Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA"


1 Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

2 Βασικές αρχές Μοριακής Βιολογίας Jones & Bartlett Learning 2014 Aκαδημαϊκές Εκδόσεις 2015 Burton E. Tropp Κεφάλαιο 1: Εισαγωγή στη μοριακή βιολογία

3 Το μόριο της ζωής Τρισεκατομμύρια κυττάρων Κάθε ανθρώπινο κύτταρο 46 χρωμοσώματα χρωμοσώματα γονίδιο κύτταρο 2 μέτρα DNA 6 δισ. βάσεις DNA (Α, Τ, G, C) Περίπου γονίδια Κωδικοποιούν πρωτεΐνες που συμμετέχουν στις λειτουργίες της ζωής Πρωτεΐνη

4 ΕΙΚΟΝΑ 1.17 Το «κεντρικό δόγμα» Σύμφωνα με το κεντρικό δόγμα, όπως αρχικά προτάθηκε από τον Francis Crick, η ροή πληροφοριών κατευθύνεται από το DNA στο RNA και από το RNA στην πρωτεΐνη. Το ριβόσωμα είναι το κυτταρικό οργανίδιο στο οποίο επιτελείται η πρωτεϊνοσύνθεση. Μεταγενέστερα πειράματα έδειξαν ότι η πληροφορία μπορεί επίσης να ρέει από RNA σε RNA και από RNA σε DNA (αντίστροφη μεταγραφή).

5 ΕΙΚΟΝΑ 1.18 Απλουστευμένο διάγραμμα του μηχανισμού της πρωτεϊνοσύνθεσης σε κύτταρα ζώων, φυτών ή ζυμομυκήτων Το μεταφορικό RNA (trna) μεταφέρει στο ριβόσωμα το αμινοξύ που πρέπει να συνδεθεί στο άκρο της επιμηκυνόμενης πολυπεπτιδικής αλυσίδας. Το ριβόσωμα αναγνωρίζει τη συμπλη-ρωματική τρινουκλεοδιτική αλληλουχία του trna (το αντικωδικόνιο) που ταιριάζει με το mrna (το κωδικόνιο) και μεταφέρει την επιμηκυνόμενη πολυπεπτιδική αλυσίδα στο εισερ-χόμενο αμινοξύ ενώ αυτό βρίσκεται συνδεδεμένο στο trna.

6 Το πείραμα βακτηριακού μετασχηματισμού του Griffith Αν ένας ποντικός μολυνθεί με το παθογόνο στέλεχος S του Streptococcus pneumoniae, αναπτύσσει πνευμονία και πεθαίνει. Αυτό δε συμβαίνει αν ο ποντικός μολυνθεί με το μη παθογόνο στέλεχος R ή με νεκρά, λόγω έκθεσης σε υψηλή θερμοκρασία, βακτήρια του στελέχους S. Παρουσία νεκρών, λόγω έκθεσης σε υψηλή θερμοκρασία, βακτηρίων S, τα βακτήρια R μετασχηματίζονται σε παθογόνα βακτήρια S και προκαλούν τον θάνατο του ποντικού.

7 Εικόνα 1.5 Το γενετικό υλικό του φάγου Τ2 είναι DNA.

8 ΕΙΚΟΝΑ 1.4 Οι πυριμιδίνες και οι πουρίνες του DNA (α) Πυριμιδίνες και (β) πουρίνες.

9 ΕΙΚΟΝΑ 1.6 Τα δεοξυριβονουκλεοσίδια

10 ΕΙΚΟΝΑ 1.8 Τα νουκλεοτίδια Τα νουκλεοτίδια σχηματίζονται με την προσθήκη φωσφορικών ομάδων στον δακτύλιο της πεντόζης ενός νουκλεοσιδίου. (α) Νουκλεοτίδια που σχηματίζονται με προσθήκη μιας φωσφορικής ομάδας στην 5 - υδροξυλομάδα της ουριδίνης ή της θυμιδίνης. (β) Νουκλεοτίδια που σχηματίζονται με προσθήκη μιας φωσφορικής ομάδας στην 3 - υδροξυλομάδα της ουριδίνης ή της θυμιδίνης.

11 ΕΙΚΟΝΑ 1.9 Αναπαράσταση τμήματος ενός πολυδεοξυριβονουκλεοτιδίου (α) Εκτενής αναπαράσταση στη μορφή άλατος νατρίου,


13 Εικόνα 1.10 Οι δύο αλυσίδες του DNA σχηματίζουν διπλή έλικα. e:adn_animation.gif

14 Η αντιγραφή του DNA PGlCc&feature=related

15 Εικόνα 1.12 Η αντιγραφή του DNA είναι ημισυντηρητική. https://www.yo utube.com/wat ch?v=mfndvv 518es

16 Εικόνα 1.13 Η αντιγραφική διχάλα είναι η περιοχή του DNA στην οποία το αποδιαταγμένο γονικό δίκλωνο μετατρέπεται σε αντιγραμμένα θυγατρικά δίκλωνα.

17 Εικόνα 1.16 Το ζευγάρωμα των βάσεων απαντάται στο δίκλωνο DNA, καθώς και στις ενδο- και διαμοριακές αλληλεπιδράσεις μονόκλωνων RNA (ή DNA).


19 Εικόνα 1.17 Οι αποδιαταγμένες αλυσίδες DNA μπορούν να επαναδιαταχθούν και να σχηματίσουν τη δίκλωνη μορφή.

20 Εικόνα 1.18 Με τον υβριδισμό σε φίλτρα μπορεί να ελεγχθεί αν ένα διάλυμα αποδιαταγμένου DNA (ή RNA) περιέχει αλληλουχίες οι οποίες είναι συμπληρωματικές με τις αλυσίδες που είχαν ακινητοποιηθεί στο φίλτρο.

21 Μεταλλάξεις Όλες οι μεταλλάξεις είναι αλλαγές στην αλληλουχία του DNA Συμβαίνουν αυθόρμητα ή επάγονται Χημική μετατροπή Κατά την αντιγραφή

22 Εικόνα 1.19 Ένα ζεύγος βάσεων μεταλλάσσεται με ρυθμό ανά γενιά, ένα γονίδιο bp μεταλλάσσεται με ρυθμό ~10-6 ανά γενιά και ένα βακτηριακό γονιδίωμα με ρυθμό 3 x 10-3 ανά γενιά.

23 Πρόσθιες και ανάστροφες μεταλλάξεις Οι σημειακές μεταλλάξεις και οι προσθήκες μπορεί να αναστραφούν, ενώ τα ελλείμματα δεν αναστρέφονται ποτέ. Αληθινή αναστροφή Ισοδύναμη αναστροφή

24 CpG islands Εικόνα 1.23 Αυθόρμητες μεταλλάξεις συμβαίνουν σε όλο το γονίδιο lacl της E. coli, αλλά η συγκέντρωσή τους αυξάνεται στα θερμά σημεία.

25 Εικόνα 1.24 Η απαμίνωση της κυτοσίνης παράγει ουρακίλη, ενώ η απαμίνωση της 5- μεθυλοκυτοσίνης παράγει θυμίνη.

26 Εικόνα 1.26 Τα γονίδια κωδικοποιούν πρωτεΐνες. Η επικράτηση εξηγείται από τις ιδιότητες των μεταλλαγμένων πρωτεϊνών. Ένα υποτελές αλληλόμορφο δε συνεισφέρει στο φαινότυπο, διότι δεν παράγει πρωτεΐνη (ή παράγει πρωτεΐνη που δεν είναι λειτουργική).

27 Εικόνα 1.28 Οι μεταλλάξεις που δεν επηρεάζουν την πρωτεϊνική αλληλουχία ή λειτουργία ονομάζονται σιωπηλές. Οι μεταλλάξεις που καταργούν εντελώς τη λειτουργία της πρωτεΐνης ονομάζονται εκμηδενιστικές. Οι σημειακές μεταλλάξεις που προκαλούν απώλεια λειτουργίας είναι υποτελείς, ενώ αυτές που προκαλούν απόκτηση λειτουργίας είναι επικρατείς.

28 Πολλαπλά αλληλόμορφα Εικόνα 1.29 Ο γενετικός τόπος w περιλαμβάνει μια εκτεταμένη σειρά αλληλομόρφων των οποίων οι φαινότυποι ποικίλλουν από το κόκκινο χρώμα του άγριου τύπου ως την πλήρη απώλεια χρωστικής.

29 Πολλαπλά αλληλόμορφα ομάδων αίματος

30 Εικόνα 1.31 Ο σχηματισμός χιασμάτων δημιουργεί ανασυνδυασμένα προϊόντα. https://www.youtube.com/watc h?v=ztlgi1nzuhs https://www.youtube.com/wat ch?v=bhjf9mhhmc4

31 Εικόνα 1.32 Ο ανασυνδυασμός στηρίζεται στο ζευγάρωμα συμπληρωματικών αλυσίδων ανάμεσα στα δύο γονικά δίκλωνα μόρια DNA.

32 Γενετικός κώδικας

33 Εικόνα 1.33 Οι μεταλλάξεις μετατόπισης αναγνωστικού πλαισίου δείχνουν ότι η ανάγνωση του γενετικού κώδικα γίνεται σε τριπλέτες από ένα καθορισμένο σημείο έναρξης.

34 Εικόνα 1.34 Ένα ανοικτό αναγνωστικό πλαίσιο ξεκινάει με AUG και συνεχίζει με τριπλέτες μέχρι ένα κωδικόνιο τερματισμού. Ένα κλειστό αναγνωστικό πλαίσιο διακόπτεται συχνά από κωδικόνια τερματισμού.

35 Εικόνα 1.36 Για τη σύνθεση RNA χρησιμοποιείται ως μήτρα η μία αλυσίδα του DNA, με την οποία ζευγαρώνουν οι συμπληρωματικές βάσεις των ριβονουκλεοτιδίων του νεοσυντιθέμενου RNA.

36 Εικόνα 1.46 Το μέγεθος των γονιδιωμάτων ποικίλλει ευρέως.

37 Εικόνα 1.47 Το RNA του PSTV είναι ένα κυκλικό μόριο με εκτεταμένη δευτεροταγή δομή, η οποία διακόπτεται από πολλούς εσωτερικούς βρόχους. Η οξεία μολυσματική μορφή διαφέρει από την ήπια σε τρία σημεία.

38 Κ Ε Φ Α Λ Α Ι Ο 2: Το διακοπτόμενο γονίδιο Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

39 Εικόνα 2.1 Τα διακοπτόμενα γονίδια εκφράζονται μέσω ενός πρόδρομου RNA. Τα ιντρόνια αφαιρούνται κατά το μάτισμα. Το mrna φέρει μόνο τις αλληλουχίες των εξονίων.

40 Εικόνα 2.2 Τα εξόνια διατηρούν την ίδια σειρά στο mrna όπως και στο DNA, αλλά οι αποστάσεις κατά μήκος του γονιδίου δεν αντιστοιχούν στις αποστάσεις κατά μήκος του mrna ή των πρωτεϊνικών προϊόντων. Έτσι, ενώ στο γονίδιο η απόσταση Α-Β είναι μικρότερη από την απόσταση B-C, στο mrna (και στην πρωτεΐνη) η απόσταση Α-Β είναι μεγαλύτερη από την B-C.

41 Η δομή ενός γονιδίου

42 ΕΙΚΟΝΑ 14.7 Ένα γονίδιο του αδενοϊού το οποίο κωδικοποιεί μια πρωτεΐνη του περιβλήματος του ιού διακόπτεται από τμήματα νουκλεοτιδικών αλληλουχιών τα οποία δεν εμφανίζονται στο mrna (γ) Χάρτης του διακοπτόμενου ιικού γονιδίου που κωδικοποιεί μια πρωτεΐνη του ιικού περιβλήματος. Τα εξόνια είναι μπλε και τα ιντρόνια κόκκινα.

43 ΕΙΚΟΝΑ 14.9 Η οργάνωση του γονιδίου της ωοαλβουμίνης όπως παρατηρήθηκε με ηλεκτρονική μικροσκοπία (α) Φωτογραφία ηλεκτρονικού μικροσκοπίου που δείχνει το mrna της ωοαλβουμίνης υβριδισμένο με μονόκλωνο DNA το οποίο περιέχει το γονίδιο της ωοαλβουμίνης.

44 ΕΙΚΟΝΑ 14.9 Η οργάνωση του γονιδίου της ωοαλβουμίνης όπως παρατηρήθηκε με ηλεκτρονική μικροσκοπία (β) Σχηματική αναπαράσταση της φωτογραφίας από το ηλεκτρονικό μικροσκόπιο. Τμήματα του DNA (μπλε καμπύλη) ζευγαρώνουν με συμπληρωματικές αλληλουχίες του mrna (κόκκινη καμπύλη) και σχηματίζουν δίκλωνες περιοχές υβριδίου DNA:RNA. Τα οκτώ τμήματα του γονιδίου (L και 1-7) που εκφράζονται, δηλαδή εμφανίζονται και στο mrna, ονομάζονται εξόνια. Τα επτά τμήματα του DNA, τα οποία σχηματίζουν βρόχους που προεκβάλλουν από το υβρίδιο (A-G) επειδή το mrna δε διαθέτει συμπληρωματικές αλληλουχίες με τις οποίες να μπορούσαν να υβριδιστούν, ονομάζονται παρεμ-βαλλόμενες αλληλουχίες ή ιντρόνια. Δε φαίνεται η 5 καλύπτρα m7g, αλλά μπορούμε να παρατη-ρήσουμε την 3 ουρά πολυ(a).

45 Εικόνα 2.6 Ιντρόνιο είναι μια αλληλουχία του γονιδίου η οποία απουσιάζει από το mrna (η αλληλουχία του mrna αντιστοιχεί στην αλληλουχία του cdna). Η εναλλαγή ανοικτών και σκιασμένων τριπλετών δηλώνει το πλαίσιο ανάγνωσης. Στο ιντρόνιο υπάρχουν κωδικόνια τερματισμού και στα τρία πιθανά πλαίσια ανάγνωσης.

46 https://www.youtube.com/watch?v=njhxz F--lKI (γ) Χάρτης του γονιδίου που δείχνει τα επτά ιντρόνια (γκρι) και τα οκτώ εξόνια (κόκκινα), καθώς και τον αριθμό των ζευγών βάσεων σε κάθε εξόνιο. Τα μεγέθη των ιντρονίων ποικίλλουν από 251 bp μέχρι και περίπου bp.

47 ΕΙΚΟΝΑ Κατανομή μεγεθών των εξονίων τριών γονιδιωμάτων που έχουν αλληλουχηθεί πλήρως

48 ΕΙΚΟΝΑ Κατανομή μεγεθών των ιντρονίων τριών γονιδιωμάτων που έχουν αλληλουχηθεί πλήρως (α) Ιντρόνια και (β) ιντρόνια μικρού μεγέθους (μεγέθυνση από α).

49 https://www.youtube.com/watch?v=avgwr0 QpYNE&list=PLlmkXNgGPqOQNhp9Sf4T5 s6kvog7uek3u&index=2 Εικόνα 2.7 Όλα τα λειτουργικά γονίδια σφαιρίνης έχουν διακοπτόμενη δομή με τρία εξόνια. Τα μήκη που επισημαίνονται αφορούν τα γονίδια β-σφαιρίνης των θηλαστικών.

50 Εικόνα 2.8 Στα θηλαστικά, τα γονίδια της DHFR έχουν την ίδια σχετική οργάνωση, με σχετικά μικρά εξόνια και πολύ μεγάλα ιντρόνια, αλλά το μήκος των αντίστοιχων ιντρονίων ποικίλλει σε μεγάλο βαθμό.

51 Εικόνα 2.9 Οι αλληλουχίες των γονιδίων β maj - και β min - σφαιρίνης του ποντικού εμφανίζουν μεγάλη ομοιότητα στις κωδικές περιοχές, αλλά διαφέρουν στις γύρω περιοχές και στο μεγάλο ιντρόνιο. Τα δεδομένα είναι ευγενική προσφορά του Philip Leder.

52 Ταυτοποίηση γονιδίων Ανοικτό πλαίσιο ανάγνωσης Συγγενική αλληλουχία σε άλλο είδος Πχ γνωρίζουμε γονιδιακή περιοχή υπεύθυνη για νόσο αλλά δεν γνωρίζουμε το γονίδιο Στύπωμα βιοποικιλότητας

53 Εικόνα 2.13 Στη ζύμη, τα περισσότερα γονίδια δεν είναι διακοπτόμενα. Αντίθετα, στις μύγες και στα θηλαστικά, τα περισσότερα γονίδια είναι διακοπτόμενα. Τα μη διακοπτόμενα γονίδια έχουν μόνο ένα εξόνιο και το ποσοστό τους σε κάθε οργανισμό αντιστοιχεί στο ύψος της κόκκινης ράβδου.

54 Εικόνα 2.14 Τα γονίδια της ζύμης είναι μικρά, ενώ στις μύγες και στα θηλαστικά το μέγεθός τους ποικίλλει και μπορεί να έχουν πολύ μεγάλο μήκος.

55 Εικόνα 2.15 Τα εξόνια που κωδικοποιούν πρωτεΐνες συνήθως είναι μικρά.

56 Εικόνα 2.16 Το μήκος των ιντρονίων μπορεί να κυμαίνεται από πολύ μικρό έως πολύ μεγάλο. Κατά μέσο όρο στα θηλαστικά το μήκος ενός γονίδιου είναι πενταπλάσιο από το mrna του

57 Μια αλληλουχία DNA μπορεί να κωδικοποιεί διαφορετικές πρωτεΐνες 1. Εναλλακτικά κωδικόνια έναρξης και λήξης 2. Επικαλυπτόμενα γονίδια με διαφορετικό πλαίσιο ανάγνωσης 3. Εναλλακτικό μάτισμα

58 Εικόνα 2.17 Από την έκφραση ενός γονιδίου μπορεί να παράγονται δύο πρωτεΐνες που έχουν διαφορετικά Ν- τελικά (ή C- τελικά) άκρα.

59 Εικόνα 2.18 Το ίδιο τμήμα DNA μπορεί να φέρει δύο γονίδια στα οποία η γενετική πληροφορία κωδικοποιείται σε διαφορετικά πλαίσια ανάγνωσης.

60 Εικόνα 2.19 Οι παραλλαγές α και β της τροπονίνης Τ δημιουργούνται με εναλλακτικό μάτισμα.

61 ΕΙΚΟΝΑ Πρότυπα εναλλακτικού ματίσματος που βρίσκουμε στη φύση (α-ε) Τα κόκκινα πλαίσια αντιστοιχούν σε ιδιοστατικά εξόνια, τα μπλε και πράσινα πλαίσια σε εξονικές κασέτες (ή προαιρετικά εξόνια), τα γαλάζια πλαίσια σε τμήματα στο εσωτερικό ιδιοστατικών εξονίων και οι γκρι περιοχές σε ιντρόνια. Το κίτρινο πλαίσιο είναι ένα ιντρόνιο που κάποιες φορές είναι δυνατόν να μην απομακρύνεται. Οι λεπτές γραμμές πάνω και κάτω από το pre-mrna δείχνουν τους εναλλακτικούς τρόπους συρραφής εξονίων στα διάφορα πρότυπα ματίσματος.

62 ΕΙΚΟΝΑ Εναλλακτικό μάτισμα του γονιδίου WT1 Από το γονίδιο WT1 παράγονται μέχρι και 24 διαφορετικές πρωτεϊνικές ισομορφές ως αποτέλεσμα της ύπαρξης τριών εναλλακτικών κωδικονίων έναρξης της μετάφρασης στο εξόνιο 1 (κωδικόνια CUG, AUG και AUG), του εναλλακτικού ματίσματος της εξονικής κασέτας 5 (κόκκινο πλαίσιο), των εναλλακτικών θέσεων ματίσματος στο εξόνιο 9 και άλλων μεταμεταγραφικών τροποποιήσεων. Κάθε ισομορφή διαθέτει μία επικράτεια πλούσια σε προλίνη και γλουταμίνη στο αμινοτελικό της άκρο και μία επικράτεια πρόσδεσης στο DNA η οποία αποτελείται από τέσσερα μοτίβα δακτύλου ψευδαργύρου (ZF, Zinc Finger) στο καρβοξυτελικό της άκρο. Σε ορισμένες ισομορφές, κατά το εναλλακτικό μάτισμα εισάγονται τρία αμινοξέα (KTS) μεταξύ των δακτύλων ψευδαργύρου 3 και 4. Οι πρωτεϊνικές ισομορφές WT1 που δε διαθέτουν την αλληλουχία KTS φαίνεται να λειτουργούν ως μεταγραφικοί παράγοντες, ενώ οι ισομορφές με την KTS φαίνεται να αλληλεπιδρούν με παράγοντες ματίσματος.

63 Εικόνα 2.20 Στο εναλλακτικό μάτισμα χρησιμοποιείται το ίδιο προ-mrna, αλλά δημιουργούνται μόρια mrna με διαφορετικούς συνδυασμούς εξονίων.

64 Τα εξόνια ως πρωτεϊνικές επικράτειες 1. Συντηρημένη οργάνωση ομόλογων γονιδίων ανάμεσα στα είδη 2. Εξόνια αντιστοιχούν σε πρωτεϊνικές επικράτειες με συγκεκριμένη λειτουργία 3. Συγγενικά εξόνια απαντώνται σε διαφορετικά γονίδια

65 Εικόνα 2.22 Τα εξόνια που συγκροτούν τα γονίδια των ελαφριών και βαριών αλυσίδων των ανοσοσφαιρινών αντιστοιχούν στις διακριτές επικράτειες των πρωτεϊνών. Κάθε επικράτεια πρωτεΐνης αντιστοιχεί σε ένα εξόνιο. Τα ιντρόνια αριθμούνται από 1 έως 5.

66 Εικόνα 2.23 Το γονίδιο του υποδοχέα της LDL αποτελείται από 18 εξόνια, κάποια από τα οποία είναι ομόλογα με εξόνια του πρόδρομου EGF και κάποια με εξόνια του παράγοντα συμπληρωματικότητας C9. Τα τρίγωνα επισημαίνουν τις θέσεις των ιντρονίων. Μόνο ορισμένα από τα ιντρόνια της περιοχής του υποδοχέα της LDL, που είναι ομόλογη με τον πρόδρομο EGF, έχουν την ίδια θέση και στο γονίδιο του EGF.

67 Οικογένειες γονίδιων Εικόνα 2.24 Στα γονίδια σφαιρίνης η δομή των εξονίων αντιστοιχεί στην πρωτεϊνική λειτουργία, ενώ στο γονίδιο της λεγκαιμοσφαιρίνης υπάρχει ένα επιπρόσθετο ιντρόνιο στην κεντρική επικράτεια.

68 Εικόνα 2.25 Το γονίδιο ινσουλίνης του αρουραίου, που περιέχει ένα ιντρόνιο, προέρχεται από ένα προγονικό γονίδιο που διέθετε δύο ιντρόνια, ένα από τα οποία χάθηκε στην πορεία της εξέλιξης.

69 Εικόνα 2.26 Τα γονίδια ακτίνης ποικίλλουν σε μεγάλο βαθμό ως προς την οργάνωσή τους. Οι θέσεις ιντρονίων επισημαίνονται με μοβ.

70 ΕΙΚΟΝΑ Συντηρημένες αλληλουχίες στο pre-mrna του ζυμομύκητα οι οποίες ενέχονται στον καθορισμό των 5 και 3 θέσεων ματίσματος Το γράμμα Y αντιπροσωπεύει ένα πυριμιδινικό νουκλεοτίδιο. Η αδενοσίνη (Α) στη θέση διακλάδωσης σημειώνεται με κόκκινο χρώμα. Το δινουκλεοτίδιο GU στο 5 άκρο του ιντρονίου και το δινουκλεοτίδιο AG στο 3 άκρο του ιντρονίου σημειώνονται με πράσινο χρώμα.

71 ΕΙΚΟΝΑ Συντηρημένες αλληλουχίες που ενέχονται στον καθορισμό των ιντρονίων του ανθρώπου Δύο τύποι συντηρημένων αλληλουχιών βρίσκονται στα άκρα των ιντρονίων του ανθρώπου (α) GU-AG και (β) AU-AC. Όπου Y είναι οποιοδήποτε πυριμιδινικό νουκλεοτίδιο, όπου R είναι οποιοδήποτε πουρινικό νουκλεοτίδιο και όπου N είναι οποιοδήποτε νουκλεοτίδιο. Η αδενοσίνη (Α) στη θέση διακλάδωσης σημειώνεται με κόκκινο χρώμα και τα συντηρημένα δινουκλεοτίδια στα άκρα του ιντρονίου σημειώνονται

72 Γενετική πληροφορία Πληροφορία DNA Πληροφορία θέσης σε γονιμοποιημένο ωάριο Πληροφορία θέσης στο DNA επιγενετική


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Εικόνα 24.1 Το hnrna απαντάται ως ριβονουκλεοπρωτεϊνικό σύµπλοκο µε µορφή µιας σειράς από χάντρες. Εικόνα 24.2 Το RNA τροποποιείται στον πυρήνα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA

Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA Κ Ε Φ Α Λ Α Ι Ο 1 : Τα γονίδια είναι DNA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Βασικές αρχές Μοριακής Βιολογίας Jones & Bartlett Learning 2014 Aκαδημαϊκές Εκδόσεις 2015 Burton E. Tropp Κεφάλαιο 1: Εισαγωγή

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Εικόνα 21.1 Ένα τυπικό γονίδιο που µεταγράφεται από την RNA πολυµεράση ΙΙ έχει έναν υποκινητή ο οποίος εκτείνεται ανοδικά από τη θέση έναρξης της µεταγραφής.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Κεφάλαιο 15 Μεταλλαγές του DNA, επιδιόρθωση του DNA και μεταθετά στοιχεία. Η πρωτεΐνη UvrB, ένα ένζυμο επιδιόρθωσης με εκτομή νουκλεοτιδίου.

Κεφάλαιο 15 Μεταλλαγές του DNA, επιδιόρθωση του DNA και μεταθετά στοιχεία. Η πρωτεΐνη UvrB, ένα ένζυμο επιδιόρθωσης με εκτομή νουκλεοτιδίου. Κεφάλαιο 15 Μεταλλαγές του DNA, επιδιόρθωση του DNA και μεταθετά στοιχεία Η πρωτεΐνη UvrB, ένα ένζυμο επιδιόρθωσης με εκτομή νουκλεοτιδίου. 1 ΕΙΚΟΝΑ 15.1 Συνέπειες των μεταλλαγών στην κωδική περιοχή ενός

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA Μεταλλάξεις DNA Επιδιόρθωση DNA Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA 1 Tι είναι µετάλλαξη Τι προκαλεί τις µεταλλάξεις Τύποι των µεταλλάξεων Tύποι των µεταλλαξογόνων Μεταλλάξεις και ασθένειες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ (Οµάδα Β ).

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα