Gens VIII (Lewin) Μοριακή Βιολογία του Γονιδίου (Watson et al.)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Gens VIII (Lewin) Μοριακή Βιολογία του Γονιδίου (Watson et al.)"

Transcript

1 Gens VIII (Lewin) Κεφάλαιο 5 (εκτός 14) Κεφάλαιο 6 (1-15, 18-19) Κεφάλαιο 7 (1-5, 8-10, 14) Κεφάλαιο 9 (1-4, 6-15, 17, 20-25) Κεφάλαιο 24 (19, 21) Κεφάλαιο 10 (1-14) Κεφάλαιο 11 (2-5, 15-17) Μοριακή Βιολογία του Γονιδίου (Watson et al.) Κεφάλαιο 15 Κεφάλαιο 14 Κεφάλαιο 12 Κεφάλαιο 16

2 ΕΙΣΑΓΩΓΗ

3 Ισχύς χημικών δεσμών Δεσμοί Μήκος Ισχύς στο κενό Ισχύς στο νερό ( o Α) (kcal/mole) (kcal/mole) Ομοιοπολικός ~1.5 ~90 ~90 Ετεροπολικός ή Ιοντικός ~2.5 ~80 ~3 Δεσμός υδρογόνου Δεσμός Van der Waals ~3 ~5 ~1 ~3.5 ~1 ~0.1

4 Χημικοί δεσμοί Δεσμός Η Δεσμός Van der Waals Υδρόφοβες αλληλεπιδράσεις

5 Ασθενείς δεσμοί μεταξύ μακρομορίων

6 Μήκος Μάζα Όγκος 1 m 1 mm = 10-3 m 1 μm = 10-6 m 1 nm = 10-9 m 1 o A = m 1 pm = m 1 g 1 mg = 10-3 g 1 μg (γ) = 10-6 g 1 ng = 10-9 g 1 pg = g 1 Da = 1,66 x g 1 kda = 10 3 Da 1 L 1 ml = 10-3 L 1 μl (λ) = 10-6 L 1 nl = 10-9 L 1 pl = 10-9 L C-C=1.5 o A, Πάχος DNA=20 o A, Μήκος περιστροφής DNA= 34 o A Ριβόσωμα=20nm, Μιτοχόνδριο/Βακτήριο=1-2 μm, Πυρήνας= 10 μm, Ζωικό κύτταρο=10-30 μm, DNA ανθρώπου= ~1 m, ~0.3 pg,1 bp= ~660 Da, 1 αμινοξύ= ~110 Da

7 Κ Ε Φ Α Λ Α Ι Ο 5: Το αγγελιοφόρο RNA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

8 Γιατί τα κύτταρα έχουν διαφορετική μορφή και λειτουργίες?

9 [κυτταρικές δομές, κατάλυση, ρύθμιση, ανοσοαπόκριση, μεταφορά, κίνηση] κυτταρικός τύπος Εικόνα 5.2 Αντιγραφή (Διαιώνιση/ Εξέλιξη της πληροφορίας) rrna (Μετάφραση) trna (Μετάφραση) srna (κατάλυση-ρύθμιση) mrna (Μεταφορά της πληροφορίας) Πρωτεΐνη (Εκτέλεση της πληροφορίας)

10 Ποια μακρομόρια βρίσκονται σε μεγαλύτερη αφθονία στο κύτταρο?

11 Εικόνα 5.12 Παρουσίαση των μακρομοριακών συστατικών της E. coli. ριβοσώματα ~ (25%) Πρωτεΐνες: ~60%, RNA: ~20%, mrna: ~ 1%, DNA: ~ 1,5% Πρωτεϊνοσύνθεση: ~90% ATP

12 Από πόσες περιοχές αποτελείται ένα mrna?

13 5 UTR α β 3 UTR Εικόνα 5.15 Ένα βακτηριακό mrna περιλαμβάνει μη μεταφραζόμενες, αλλά και μεταφραζόμενες περιοχές. Κάθε κωδική περιοχή έχει τα δικά της σήματα έναρξης και τερματισμού. Ένα τυπικό mrna μπορεί να έχει αρκετές κωδικές περιοχές.

14 Το ευκαρυοτικό mrna είναι μονοκιστρονικό ~17 ~170 ~700 ~700 0

15 Προκαυωτικά DNA mrna Μεταγραφή Μετάφραση Πρωτεΐνες Ευκαρυωτικά Eξ-1 Eξ-2 Eξ-3 DNA Προ-mRNA Εσ-1 Εσ-2 Μεταγραφή Ωρίμανση mrna Εξ-1 Εξ-2 Εξ-3 Πολυ(A) Μετάφραση Πρωτεΐνη

16 Μέσος αριθμός εσονίων ανά γονίδιο Figure 13-2

17

18 Λειτουργίες της 5 UTR Σταθερότητα του mrna Έναρξη της μετάφρασης Ρύθμιση της μετάφρασης (ευκαριωτικά) Λειτουργίες της 3 UTR Σταθερότητα του mrna Ρύθμιση της μετάφρασης (ευκαριωτικά) Καθορισμός του 3 άκρου και προσθήκη των πρώτων Α της πολυ(α) ουράς (ευκαριωτικά)

19 Εικόνα 5.13 Επισκόπηση: Το mrna μεταγράφεται, μεταφράζεται και αποικοδομείται ταυτόχρονα στα βακτήρια. Μεταγραφή:~40 Nt/sec Μετάφραση:~15 αα/sec mrna:5000 Nt t 1/2 ~ 2 min

20 Εικόνα 5.17 Επισκόπηση: Η έκφραση του mrna σε ζωικά κύτταρα απαιτεί μεταγραφή, τροποποίηση, επεξεργασία, πυρηνο-κυτταροπλασματική μεταφορά και μετάφραση. CAP ~40 Nt/sec Εσ-1 Εσ-2 Ζυμομύκητες: t1/2~ 1-60 min Ανώτεροι: t1/2 ~ 1-24 h ~2 αα/sec

21 Μεταφορά του mrna Figure 13-2 Μεταφορά mrna

22 Τα ευκαρυωτικά γονίδια ρυθμίζονται σε πολλά επίπεδα Chromatin

23 Ποια είναι τα υποστρώματα της RNA Πολυμεράσης?

24 Καλύπτρα 3 5 δεσμός 5 5 δεσμός P-P-P γ 3 β α 5 P-P-P

25 Εικόνα 5.18 Η καλύπτρα ασφαλίζει το 5 άκρο του mrna και μπορεί να μεθυλιωθεί σε αρκετές θέσεις. (Α) CH α β α (πολυκύτταροι) 6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 (Ανώτεροι: CH3 σε (Α) ανά ~1000 Nt) Ορισμένοι πολυκύτταροι

26 Λειτουργίες της καλύπτρας Μεταφορά μέσω πυρηνικών πόρων Προστασία του mrna από 5 εξωνουκλεάσες Έναρξη της μετάφρασης Απομάκρυνση του 1 ου (5 ) εσονίου

27 Εικόνα 5.17 Poly(A)+ Εσ-2 Εσ-1 (Εκτός mrna ιστονών)

28 Poly(A) Nt Εικόνα Το σύμπλοκο επεξεργασίας του 3 άκρου περιλαμβάνει αρκετές ενζυμικές ενεργότητες. Οι παράγοντες CPSF και CstF αποτελούνται από αρκετές υπομονάδες. Τα άλλα συστατικά είναι μονομερή. Η συνολική μάζα του συμπλόκου ξεπερνάει τα 900 kd. PAP Nt Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

29 Λειτουργίες πολύ(α) ουράς Μεταφορά μέσω πυρηνικών πόρων Προστασία του mrna από 3 εξωνουκλεάσες Έναρξη της μετάφρασης Ρύθμιση στο επίπεδο της μετάφρασης [αποθηκευμένα μηνύματα με μικρά πολυ(α) ~20 Α]

30 Εικόνα 5.19 Το πολυ(α) + RNA μπορεί να διαχωριστεί από τα άλλα RNA με κλασμάτωση σε στήλη σεφαρόζης-ολιγο(dt). Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

31 Εναλλακτικό μάτισμα

32 Πολλαπλά polya+ ~50% των mrna Έχουν περισσότερα από ένα σήματα πολυαδενυλίωσης Πολλαπλοί υποκινητές

33 Εικόνα 5.20 Η αποικοδόμηση του βακτηριακού mrna είναι μια διαδικασία δύο σταδίων. Οι ενδονουκλεολυτικές διασπάσεις προχωρούν από το 5 προς το 3 άκρο, πίσω από τα ριβοσώματα. Τα κομμάτια που απελευθερώνονται αποικοδομούνται από εξωνουκλεάσες που κινούνται από το 3 προς το 5 άκρο. 5 3 αποικοδόμηση κατά κανόνα 3 5 Eλικάση Αποικοδομόσωμα PAP προκαρυωτικών προσθέτει ~10-40 Α στο 3 άκρο σε ορισμένα RNA. Σήμα αποικο-δόμησης από το 3 άκρο. 3 5 αποικοδόμηση Δευτεροταγής δομές στις 5 - και 3 -UTR σταθεροποιούν ορισμένα mrna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

34 Εικόνα 5.21 Οι τροποποιήσεις των άκρων του mrna το προστατεύουν από την αποικοδόμηση. Εσωτερικές αλληλουχίες μπορεί να ενεργοποιήσουν τα συστήματα αποικοδόμησης. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

35 Fig

36 Αποικοδόμηση 5 3 στους ζυμομύκητες Η αποαδενυλίωση επιτρέπει την αφαίρεση της καλύπτρας, γεγονός που οδηγεί στην εξωνουκλεολυτική διάσπαση του 5 άκρου. STOP 1-2 Nt Απο- Αδενυλάση Ccr4 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

37 Αποικοδόμηση 3 5 στους ζυμομύκητες Εικόνα 5.25 Η αποαδενυλίωση μπορεί να προκαλέσει άμεσα την ενδονουκλεολυτική διάσπαση και την εξωνουκλεολυτική αποικοδόμηση από το 3 άκρο. Ειδικές πολυα ριβονουκλεάσες Ειδικές ενδοριβονουκλεάσες Εξώσωμα (~9 εξωνουκλεάσες) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Ανώριμα πρόδρομα RΝΑ

38 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 AU rich element Εικόνα 5.22 Ρυθμιστικές πρωτεΐνες: Μια αλληλουχία ARE στην 3 μη μεταφραζόμενη περιοχή προκαλεί την αποικοδόμηση του mrna.

39 Εικόνα 5.23 Υποδοχέας της τρανσφερίνης του σιδήρου. Μια αλληλουχία IRE στην 5 UTR ελέγχει τη σταθερότητα του mrna. IRE Fe Τρανσφερίνη Υποδοχέας Φεριτίνη

40 Εικόνα 5.28 Τα RNA μεταφέρονται μέσω μεμβρανών σε μια ποικιλία συστημάτων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

41 Μεταφορά του mrna στο κυτταρόπλασμα α) Με ειδική μεταφορά σε συγκεκριμένη θέση β) Με γενική αποικοδόμηση εκτός της συγκεκριμένης θέσης γ) με ελεύθερη διάχυση και παγίδευση σε συγκεκριμένη θέση

42 Έμβρυο Δροσόφιλας

43 Κ Ε Φ Α Λ Α Ι Α 6-7: Μετάφραση Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

44 Ποια μακρομόρια και οργανίδια συμμετέχουν στη μετάφραση?

45 Εικόνα 5.1 Οι τρεις τύποι του RNA που είναι απαραίτητοι για τη γονιδιακή έκφραση σε όλα τα συστήματα είναι το mrna (φέρει την κωδική αλληλουχία), το trna (παρέχει το αμινοξύ που αντιστοιχεί σε κάθε κωδικόνιο) και το rrna (ένα μείζον συστατικό του ριβοσώματος που παρέχει το περιβάλλον για την πρωτεϊνοσύνθεση). Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

46 20 nm Εικόνα 5.8 Το ριβόσωμα αποτελείται από δύο υπομονάδες.

47 Εικόνα 6.2 Τα ριβοσώματα είναι μεγάλα ριβονουκλεοπρωτεϊνικά σωμάτια που περιέχουν περισσότερο RNA από πρωτεΐνη και αποσυνδέονται σε μεγάλες και μικρές υπομονάδες. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

48 Τι είναι τα πολυσώματα (πολυριβοσώματα) και από τι αποτελούνται

49 5 3 Εικόνα 5.9 Ένα πολυριβόσωμα αποτελείται από ένα mrna που μεταφράζεται ταυτόχρονα από πολλά ριβοσώματα, τα οποία κινούνται στην κατεύθυνση 5 3. Κάθε ριβόσωμα περιέχει δύο μόρια trna: το ένα φέρει την αρτιγενή πρωτεΐνη και το άλλο φέρει το επόμενο αμινοξύ που πρόκειται να προστεθεί. Προκαριωτικά > 10, Ευκαρυωτικά ~ 8 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

50 Εικόνα 5.10 Η πρωτεϊνοσύνθεση λαμβάνει χώρα στα πολυσώματα. Η φωτογραφία είναι ευγενική προσφορά του Alex Rich. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

51 Εικόνα 5.14 Οι μεταγραφικές μονάδες μπορούν να γίνουν ορατές στα βακτήρια. Η φωτογραφία είναι ευγενική προσφορά του Oscar Miller. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

52 Ποια είναι η λειτουργία του trna

53 2 3 Εικόνα 5.3 Ένα trna έχει τη διττή ιδιότητα ενός προσαρμοστή, ο οποίος αναγνωρίζει τόσο το αμινοξύ όσο και το κωδικόνιο. Η 3 αδενοσίνη είναι ομοιοπολικά συνδεδεμένη με ένα αμινοξύ. Το αντικωδικόνιο δημιουργεί ζεύγη βάσεων με το κωδικόνιο στο mrna. Προσαρμοστής: Διαμεσολαβιτικό μόριο μεταξύ ενός αμινοξέος και ενός κωδικονίου Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

54 Εικόνα 5.4 Η διάταξη σε σχήμα τριφυλλιού του trna έχει σταθερές και ημισταθερές βάσεις και μια συντηρημένη ομάδα αλληλεπιδράσεων μεταξύ ζευγών βάσεων Nt D: Διυδροουριδίνη D D T:Ριβοθυμιδίνη Ψ:Ψευδοουριδίνη Επιπλέον ζεύγη: G-U, G-Ψ, A-Ψ Στέλεχος Βρόχος Βραχίονας αντικωδικονίου 3-21 Nt Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

55 Εικόνα 7.7 Και οι τέσσερις βάσεις μπορούν να τροποποιηθούν στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις

56 Εικόνα 5.6, 7 Βραχίονας δέκτης Βραχίονας Δέκτης

57 Κ Ε Φ Α Λ Α Ι Ο 7 Γενετικός κώδικας Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

58 Εικόνα 7.1 Όλες οι τριπλέτες-κωδικόνια έχουν νόημα: 61 αντιστοιχούν σε αμινοξέα και 3 προκαλούν τερματισμό (STOP). α. 61 κωδικόνια + 3 λήξης β. Κοινός εκτός ορισμένων πρωτόζωων και μιτοχονδρίων γ. Συνώνυμα κωδικόνια δ. Εκφυλισμός στην 3 η βάση ε. Σε 2 συνώνυμα κωδικόνια η 3η βάση είναι Pur ή Pyr

59 Αλληλουχία mrna Αλληλουχία πρωτεΐνης Ανοιχτό πλαίσιο ανάγνωσης Fig. 14-1

60 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 7.2 Το πλήθος των κωδικονίων για κάθε αμινοξύ δεν αντιστοιχεί στη συχνότητα εμφάνισης του αμινοξέος στις πρωτεΐνες.

61 In vitro μετάφραση mrna + ribosomes Poly-U Poly-Phe Poly-C Poly-Pro Poly-A Poly-Lys

62

63 Rib + 3Nt + (trna + συνθετάσες + αα) Rib-3Nt-tRNA~αα Rib + 3Nt + (trna + συνθετάσες + αα) + αα* Rib-3Nt- trna~αα? + AUC AUC + AUC

64 Πόσα διαφορετικά trna χρειάζονται? Ο αριθμός των trna > του αριθμού των αμινοξέων 20 ομάδες ισοδεκτικών (ομότυπων) trna [trna1-cys, trna2-cys] Τα ομότυπα trna προσδένουν το ίδιο αα και προσδένονται σε συνώνυμα κωδικόνια Ο αριθμός των trna < του αριθμού των κωδικονίων (E. coli:45) Το ίδιο trna (αντικωδικόνιο) προσδένεται σε περισσότερα από ένα συνώνυμα κωδικόνια

65 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Υπόθεση ταλάντευσης: Η ταλάντευση στο ζευγάρωμα βάσεων επιτρέπει το σχηματισμό ζευγών G-U μεταξύ της τρίτης βάσης του κωδικονίου και της πρώτης βάσης του αντικωδικονίου.

66 Εικόνα 7.5 Το ζευγάρωμα κωδικονίου-αντικωδικονίου περιλαμβάνει ταλάντευση στην τρίτη θέση. I A, U, C Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

67 Εικόνα 7.7 Και οι τέσσερις βάσεις μπορούν να τροποποιηθούν στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

68 Εικόνα 7.8 Η ινοσίνη μπορεί να σχηματίσει ζεύγη με οποιαδήποτε από τις U, C και A. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

69 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 7.3 Οι βάσεις στην τρίτη θέση έχουν τη μικρότερη επίδραση στο νόημα των κωδικονίων. Τα πλαίσια επισημαίνουν τις ομάδες κωδικονίων στις οποίες ο εκφυλισμός της τρίτης βάσης διασφαλίζει ότι όλα τα κωδικόνια έχουν το ίδιο νόημα. G U I C C G U Ελάχιστο=31 trna G U G U C G U G U G U G G U G U G U G G U G U G U

70 Κ Ε Φ Α Λ Α Ι Α 6-7: Μετάφραση Προεναρκτήριες Αντιδράσεις (Προ-εναρκτήριες αντιδράσεις)

71 Εικόνα 6.7 Η πρωτεϊνοσύνθεση διακρίνεται σε τρία στάδια. ~30-35 aa P A Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

72 2 3 A Εικόνα 5.3 Ένα trna έχει τη διττή ιδιότητα ενός προσαρμοστή, ο οποίος αναγνωρίζει τόσο το αμινοξύ όσο και το κωδικόνιο. Η 3 αδενοσίνη είναι ομοιοπολικά συνδεδεμένη με ένα αμινοξύ. Το αντικωδικόνιο δημιουργεί ζεύγη βάσεων με το κωδικόνιο στο mrna. Αμινοάκυλο trna συνθετάσες 1 συνθετάση/αα/ομάδα ομότυπων trna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

73 Προ-εναρκτήριεςαντιδράσεις Fig ~ ~ ~ ~ 2 - ή Χρησιμοποιείτε για τον πεπτιδικό δεσμό ~ αα~trna

74 Προ-εναρκτήριες αντιδράσεις Εικόνα 7.13 Μια αμινοακυλο-trna συνθετάση φορτώνει το trna με ένα αμινοξύ.

75 Εικόνα 7.14 Μια αμινοακυλο-trna συνθετάση φέρει τρεις ή τέσσερις περιοχές με διαφορετικές λειτουργίες. Οι πολυμερείς συνθετάσες διαθέτουν και μία επικράτεια ολιγομερισμού. Ν- Ν- Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

76 Εικόνα 7.16 H trna συνθετάση τάξης Ι έρχεται σε επαφή με το trna στη μικρή αύλακα του στελέχους-δέκτη και στο αντικωδικόνιο. αα Επιλογέας (ομότυπα) (1 δεσμός Η) Κέντρο σύνθεσης (1 ή 2 δεσμοί Η)

77 Εικόνα 6.8 Στα διάφορα στάδια της πρωτεϊνοσύνθεσης, η συχνότητα λάθους κυμαίνεται από 10-6 έως 5 x Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

78 P1 + m1 P1 + m2 P1-m1 + ~15 Kcal/mol (G1) P1-m2 + ~10 Kcal/mol (G2) ΔG = G2-G1 = ~ - 5 Kcal/mol (~ 1 δεσμός Η) P1-m1 P1-m2 = ~ 10 5

79 Κινητικός έλεγχος-ii Κινητικός έλεγχος-i Εικόνα 7.18 Η αναγνώριση του σωστού trna από τις συνθετάσες ελέγχεται σε δύο στάδια. Πρώτον, το ένζυμο έχει μεγαλύτερη συγγένεια για τα ομότυπα trna. Δεύτερον, η αμινοακυλίωση ενός λανθασμένου trna γίνεται με πολύ αργό ρυθμό.

80 Πρόσδεση αα στις συνθετάσες Tyr~tRNA συνθετάση 4-5 Kcal/mol Phe Tyr Trp Etyr-Tyr Etyr-Phe = ~ 104 Λάθος = ~ 10-4

81 EIle ~2 Kcal/mol E Ile + Ile( 3 H)/Val( 14 C) E Ile -Ile (3H) E Ile -Val (14C) = ~ 225 Λάθος = ~ 1/225 E Ile + Ile( 3 H)/Val( 14 C) + trna Ile E Ile -Ile (3H) E Ile -Val (14C) = ~ Λάθος = ~ 1/60.000

82 Ile Val Κινητικός έλεγχος 1/225 Εικόνα 7.19 Ο διορθωτικός έλεγχος απαιτεί την πρόσδεση του ομότυπου trna στη συνθετάση που έχει δεσμεύσει λανθασμένο αμινοξύ και γίνεται είτε μέσω μιας αλλαγής στη διαμόρφωση που προκαλεί την υδρόλυση του αμινοακυλο- AMP είτε μέσω της μεταφοράς του αμινοξέος στο trna η οποία ακολουθείται από υδρόλυση. Χημικός διορθωτικός έλεγχος

83 Συνθετάση ισολευκίνης Εικόνα 7.21 Η Ile-tRNA συνθετάση έχει δύο ενεργά κέντρα. Τα αμινοξέα που είναι μεγαλύτερα από την Ile δεν μπορούν να ενεργοποιηθούν, επειδή δε χωρούν στο κέντρο σύνθεσης. Τα αμινοξέα που είναι μικρότερα από την Ile αποβάλλονται, διότι μπορούν να εισέλθουν στη θέση διόρθωσης. αα αα trnaile trna-ile trna+val trna-ile Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 trna-val

84 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 5.5 Το νόημα του trna καθορίζεται από το αντικωδικόνιό του και όχι από το αμινοξύ του.

85 ΕΝΑΡΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

86 Προκαρυωτικά AUG AUG AUG Ευκαρυωτικά

87 ΕΝΑΡΞΗ Fig Παράγοντες έναρξης IF1, IF2, IF3

88 ~20% Εικόνα 6.11 Η έναρξη απαιτεί υπομονάδες 30S, που φέρουν τον IF-3. P A fmet Εναρκτήριο fmet GTP P A P A Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

89 Πως η μικρή ρβοσωματικά υπομονάδα αναγνωρίζει τη σωστή θέση πρόσδεσης στο mrna?

90 Εικόνα 6.16 Οι θέσεις πρόσδεσης του ριβοσώματος στο mrna μπορούν να απομονωθούν από σύμπλοκα έναρξης. Οι θέσεις πρόσδεσης περιλαμβάνουν μια ανοδική αλληλουχία Shine-Dalgarno και ένα κωδικόνιο έναρξης. 16S RNA Nt AGGAGGNNN UCCUCCNNN 3 8 Nt IF3? 16S RNA 5 AGGAGGNNN mrna 5 ---AGGAGG-----AUG UCCUCCNNN 3

91 P Fig

92 Εικόνα 6.13 Το fmet-trna f έχει μοναδικά χαρακτηριστικά, τα οποία το διακρίνουν ως το εναρκτήριο trna. GTP GTP Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

93 IF-2 Εικόνα 6.14 Το fmet-trna f μπορεί να χρησιμοποιηθεί αποκλειστικά για την έναρξη από τις υπομονάδες 30S, ενώ τα άλλα αμινοακυλo-trna (αα-trna) μπορούν να χρησιμοποιηθούν κατά την επιμήκυνση από τα ριβοσώματα 70S. 5 & μη εισαγωγή στη θέση Α G U A -met G U G -val G U U -leu 5 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

94 Εικόνα 6.12 Το N-φορμυλο-μεθειονυλο-tRNA (fmet-trna f ) έναρξης δημιουργείται με φορμυλίωση του μεθειονυλο-trna, χρησιμοποιώντας ως συμπαράγοντα το φορμυλο-τετραϋδροφολικό οξύ. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

95 Εικόνα 6.15 Ο IF-2 είναι αναγκαίος για την πρόσδεση του fmet-trna f στο σύμπλοκο 30S-mRNA. Μετά τη σύνδεση της 50S, αποδεσμεύονται όλοι οι παράγοντες IF και διασπάται το GTP. Η 50S επάγει την υδρόλυση του GTP από τον IF-2 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

96 Έναρξη της μετάφρασης

97 Αποφορμυλίωση

98 Εικόνα 6.17 Η έναρξη πραγματοποιείται ανεξάρτητα σε κάθε κιστρόνιο ενός πολυκιστρονικού mrna. Όταν η διακιστρονική περιοχή είναι μακρύτερη από το εύρος του ριβοσώματος, η αποσύνδεση κατά τον τερματισμό ακολουθείται από ανεξάρτητη επανέναρξη στο επόμενο κιστρόνιο. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

99 Εξάρτηση Fig RBS 2

100 Έναρξη στα ευκαρυωτικά Εικόνα 6.18 NNNPuNNAUGG

101 Παράγοντες ρύθμισης Επαναλαμβανόμενες ενάρξεις Fig

102 α Εικόνα Α β Ελικάση P A AUG 3 UTR 1Α 1 GTP 1Α 1 γ δ 4E 3 2 1Α 1 + AUG 3 UTR Genes VIII - Ακαδημαϊκές Εκδόσεις Α 1

103 GTP Εικόνα 6.24 Ο eιf1 και ο eιf1a βοηθούν το σύμπλοκο έναρξης 43S να σαρώσει το mrna, έως ότου να συναντήσει ένα κωδικόνιο AUG. Ο eιf2 υδρολύει το GTP του και αποδεσμεύεται μαζί με τον IF3. Ο eιf5β μεσολαβεί στη σύνδεση των ριβοσωμικών υπομονάδων 60S και 40S. P 1A GTP NNNPuNNAUGG Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

104 * Fig , 27

105 AUG Εικόνα 6.18 Η μικρή υπομονάδα των ευκαρυωτικών ριβοσωμάτων μεταναστεύει από το 5 άκρο του mrna στη θέση πρόσδεσης του ριβοσώματος, η οποία περιλαμβάνει ένα κωδικόνιο έναρξης AUG. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

106 Έναρξη σε εσωτερικές θέσεις (IRES) 43S 5 5 1Α 1 3 IRES

107 ΕΠΙΜΗΚΥΝΣΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

108 Fig Επιμήκυνση στα προκαρυωτικά Παράγοντες Επιμήκυνσης Tu, Ts, G

109 fmet-trnaf P A 5% των πρωτεϊνών μόρια/κύτταρο Κιρομμυκίνη Εικόνα 6.25 Ο EF-Tu- GTP τοποθετεί το αμινοακυλο-trna στο ριβόσωμα και στη συνέχεια αποδεσμεύεται ως EF- Tu-GDP. Ο EF-Ts απαιτείται για την αντικατάσταση του GDP από το GTP. Η αντίδραση καταναλώνει GTP και απελευθερώνει GDP. Το μόνο αμινοακυλοtrna που δεν μπορεί να αναγνωριστεί από τον EF-Tu-GTP είναι το fmet-trnaf και έτσι αποτρέπεται η ενσωμάτωσή του σε εσωτερικά κωδικόνια AUG ή GUG. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

110

111 5X10-3 Εικόνα 6.8 Στα διάφορα στάδια της πρωτεϊνοσύνθεσης, η συχνότητα λάθους κυμαίνεται από 10-6 έως 5 x ~5 x 10-4 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

112 Εικόνα 7.27 Στη θέση Α μπορεί να εισαχθεί (από τον EF-Tu) οποιοδήποτε αμινοακυλο-trna, αλλά μόνο όποιο ζευγαρώσει με το αντικωδικόνιο δημιουργεί επαφές με το rrna οι οποίες το σταθεροποιούν. Απουσία αυτών των επαφών, το αμινοακυλο-trna αποβάλλεται από τη θέση Α. Tu-GTPαα~tRΝΑ

113 mrna trna trna 5 Εικόνα 6.47 Το ζευγάρωμα κωδικονίουαντικωδικονίου προάγει την αλληλεπίδραση του mrna με τις αδενίνες του 16S rrna, ενώ στην περίπτωση της αντιπαράθεσης μη συμπληρωματικών κωδικονίων-αντικωδικονίων το mrna δεν μπορεί να αλληλεπιδράσει με τις αδενίνες αυτές mrna Πρόσδεση του σωστού αα~trna στη μικρή ριβοσωματική υπομονάδα Αλληλεπίδραση mrna με16s rrna Αλλαγή στην στερεοδιαμόρφωση του ριβοσώματος υδρόλυση του GTP Απομάκρυνση του Tu-GDP Μεταφορά ολόκληρου του αα~trna στην A θέση

114 Tu-GDP Tu-GTP

115 Πεπτιδικός δεσμός Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

116 Εικόνα 6.26 Ο σχηματισμός του πεπτιδικού δεσμού γίνεται με την αντίδραση μεταξύ του πολυπεπτιδίου του πεπτιδυλο-trna στη θέση P και του αμινοξέος του αμινοακυλοtrna στη θέση Α. Πεπτίδυλο-μεταφοράση-23S rrna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

117 Εικόνα 6.27 Η πουρομυκίνη μιμείται το αμινοακυλο-trna, επειδή μοιάζει με ένα αρωματικό αμινοξύ συνδεδεμένο σε μια ένωση σακχάρου-βάσης. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

118 Μετατόπιση του p~trna G GTP pi Εικόνα 6.28 Το βακτηριακό ριβόσωμα έχει τρεις θέσεις πρόσδεσης του trna. E G GDP Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 P A

119 P A III G GTP pi Εικόνα 6.29 Τα μοντέλα για τη μετατόπιση περιλαμβάνουν δύο στάδια. Κατά το σχηματισμό του πεπτιδικού δεσμού, αρχικά μετατοπίζεται το αμινοάκυλο άκρο του trna από τη θέση Α στη θέση P. Στη συνέχεια, μετατοπίζεται το άκρο του αντικωδικονίου του trna στη θέση P. P A G-GDP P A III G-GDP III

120 Εικόνα 6.30 Η πρόσδεση των παραγόντων EF-Tu και EF-G γίνεται εναλλάξ, καθώς τα ριβοσώματα δέχονται καινούρια αμινοακυλοtrna, σχηματίζουν πεπτιδικούς δεσμούς και μετατοπίζονται. 1 ATP και 2 GTP/πεπτιδικό δεσμό Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

121 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 6.31 Η δομή του τριμερούς συμπλόκου αμινοακυλο-trna EF-Tu GTP (αριστερά) μοιάζει με τη δομή του EF-G (δεξιά). Οι δομικά συντηρημένες επικράτειες του EF-Tu και του EF-G επισημαίνονται με κόκκινο και πράσινο, ενώ το trna και η επικράτεια του EF-G, που μοιάζει με αυτό, επισημαίνονται με μοβ. Η φωτογραφία είναι ευγενική προσφορά του Poul Nissen.

122 ΛΗΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

123 Εικόνα 6.32 Η μοριακή μίμηση καθιστά δυνατή την πρόσδεση του συμπλόκου EF-Tu trna, του παράγοντα μετατόπισης EF-G και των παραγόντων αποδέσμευσης RF1/2-RF3 στην ίδια ριβοσωμική θέση. RF1: UAA/UAG RF2: UAA/UGA RF3: UAA/UAG/UGA erf1: UAA/UAG/UGA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

124 Παράγοντες αποδέσμευσης/trna Gly-Gly-Gln Πεπτιδικό αντικωδικόνιο

125 Εικόνα 6.34 Η πεπτιδυλομεταφορά και ο τερματισμός είναι ανάλογες αντιδράσεις, στις οποίες μία βάση στο κέντρο της πεπτιδυλο-μεταφοράσης πυροδοτεί μία αντίδραση μετεστεροποίησης, προσβάλλοντας ένα δεσμό N-H ή O-H και διευκολύνοντας το άτομο N ή Ο να προσβάλλει το δεσμό στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

126 RF1/RF2 RF3 IF-3 IF-3 G GTP GDP + G Εικόνα 6.35 Ο παράγοντας αποδέσμευσης (RF) τερματίζει την πρωτεϊνοσύνθεση αποδεσμεύοντας την πρωτεϊνική αλυσίδα. Ο παράγοντας ανακύκλωσης του ριβοσώματος (RRF) αποδεσμεύει το τελευταίο trna και ο EF-G αποδεσμεύει τον RRF, προκαλώντας την αποσύνδεση των ριβοσωμικών υπομονάδων. RRF : Απομάκρυνση RF3 G-GTP: Απομάκρυνση RRF υδρόλυση GTP χωρισμός υπομονάδων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

127 Κ Ε Φ Α Λ Α Ι Ο 9: Η μεταγραφή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

128 K M Προκαρυωτικοί οργανισμοί Ευκαρυωτικοί οργανισμοί RNA ρετροϊοί Εικόνα 9.1 Η λειτουργία της RNA πολυμεράσης είναι να μεταγράφει μια αλυσίδα δίκλωνου DNA σε RNA. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

129 RNA ρετροϊοί RNάση Αντίστροφη μεταγραφάση DNA πολυμεράση Μεταγραφή 5

130 RNA ιοί + - Proteins + -

131 Έκφραση της γενετικής πληροφορίας α β α β 1 2 α β α β 1α 1β

132 5 3 Μεταγραφική μονάδα Πρωτογενές μετάγραφο Κ Μ Εικόνα 9.2 Μια μεταγραφική μονάδα μεταγράφεται σε ένα ενιαίο RNA. Ώριμο RNA (mrna) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

133 Εικόνα 9.3 Οι αλυσίδες DNA διαχωρίζονται για να σχηματίσουν μια μεταγραφική θηλιά. Το RNA συντίθεται με το ζευγάρωμα συμπληρωματικών βάσεων με μία από τις αλυσίδες του DNA. Τριφωσφοριβονουκλεοτίδια A, U, G, C Συχνότητα λαθών = 10-6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

134 P-P-P Κατεύθυνση μεταγραφής γ β α P-P-P 3 Ι Η 2 3 δεόξυ-τριφωσφορική αδενοσύνη 3 5

135 Κάθε γονίδιο μεταγράφεται από την μία μόνο αλυσίδα DNA 5 Κ Κ Μ 3 3 Μ Μ Κ 5 5 Κ Κ Μ 3 3 Μ Μ Κ 5

136 RNA Πολυμεράσες

137 Υποκινητές Fig Y

138 -7 ~ 100 kda ~200 Nt/sec 25 υποκινητές -7-4 Εικόνα 9.7 Η T7 RNA πολυμεράση έχει ένα βρόχο ειδικότητας που προσδένει τις θέσεις -7 έως -11 του υποκινητή, ενώ οι θέσεις -1 έως -4 εισέρχονται στο ενεργό κέντρο. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

139 16 bp DNA K Εικόνα 9.8 Οι υπομονάδες β (κυανό) και β (ροζ) της βακτηριακής RNA πολυμεράσης έχουν ένα κανάλι για την αλυσίδαμήτρα του DNA. Η σύνθεση ενός μεταγράφου RNA (χρώμα του χαλκού) έχει μόλις αρχίσει. Μέσα σε μια μεταγραφική θηλιά η αλυσίδα-μήτρα (κόκκινο) και η κωδική αλυσίδα (κίτρινο) έχουν διαχωριστεί. Η φωτογραφία είναι ευγενική προσφορά του Seth Darst. 465 kda Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

140 Βακτηριακή RNA Πολυμεράση

141 RNA Πολυμεράση του σακχαρομύκητα 25 bp DNA Εικόνα 9.9 Η θέση δέκα υπομονάδων της RNA πολυμεράσης έχει χαρτογραφηθεί στην κρυσταλλική δομή. Τα χρώματα των υπομονάδων είναι τα ίδια με αυτά των κρυσταλλικών δομών στις Εικόνες που ακολουθούν. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

142 RNA Πολ. E. coli RNA Πολ. σακχαρομύκητα

143 Μεταγραφή στους προκαρυωτικούς οργανισμούς

144 Εικόνα 9.16 Οι RNA πολυμεράσες των ευβακτηρίων αποτελούνται από τέσσερα είδη υπομονάδων: οι α, β και β έχουν σχετικά σταθερά μεγέθη σε διάφορα είδη βακτηρίων, ενώ η σ ποικίλλει σε μεγαλύτερο βαθμό. 40 Nt/sec Συχνότητα λαθών = 10-6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

145 Λειτουργίες της RNA πολ. Μία RNA πολ. στα προκαρυωτικά Τρείς RNA πολ. στα ευκαρυωτικά Εικόνα 9.5, DNA/RNA (~9 bp) bp 5 RNA (~17 Nt) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

146 Λειτουργίες ΟΕ και ΚΕ Εικόνα ~9Nt 5

147 Μοντέλα διακοπτόμενης έναρξης

148 Εικόνα 9.16 Οι RNA πολυμεράσες των ευβακτηρίων αποτελούνται από τέσσερα είδη υπομονάδων: οι α, β και β έχουν σχετικά σταθερά μεγέθη σε διάφορα είδη βακτηρίων, ενώ η σ ποικίλλει σε μεγαλύτερο βαθμό. Λειτουργίες των υπομονάδων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

149 Σ-9.17 Μη ειδική πρόσδεση K Εικόνα 9.17 Οι υπομονάδες β και β δημιουργούν επαφές τόσο με τη μήτρα όσο και με την κωδική αλυσίδα του DNA, κυρίως στην περιοχή της μεταγραφικής θηλιάς και πιο καθοδικά από αυτή. Οι επαφές με το RNA εντοπίζονται κυρίως στη μεταγραφική θηλιά. Συνήθως, καθοδικά δεν υπάρχει RNA και οι επαφές με αυτό γίνονται μόνο σε ειδικές περιπτώσεις στην κάθοδο, όταν το ένζυμο οπισθοδρομεί. M Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

150 DNA + Pol DNA + Pol DNA-Pol t 1/2 [DNA-Pol] KB = (Μ [DNA] [Pol] -1 ) k = Προϊόν / t

151 ΚΒ= 10 5 t 1/2 =60 min ΚΒ= 10 1 t 1/2 =~1 sec ΚΒ= t 1/2 > hr ΚΒ= έναρξη/30 min ΚΒ= έναρξη/1 sec (1.800X) Εικόνα 9.22

152 Υποστάδια της έναρξης Αναγνώριση msec 1 msec Συχνότητα ενάρξεων< 1 έναρξη/sec Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

153 Εικόνα /2 θέσεις χαλαρής πρόσδεσης 1/2 θέσεις ειδικής πρόσδεσης

154 Εικόνα 9.23 Η κινητική σταθερά πρόσδεσης της RNA πολυμεράσης στους υποκινητές είναι γρηγορότερη από την τυχαία διάχυση.

155 Εικόνα 9.24 Η RNA πολυμεράση προσδένεται πολύ γρήγορα σε τυχαίες αλληλουχίες DNA και θα μπορούσε να βρει έναν υποκινητή με άμεση μετατόπιση από μία προσδεδεμένη αλληλουχία DNA σε άλλη. 4Χ bp Y Y bp 4x10 6 bp/~1500 OE= bp 1 OE/2.600 bp Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

156 Εικόνα 9.25 H RNA πολυμεράση δεν ολισθαίνει κατά μήκος του DNA. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

157 Εικόνα 9.29 Η μέθοδος της ιχνηλάτησης προσδιορίζει τις θέσεις πρόσδεσης πρωτεϊνών στο DNA βάσει της προστασίας που παρέχουν ενάντια στη δημιουργία εγκοπών. T4 πολυνουκλεοτιδική κινάση ~50 bp ~80 bp Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

158 Υποκινητές προκαρυωτικών γονιδίων

159 bp ειδικό σήμα (4 = 1/17X10 6 ) Σ-9.27 Αντιπροσωπευτικές ή συναινετικές αλληλουχίες Pu (90%) TTGACA TATAAT Pu (Ιδανικός υποκινητής) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

160 Εικόνα 9.19 Η RNA πολυμεράση διέρχεται από αρκετά στάδια πριν τη φάση επιμήκυνσης. Ένα κλειστό δυαδικό σύμπλοκο μετατρέπεται σε μια ανοικτή μορφή και μετά σε ένα τριαδικό σύμπλοκο. Μεταλλάξεις (-35) [αναγνώριση και πρόσδεση] Μεταλλάξεις (-10) [τήξη] Μεταλλάξεις (+1/+30) [χρόνος εκκαθάρισης] Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

161 K M Θέσεις αναγνώρισης Θέσεις πρόσδεσης

162 Πρόσδεση RNA πολ. στους υποκινητές β β.2.4 (ΑΤ)n -50

163 Εικόνα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

164 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.37

165 ΚΕ Εικόνα 9.38 Το Ν-τελικό άκρο του σίγμα εμποδίζει τις επικράτειες πρόσδεσης στο DNA να προσδεθούν σε αυτό. Όταν σχηματίζεται ένα ανοικτό σύμπλοκο, το Ν-τελικό άκρο μετακινείται 20 Ǻ μακριά και οι δύο επικράτειες πρόσδεσης στο DNA απομακρύνονται η μία από την άλλη κατά 15 Ǻ. Πρόσδεση στο ΚΕ μετατόπιση της Ν-τελικής περιοχής κατά 20 Α ο πρόσδεση στο -35 κουτί και ακολούθως στο -10 κουτί αποδιάταξη του DNA εκτόπιση της Ν-τελικής περιοχής και εισαγωγή της περιοχής +1 του DNA στο ενεργό κέντρο του ενζύμου Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

166 Πρόσδεση του παράγοντα σ στους υποκινητές 2.4 A T T A A 2.3 T Κ Μεταγραφή Μ

167 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.35

168 Fig Ρύθμιση της μεταγραφής με εναλακτικούς παράγοντες σ (SPO1)

169 Τοποϊσομεράση (+) Γυράση (-) Εικόνα 9.31 H μεταγραφή δημιουργεί θετικά υπερελικωμένο DNA μπροστά από την RNA πολυμεράση και αρνητικά υπερελικωμένο DNA πίσω απ αυτήν. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

170 Εικόνα 9.21 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

171 Εγγενής τερματισμός Εικόνα GCAATCCCGAAACAGTTCGGTAGTAGTTAGAGCCGATAACGGTTTCGGGATTTTTTT CGTTAGGGCTTTGTCAAGCCATC ATCAATCTCGGCTATTGCCAAAGCCCTAAAAAAA--5 Βρόχος (6-12 Nt) Φουρκέτα Στέλεχος (7-20 bp) Παύση της RNA Pol ~1sec

172 Εικόνα 9.46 Οι αλληλουχίες DNA που απαιτούνται για τον τερματισμό εντοπίζονται πριν την αλληλουχία τερματισμού. Ίσως είναι αναγκαίος ο σχηματισμός μιας φουρκέτας στο RNA.

173 50-90 Nt Εικόνα 9.48 Ένας Rho-εξαρτώμενος τερματιστής έχει αλληλουχία πλούσια σε C και φτωχή σε G, και εντοπίζεται πριν από την ακριβή θέση (ή θέσεις) τερματισμού. Η αλληλουχία παρουσιάζεται με τη μορφή του RNA. Αντιπροσωπεύει το 3 άκρο του RNA.

174 Εικόνα 9.49 Ο παράγοντας Rho «καταδιώκει» την RNA πολυμεράση κατά μήκος του RNA και μπορεί να προκαλέσει τερματισμό όταν προλάβει το στάσιμο ένζυμο σε μια Rho-εξαρτώμενη αλληλουχία τερματισμού. β ATP ADP Ο ρ έχει RNA-εξαρτώμενη ενεργότητα ATPάσης και ATP-εξαρτώμενη ενεργότητα ελικάσης. ATP ADP

175 * Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.50: Φαινόμενο πολικότητος.

176 Ασθενής

177 Αντιτερματισμός Εικόνα 9.51

178 Παράγοντες τερματισμού Εικόνα 9.54 Ασθενής Oι παράγοντες τερματισμού αν και λειτουργούν στον τερματιστή, αναγνωρίζουν άλλες αλληλουχίες. Προσδένονται στο κεντρικό ένζυμο όταν αυτό περάσει από την αλληλουχία Nut μέσω του RNA και αυξάνουν το χρόνο παύσης της RNA pol στον τερματιστή.

179 ΝusA pν NusB-S10 5 Εικόνα 9.5: Όταν το ΚΕ περνάει από την αλληλουχία Nut, οι παράγοντες τερματισμού προσδένονται (μέσω του RNA) στο ΚΕ και αυξάνουν το χρόνο της παύσης στον ασθενή τερματιστή Τερματισμός. Ο παράγοντας αντιτερματισμού pn (μέσω του RNA) προσδένεται στο box B. H pn έχει δύο επικράτειες: η μία αλληλεπιδρά με το RNA και η άλλη με τον Nus A αποτρέποντας την δράση του στον ασθενή τερματιστή.

180 7 οπερόνια Εικόνα Τα οπερόνια rrn στο βακτήριο E. coli περιέχουν γονίδια που κωδικοποιούν τόσο για rrna όσο και για trna. Το ακριβές μήκος των μεταγράφων εξαρτάται από τους υποκινητές (P) και τις αλληλουχίες τερματισμού (t) που χρησιμοποιούνται. Κάθε προϊόν RNA πρέπει να απελευθερωθεί από το μετάγραφο με αποκοπή στα δύο του άκρα. RΝάση ΙΙΙ

181 Πέψη Σ RΝάσης a ΙΙΙ Ένδονουκλεάσες Εξοωνουκλεάσες Ώριμα 23S και 16S RNAs

182 Εικόνα 7.6 Τύπος Ι Τύπος ΙΙ CCA CCA 3 trna-νουκλεοτιδική μεταφοράση Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

183 Ρύθμιση της μεταγραφής στους προκαρυωτικούς οργανισμούς

184 Εικόνα 10.1 Trans-ρυθμιστικοί παράγοντες (Μεταγραφικοί παράγοντες) [Καταστολείς (-) (αρνητικός έλεγχος)] [Ενεργοποιητές (+) (θετικός έλεγχος) Cis-ρυθμιστικά στοιχεία (σε φυσική σύνδεση με το γονίδιο στόχο). Αλληλουχίες στις οποίες προσδένονται οι μεταγραφικοί παράγοντες Μικρομόρια που προσδένονται στους μεταγραφικούς παράγοντες και επάγουν τη μεταγραφή (επαγωγείς) ή καταστέλουν τη μεταγραφή (συγκαταστολείς) Γονίδιο στόχος Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

185 Εικόνα 10.2 Στον αρνητικό έλεγχο, ένας trans-δραστικός καταστολέας προσδένεται στο cisδραστικό χειριστή και σταματά τη μεταγραφή. Αρνητική ρύθμιση (Καταστολείς) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

186 Εικόνα 10.3 Στο θετικό έλεγχο, οι trans-δραστικοί παράγοντες πρέπει να προσδεθούν στις cis-δραστικές θέσεις προκειμένου η RNA πολυμεράση να αρχίσει τη μεταγραφή από τον υποκινητή. Θετική ρύθμιση (Ενεργοποιητές) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

187 Εικόνα 11.3 Tα ρυθμιστικά κυκλώματα είναι ευέλικτα και, ανάλογα με το σχεδιασμό, ελέγχουν θετικά ή αρνητικά την επαγωγή ή την καταστολή. Επαγωγείς Συγκαταστολείς Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

188 Αρνητική ρύθμιση Καταστολέας lac

189 Απέκκριση Οπερόνιο λακτόζης

190 Εικόνα 10.4 Το οπερόνιο lac καταλαμβάνει ~6.000 bp DNA. Το γονίδιο laci (αριστερά) έχει το δικό του υποκινητή (P) και τερματιστή. Το άκρο του laci βρίσκεται ακριβώς πριν τον υποκινητή των δομικών γονιδίων. Ο χειριστής (O) καταλαμβάνει τα πρώτα 26 bp της μεταγραφικής μονάδας. Το γονίδιο lacz ξεκινά από τη βάση +39. Μετά από αυτό ακολουθούν τα γονίδια lacυ και laca. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

191 38 kda (10 μόρια/κύτταρο, ΚΒ=2x10 13 ) X Εικόνα 10.7 Ο καταστολέας διατηρεί το οπερόνιο lac στην ανενεργή κατάσταση μέσω της πρόσδεσής του στο χειριστή. Ο καταστολέας απεικονίζεται ως μια σειρά από συνδεδεμένες επικράτειες, όπως προέκυψαν από την ανάλυση της κρυσταλλικής δομής του. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

192 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Χ Εικόνα 10.8 Η προσθήκη του επαγωγέα μετατρέπει τον καταστολέα στην ανενεργή μορφή του, που δεν μπορεί να προσδεθεί στο χειριστή. Αυτό επιτρέπει στην RNA πολυμεράση να αρχίσει τη μεταγραφή.

193 Εικόνα 10.6 Η προσθήκη επαγωγέα προκαλεί τη γρήγορη επαγωγή του mrna του οπερονίου lac και ακολουθείται από τη σύνθεση των ενζύμων, μετά από μια σύντομη φάση υστέρησης. Η απομάκρυνση του επαγωγέα ακολουθείται από γρήγορη παύση της σύνθεσης.

194 (Cis-επικρατείς) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 10.9 Οι μεταλλάξεις του χειριστή είναι ιδιοστατικές, επειδή ο χειριστής καθίσταται ανίκανος να προσδέσει την πρωτεΐνη-καταστολέα. Αυτό επιτρέπει στην RNA πολυμεράση να έχει απεριόριστη πρόσβαση στον υποκινητή. Οι μεταλλάξεις Oc είναι cis-δραστικές, επειδή επηρεάζουν μόνο τα συνεχόμενα συνδεδεμένα δομικά γονίδια.

195 Χ laci - (Transυποτελείς) ή δεν παράγουν καταστολέα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα Οι μεταλλάξεις που απενεργοποιούν το γονίδιο laci προκαλούν την ιδιοστατική έκφραση του οπερονίου, επειδή η μεταλλαγμένη πρωτεΐνη του καταστολέα δεν μπορεί να προσδεθεί στο χειριστή.

196 Μόνιμη καταστολή (Επαγωγέας) laci S (Trans- Επικρατής) Χ ή δεν παράγουν καταστολέα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

197 Εικόνα 10.5 Ο καταστολέας και η RNA πολυμεράση προσδένονται σε αλληλοεπικαλυπτόμενες θέσεις, γύρω από το σημείο έναρξης της μεταγραφής του οπερονίου lac. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

198 Συνεχείς και ανεστραμμένες επαναλήψεις Εικόνα Ο χειριστής lac έχει συμμετρική αλληλουχία. Η αλληλουχία αριθμείται σε σχέση με το σημείο έναρξης της μεταγραφής στο +1. Τα ροζ βέλη αριστερά και δεξιά δείχνουν τις δύο ανεστραμμένες επαναλήψεις. Με πράσινο φόντο εμφανίζονται οι ταυτόσημες θέσεις των δύο ανεστραμμένων επαναλήψεων. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

199 Κ Μ Εικόνα Οι βάσεις που έρχονται σε επαφή με τον καταστολέα μπορεί να ταυτοποιηθούν με ομοιοπολική διασύνδεση ή με πειράματα που δείχνουν αν η χημική μετατροπή τους αποτρέπει την πρόσδεση. Έτσι, αναγνωρίστηκαν θέσεις και στις δύο αλυσίδες του DNA, που εκτείνονται από το +1 έως το +23. Ιδιοστατικές μεταλλάξεις συμβαίνουν σε 8 θέσεις του χειριστή, ανάμεσα στο +5 και στο +17. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

200 Εικόνα Ο επαγωγέας προσδένεται στον ελεύθερο καταστολέα, ώστε να διαταράξει μια ισορροπία (αριστερά), ή προσδένεται άμεσα στον καταστολέα που βρίσκεται προσδεδεμένος στο χειριστή (δεξιά); Ταχεία επαγωγή t1/2>15 min t1/2<1 min

201 Και τα 10 μόρια του καταστολέα είναι προσδεμένα στο DNA Εικόνα Ο καταστολέας Lac προσδένεται ισχυρά και με ειδικό τρόπο στο χειριστή του, αλλά απελευθερώνεται από τον επαγωγέα. Όλες οι σταθερές ισορροπίας δίνονται σε M -1. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

202 96% Βασικά επίπεδα Εικόνα Σχεδόν όλη η ποσότητα του καταστολέα ενός κυττάρου βρίσκεται δεσμευμένη στο DNA. Επαγόμενα επίπεδα Κατάληψη του χειριστή 3% Ταχεία καταστολή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

203 Πως ο καταστολέας εμποδίζει την RNA πολυμεράση? Y+RNA Pol (KB=10 5 ) πολύ μικρή συχνότητα ενάρξεων Y + RNA Pol + K, (KB=10 7 ) μεγάλη συχνότητα ενάρξεων Ο καταστολέας αυξάνει την πρόσδεση της RNA Pol στον υποκινητή κατά δύο τάξεις μεγέθους αλλά δεν επιτρέπει τη δημιουργία του ανοιχτού συμπλόκου

204 Εικόνα Η δομή ενός μονομερούς του καταστολέα Lac αποκαλύπτει αρκετές ανεξάρτητες επικράτειες. Η φωτογραφία είναι ευγενική προσφορά του Mitchell Lewis. Κεφαλή Διμερή και τετραμερή ολιγομερισμού Τετραμερή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

205 Μοτίβο HTH Φερμουάρ λευκίνης

206 Εικόνα Το τετραμερές του καταστολέα αποτελείται από δύο διμερή. 1 Ομοδιμερισμός Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

207 Εικόνα Αν και τα δύο διμερή σε ένα τετραμερές καταστολέα προσδεθούν στο DNA, τότε το DNA ανάμεσα στις δύο θέσεις πρόσδεσης σχηματίζει ένα βρόχο. Ο2-80 Ο Ο1

208 -35 Εικόνα Όταν ένας τετραμερής καταστολέας προσδένεται σε δύο χειριστές, η έκταση του DNA ανάμεσά τους εξωθείται στη δημιουργία ενός σφιχτού βρόχου. Η μπλε δομή στο κέντρο του βρόχου του DNA αντιπροσωπεύει την πρωτεΐνη CAP (CRP), άλλη μια ρυθμιστική πρωτεΐνη που προσδένεται στην περιοχή. Η φωτογραφία είναι ευγενική προσφορά του Mitchell Lewis. ΤΑΤΑ

209 Θετική ρύθμιση Ενεργοποιητής CAP

210 Αλληλεπίδραση CAP με RNA pol μέσω της α υπομονάδας Fig Ασθενές +1 Θέση Χειριστή

211 Εικόνα 11.5 Tο camp περιέχει μία μόνο φωσφορική ομάδα που συνδέεται τόσο με το 5 όσο και με το 3 του δακτυλίου του σακχάρου. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

212 - + Εικόνα 11.6 Η γλυκόζη, μειώνοντας τα επίπεδα του camp, εμποδίζει τη μεταγραφή των οπερονίων που εξαρτώνται από την ενεργότητα της πρωτεΐνης CRP kda (CAP) Επικράτεια ενεργοποίησης CRP: camp Receptor Protein CAP: Catabolite Activator Protein Επικράτεια πρόσδεσης ~ 100 γονίδια

213 Fig lac Ασθενές Εικόνα 11.7 H πρότυπη αλληλουχία πρόσδεσης της CRP (CAP) περιέχει το πολύ καλά συντηρημένο πενταμερές TGTGA και (μερικές φορές) και την ανάστροφή του αλληλουχία (TCANA).

214 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 11.8 Η απόσταση της θέσης πρόσδεσης της πρωτεΐνης CRP από τη θέση πρόσδεσης της RNA πολυμεράσης διαφέρει στα διάφορα οπερόνια.

215 Ρύθμιση μετά την έναρξη της μεταγραφής

216 Εικόνα Η εξασθένηση παρατηρείται όταν παρεμποδίζεται ο σχηματισμός της φουρκέτας τερματισμού στο RNA. Εξασθενητής (Attenuator) Πολλά οπερόνια σύνθεσης αα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

217 E. coli Κ Trp... Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα Tο οπερόνιο trp αποτελείται από πέντε συνεχή δομικά γονίδια και μία ρυθμιστική περιοχή που προηγείται και περιλαμβάνει τον υποκινητή, το χειριστή, μία περιοχή που κωδικοποιεί ένα πεπτίδιο-οδηγό και έναν εξασθενητή.

218 Trp + Trp - Εικόνα H περιοχή-οδηγός του οπερονίου trp μπορεί να υιοθετήσει δύο εναλλακτικές στερεοδιατάξεις. Στο κέντρο φαίνονται οι τέσσερις περιοχές που μπορούν να ζευγαρώσουν. Η περιοχή 1 είναι συμπληρωματική με την περιοχή 2, η οποία είναι επίσης συμπληρωματική και με την περιοχή 3. Η περιοχή 3 είναι συμπληρωματική, εκτός από την περιοχή 2, και με την περιοχή 4. Στα αριστερά παρουσιάζεται η δομή που υιοθετείται όταν η περιοχή 1 ζευγαρώνει με την περιοχή 2 και η περιοχή 3 με την περιοχή 4. Στα δεξιά παρουσιάζεται η στερεοδιάταξη που υιοθετείται όταν η περιοχή 2 ζευγαρώνει με την περιοχή 3 αφήνοντας μονόκλωνες τις περιοχές 1 και Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

219 Μηχανισμός ρύθμισης από το ριβόσωμα UGGUGG UGA uuuuu RNA Pol UGA UGGUGG uuuu RNA Pol AUG

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ

ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ ΔΕΥΤΕΡΟ ΣΚΑΛΟΠΑΤΙ ΤΗΣ ΡΟΗΣ ΠΛΗΡΟΦΟΡΙΩΝ - ΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ Ιωάννης Π. Τρουγκάκος Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας, Παν/μιο Αθηνών 6.1. Πρωτεϊνοσύνθεση Ένας μηχανισμός αποκωδικοποίησης

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ογκογονίδια, τα oγκοκατασταλτικά γονίδια και οι αυξητικοί παράγοντες.

ΕΙΣΑΓΩΓΗ ογκογονίδια, τα oγκοκατασταλτικά γονίδια και οι αυξητικοί παράγοντες. ΜΟΡΙΑΚΗ ΟΓΚΟΓΕΝΕΣΗ ΕΙΣΑΓΩΓΗ Κάθε αλλαγή ή βλάβη στο σύστημα ελέγχου του κυτταρικού πολλαπλασιασμού έχει δραματικές επιπτώσεις για τον οργανισμό και μπορεί να οδηγήσει στην εμφάνιση καρκίνου. Ένα καρκινικό

Διαβάστε περισσότερα