Gens VIII (Lewin) Μοριακή Βιολογία του Γονιδίου (Watson et al.)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Gens VIII (Lewin) Μοριακή Βιολογία του Γονιδίου (Watson et al.)"

Transcript

1 Gens VIII (Lewin) Κεφάλαιο 5 (εκτός 14) Κεφάλαιο 6 (1-15, 18-19) Κεφάλαιο 7 (1-5, 8-10, 14) Κεφάλαιο 9 (1-4, 6-15, 17, 20-25) Κεφάλαιο 24 (19, 21) Κεφάλαιο 10 (1-14) Κεφάλαιο 11 (2-5, 15-17) Μοριακή Βιολογία του Γονιδίου (Watson et al.) Κεφάλαιο 15 Κεφάλαιο 14 Κεφάλαιο 12 Κεφάλαιο 16

2 ΕΙΣΑΓΩΓΗ

3 Ισχύς χημικών δεσμών Δεσμοί Μήκος Ισχύς στο κενό Ισχύς στο νερό ( o Α) (kcal/mole) (kcal/mole) Ομοιοπολικός ~1.5 ~90 ~90 Ετεροπολικός ή Ιοντικός ~2.5 ~80 ~3 Δεσμός υδρογόνου Δεσμός Van der Waals ~3 ~5 ~1 ~3.5 ~1 ~0.1

4 Χημικοί δεσμοί Δεσμός Η Δεσμός Van der Waals Υδρόφοβες αλληλεπιδράσεις

5 Ασθενείς δεσμοί μεταξύ μακρομορίων

6 Μήκος Μάζα Όγκος 1 m 1 mm = 10-3 m 1 μm = 10-6 m 1 nm = 10-9 m 1 o A = m 1 pm = m 1 g 1 mg = 10-3 g 1 μg (γ) = 10-6 g 1 ng = 10-9 g 1 pg = g 1 Da = 1,66 x g 1 kda = 10 3 Da 1 L 1 ml = 10-3 L 1 μl (λ) = 10-6 L 1 nl = 10-9 L 1 pl = 10-9 L C-C=1.5 o A, Πάχος DNA=20 o A, Μήκος περιστροφής DNA= 34 o A Ριβόσωμα=20nm, Μιτοχόνδριο/Βακτήριο=1-2 μm, Πυρήνας= 10 μm, Ζωικό κύτταρο=10-30 μm, DNA ανθρώπου= ~1 m, ~0.3 pg,1 bp= ~660 Da, 1 αμινοξύ= ~110 Da

7 Κ Ε Φ Α Λ Α Ι Ο 5: Το αγγελιοφόρο RNA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

8 Γιατί τα κύτταρα έχουν διαφορετική μορφή και λειτουργίες?

9 [κυτταρικές δομές, κατάλυση, ρύθμιση, ανοσοαπόκριση, μεταφορά, κίνηση] κυτταρικός τύπος Εικόνα 5.2 Αντιγραφή (Διαιώνιση/ Εξέλιξη της πληροφορίας) rrna (Μετάφραση) trna (Μετάφραση) srna (κατάλυση-ρύθμιση) mrna (Μεταφορά της πληροφορίας) Πρωτεΐνη (Εκτέλεση της πληροφορίας)

10 Ποια μακρομόρια βρίσκονται σε μεγαλύτερη αφθονία στο κύτταρο?

11 Εικόνα 5.12 Παρουσίαση των μακρομοριακών συστατικών της E. coli. ριβοσώματα ~ (25%) Πρωτεΐνες: ~60%, RNA: ~20%, mrna: ~ 1%, DNA: ~ 1,5% Πρωτεϊνοσύνθεση: ~90% ATP

12 Από πόσες περιοχές αποτελείται ένα mrna?

13 5 UTR α β 3 UTR Εικόνα 5.15 Ένα βακτηριακό mrna περιλαμβάνει μη μεταφραζόμενες, αλλά και μεταφραζόμενες περιοχές. Κάθε κωδική περιοχή έχει τα δικά της σήματα έναρξης και τερματισμού. Ένα τυπικό mrna μπορεί να έχει αρκετές κωδικές περιοχές.

14 Το ευκαρυοτικό mrna είναι μονοκιστρονικό ~17 ~170 ~700 ~700 0

15 Προκαυωτικά DNA mrna Μεταγραφή Μετάφραση Πρωτεΐνες Ευκαρυωτικά Eξ-1 Eξ-2 Eξ-3 DNA Προ-mRNA Εσ-1 Εσ-2 Μεταγραφή Ωρίμανση mrna Εξ-1 Εξ-2 Εξ-3 Πολυ(A) Μετάφραση Πρωτεΐνη

16 Μέσος αριθμός εσονίων ανά γονίδιο Figure 13-2

17

18 Λειτουργίες της 5 UTR Σταθερότητα του mrna Έναρξη της μετάφρασης Ρύθμιση της μετάφρασης (ευκαριωτικά) Λειτουργίες της 3 UTR Σταθερότητα του mrna Ρύθμιση της μετάφρασης (ευκαριωτικά) Καθορισμός του 3 άκρου και προσθήκη των πρώτων Α της πολυ(α) ουράς (ευκαριωτικά)

19 Εικόνα 5.13 Επισκόπηση: Το mrna μεταγράφεται, μεταφράζεται και αποικοδομείται ταυτόχρονα στα βακτήρια. Μεταγραφή:~40 Nt/sec Μετάφραση:~15 αα/sec mrna:5000 Nt t 1/2 ~ 2 min

20 Εικόνα 5.17 Επισκόπηση: Η έκφραση του mrna σε ζωικά κύτταρα απαιτεί μεταγραφή, τροποποίηση, επεξεργασία, πυρηνο-κυτταροπλασματική μεταφορά και μετάφραση. CAP ~40 Nt/sec Εσ-1 Εσ-2 Ζυμομύκητες: t1/2~ 1-60 min Ανώτεροι: t1/2 ~ 1-24 h ~2 αα/sec

21 Μεταφορά του mrna Figure 13-2 Μεταφορά mrna

22 Τα ευκαρυωτικά γονίδια ρυθμίζονται σε πολλά επίπεδα Chromatin

23 Ποια είναι τα υποστρώματα της RNA Πολυμεράσης?

24 Καλύπτρα 3 5 δεσμός 5 5 δεσμός P-P-P γ 3 β α 5 P-P-P

25 Εικόνα 5.18 Η καλύπτρα ασφαλίζει το 5 άκρο του mrna και μπορεί να μεθυλιωθεί σε αρκετές θέσεις. (Α) CH α β α (πολυκύτταροι) 6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 (Ανώτεροι: CH3 σε (Α) ανά ~1000 Nt) Ορισμένοι πολυκύτταροι

26 Λειτουργίες της καλύπτρας Μεταφορά μέσω πυρηνικών πόρων Προστασία του mrna από 5 εξωνουκλεάσες Έναρξη της μετάφρασης Απομάκρυνση του 1 ου (5 ) εσονίου

27 Εικόνα 5.17 Poly(A)+ Εσ-2 Εσ-1 (Εκτός mrna ιστονών)

28 Poly(A) Nt Εικόνα Το σύμπλοκο επεξεργασίας του 3 άκρου περιλαμβάνει αρκετές ενζυμικές ενεργότητες. Οι παράγοντες CPSF και CstF αποτελούνται από αρκετές υπομονάδες. Τα άλλα συστατικά είναι μονομερή. Η συνολική μάζα του συμπλόκου ξεπερνάει τα 900 kd. PAP Nt Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

29 Λειτουργίες πολύ(α) ουράς Μεταφορά μέσω πυρηνικών πόρων Προστασία του mrna από 3 εξωνουκλεάσες Έναρξη της μετάφρασης Ρύθμιση στο επίπεδο της μετάφρασης [αποθηκευμένα μηνύματα με μικρά πολυ(α) ~20 Α]

30 Εικόνα 5.19 Το πολυ(α) + RNA μπορεί να διαχωριστεί από τα άλλα RNA με κλασμάτωση σε στήλη σεφαρόζης-ολιγο(dt). Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

31 Εναλλακτικό μάτισμα

32 Πολλαπλά polya+ ~50% των mrna Έχουν περισσότερα από ένα σήματα πολυαδενυλίωσης Πολλαπλοί υποκινητές

33 Εικόνα 5.20 Η αποικοδόμηση του βακτηριακού mrna είναι μια διαδικασία δύο σταδίων. Οι ενδονουκλεολυτικές διασπάσεις προχωρούν από το 5 προς το 3 άκρο, πίσω από τα ριβοσώματα. Τα κομμάτια που απελευθερώνονται αποικοδομούνται από εξωνουκλεάσες που κινούνται από το 3 προς το 5 άκρο. 5 3 αποικοδόμηση κατά κανόνα 3 5 Eλικάση Αποικοδομόσωμα PAP προκαρυωτικών προσθέτει ~10-40 Α στο 3 άκρο σε ορισμένα RNA. Σήμα αποικο-δόμησης από το 3 άκρο. 3 5 αποικοδόμηση Δευτεροταγής δομές στις 5 - και 3 -UTR σταθεροποιούν ορισμένα mrna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

34 Εικόνα 5.21 Οι τροποποιήσεις των άκρων του mrna το προστατεύουν από την αποικοδόμηση. Εσωτερικές αλληλουχίες μπορεί να ενεργοποιήσουν τα συστήματα αποικοδόμησης. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

35 Fig

36 Αποικοδόμηση 5 3 στους ζυμομύκητες Η αποαδενυλίωση επιτρέπει την αφαίρεση της καλύπτρας, γεγονός που οδηγεί στην εξωνουκλεολυτική διάσπαση του 5 άκρου. STOP 1-2 Nt Απο- Αδενυλάση Ccr4 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

37 Αποικοδόμηση 3 5 στους ζυμομύκητες Εικόνα 5.25 Η αποαδενυλίωση μπορεί να προκαλέσει άμεσα την ενδονουκλεολυτική διάσπαση και την εξωνουκλεολυτική αποικοδόμηση από το 3 άκρο. Ειδικές πολυα ριβονουκλεάσες Ειδικές ενδοριβονουκλεάσες Εξώσωμα (~9 εξωνουκλεάσες) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Ανώριμα πρόδρομα RΝΑ

38 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 AU rich element Εικόνα 5.22 Ρυθμιστικές πρωτεΐνες: Μια αλληλουχία ARE στην 3 μη μεταφραζόμενη περιοχή προκαλεί την αποικοδόμηση του mrna.

39 Εικόνα 5.23 Υποδοχέας της τρανσφερίνης του σιδήρου. Μια αλληλουχία IRE στην 5 UTR ελέγχει τη σταθερότητα του mrna. IRE Fe Τρανσφερίνη Υποδοχέας Φεριτίνη

40 Εικόνα 5.28 Τα RNA μεταφέρονται μέσω μεμβρανών σε μια ποικιλία συστημάτων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

41 Μεταφορά του mrna στο κυτταρόπλασμα α) Με ειδική μεταφορά σε συγκεκριμένη θέση β) Με γενική αποικοδόμηση εκτός της συγκεκριμένης θέσης γ) με ελεύθερη διάχυση και παγίδευση σε συγκεκριμένη θέση

42 Έμβρυο Δροσόφιλας

43 Κ Ε Φ Α Λ Α Ι Α 6-7: Μετάφραση Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

44 Ποια μακρομόρια και οργανίδια συμμετέχουν στη μετάφραση?

45 Εικόνα 5.1 Οι τρεις τύποι του RNA που είναι απαραίτητοι για τη γονιδιακή έκφραση σε όλα τα συστήματα είναι το mrna (φέρει την κωδική αλληλουχία), το trna (παρέχει το αμινοξύ που αντιστοιχεί σε κάθε κωδικόνιο) και το rrna (ένα μείζον συστατικό του ριβοσώματος που παρέχει το περιβάλλον για την πρωτεϊνοσύνθεση). Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

46 20 nm Εικόνα 5.8 Το ριβόσωμα αποτελείται από δύο υπομονάδες.

47 Εικόνα 6.2 Τα ριβοσώματα είναι μεγάλα ριβονουκλεοπρωτεϊνικά σωμάτια που περιέχουν περισσότερο RNA από πρωτεΐνη και αποσυνδέονται σε μεγάλες και μικρές υπομονάδες. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

48 Τι είναι τα πολυσώματα (πολυριβοσώματα) και από τι αποτελούνται

49 5 3 Εικόνα 5.9 Ένα πολυριβόσωμα αποτελείται από ένα mrna που μεταφράζεται ταυτόχρονα από πολλά ριβοσώματα, τα οποία κινούνται στην κατεύθυνση 5 3. Κάθε ριβόσωμα περιέχει δύο μόρια trna: το ένα φέρει την αρτιγενή πρωτεΐνη και το άλλο φέρει το επόμενο αμινοξύ που πρόκειται να προστεθεί. Προκαριωτικά > 10, Ευκαρυωτικά ~ 8 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

50 Εικόνα 5.10 Η πρωτεϊνοσύνθεση λαμβάνει χώρα στα πολυσώματα. Η φωτογραφία είναι ευγενική προσφορά του Alex Rich. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

51 Εικόνα 5.14 Οι μεταγραφικές μονάδες μπορούν να γίνουν ορατές στα βακτήρια. Η φωτογραφία είναι ευγενική προσφορά του Oscar Miller. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

52 Ποια είναι η λειτουργία του trna

53 2 3 Εικόνα 5.3 Ένα trna έχει τη διττή ιδιότητα ενός προσαρμοστή, ο οποίος αναγνωρίζει τόσο το αμινοξύ όσο και το κωδικόνιο. Η 3 αδενοσίνη είναι ομοιοπολικά συνδεδεμένη με ένα αμινοξύ. Το αντικωδικόνιο δημιουργεί ζεύγη βάσεων με το κωδικόνιο στο mrna. Προσαρμοστής: Διαμεσολαβιτικό μόριο μεταξύ ενός αμινοξέος και ενός κωδικονίου Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

54 Εικόνα 5.4 Η διάταξη σε σχήμα τριφυλλιού του trna έχει σταθερές και ημισταθερές βάσεις και μια συντηρημένη ομάδα αλληλεπιδράσεων μεταξύ ζευγών βάσεων Nt D: Διυδροουριδίνη D D T:Ριβοθυμιδίνη Ψ:Ψευδοουριδίνη Επιπλέον ζεύγη: G-U, G-Ψ, A-Ψ Στέλεχος Βρόχος Βραχίονας αντικωδικονίου 3-21 Nt Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

55 Εικόνα 7.7 Και οι τέσσερις βάσεις μπορούν να τροποποιηθούν στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις

56 Εικόνα 5.6, 7 Βραχίονας δέκτης Βραχίονας Δέκτης

57 Κ Ε Φ Α Λ Α Ι Ο 7 Γενετικός κώδικας Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

58 Εικόνα 7.1 Όλες οι τριπλέτες-κωδικόνια έχουν νόημα: 61 αντιστοιχούν σε αμινοξέα και 3 προκαλούν τερματισμό (STOP). α. 61 κωδικόνια + 3 λήξης β. Κοινός εκτός ορισμένων πρωτόζωων και μιτοχονδρίων γ. Συνώνυμα κωδικόνια δ. Εκφυλισμός στην 3 η βάση ε. Σε 2 συνώνυμα κωδικόνια η 3η βάση είναι Pur ή Pyr

59 Αλληλουχία mrna Αλληλουχία πρωτεΐνης Ανοιχτό πλαίσιο ανάγνωσης Fig. 14-1

60 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 7.2 Το πλήθος των κωδικονίων για κάθε αμινοξύ δεν αντιστοιχεί στη συχνότητα εμφάνισης του αμινοξέος στις πρωτεΐνες.

61 In vitro μετάφραση mrna + ribosomes Poly-U Poly-Phe Poly-C Poly-Pro Poly-A Poly-Lys

62

63 Rib + 3Nt + (trna + συνθετάσες + αα) Rib-3Nt-tRNA~αα Rib + 3Nt + (trna + συνθετάσες + αα) + αα* Rib-3Nt- trna~αα? + AUC AUC + AUC

64 Πόσα διαφορετικά trna χρειάζονται? Ο αριθμός των trna > του αριθμού των αμινοξέων 20 ομάδες ισοδεκτικών (ομότυπων) trna [trna1-cys, trna2-cys] Τα ομότυπα trna προσδένουν το ίδιο αα και προσδένονται σε συνώνυμα κωδικόνια Ο αριθμός των trna < του αριθμού των κωδικονίων (E. coli:45) Το ίδιο trna (αντικωδικόνιο) προσδένεται σε περισσότερα από ένα συνώνυμα κωδικόνια

65 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Υπόθεση ταλάντευσης: Η ταλάντευση στο ζευγάρωμα βάσεων επιτρέπει το σχηματισμό ζευγών G-U μεταξύ της τρίτης βάσης του κωδικονίου και της πρώτης βάσης του αντικωδικονίου.

66 Εικόνα 7.5 Το ζευγάρωμα κωδικονίου-αντικωδικονίου περιλαμβάνει ταλάντευση στην τρίτη θέση. I A, U, C Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

67 Εικόνα 7.7 Και οι τέσσερις βάσεις μπορούν να τροποποιηθούν στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

68 Εικόνα 7.8 Η ινοσίνη μπορεί να σχηματίσει ζεύγη με οποιαδήποτε από τις U, C και A. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

69 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 7.3 Οι βάσεις στην τρίτη θέση έχουν τη μικρότερη επίδραση στο νόημα των κωδικονίων. Τα πλαίσια επισημαίνουν τις ομάδες κωδικονίων στις οποίες ο εκφυλισμός της τρίτης βάσης διασφαλίζει ότι όλα τα κωδικόνια έχουν το ίδιο νόημα. G U I C C G U Ελάχιστο=31 trna G U G U C G U G U G U G G U G U G U G G U G U G U

70 Κ Ε Φ Α Λ Α Ι Α 6-7: Μετάφραση Προεναρκτήριες Αντιδράσεις (Προ-εναρκτήριες αντιδράσεις)

71 Εικόνα 6.7 Η πρωτεϊνοσύνθεση διακρίνεται σε τρία στάδια. ~30-35 aa P A Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

72 2 3 A Εικόνα 5.3 Ένα trna έχει τη διττή ιδιότητα ενός προσαρμοστή, ο οποίος αναγνωρίζει τόσο το αμινοξύ όσο και το κωδικόνιο. Η 3 αδενοσίνη είναι ομοιοπολικά συνδεδεμένη με ένα αμινοξύ. Το αντικωδικόνιο δημιουργεί ζεύγη βάσεων με το κωδικόνιο στο mrna. Αμινοάκυλο trna συνθετάσες 1 συνθετάση/αα/ομάδα ομότυπων trna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

73 Προ-εναρκτήριεςαντιδράσεις Fig ~ ~ ~ ~ 2 - ή Χρησιμοποιείτε για τον πεπτιδικό δεσμό ~ αα~trna

74 Προ-εναρκτήριες αντιδράσεις Εικόνα 7.13 Μια αμινοακυλο-trna συνθετάση φορτώνει το trna με ένα αμινοξύ.

75 Εικόνα 7.14 Μια αμινοακυλο-trna συνθετάση φέρει τρεις ή τέσσερις περιοχές με διαφορετικές λειτουργίες. Οι πολυμερείς συνθετάσες διαθέτουν και μία επικράτεια ολιγομερισμού. Ν- Ν- Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

76 Εικόνα 7.16 H trna συνθετάση τάξης Ι έρχεται σε επαφή με το trna στη μικρή αύλακα του στελέχους-δέκτη και στο αντικωδικόνιο. αα Επιλογέας (ομότυπα) (1 δεσμός Η) Κέντρο σύνθεσης (1 ή 2 δεσμοί Η)

77 Εικόνα 6.8 Στα διάφορα στάδια της πρωτεϊνοσύνθεσης, η συχνότητα λάθους κυμαίνεται από 10-6 έως 5 x Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

78 P1 + m1 P1 + m2 P1-m1 + ~15 Kcal/mol (G1) P1-m2 + ~10 Kcal/mol (G2) ΔG = G2-G1 = ~ - 5 Kcal/mol (~ 1 δεσμός Η) P1-m1 P1-m2 = ~ 10 5

79 Κινητικός έλεγχος-ii Κινητικός έλεγχος-i Εικόνα 7.18 Η αναγνώριση του σωστού trna από τις συνθετάσες ελέγχεται σε δύο στάδια. Πρώτον, το ένζυμο έχει μεγαλύτερη συγγένεια για τα ομότυπα trna. Δεύτερον, η αμινοακυλίωση ενός λανθασμένου trna γίνεται με πολύ αργό ρυθμό.

80 Πρόσδεση αα στις συνθετάσες Tyr~tRNA συνθετάση 4-5 Kcal/mol Phe Tyr Trp Etyr-Tyr Etyr-Phe = ~ 104 Λάθος = ~ 10-4

81 EIle ~2 Kcal/mol E Ile + Ile( 3 H)/Val( 14 C) E Ile -Ile (3H) E Ile -Val (14C) = ~ 225 Λάθος = ~ 1/225 E Ile + Ile( 3 H)/Val( 14 C) + trna Ile E Ile -Ile (3H) E Ile -Val (14C) = ~ Λάθος = ~ 1/60.000

82 Ile Val Κινητικός έλεγχος 1/225 Εικόνα 7.19 Ο διορθωτικός έλεγχος απαιτεί την πρόσδεση του ομότυπου trna στη συνθετάση που έχει δεσμεύσει λανθασμένο αμινοξύ και γίνεται είτε μέσω μιας αλλαγής στη διαμόρφωση που προκαλεί την υδρόλυση του αμινοακυλο- AMP είτε μέσω της μεταφοράς του αμινοξέος στο trna η οποία ακολουθείται από υδρόλυση. Χημικός διορθωτικός έλεγχος

83 Συνθετάση ισολευκίνης Εικόνα 7.21 Η Ile-tRNA συνθετάση έχει δύο ενεργά κέντρα. Τα αμινοξέα που είναι μεγαλύτερα από την Ile δεν μπορούν να ενεργοποιηθούν, επειδή δε χωρούν στο κέντρο σύνθεσης. Τα αμινοξέα που είναι μικρότερα από την Ile αποβάλλονται, διότι μπορούν να εισέλθουν στη θέση διόρθωσης. αα αα trnaile trna-ile trna+val trna-ile Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 trna-val

84 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 5.5 Το νόημα του trna καθορίζεται από το αντικωδικόνιό του και όχι από το αμινοξύ του.

85 ΕΝΑΡΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

86 Προκαρυωτικά AUG AUG AUG Ευκαρυωτικά

87 ΕΝΑΡΞΗ Fig Παράγοντες έναρξης IF1, IF2, IF3

88 ~20% Εικόνα 6.11 Η έναρξη απαιτεί υπομονάδες 30S, που φέρουν τον IF-3. P A fmet Εναρκτήριο fmet GTP P A P A Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

89 Πως η μικρή ρβοσωματικά υπομονάδα αναγνωρίζει τη σωστή θέση πρόσδεσης στο mrna?

90 Εικόνα 6.16 Οι θέσεις πρόσδεσης του ριβοσώματος στο mrna μπορούν να απομονωθούν από σύμπλοκα έναρξης. Οι θέσεις πρόσδεσης περιλαμβάνουν μια ανοδική αλληλουχία Shine-Dalgarno και ένα κωδικόνιο έναρξης. 16S RNA Nt AGGAGGNNN UCCUCCNNN 3 8 Nt IF3? 16S RNA 5 AGGAGGNNN mrna 5 ---AGGAGG-----AUG UCCUCCNNN 3

91 P Fig

92 Εικόνα 6.13 Το fmet-trna f έχει μοναδικά χαρακτηριστικά, τα οποία το διακρίνουν ως το εναρκτήριο trna. GTP GTP Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

93 IF-2 Εικόνα 6.14 Το fmet-trna f μπορεί να χρησιμοποιηθεί αποκλειστικά για την έναρξη από τις υπομονάδες 30S, ενώ τα άλλα αμινοακυλo-trna (αα-trna) μπορούν να χρησιμοποιηθούν κατά την επιμήκυνση από τα ριβοσώματα 70S. 5 & μη εισαγωγή στη θέση Α G U A -met G U G -val G U U -leu 5 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

94 Εικόνα 6.12 Το N-φορμυλο-μεθειονυλο-tRNA (fmet-trna f ) έναρξης δημιουργείται με φορμυλίωση του μεθειονυλο-trna, χρησιμοποιώντας ως συμπαράγοντα το φορμυλο-τετραϋδροφολικό οξύ. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

95 Εικόνα 6.15 Ο IF-2 είναι αναγκαίος για την πρόσδεση του fmet-trna f στο σύμπλοκο 30S-mRNA. Μετά τη σύνδεση της 50S, αποδεσμεύονται όλοι οι παράγοντες IF και διασπάται το GTP. Η 50S επάγει την υδρόλυση του GTP από τον IF-2 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

96 Έναρξη της μετάφρασης

97 Αποφορμυλίωση

98 Εικόνα 6.17 Η έναρξη πραγματοποιείται ανεξάρτητα σε κάθε κιστρόνιο ενός πολυκιστρονικού mrna. Όταν η διακιστρονική περιοχή είναι μακρύτερη από το εύρος του ριβοσώματος, η αποσύνδεση κατά τον τερματισμό ακολουθείται από ανεξάρτητη επανέναρξη στο επόμενο κιστρόνιο. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

99 Εξάρτηση Fig RBS 2

100 Έναρξη στα ευκαρυωτικά Εικόνα 6.18 NNNPuNNAUGG

101 Παράγοντες ρύθμισης Επαναλαμβανόμενες ενάρξεις Fig

102 α Εικόνα Α β Ελικάση P A AUG 3 UTR 1Α 1 GTP 1Α 1 γ δ 4E 3 2 1Α 1 + AUG 3 UTR Genes VIII - Ακαδημαϊκές Εκδόσεις Α 1

103 GTP Εικόνα 6.24 Ο eιf1 και ο eιf1a βοηθούν το σύμπλοκο έναρξης 43S να σαρώσει το mrna, έως ότου να συναντήσει ένα κωδικόνιο AUG. Ο eιf2 υδρολύει το GTP του και αποδεσμεύεται μαζί με τον IF3. Ο eιf5β μεσολαβεί στη σύνδεση των ριβοσωμικών υπομονάδων 60S και 40S. P 1A GTP NNNPuNNAUGG Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

104 * Fig , 27

105 AUG Εικόνα 6.18 Η μικρή υπομονάδα των ευκαρυωτικών ριβοσωμάτων μεταναστεύει από το 5 άκρο του mrna στη θέση πρόσδεσης του ριβοσώματος, η οποία περιλαμβάνει ένα κωδικόνιο έναρξης AUG. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

106 Έναρξη σε εσωτερικές θέσεις (IRES) 43S 5 5 1Α 1 3 IRES

107 ΕΠΙΜΗΚΥΝΣΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

108 Fig Επιμήκυνση στα προκαρυωτικά Παράγοντες Επιμήκυνσης Tu, Ts, G

109 fmet-trnaf P A 5% των πρωτεϊνών μόρια/κύτταρο Κιρομμυκίνη Εικόνα 6.25 Ο EF-Tu- GTP τοποθετεί το αμινοακυλο-trna στο ριβόσωμα και στη συνέχεια αποδεσμεύεται ως EF- Tu-GDP. Ο EF-Ts απαιτείται για την αντικατάσταση του GDP από το GTP. Η αντίδραση καταναλώνει GTP και απελευθερώνει GDP. Το μόνο αμινοακυλοtrna που δεν μπορεί να αναγνωριστεί από τον EF-Tu-GTP είναι το fmet-trnaf και έτσι αποτρέπεται η ενσωμάτωσή του σε εσωτερικά κωδικόνια AUG ή GUG. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

110

111 5X10-3 Εικόνα 6.8 Στα διάφορα στάδια της πρωτεϊνοσύνθεσης, η συχνότητα λάθους κυμαίνεται από 10-6 έως 5 x ~5 x 10-4 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

112 Εικόνα 7.27 Στη θέση Α μπορεί να εισαχθεί (από τον EF-Tu) οποιοδήποτε αμινοακυλο-trna, αλλά μόνο όποιο ζευγαρώσει με το αντικωδικόνιο δημιουργεί επαφές με το rrna οι οποίες το σταθεροποιούν. Απουσία αυτών των επαφών, το αμινοακυλο-trna αποβάλλεται από τη θέση Α. Tu-GTPαα~tRΝΑ

113 mrna trna trna 5 Εικόνα 6.47 Το ζευγάρωμα κωδικονίουαντικωδικονίου προάγει την αλληλεπίδραση του mrna με τις αδενίνες του 16S rrna, ενώ στην περίπτωση της αντιπαράθεσης μη συμπληρωματικών κωδικονίων-αντικωδικονίων το mrna δεν μπορεί να αλληλεπιδράσει με τις αδενίνες αυτές mrna Πρόσδεση του σωστού αα~trna στη μικρή ριβοσωματική υπομονάδα Αλληλεπίδραση mrna με16s rrna Αλλαγή στην στερεοδιαμόρφωση του ριβοσώματος υδρόλυση του GTP Απομάκρυνση του Tu-GDP Μεταφορά ολόκληρου του αα~trna στην A θέση

114 Tu-GDP Tu-GTP

115 Πεπτιδικός δεσμός Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

116 Εικόνα 6.26 Ο σχηματισμός του πεπτιδικού δεσμού γίνεται με την αντίδραση μεταξύ του πολυπεπτιδίου του πεπτιδυλο-trna στη θέση P και του αμινοξέος του αμινοακυλοtrna στη θέση Α. Πεπτίδυλο-μεταφοράση-23S rrna Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

117 Εικόνα 6.27 Η πουρομυκίνη μιμείται το αμινοακυλο-trna, επειδή μοιάζει με ένα αρωματικό αμινοξύ συνδεδεμένο σε μια ένωση σακχάρου-βάσης. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

118 Μετατόπιση του p~trna G GTP pi Εικόνα 6.28 Το βακτηριακό ριβόσωμα έχει τρεις θέσεις πρόσδεσης του trna. E G GDP Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 P A

119 P A III G GTP pi Εικόνα 6.29 Τα μοντέλα για τη μετατόπιση περιλαμβάνουν δύο στάδια. Κατά το σχηματισμό του πεπτιδικού δεσμού, αρχικά μετατοπίζεται το αμινοάκυλο άκρο του trna από τη θέση Α στη θέση P. Στη συνέχεια, μετατοπίζεται το άκρο του αντικωδικονίου του trna στη θέση P. P A G-GDP P A III G-GDP III

120 Εικόνα 6.30 Η πρόσδεση των παραγόντων EF-Tu και EF-G γίνεται εναλλάξ, καθώς τα ριβοσώματα δέχονται καινούρια αμινοακυλοtrna, σχηματίζουν πεπτιδικούς δεσμούς και μετατοπίζονται. 1 ATP και 2 GTP/πεπτιδικό δεσμό Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

121 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 6.31 Η δομή του τριμερούς συμπλόκου αμινοακυλο-trna EF-Tu GTP (αριστερά) μοιάζει με τη δομή του EF-G (δεξιά). Οι δομικά συντηρημένες επικράτειες του EF-Tu και του EF-G επισημαίνονται με κόκκινο και πράσινο, ενώ το trna και η επικράτεια του EF-G, που μοιάζει με αυτό, επισημαίνονται με μοβ. Η φωτογραφία είναι ευγενική προσφορά του Poul Nissen.

122 ΛΗΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ

123 Εικόνα 6.32 Η μοριακή μίμηση καθιστά δυνατή την πρόσδεση του συμπλόκου EF-Tu trna, του παράγοντα μετατόπισης EF-G και των παραγόντων αποδέσμευσης RF1/2-RF3 στην ίδια ριβοσωμική θέση. RF1: UAA/UAG RF2: UAA/UGA RF3: UAA/UAG/UGA erf1: UAA/UAG/UGA Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

124 Παράγοντες αποδέσμευσης/trna Gly-Gly-Gln Πεπτιδικό αντικωδικόνιο

125 Εικόνα 6.34 Η πεπτιδυλομεταφορά και ο τερματισμός είναι ανάλογες αντιδράσεις, στις οποίες μία βάση στο κέντρο της πεπτιδυλο-μεταφοράσης πυροδοτεί μία αντίδραση μετεστεροποίησης, προσβάλλοντας ένα δεσμό N-H ή O-H και διευκολύνοντας το άτομο N ή Ο να προσβάλλει το δεσμό στο trna. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

126 RF1/RF2 RF3 IF-3 IF-3 G GTP GDP + G Εικόνα 6.35 Ο παράγοντας αποδέσμευσης (RF) τερματίζει την πρωτεϊνοσύνθεση αποδεσμεύοντας την πρωτεϊνική αλυσίδα. Ο παράγοντας ανακύκλωσης του ριβοσώματος (RRF) αποδεσμεύει το τελευταίο trna και ο EF-G αποδεσμεύει τον RRF, προκαλώντας την αποσύνδεση των ριβοσωμικών υπομονάδων. RRF : Απομάκρυνση RF3 G-GTP: Απομάκρυνση RRF υδρόλυση GTP χωρισμός υπομονάδων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

127 Κ Ε Φ Α Λ Α Ι Ο 9: Η μεταγραφή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

128 K M Προκαρυωτικοί οργανισμοί Ευκαρυωτικοί οργανισμοί RNA ρετροϊοί Εικόνα 9.1 Η λειτουργία της RNA πολυμεράσης είναι να μεταγράφει μια αλυσίδα δίκλωνου DNA σε RNA. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

129 RNA ρετροϊοί RNάση Αντίστροφη μεταγραφάση DNA πολυμεράση Μεταγραφή 5

130 RNA ιοί + - Proteins + -

131 Έκφραση της γενετικής πληροφορίας α β α β 1 2 α β α β 1α 1β

132 5 3 Μεταγραφική μονάδα Πρωτογενές μετάγραφο Κ Μ Εικόνα 9.2 Μια μεταγραφική μονάδα μεταγράφεται σε ένα ενιαίο RNA. Ώριμο RNA (mrna) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

133 Εικόνα 9.3 Οι αλυσίδες DNA διαχωρίζονται για να σχηματίσουν μια μεταγραφική θηλιά. Το RNA συντίθεται με το ζευγάρωμα συμπληρωματικών βάσεων με μία από τις αλυσίδες του DNA. Τριφωσφοριβονουκλεοτίδια A, U, G, C Συχνότητα λαθών = 10-6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

134 P-P-P Κατεύθυνση μεταγραφής γ β α P-P-P 3 Ι Η 2 3 δεόξυ-τριφωσφορική αδενοσύνη 3 5

135 Κάθε γονίδιο μεταγράφεται από την μία μόνο αλυσίδα DNA 5 Κ Κ Μ 3 3 Μ Μ Κ 5 5 Κ Κ Μ 3 3 Μ Μ Κ 5

136 RNA Πολυμεράσες

137 Υποκινητές Fig Y

138 -7 ~ 100 kda ~200 Nt/sec 25 υποκινητές -7-4 Εικόνα 9.7 Η T7 RNA πολυμεράση έχει ένα βρόχο ειδικότητας που προσδένει τις θέσεις -7 έως -11 του υποκινητή, ενώ οι θέσεις -1 έως -4 εισέρχονται στο ενεργό κέντρο. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

139 16 bp DNA K Εικόνα 9.8 Οι υπομονάδες β (κυανό) και β (ροζ) της βακτηριακής RNA πολυμεράσης έχουν ένα κανάλι για την αλυσίδαμήτρα του DNA. Η σύνθεση ενός μεταγράφου RNA (χρώμα του χαλκού) έχει μόλις αρχίσει. Μέσα σε μια μεταγραφική θηλιά η αλυσίδα-μήτρα (κόκκινο) και η κωδική αλυσίδα (κίτρινο) έχουν διαχωριστεί. Η φωτογραφία είναι ευγενική προσφορά του Seth Darst. 465 kda Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

140 Βακτηριακή RNA Πολυμεράση

141 RNA Πολυμεράση του σακχαρομύκητα 25 bp DNA Εικόνα 9.9 Η θέση δέκα υπομονάδων της RNA πολυμεράσης έχει χαρτογραφηθεί στην κρυσταλλική δομή. Τα χρώματα των υπομονάδων είναι τα ίδια με αυτά των κρυσταλλικών δομών στις Εικόνες που ακολουθούν. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

142 RNA Πολ. E. coli RNA Πολ. σακχαρομύκητα

143 Μεταγραφή στους προκαρυωτικούς οργανισμούς

144 Εικόνα 9.16 Οι RNA πολυμεράσες των ευβακτηρίων αποτελούνται από τέσσερα είδη υπομονάδων: οι α, β και β έχουν σχετικά σταθερά μεγέθη σε διάφορα είδη βακτηρίων, ενώ η σ ποικίλλει σε μεγαλύτερο βαθμό. 40 Nt/sec Συχνότητα λαθών = 10-6 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

145 Λειτουργίες της RNA πολ. Μία RNA πολ. στα προκαρυωτικά Τρείς RNA πολ. στα ευκαρυωτικά Εικόνα 9.5, DNA/RNA (~9 bp) bp 5 RNA (~17 Nt) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

146 Λειτουργίες ΟΕ και ΚΕ Εικόνα ~9Nt 5

147 Μοντέλα διακοπτόμενης έναρξης

148 Εικόνα 9.16 Οι RNA πολυμεράσες των ευβακτηρίων αποτελούνται από τέσσερα είδη υπομονάδων: οι α, β και β έχουν σχετικά σταθερά μεγέθη σε διάφορα είδη βακτηρίων, ενώ η σ ποικίλλει σε μεγαλύτερο βαθμό. Λειτουργίες των υπομονάδων Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

149 Σ-9.17 Μη ειδική πρόσδεση K Εικόνα 9.17 Οι υπομονάδες β και β δημιουργούν επαφές τόσο με τη μήτρα όσο και με την κωδική αλυσίδα του DNA, κυρίως στην περιοχή της μεταγραφικής θηλιάς και πιο καθοδικά από αυτή. Οι επαφές με το RNA εντοπίζονται κυρίως στη μεταγραφική θηλιά. Συνήθως, καθοδικά δεν υπάρχει RNA και οι επαφές με αυτό γίνονται μόνο σε ειδικές περιπτώσεις στην κάθοδο, όταν το ένζυμο οπισθοδρομεί. M Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

150 DNA + Pol DNA + Pol DNA-Pol t 1/2 [DNA-Pol] KB = (Μ [DNA] [Pol] -1 ) k = Προϊόν / t

151 ΚΒ= 10 5 t 1/2 =60 min ΚΒ= 10 1 t 1/2 =~1 sec ΚΒ= t 1/2 > hr ΚΒ= έναρξη/30 min ΚΒ= έναρξη/1 sec (1.800X) Εικόνα 9.22

152 Υποστάδια της έναρξης Αναγνώριση msec 1 msec Συχνότητα ενάρξεων< 1 έναρξη/sec Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

153 Εικόνα /2 θέσεις χαλαρής πρόσδεσης 1/2 θέσεις ειδικής πρόσδεσης

154 Εικόνα 9.23 Η κινητική σταθερά πρόσδεσης της RNA πολυμεράσης στους υποκινητές είναι γρηγορότερη από την τυχαία διάχυση.

155 Εικόνα 9.24 Η RNA πολυμεράση προσδένεται πολύ γρήγορα σε τυχαίες αλληλουχίες DNA και θα μπορούσε να βρει έναν υποκινητή με άμεση μετατόπιση από μία προσδεδεμένη αλληλουχία DNA σε άλλη. 4Χ bp Y Y bp 4x10 6 bp/~1500 OE= bp 1 OE/2.600 bp Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

156 Εικόνα 9.25 H RNA πολυμεράση δεν ολισθαίνει κατά μήκος του DNA. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

157 Εικόνα 9.29 Η μέθοδος της ιχνηλάτησης προσδιορίζει τις θέσεις πρόσδεσης πρωτεϊνών στο DNA βάσει της προστασίας που παρέχουν ενάντια στη δημιουργία εγκοπών. T4 πολυνουκλεοτιδική κινάση ~50 bp ~80 bp Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

158 Υποκινητές προκαρυωτικών γονιδίων

159 bp ειδικό σήμα (4 = 1/17X10 6 ) Σ-9.27 Αντιπροσωπευτικές ή συναινετικές αλληλουχίες Pu (90%) TTGACA TATAAT Pu (Ιδανικός υποκινητής) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

160 Εικόνα 9.19 Η RNA πολυμεράση διέρχεται από αρκετά στάδια πριν τη φάση επιμήκυνσης. Ένα κλειστό δυαδικό σύμπλοκο μετατρέπεται σε μια ανοικτή μορφή και μετά σε ένα τριαδικό σύμπλοκο. Μεταλλάξεις (-35) [αναγνώριση και πρόσδεση] Μεταλλάξεις (-10) [τήξη] Μεταλλάξεις (+1/+30) [χρόνος εκκαθάρισης] Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

161 K M Θέσεις αναγνώρισης Θέσεις πρόσδεσης

162 Πρόσδεση RNA πολ. στους υποκινητές β β.2.4 (ΑΤ)n -50

163 Εικόνα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

164 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.37

165 ΚΕ Εικόνα 9.38 Το Ν-τελικό άκρο του σίγμα εμποδίζει τις επικράτειες πρόσδεσης στο DNA να προσδεθούν σε αυτό. Όταν σχηματίζεται ένα ανοικτό σύμπλοκο, το Ν-τελικό άκρο μετακινείται 20 Ǻ μακριά και οι δύο επικράτειες πρόσδεσης στο DNA απομακρύνονται η μία από την άλλη κατά 15 Ǻ. Πρόσδεση στο ΚΕ μετατόπιση της Ν-τελικής περιοχής κατά 20 Α ο πρόσδεση στο -35 κουτί και ακολούθως στο -10 κουτί αποδιάταξη του DNA εκτόπιση της Ν-τελικής περιοχής και εισαγωγή της περιοχής +1 του DNA στο ενεργό κέντρο του ενζύμου Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

166 Πρόσδεση του παράγοντα σ στους υποκινητές 2.4 A T T A A 2.3 T Κ Μεταγραφή Μ

167 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.35

168 Fig Ρύθμιση της μεταγραφής με εναλακτικούς παράγοντες σ (SPO1)

169 Τοποϊσομεράση (+) Γυράση (-) Εικόνα 9.31 H μεταγραφή δημιουργεί θετικά υπερελικωμένο DNA μπροστά από την RNA πολυμεράση και αρνητικά υπερελικωμένο DNA πίσω απ αυτήν. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

170 Εικόνα 9.21 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

171 Εγγενής τερματισμός Εικόνα GCAATCCCGAAACAGTTCGGTAGTAGTTAGAGCCGATAACGGTTTCGGGATTTTTTT CGTTAGGGCTTTGTCAAGCCATC ATCAATCTCGGCTATTGCCAAAGCCCTAAAAAAA--5 Βρόχος (6-12 Nt) Φουρκέτα Στέλεχος (7-20 bp) Παύση της RNA Pol ~1sec

172 Εικόνα 9.46 Οι αλληλουχίες DNA που απαιτούνται για τον τερματισμό εντοπίζονται πριν την αλληλουχία τερματισμού. Ίσως είναι αναγκαίος ο σχηματισμός μιας φουρκέτας στο RNA.

173 50-90 Nt Εικόνα 9.48 Ένας Rho-εξαρτώμενος τερματιστής έχει αλληλουχία πλούσια σε C και φτωχή σε G, και εντοπίζεται πριν από την ακριβή θέση (ή θέσεις) τερματισμού. Η αλληλουχία παρουσιάζεται με τη μορφή του RNA. Αντιπροσωπεύει το 3 άκρο του RNA.

174 Εικόνα 9.49 Ο παράγοντας Rho «καταδιώκει» την RNA πολυμεράση κατά μήκος του RNA και μπορεί να προκαλέσει τερματισμό όταν προλάβει το στάσιμο ένζυμο σε μια Rho-εξαρτώμενη αλληλουχία τερματισμού. β ATP ADP Ο ρ έχει RNA-εξαρτώμενη ενεργότητα ATPάσης και ATP-εξαρτώμενη ενεργότητα ελικάσης. ATP ADP

175 * Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 9.50: Φαινόμενο πολικότητος.

176 Ασθενής

177 Αντιτερματισμός Εικόνα 9.51

178 Παράγοντες τερματισμού Εικόνα 9.54 Ασθενής Oι παράγοντες τερματισμού αν και λειτουργούν στον τερματιστή, αναγνωρίζουν άλλες αλληλουχίες. Προσδένονται στο κεντρικό ένζυμο όταν αυτό περάσει από την αλληλουχία Nut μέσω του RNA και αυξάνουν το χρόνο παύσης της RNA pol στον τερματιστή.

179 ΝusA pν NusB-S10 5 Εικόνα 9.5: Όταν το ΚΕ περνάει από την αλληλουχία Nut, οι παράγοντες τερματισμού προσδένονται (μέσω του RNA) στο ΚΕ και αυξάνουν το χρόνο της παύσης στον ασθενή τερματιστή Τερματισμός. Ο παράγοντας αντιτερματισμού pn (μέσω του RNA) προσδένεται στο box B. H pn έχει δύο επικράτειες: η μία αλληλεπιδρά με το RNA και η άλλη με τον Nus A αποτρέποντας την δράση του στον ασθενή τερματιστή.

180 7 οπερόνια Εικόνα Τα οπερόνια rrn στο βακτήριο E. coli περιέχουν γονίδια που κωδικοποιούν τόσο για rrna όσο και για trna. Το ακριβές μήκος των μεταγράφων εξαρτάται από τους υποκινητές (P) και τις αλληλουχίες τερματισμού (t) που χρησιμοποιούνται. Κάθε προϊόν RNA πρέπει να απελευθερωθεί από το μετάγραφο με αποκοπή στα δύο του άκρα. RΝάση ΙΙΙ

181 Πέψη Σ RΝάσης a ΙΙΙ Ένδονουκλεάσες Εξοωνουκλεάσες Ώριμα 23S και 16S RNAs

182 Εικόνα 7.6 Τύπος Ι Τύπος ΙΙ CCA CCA 3 trna-νουκλεοτιδική μεταφοράση Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

183 Ρύθμιση της μεταγραφής στους προκαρυωτικούς οργανισμούς

184 Εικόνα 10.1 Trans-ρυθμιστικοί παράγοντες (Μεταγραφικοί παράγοντες) [Καταστολείς (-) (αρνητικός έλεγχος)] [Ενεργοποιητές (+) (θετικός έλεγχος) Cis-ρυθμιστικά στοιχεία (σε φυσική σύνδεση με το γονίδιο στόχο). Αλληλουχίες στις οποίες προσδένονται οι μεταγραφικοί παράγοντες Μικρομόρια που προσδένονται στους μεταγραφικούς παράγοντες και επάγουν τη μεταγραφή (επαγωγείς) ή καταστέλουν τη μεταγραφή (συγκαταστολείς) Γονίδιο στόχος Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

185 Εικόνα 10.2 Στον αρνητικό έλεγχο, ένας trans-δραστικός καταστολέας προσδένεται στο cisδραστικό χειριστή και σταματά τη μεταγραφή. Αρνητική ρύθμιση (Καταστολείς) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

186 Εικόνα 10.3 Στο θετικό έλεγχο, οι trans-δραστικοί παράγοντες πρέπει να προσδεθούν στις cis-δραστικές θέσεις προκειμένου η RNA πολυμεράση να αρχίσει τη μεταγραφή από τον υποκινητή. Θετική ρύθμιση (Ενεργοποιητές) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

187 Εικόνα 11.3 Tα ρυθμιστικά κυκλώματα είναι ευέλικτα και, ανάλογα με το σχεδιασμό, ελέγχουν θετικά ή αρνητικά την επαγωγή ή την καταστολή. Επαγωγείς Συγκαταστολείς Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

188 Αρνητική ρύθμιση Καταστολέας lac

189 Απέκκριση Οπερόνιο λακτόζης

190 Εικόνα 10.4 Το οπερόνιο lac καταλαμβάνει ~6.000 bp DNA. Το γονίδιο laci (αριστερά) έχει το δικό του υποκινητή (P) και τερματιστή. Το άκρο του laci βρίσκεται ακριβώς πριν τον υποκινητή των δομικών γονιδίων. Ο χειριστής (O) καταλαμβάνει τα πρώτα 26 bp της μεταγραφικής μονάδας. Το γονίδιο lacz ξεκινά από τη βάση +39. Μετά από αυτό ακολουθούν τα γονίδια lacυ και laca. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

191 38 kda (10 μόρια/κύτταρο, ΚΒ=2x10 13 ) X Εικόνα 10.7 Ο καταστολέας διατηρεί το οπερόνιο lac στην ανενεργή κατάσταση μέσω της πρόσδεσής του στο χειριστή. Ο καταστολέας απεικονίζεται ως μια σειρά από συνδεδεμένες επικράτειες, όπως προέκυψαν από την ανάλυση της κρυσταλλικής δομής του. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

192 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Χ Εικόνα 10.8 Η προσθήκη του επαγωγέα μετατρέπει τον καταστολέα στην ανενεργή μορφή του, που δεν μπορεί να προσδεθεί στο χειριστή. Αυτό επιτρέπει στην RNA πολυμεράση να αρχίσει τη μεταγραφή.

193 Εικόνα 10.6 Η προσθήκη επαγωγέα προκαλεί τη γρήγορη επαγωγή του mrna του οπερονίου lac και ακολουθείται από τη σύνθεση των ενζύμων, μετά από μια σύντομη φάση υστέρησης. Η απομάκρυνση του επαγωγέα ακολουθείται από γρήγορη παύση της σύνθεσης.

194 (Cis-επικρατείς) Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 10.9 Οι μεταλλάξεις του χειριστή είναι ιδιοστατικές, επειδή ο χειριστής καθίσταται ανίκανος να προσδέσει την πρωτεΐνη-καταστολέα. Αυτό επιτρέπει στην RNA πολυμεράση να έχει απεριόριστη πρόσβαση στον υποκινητή. Οι μεταλλάξεις Oc είναι cis-δραστικές, επειδή επηρεάζουν μόνο τα συνεχόμενα συνδεδεμένα δομικά γονίδια.

195 Χ laci - (Transυποτελείς) ή δεν παράγουν καταστολέα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα Οι μεταλλάξεις που απενεργοποιούν το γονίδιο laci προκαλούν την ιδιοστατική έκφραση του οπερονίου, επειδή η μεταλλαγμένη πρωτεΐνη του καταστολέα δεν μπορεί να προσδεθεί στο χειριστή.

196 Μόνιμη καταστολή (Επαγωγέας) laci S (Trans- Επικρατής) Χ ή δεν παράγουν καταστολέα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

197 Εικόνα 10.5 Ο καταστολέας και η RNA πολυμεράση προσδένονται σε αλληλοεπικαλυπτόμενες θέσεις, γύρω από το σημείο έναρξης της μεταγραφής του οπερονίου lac. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

198 Συνεχείς και ανεστραμμένες επαναλήψεις Εικόνα Ο χειριστής lac έχει συμμετρική αλληλουχία. Η αλληλουχία αριθμείται σε σχέση με το σημείο έναρξης της μεταγραφής στο +1. Τα ροζ βέλη αριστερά και δεξιά δείχνουν τις δύο ανεστραμμένες επαναλήψεις. Με πράσινο φόντο εμφανίζονται οι ταυτόσημες θέσεις των δύο ανεστραμμένων επαναλήψεων. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

199 Κ Μ Εικόνα Οι βάσεις που έρχονται σε επαφή με τον καταστολέα μπορεί να ταυτοποιηθούν με ομοιοπολική διασύνδεση ή με πειράματα που δείχνουν αν η χημική μετατροπή τους αποτρέπει την πρόσδεση. Έτσι, αναγνωρίστηκαν θέσεις και στις δύο αλυσίδες του DNA, που εκτείνονται από το +1 έως το +23. Ιδιοστατικές μεταλλάξεις συμβαίνουν σε 8 θέσεις του χειριστή, ανάμεσα στο +5 και στο +17. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

200 Εικόνα Ο επαγωγέας προσδένεται στον ελεύθερο καταστολέα, ώστε να διαταράξει μια ισορροπία (αριστερά), ή προσδένεται άμεσα στον καταστολέα που βρίσκεται προσδεδεμένος στο χειριστή (δεξιά); Ταχεία επαγωγή t1/2>15 min t1/2<1 min

201 Και τα 10 μόρια του καταστολέα είναι προσδεμένα στο DNA Εικόνα Ο καταστολέας Lac προσδένεται ισχυρά και με ειδικό τρόπο στο χειριστή του, αλλά απελευθερώνεται από τον επαγωγέα. Όλες οι σταθερές ισορροπίας δίνονται σε M -1. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

202 96% Βασικά επίπεδα Εικόνα Σχεδόν όλη η ποσότητα του καταστολέα ενός κυττάρου βρίσκεται δεσμευμένη στο DNA. Επαγόμενα επίπεδα Κατάληψη του χειριστή 3% Ταχεία καταστολή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

203 Πως ο καταστολέας εμποδίζει την RNA πολυμεράση? Y+RNA Pol (KB=10 5 ) πολύ μικρή συχνότητα ενάρξεων Y + RNA Pol + K, (KB=10 7 ) μεγάλη συχνότητα ενάρξεων Ο καταστολέας αυξάνει την πρόσδεση της RNA Pol στον υποκινητή κατά δύο τάξεις μεγέθους αλλά δεν επιτρέπει τη δημιουργία του ανοιχτού συμπλόκου

204 Εικόνα Η δομή ενός μονομερούς του καταστολέα Lac αποκαλύπτει αρκετές ανεξάρτητες επικράτειες. Η φωτογραφία είναι ευγενική προσφορά του Mitchell Lewis. Κεφαλή Διμερή και τετραμερή ολιγομερισμού Τετραμερή Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

205 Μοτίβο HTH Φερμουάρ λευκίνης

206 Εικόνα Το τετραμερές του καταστολέα αποτελείται από δύο διμερή. 1 Ομοδιμερισμός Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

207 Εικόνα Αν και τα δύο διμερή σε ένα τετραμερές καταστολέα προσδεθούν στο DNA, τότε το DNA ανάμεσα στις δύο θέσεις πρόσδεσης σχηματίζει ένα βρόχο. Ο2-80 Ο Ο1

208 -35 Εικόνα Όταν ένας τετραμερής καταστολέας προσδένεται σε δύο χειριστές, η έκταση του DNA ανάμεσά τους εξωθείται στη δημιουργία ενός σφιχτού βρόχου. Η μπλε δομή στο κέντρο του βρόχου του DNA αντιπροσωπεύει την πρωτεΐνη CAP (CRP), άλλη μια ρυθμιστική πρωτεΐνη που προσδένεται στην περιοχή. Η φωτογραφία είναι ευγενική προσφορά του Mitchell Lewis. ΤΑΤΑ

209 Θετική ρύθμιση Ενεργοποιητής CAP

210 Αλληλεπίδραση CAP με RNA pol μέσω της α υπομονάδας Fig Ασθενές +1 Θέση Χειριστή

211 Εικόνα 11.5 Tο camp περιέχει μία μόνο φωσφορική ομάδα που συνδέεται τόσο με το 5 όσο και με το 3 του δακτυλίου του σακχάρου. Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

212 - + Εικόνα 11.6 Η γλυκόζη, μειώνοντας τα επίπεδα του camp, εμποδίζει τη μεταγραφή των οπερονίων που εξαρτώνται από την ενεργότητα της πρωτεΐνης CRP kda (CAP) Επικράτεια ενεργοποίησης CRP: camp Receptor Protein CAP: Catabolite Activator Protein Επικράτεια πρόσδεσης ~ 100 γονίδια

213 Fig lac Ασθενές Εικόνα 11.7 H πρότυπη αλληλουχία πρόσδεσης της CRP (CAP) περιέχει το πολύ καλά συντηρημένο πενταμερές TGTGA και (μερικές φορές) και την ανάστροφή του αλληλουχία (TCANA).

214 Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα 11.8 Η απόσταση της θέσης πρόσδεσης της πρωτεΐνης CRP από τη θέση πρόσδεσης της RNA πολυμεράσης διαφέρει στα διάφορα οπερόνια.

215 Ρύθμιση μετά την έναρξη της μεταγραφής

216 Εικόνα Η εξασθένηση παρατηρείται όταν παρεμποδίζεται ο σχηματισμός της φουρκέτας τερματισμού στο RNA. Εξασθενητής (Attenuator) Πολλά οπερόνια σύνθεσης αα Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

217 E. coli Κ Trp... Genes VIII - Ακαδημαϊκές Εκδόσεις 2004 Εικόνα Tο οπερόνιο trp αποτελείται από πέντε συνεχή δομικά γονίδια και μία ρυθμιστική περιοχή που προηγείται και περιλαμβάνει τον υποκινητή, το χειριστή, μία περιοχή που κωδικοποιεί ένα πεπτίδιο-οδηγό και έναν εξασθενητή.

218 Trp + Trp - Εικόνα H περιοχή-οδηγός του οπερονίου trp μπορεί να υιοθετήσει δύο εναλλακτικές στερεοδιατάξεις. Στο κέντρο φαίνονται οι τέσσερις περιοχές που μπορούν να ζευγαρώσουν. Η περιοχή 1 είναι συμπληρωματική με την περιοχή 2, η οποία είναι επίσης συμπληρωματική και με την περιοχή 3. Η περιοχή 3 είναι συμπληρωματική, εκτός από την περιοχή 2, και με την περιοχή 4. Στα αριστερά παρουσιάζεται η δομή που υιοθετείται όταν η περιοχή 1 ζευγαρώνει με την περιοχή 2 και η περιοχή 3 με την περιοχή 4. Στα δεξιά παρουσιάζεται η στερεοδιάταξη που υιοθετείται όταν η περιοχή 2 ζευγαρώνει με την περιοχή 3 αφήνοντας μονόκλωνες τις περιοχές 1 και Genes VIII - Ακαδημαϊκές Εκδόσεις 2004

219 Μηχανισμός ρύθμισης από το ριβόσωμα UGGUGG UGA uuuuu RNA Pol UGA UGGUGG uuuu RNA Pol AUG

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ογκογονίδια, τα oγκοκατασταλτικά γονίδια και οι αυξητικοί παράγοντες.

ΕΙΣΑΓΩΓΗ ογκογονίδια, τα oγκοκατασταλτικά γονίδια και οι αυξητικοί παράγοντες. ΜΟΡΙΑΚΗ ΟΓΚΟΓΕΝΕΣΗ ΕΙΣΑΓΩΓΗ Κάθε αλλαγή ή βλάβη στο σύστημα ελέγχου του κυτταρικού πολλαπλασιασμού έχει δραματικές επιπτώσεις για τον οργανισμό και μπορεί να οδηγήσει στην εμφάνιση καρκίνου. Ένα καρκινικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά

Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά Το βασικό δόγμα σε προκαρυωτικά και ευκαρυωτικά http://barleyworld.org/sites/default/files/figure-08-01_0.jpg Μεταγραφή-μετάφραση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θεόδωρος Γ. Κουρέλης Ιατρός Ογκολόγος - Παθολόγος

Θεόδωρος Γ. Κουρέλης Ιατρός Ογκολόγος - Παθολόγος ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ ΕΦΑΡΜΟΓΕΣ ΤΩΝ ΒΑΣΙΚΩΝ ΙΑΤΡΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΠΑΘΟΒΙΟΧΗΜΕΙΑ ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΚΗΣ ΧΗΜΕΙΑΣ ΣΥΝΘΕΣΗ ΠΕΠΤΙΔΙΚΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Μηχανισμοί Μεταμεταγραφικού Ελέγχου

Μηχανισμοί Μεταμεταγραφικού Ελέγχου Μηχανισμοί Μεταμεταγραφικού Ελέγχου Δημήτρης Λ. Κοντογιάννης, PhD Ερευνητής Β, Ινστιτούτο Ανοσολογίας ΕΕΠΑ Αθήνα 6-2-2010 Crowne-Plaza Μεταμεταγραφικοί Μηχανισμοί Χρήσης- Τα Βασικά... ΕΕΠΑ Αθήνα 6-2-2010

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA ρ. Αποστολία Γκιάλη Υπεύθυνη Προγράµµατος Μοριακή Βιολογία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

GENES VIII. Ελληνική Έκδοση. Benjamin Lewin. Προλογίζει ο Καθηγητής Γιώργος Σταματογιαννόπουλος. Aκαδημαϊκές Εκδόσεις AcademicPublications@yahoo.

GENES VIII. Ελληνική Έκδοση. Benjamin Lewin. Προλογίζει ο Καθηγητής Γιώργος Σταματογιαννόπουλος. Aκαδημαϊκές Εκδόσεις AcademicPublications@yahoo. GENES VIII Benjamin Lewin Ελληνική Έκδοση Προλογίζει ο Καθηγητής Γιώργος Σταματογιαννόπουλος A ª π Upper Saddle River, NJ 07458 www.prenhall.com Aκαδημαϊκές Εκδόσεις AcademicPublications@yahoo.com i Στοιχεία

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια, 2007-2008 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Μέρος A ΠΕΡΙ ΕΝΕΡΓΕΙΑΣ Α. Η λειτουργία απλών µηχανών εξαρτάται από ενέργεια: - κίνηση αυτοκινήτου= βενζίνη / πετρέλαιο

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

6η η ιάλεξη. Αντιγραφή του DNA. Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή. αντιγραφής του DNA

6η η ιάλεξη. Αντιγραφή του DNA. Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή. αντιγραφής του DNA Σχολή Γεωπονικών Επιστηµών Τµήµα Γεωπονίας Φυτικής Παραγωγής και Αγροτικού Περιβάλλοντος Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή 6η η ιάλεξη ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ A ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία)

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή ινσουλίνης από βακτήρια Παρελθόν: απομόνωση ινσουλίνης από πάνγκρεας

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου

Διαβάστε περισσότερα

Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών

Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα