7. χγθξηζε ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ηνπ πξηκνδφηε ITS 1 (forward) γηα ην ζηέιερνο (Query) κε ηελ αληίζηνηρε ζηειέρνπο Saccharomyces cerevisiae (Sbjct) θαη νκνινγία απηψλ (99%). 107

126 Απφ ηελ παξαπάλσ ζχγθξηζε δηαπηζηψζεθε φηη ε αιιεινπρία βάζεσλ ζην γνλίδην 5.8S rrna ηνπ ζηειέρνπο παξνπζηάδεη νκνινγία 99% κε ηελ αληίζηνηρε ζηειέρνπο ηνπ είδνπο Saccharomyces cerevisiae. Ζ ζχγθξηζε επίζεο ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ησλ ππφινηπσλ 3 ζηειερψλ 841 bp κε ηελ αληίζηνηρε απφ ζηειέρε Saccharomyces cerevisiae έδεημε θαη απηή νκνινγία 99%. Δπνκέλσο, ηα 28 ζηειέρε 841 bp θαίλεηαη λα αλήθνπλ ζην είδνο Saccharomyces cerevisiae. Όζνλ αθνξά ην ζηέιερνο , ε αιιεινπρία βάζεσλ ζην γνλίδην 5.8S rrna θαη ε ζχγθξηζή ηεο κε αληίζηνηρεο ζηε βάζε δεδνκέλσλ θαίλνληαη παξαθάησ. Query 23 CACACATGCGTGAGCGCACAAAACACATAAACCGTGAGTAATTTTAGTCGAAACTTGaaa 82 Sbjct 3 CACACATGCGTGAGCGCACAAAACACATAAACCGTGAGTAATTTTAGTCGAAACTTGAAA 62 Query 83 aacaaaaaatacaaaactttcaacaacggatctcttggttctcgcatcgatgaagagcgc 142 Sbjct 63 AACAAAAAATACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGC 122 Query 143 AGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGC 202 Sbjct 123 AGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGC 182 Query 203 ACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGA 262 Sbjct 183 ACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGA 242 Query 263 GTCTTCTCTTTTGAGAAGATGCCAGAACTGGCCGTGCCACTGGCCCGGCCGAAAAGAAAC 322 Sbjct 243 GTCTTCTCTTTTGAGAAGATGCCAGAACTGGCCGTGCCACTGGCCCGGCCGAAAAGAAAC 302 Query 323 GTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAATATATATCAT 382 Sbjct 303 GTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAATATATATCAT 362 Query 383 TGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCA-TARGCGG 440 Sbjct 363 TGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAGTAAGCGG 421 ρήκα 5.8. χγθξηζε ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ηνπ πξηκνδφηε ITS 1 (forward) γηα ην ζηέιερνο (Query) κε ηελ αληίζηνηρε ζηειέρνπο πνπ αλήθεη ζε είδνο ηνπ γέλνπο Pichia (Sbjct) θαη νκνινγία απηψλ (99%). Ζ νκνινγία είλαη 95% κε ζηέιερνο Pichia membranifaciens Απφ ηελ παξαπάλσ ζχγθξηζε δηαπηζηψζεθε φηη ε αιιεινπρία βάζεσλ ζην γνλίδην 5.8S rrna ηνπ ζηειέρνπο παξνπζηάδεη νκνινγία 99% κε είδε ηνπ γέλνπο Pichia θαη νκνινγία 95% κε ηελ αληίζηνηρε ζηειέρνπο ηνπ είδνπο Pichia membranifaciens. Ζ ζχγθξηζε επίζεο ηεο αιιεινπρίαο βάζεσλ ζην γνλίδην 5.8S rrna ηoπ ζηειέρνπο κε ηελ αληίζηνηρε εηδψλ ηνπ γέλνπο Pichia έδεημε νκνινγία 99% θαη κε ζηέιερνο Pichia membranifaciens έδεημε νκνινγία 95%. Δπνκέλσο, ηα ζηειέρε θαη θαίλεηαη 108

127 λα αλήθνπλ θαηά 99% ζε είδε ηνπ γέλνπο Pichia θαη θαηά 95% ζην είδνο Pichia membranifaciens. πκπεξαζκαηηθά, απφ ηα 30 ζηειέρε δπκψλ πνπ απνκνλψζεθαλ ηα 28 αλήθνπλ θαηά 99% ζην είδνο Saccharomyces cerevisiae, ελψ κφλν ηα ζηειέρε θαη αλήθνπλ θαηά 99% ζε είδε ηνπ γέλνπο Pichia θαη θαηά 95% ζην είδνο Pichia membranifaciens. H ηαπηνπνίεζε ησλ παξαπάλσ εηδψλ ζπκθσλεί θαη κε ηε βηβιηνγξαθία, αθνχ κεηαμχ άιισλ, δχκεο ηνπ γέλνπο Pichia (P. membranifaciens, P. fermentans θαη P. holstii), θαη ηνπ γέλνπο Saccharomyces (S.cerevisiae) έρνπλ απνκνλσζεί απφ ΟΟΜW (Bleve et al., 2011; Sinigaglia et al., 2010 ; Mouncif et al., 1993). Ζ ηαπηφηεηα αιιεινπρίαο (Sequence ID) ζηειερψλ, ηα νπνία ζπγθξίζεθαλ κε ηα δηθά καο ζηειέρε θαίλεηαη ζηνλ παξαθάησ πίλαθα. Πίλαθαο 5.6. Tαπηφηεηεο αιιεινπρίαο ησλ ζηειερψλ κε ηα νπνία ζπγθξίζεθαλ ηα δηθά καο ζηειέρε ζηε βάζε δεδνκέλσλ ηνπ NCBI (Γηα ηα ζηειέρε 841 βάζεσλ αλαθέξνληαη ελδεηθηηθά θάπνηα ζηειέρε απφ ηα 28, αθνχ δελ έρνπλ δηαθνξέο θαη θαίλεηαη λα αλήθνπλ θαηά 99% ζην είδνο Saccharomyces cerevisiae) ηειέρε Sequence ID (ITS 1 forward) dbj AB (ITS 4 reverse) gb GU (ITS 1 forward) gb JN (ITS 4 reverse) gb JN (ITS 1 forward) gb KC (ITS 4 reverse) gb EU (ITS 1 forward) gb JN (ITS 4 reverse) gb JN (ITS 1 forward) gb KC (ITS 4 reverse) gb EU (ITS 1 forward) gb KC (ITS 4 reverse) gb EU

128 5.5. Μειέηε θπζηθνρεκηθώλ ραξαθηεξηζηηθώλ θαηά ηε δηάξθεηα ηεο δύκσζεο Ζ κεηαβνιή ησλ θπζηθνρεκηθψλ ραξαθηεξηζηηθψλ θαηά ηε δηάξθεηα ηεο δχκσζεο απνδίδεηαη ζηνλ Πίλαθα 5.7. Πίλαθαο 5.7. Φπζηθνρεκηθά ραξαθηεξηζηηθά θαηά ηε δηάξθεηα ηεο δχκσζεο ηνπ ζηεξενχ ππνιείκκαηνο θνζθίληζεο ησλ πγξψλ απνβιήησλ ζε 6% NaCl *. Γηα ην θάζε ραξαθηεξηζηηθφ, νη ηηκέο κε ην ίδην γξάκκα (εθζέηεο) δελ έρνπλ ζηαηηζηηθψο ζεκαληηθή δηαθνξά ζε επίπεδν P<0.05. ph Τγξαζία % Ομχηεηα % Ο.Φ.Δ.** (mg GAE/g μεξνχ βάξνπο) Γ...*** ( % Βrix) Πξηλ ηε δχκσζε 4,64 a 88,55 a 0,42 a 27,62 a 11,3 a Μεηά ηε δχκσζε 4,47 a 85,53 a 0,36 a 20,14 b 11,1 a * oη ηηκέο είλαη κέζνη φξνη ηξηψλ επαλαιήςεσλ **oιηθέο θαηλνιηθέο ελψζεηο ***δηαιπηά ζηεξεά ζπζηαηηθά Παξαηεξείηαη φηη ην ph δε κεηαβιήζεθε ζηαηηζηηθά ζεκαληηθά θαηά ηε δηάξθεηα ηεο δχκσζεο γεγνλφο πνπ κπνξεί λα εμεγεζεί απφ ηελ απνπζία γαιαθηηθψλ βαθηεξίσλ θαη επνκέλσο ηε κε παξαγσγή γαιαθηηθνχ νμένο, ην νπνίν ζα κπνξνχζε λα πξνθαιέζεη κεγάιε πηψζε ηνπ ph. Ζ δξάζε ησλ δπκψλ δε θαίλεηαη λα ζπλδέεηαη έληνλα κε παξαγσγή νμέσλ πνπ ζα κπνξνχζε λα επεξεάζεη ζεκαληηθά ην ph. Aμίδεη επίζεο λα ζεκεησζεί φηη νη κεηαβνιέο ηνπ ph ήηαλ κε ζεκαληηθέο θαζφιε ηεο δηάξθεηα ηεο δχκσζεο (0, 2, 5, 7, 10 & 14 εκέξεο) θαη φρη κφλν ζηελ αξρή θαη ην ηέινο απηήο. Όζνλ αθνξά ηελ πεξηεθηηθφηεηα ζε πγξαζία ηνπ πνιηνχ ειηάο OMWs θαηά ηε δηάξθεηα ηεο δχκσζεο, απηή πξνζδηνξίζηεθε ζε πνζνζηφ θαηά κέζν φξν 88,55% ζηελ αξρή ηεο δχκσζεο θαη 85,53% ζην ηέινο απηήο, δειαδή κεηά απφ 14 εκέξεο. Δλδηάκεζα, δελ παξαηεξήζεθαλ επίζεο ζηαηηζηηθψο ζεκαληηθέο κεηαβνιέο. Γεληθά, ε πγξαζία ησλ πγξψλ απνβιήησλ θαηά βάξνο θπκαίλεηαη 83-94% (Davies et al., 2003). Ζ πγξαζία ηνπ πνιηνχ ειηάο είλαη ζεκαληηθή παξάκεηξνο πνηφηεηαο δηφηη πξνζδηνξίδεη ζε έλα βαζκφ ηηο δπλαηφηεηεο πεξαηηέξσ αμηνπνίεζεο θαη δηάζεζήο ηνπ. Απφ ηνλ Πίλαθα 5.7. θαίλεηαη φηη ε πγξαζία δε κεηαβιήζεθε ζηαηηζηηθά ζεκαληηθά θαηά ηε δηάξθεηα ηεο δχκσζεο. Ζ πςειή πγξαζία ηνπ πιηθνχ νθείιεηαη θαηά θχξην ιφγν ζην γεγνλφο φηη ηα δείγκαηα πξνέξρνληαη απφ ην ζηεξεφ ππφιεηκκα ηεο θνζθίληζεο πγξψλ απνβιήησλ ειαηνπξγείνπ ηα νπνία, φπσο έρεη πξναλαθεξζεί, έρνπλ πεξηεθηηθφηεηα ζε πγξαζία πεξίπνπ 80-95%. Σν πνζνζηφ πγξαζίαο ησλ εμεηαδφκελσλ 110

129 δεηγκάησλ δηαθέξεη αξθεηά απφ απηφ πνπ αλαθέξεηαη ζηε βηβιηνγξαθία (Paredes et al., 1999) γηα ζηεξεφ απφβιεην απφ ειαηνπξγείν ηξηψλ θάζεσλ θαη ην νπνίν είλαη πεξίπνπ 50%. Χζηφζν, είλαη παξφκνην κε ην πνζνζηφ πγξαζίαο πνπ έρεη βξεζεί ζε ζηεξεφ απφβιεην απφ ειαηνπξγείν δχν θάζεσλ (60-70%) (Liébanes et al., 2006). Όκσο, ηα δχν απηά πιηθά είλαη αξθεηά δηαθνξεηηθά, φπσο ζα θαλεί θαη απφ άιιεο κεηξήζεηο πνπ παξνπζηάδνληαη ζηε ζπλέρεηα. Σν ζηεξεφ ππφιεηκκα πνπ πξνέξρεηαη απφ ειαηνπξγείν ηξηψλ θάζεσλ κπνξεί λα ζεσξεζεί έλα πδαξέο ζηεξεφ, ελψ απηφ πνπ πξνέξρεηαη απφ ειαηνπξγείν δχν θάζεσλ είλαη κηα θνιιψδεο ιάζπε πνπ είλαη δχζθνιν λα κεηαθεξζεί, λα δηαρεηξηζηεί θαη λα απνζεθεπηεί. Δπίζεο, κε ηελ κέηξεζε ηεο πγξαζίαο, έγηλε θαη ν ππνινγηζκφο ηεο % πεξηεθηηθφηεηαο ηνπ δείγκαηνο ζε νιηθά ζηεξεά θαηά ηε δηάξθεηα ηεο δχκσζεο, ε νπνία ήηαλ 11,45% ζηελ αξρή θαη 14,47% ζην ηέινο απηήο. Σα νιηθά ζηεξεά, κε βάζε ηνλ πίλαθα ηεο ηππηθήο ζχζηαζεο ησλ απνβιήησλ θαηά βάξνο (Πίλαθαο 2.3.) θπκαίλνληαη ζε ηηκέο g L -1. Μεηά ηνλ δηαρσξηζκφ ησλ ζηεξεψλ (πνιηφο ειηάο OMWs) απφ ηα πγξά κέξε ησλ OMW, ηα νιηθά ζηεξεά ζηνλ πνιηφ ειηάο ΟΜWs ππνινγίζηεθαλ 114,5 g Kg -1 δείγκαηνο ζηελ αξρή ηεο δχκσζεο (0 εκέξεο) θαη 144,7 gkg -1 ζην ηέινο απηήο (14 εκέξεο). Δίλαη επίζεο πξνθαλέο απφ ηνλ Πίλαθα 5.7. φηη ε νμχηεηα δε κεηαβιήζεθε ζηαηηζηηθά ζεκαληηθά θαηά ηε δηάξθεηα ησλ 14 εκεξψλ δχκσζεο ηνπ πνιηνχ ειηάο OMW. Δλδηάκεζα ηεο δχκσζεο δελ παξαηεξήζεθαλ επίζεο ζηαηηζηηθψο ζεκαληηθέο κεηαβνιέο. Απηφ νθείιεηαη θαηαξρήλ ζηελ απνπζία γαιαθηηθψλ βαθηεξίσλ θαη κε παξαγσγή γαιαθηηθνχ νμένο. Δπίζεο, κε δεδνκέλν φηη ε νμχηεηα ππνινγίζηεθε κε βάζε ηελ % πεξηεθηηθφηεηα ζε νμηθφ νμχ, νη κε ζηαηηζηηθψο ζεκαληηθέο δηαθνξέο θαηά ηε δηάξθεηα ηεο δχκσζεο δείρλνπλ φηη ηα είδε δπκψλ πνπ επηθξαηνχλ εκθαλίδνπλ παξφκνηα ζπκπεξηθνξά σο πξνο ηελ παξαγσγή νμηθνχ νμένο. Αθφκε, ε νμχηεηα 0,36 % ηνπ πξντφληνο δχκσζεο ζεσξείηαη παξφκνηα κε ην αγνπξέιαην θαη ην εμαηξεηηθά παξζέλν ειαηφιαδν πνπ θπθινθνξνχλ ζηελ αγνξά θαη έρνπλ νμχηεηα κηθξφηεξε απφ 0,8%. Αθφκε, ζχκθσλα κε ηνπο Liébanes et al. (2006) αλαθέξεηαη φηη ε νμχηεηα απφ ζηεξεφ ππφιεηκκα ειαηνπξγείνπ δχν θάζεσλ θπκαίλεηαη κεηαμχ 0,5 θαη 1%. Απφ ηε κειέηε ηνπ Πίλαθα 5.7. παξαηεξήζεθε επίζεο κηα κηθξή γξακκηθή κείσζε ζηηο νιηθέο θαηλνιηθέο ελψζεηο. Πην ζπγθεθξηκέλα, εκθαλίζηεθε κηα πηψζε απφ ηελ ηηκή 111

130 27,62 mg γαιιηθνχ νμένο / g μεξνχ βάξνπο ζηελ ηηκή 20,14 mg γαιιηθνχ νμένο / g μεξνχ βάξνπο. Ζ κείσζε απηή ζα κπνξνχζε λα εμεγεζεί απφ ηηο απψιεηεο ιφγσ νμείδσζεο ησλ θαηλνιηθψλ νπζηψλ. ε απηφ ζπκθσλνχλ θαη νη Poiana θαη Romeo (2006), oη νπνίνη δηαπίζησζαλ φηη ην ζπλνιηθφ πεξηερφκελν ησλ θαηλνιηθψλ νπζηψλ θαηά ηελ επεμεξγαζία δηαθφξσλ πνηθηιηψλ επηηξαπέδηαο ειηάο κεηψλεηαη κεηά ηε δχκσζε. Οη πνιπθαηλφιεο ζπλζέηνπλ έλα πνιχπινθν κίγκα δεπηεξνγελψλ κεηαβνιηηψλ κέζα ζηνλ θαξπφ ηεο ειηάο, θαηέρνληαο ην 1-14% ηνπ βάξνπο ηεο μεξήο ζάξθαο. Σα θαηλνιηθά ραξαθηεξηζηηθά επεξεάδνπλ ηηο νξγαλνιεπηηθέο ηδηφηεηεο ηνπ θαξπνχ θαη απνηεινχλ ρξήζηκν δείθηε γηα ηε κειέηε ησλ ηδηαηηεξνηήησλ ησλ δηάθνξσλ πνηθηιηψλ. Ζ θαηλνιηθή ζχζηαζε ηνπ θαξπνχ ηεο ειηάο ραξαθηεξίδεηαη ηφζν απφ πνηνηηθέο φζν θαη πνζνηηθέο κεηαβνιέο νη νπνίεο εμαξηψληαη απφ ηελ πνηθηιία, ην ζηάδην σξίκαλζεο, ηελ επνρή θαη ην είδνο ηνπ ηζηνχ (Θεξηφο, 2005). Ζ αξρηθά κηθξή ζρεηηθά πεξηεθηηθφηεηα ηνπ πνιηνχ ειηάο (ΟΜWs) ζε πνιπθαηλφιεο (27,62 mg γαιιηθνχ νμένο / g μεξνχ βάξνπο ή 3,31g γαιιηθνχ νμένο /kg λσπνχ βάξνπο) νθείιεηαη ζην γεγνλφο φηη νη θαηλνιηθέο ελψζεηο απνκαθξχλνληαη κε ηα πγξφ θιάζκα (OMW L ) θαηά ην δηαρσξηζκφ ησλ OMW. Οη Michailides θαη ζπλ. (2011) αλαθέξνπλ φηη πγξά απφβιεηα απφ ειαηνπξγείν ηξηψλ θάζεσλ έρνπλ πεξηεθηηθφηεηα ζε νιηθέο θαηλνιηθέο ελψζεηο 4,3 g/l, ελψ νη Morillo θαη ζπλ. (2009) 4,98 g/l (εχξνο 0,98 10,7). Oη Tercan θαη Seker (2012) αλαθέξνπλ φηη ζηεξεφ ππφιεηκκα απφ πγξά απφβιεηα ειαηνπξγείνπ ηξηψλ θάζεσλ έρεη πεξηεθηηθφηεηα ζε πνιπθαηλφιεο 2,19 g/l θαη νη Ochando-Pulido θαη ζπλ. (2013) αλαθέξνπλ φηη ε πεξηεθηηθφηεηα ηνπ ζηεξενχ απνβιήηνπ απφ ειαηνπξγείν δχν θάζεσλ ζε νιηθέο θαηλνιηθέο ελψζεηο θπκαίλεηαη απφ 0,1 έσο 1 g/l. Όπσο είλαη θαλεξφ, ε πεξηεθηηθφηεηα ζε θαηλνιηθέο ελψζεηο θπκαίλεηαη ζε επξέα φξηα επεηδή εμαξηάηαη απφ ηελ πεξηεθηηθφηεηα ηνπ ειαηνθάξπνπ ζε θαηλνιηθέο ελψζεηο. Γεληθά, ε πνζφηεηα θαη ν ηχπνο ησλ θαηλνιηθψλ ελψζεσλ εμαξηάηαη, φπσο πξναλαθέξζεθε, απφ ηελ πνηθηιία θαη ηελ σξηκφηεηα ηνπ ειαηνθάξπνπ, ηηο θιηκαηηθέο ζπλζήθεο, ην ρξφλν απνζήθεπζεο θαη ηε κέζνδν επεμεξγαζίαο (Piperidou et al., 2000, Fiorentino et al., 2003, Allouche et al., 2004). Έγηλε ηέινο θαη πξνζδηνξηζκφο ηεο πεξηεθηηθφηεηαο (%) ηνπ ζηεξενχ ππνιείκκαηνο ησλ πγξψλ απνβιήησλ (OMWs) ζε δηαιπηά ζηεξεά ζπζηαηηθά (Γ...) θαη κε βάζε ηα απνηειέζκαηα, φπσο απηά δηαθξίλνληαη ζηνλ Πίλαθα 5.7., παξαηεξείηαη φηη ε % 112

131 πεξηεθηηθφηεηα ζε Γ... δε κεηαβάιιεηαη ζηαηηζηηθά ζεκαληηθά θαηά ηε δηάξθεηα ηεο δχκσζεο. Aμίδεη επίζεο λα ζεκεησζεί φηη νη κεηαβνιέο ζηελ π