Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών"

Transcript

1 ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ της ΑΘΑΝΑΣΙΑΣ-ΧΑΡΑΛΑΜΠΙΑΣ. ΕΥΑΓΓΕΛΙΝΟΥ Επιβλέπων: Κουτσούρης ημήτριος Καθηγητής ΕΜΠ Αθήνα, Σεπτέμβριος

2 ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ της ΑΘΑΝΑΣΙΑΣ-ΧΑΡΑΛΑΜΠΙΑΣ. ΕΥΑΓΓΕΛΙΝΟΥ Επιβλέπων: Κουτσούρης ημήτριος Καθηγητής ΕΜΠ Εγκρίθηκε από την τριμελή εξεταστική επιτροπή Κουτσούρης ημήτριος Ματσόπουλος Γιώργος Πρέντζα Ανδριάνα Καθηγητής ΕΜΠ Επίκουρος Καθηγητής Ε.Μ.Π Επίκουρη Καθηγήτρια Πανεπιστημίου Πειραιά 2

3 ... Αθανασία-Χαραλαμπία Ευαγγελινού ιπλωματούχος Ηλεκτρολόγος Μηχανικός και Μηχανικός Υπολογιστών Ε.Μ.Π. Copyright Αθανασία Ευαγγελινού - Ιούλιος 2012 Με επιφύλαξη παντός δικαιώματος. All rights reserved. Απαγορεύεται η αντιγραφή, αποθήκευση και διανομή της παρούσας εργασίας, εξολοκλήρου ή τμήματος αυτής, για εμπορικό σκοπό. Επιτρέπεται η ανατύπωση, αποθήκευση και διανομή για σκοπό μη κερδοσκοπικό, εκπαιδευτικής ή ερευνητικής φύσης, υπό την προϋπόθεση να αναφέρεται η πηγή προέλευσης και να διατηρείται το παρόν μήνυμα. Ερωτήματα που αφορούν τη χρήση της εργασίας για κερδοσκοπικό σκοπό πρέπει να απευθύνονται προς τον συγγραφέα. Οι απόψεις και τα συμπεράσματα που περιέχονται σε αυτό το έγγραφο εκφράζουν τον συγγραφέα και δεν πρέπει να ερμηνευθεί ότι αντιπροσωπεύουν τις επίσημες θέσεις του Εθνικού Μετσόβιου Πολυτεχνείου. 3

4 ΕΥΧΑΡΙΣΤΙΕΣ Θα ήθελα να ευχαριστήσω τον επιβλέποντα Καθηγητή, κ. ημήτριο Κουτσούρη, και την κα. Ανδριάνα Πρέντζα, Επίκουρη Καθηγήτρια στο Πανεπιστήμιο Πειραιώς, για την ευκαιρία που μου έδωσαν να εκπονήσω την παρούσα διπλωματική εργασία σε έναν ενδιαφέροντα τομέα της Βιοϊατρικής, καθώς και για την πολύτιμη βοήθειά τους, τις συμβουλές και τον χρόνο που μου αφιέρωσαν κατά τη διάρκεια της εκπόνησης και συγγραφής της εργασίας αυτής. Επίσης, θα ήθελα να ευχαριστήσω θερμά το ιδάκτορα κ. Εμμανουήλ Σηφάκη για την καθοδήγηση και τις πολύτιμες συμβουλές του, καθώς και την ρ. Πετροπούλου Ράνια (Ph.D.), από το Εργαστήριο Βιοϊατρικής Τεχνολογίας του Ε.Μ.Π., που συνέβαλε καθοριστικά στην επίλυση διαδικαστικών προβλημάτων που προέκυψαν κατά τη διαδικασία ολοκλήρωσης της εργασίας μου. ε θα μπορούσα να μην ευχαριστήσω την οικογένειά μου, και ιδιαίτερα την αδερφή μου Άννα, που με πολλή αγάπη με στήριξε, και συνεχίζει να με στηρίζει, καθ όλη τη διάρκεια των σπουδών και της ζωής μου. Τέλος, θα ήθελα να ευχαριστήσω την φίλη και συμφοιτήτριά μου Κατερίνα Σκούτα, που χωρίς φειδώ του προσωπικού της χρόνου με βοήθησε κατά τη διάρκεια της φοίτησής μου και συνέβαλε και εκείνη με διάφορους τρόπους στη δημιουργία αυτής της διπλωματικής εργασίας. 4

5 ΠΕΡΙΛΗΨΗ Στην παρούσα διπλωματική εργασία γίνεται αναφορά σε διαφορετικές μεθοδολογίες κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης με τη χρήση cdna μικροσυστοιχιών (microarrays). Η τεχνολογία μικροσυστοιχιών επιτρέπει τη μέτρηση των επιπέδων έκφρασης χιλιάδων γονιδίων μόνο σε ένα πείραμα, δημιουργώντας έτσι μια αφθονία δεδομένων. Τα δεδομένα προκύπτουν από έρευνες που πραγματοποιήθηκαν σε διαφορετικά ερευνητικά κέντρα και αφορούν σε δείγματα από τρία είδη καρκινικών όγκων. Αρχικά, στην εισαγωγή της εργασίας, περιγράφεται όλο το σχετικό βιολογικό υπόβαθρο, και ακολουθεί εκτενής αναφορά στις τεχνικές με βάση τον προσδιορισμό αλληλουχίας για την παρακολούθηση των επιπέδων της γονιδιακής έκφρασης, καθώς και στις διαφορετικές τεχνολογίες μικροσυστοιχιών. Στη συνέχεια, γίνεται αναλυτική ταξινόμηση του καρκίνου του μαστού, της λευχαιμίας και του καρκίνου του πνεύμονα. Παρουσιάζονται, επίσης, για κάθε μία κατηγορία καρκίνου, έρευνες που αναφέρονται στον προσδιορισμό γονιδίων ανιχνευτών, καθώς και στη χρήση τεχνολογιών και διάφορων αλγορίθμων. Απώτερος στόχος είναι η βελτίωση του τρόπου θεραπευτικής αντιμετώπισης των συγκεκριμένων καρκινικών τύπων, μέσω της ανακάλυψης νέων υποκατηγοριών και της καλύτερης ταξινόμησης των υπαρχόντων ειδών καρκίνου. Λέξεις κλειδιά: γονιδιακή έκφραση, cdna μικροσυστοιχίες, ταξινόμηση καρκίνου, καρκινικοί υπότυποι, αλγόριθμοι ταξινόμησης, καρκίνος του μαστού, καρκίνος του πνεύμονα, λευχαιμία. 5

6 ABSTRACT This paper refers to different methods of gene expression data classification using cdna microarrays. The microarray technology allows measuring the expression levels of thousands of genes in a single experiment, thus creating an abundance of data. The data is obtained from surveys conducted in different research centers on samples from three types of cancerous tumors. More specifically, the introduction encompasses all the biological background necessary, followed by a comprehensive reference to techniques based on sequencing for monitoring the levels of gene expression, as well as a comprehensive reference to different microarray technologies. Subsequently, there is a detailed classification of breast cancer, leukemia and lung cancer. Also presented is, for each category of cancer, research indicative of gene probes identification, as well as of the use of various technologies and algorithms. The ultimate goal is to improve the way of treating certain types of cancer through the discovery of new subtypes and the refinement of the classification of existing types of cancer. Keywords: gene expression, cdna microarrays, cancer clustering, cancer subtypes, classification algorithms, breast cancer, lung cancer, leukemia. 6

7 Στον Αποστόλη 7

8 ΠΕΡΙΕΧΟΜΕΝΑ ΕΥΧΑΡΙΣΤΙΕΣ... 4 ΠΕΡΙΛΗΨΗ... 5 ABSTRACT... 6 ΠΕΡΙΕΧΟΜΕΝΑ... 8 ΠΙΝΑΚΕΣ... 9 ΓΡΑΦΙΚΕΣ ΠΑΡΑΣΤΑΣΕΙΣ ΕΙΚΟΝΕΣ ΕΙΣΑΓΩΓΗ ΚΥΤΤΑΡΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΓΟΝΙ ΙΩΜΑ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΑΙ ΕΥΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ ΓΟΝΙ ΙΑ Η ΟΜΗ ΤΟΥ DNA Νουκλεοτίδια Χρωματίνη Η ΟΜΗ ΤΟΥ RNA ΚΕΝΤΡΙΚΟ ΟΓΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ Γενετικός Κώδικας Πρωτεΐνες ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ Η ΒΙΟΛΟΓΙΑ ΜΕΤΑ ΤΗΝ ΑΠΟΚΩ ΙΚΟΠΟΙΗΣΗ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΓΟΝΙ ΙΩΜΑΤΟΣ ΣΥΣΤΗΜΙΚΗ ΒΙΟΛΟΓΙΑ ΥΒΡΙ ΟΠΟΙΗΣΗ Αποτύπωση κατά Southern και Northern ΣΥΜΠΛΗΡΩΜΑΤΙΚΟ DNA & cdna ΒΙΒΛΙΟΘΗΚΕΣ ΑΛΙΣΥ ΩΤΗ ΑΝΤΙ ΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ PCR ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΣΕ ΠΗΚΤΩΜΑ ΤΕΧΝΙΚΕΣ ΜΕ ΒΑΣΗ ΤΟΝ ΠΡΟΣ ΙΟΡΙΣΜΟ ΑΛΛΗΛΟΥΧΙΑΣ ΓΙΑ ΤΗΝ ΠΑΡΑΚΟΛΟΥΘΗΣΗ ΤΩΝ ΕΠΙΠΕ ΩΝ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΜΙΚΡΟΣΥΣΤΟΙΧΙΕΣ ΕΙΣΑΓΩΓΗ ΤΕΧΝΟΛΟΓΙΕΣ ΜΙΚΡΟΣΥΣΤΟΙΧΙΩΝ Τυπωμένες Μικροσυστοιχίες Μικροσυστοιχίες με χρήση σφαιριδίων Τεχνολογία επιτόπιας σύνθεσης μικροσυστοιχιών ΚΑΡΚΙΝΟΣ ΕΙΣΑΓΩΓΗ ΚΑΤΗΓΟΡΙΟΠΟΙΗΣΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΚΑΡΚΙΝΟΣ ΤΟΥ ΜΑΣΤΟΥ ΠΑΘΟΛΟΓΙΚΗ ΑΝΑΤΟΜΙΑ ΣΤΑΤΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΜΑΣΤΟΥ ΜΟΡΙΑΚΗ ΤΑΞΙΝΟΜΗΣΗ ΚΑΡΚΙΝΩΜΑΤΩΝ ΤΟΥ ΜΑΣΤΟΥ Ο τριπλός αρνητικός καρκίνος του μαστού ΚΑΤΗΓΟΡΙΟΠΟΙΗΣΗ ΤΩΝ ΚΑΡΚΙΝΩΝ ΤΟΥ ΜΑΣΤΟΥ ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΩΝ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ Έρευνα της Αμερικανικής Οργάνωσης Κλινικής Χημείας

9 6.4.2 Ανακάλυψη της υποκατηγορίας Claudin-low Έρευνα & αποτελέσματα από το Ολλανδικό Καρκινικό Ερευνητικό Κέντρο Η μοριακή δοκιμή Oncotype DX Πρότυπο μοντέλο πρόβλεψης του καρκίνου του μαστού GENIUS ΛΕΥΧΑΙΜΙΑ ΓΕΝΙΚΑ ΤΥΠΟΙ ΛΕΥΧΑΙΜΙΑΣ Ταξινόμηση της οξείας λεμφοβλαστικής λευχαιμίας Η ΤΕΧΝΟΛΟΓΙΑ ΜΙΚΡΟΣΥΣΤΟΙΧΙΩΝ ΣΤΗΝ ΠΡΟΓΝΩΣΗ & ΙΑΓΝΩΣΗ ΤΗΣ ΛΕΥΧΑΙΜΙΑΣ Οξεία Μυελοειδής Λευχαιμία (AML) & νέες υποκατηγορίες Πανεπιστημιακό Ιατρικό Κέντρο Erasmus, Ολλανδία Έρευνες για τις υποκατηγορίες της Οξείας Προμυελοκυτταρικής Λευχαιμίας (APL) Αποτελέσματα του προγράμματος έρευνας MILE Αλγόριθμος Εκπαίδευσης για Ανάλυση Ταξινόμησης της οξείας λευχαιμίας ιάγνωση ALL & AML χρησιμοποιώντας την τεχνολογία ανάσυρσης δεδομένων ΚΑΡΚΙΝΟΣ ΤΟΥ ΠΝΕΥΜΟΝΑ ΙΣΤΟΛΟΓΙΚΗ ΤΑΞΙΝΟΜΗΣΗ Μικροκυτταρικός καρκίνος του πνεύµονα (SCLC) Πλακώδες καρκίνωµα Αδενοκαρκίνωµα Μεγαλοκυτταρικός καρκίνος ΑΙΤΙΟΛΟΓΙΑ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΠΝΕΥΜΟΝΑ Προδιαθεσικοί και αιτιολογικοί παράγοντες ΤΟ ΣΥΣΤΗΜΑ ΣΤΑ ΙΟΠΟΙΗΣΗΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΠΝΕΥΜΟΝΑ Η εξέλιξη της σταδιοποίησης του καρκίνου του πνεύμονα Το διεθνές σύστημα σταδιοποίησης του καρκίνου του πνεύμονα Η νέα σταδιοποίηση του μη μικροκυτταρικού καρκίνου του πνεύμονα από την IASLC και τα κλινικά συμπεράσματα Η ΤΕΧΝΟΛΟΓΙΑ ΜΙΚΡΟΣΥΣΤΟΙΧΙΩΝ ΣΤΗΝ ΠΡΟΓΝΩΣΗ ΚΑΙ ΙΑΓΝΩΣΗ Γονιδιακή υπογραφή 72 γονιδίων για το αδενοκαρκίνωμα & το πλακώδες καρκίνωμα Μελέτη για την ταξινόμηση των NSCLC όγκων από το Πανεπιστημιακό Ιατρικό Κέντρο Erasmus, Rotterdam Γονιδιακή υπογραφή 5 γονιδίων για την κατηγοριοποίηση του NSCLC καρκίνου ΣΥΜΠΕΡΑΣΜΑΤΑ ΒΙΒΛΙΟΓΡΑΦΙΑ ΠΙΝΑΚΕΣ Πίνακας 1: Αξιολόγηση βάσει της έκτασης του όγκου Τ (American Joint Committee) Πίνακας 2: Αξιολόγηση βάσει της διάδοσης του όγκου στους λεμφαδένες (American Joint Committee) Πίνακας 3: Αξιολόγηση βάση παρουσίασης μετάστασης M (American Joint Committee) Πίνακας 4: Τα 5 στάδια της ταξινόμησης των TNM συνδυασμών Πίνακας 5: Κυτταρογενετικές μετατοπίσεις συνδέονται με συγκεκριμένες μοριακές γενετικές ανωμαλίες στην ALL(Stams, den Boer et al. 2005, McWhirter, Neuteboom et al. 1999) Πίνακας 6: Σχέση της πρόγνωσης με την κυτταρογενετική αλλαγή που εμφανίζεται (Wikipedia 2012) Πίνακας 7: Συσχετισμός της πρόγνωσης με τα κυτταρογενετικά ευρήματα στο μυελών των οστών στην οξεία λεμφοβλαστική λευχαιμία (Stams, den Boer et al. 2005) Πίνακας 8: Οι AML υπότυποι του Γαλλο-Αμερικανο-Βρετανικού συστήματος (Wikipedia 2012)

10 Πίνακας 9: Αποτελέσματα ταξινόμησης του αλγορίθμου Naïve Bayesian Πίνακας 10: Αποτελέσματα ταξινόμησης του αλγορίθμου K Nearest Neighbor Πίνακας 11: Αποτελέσματα ταξινόμησης του αλγορίθμου SVM Πίνακας 12 : ιεξαγωγή αποτελεσμάτων από τις μελέτες των καρκινικών κυττάρων του μαστού Πίνακας 13: Αποτελέσματα από τις μελέτες διαφόρων τύπων λευχαιμίας Πίνακας 14: Αποτελέσματα από τις μελέτες διαφόρων τύπων καρκίνου του πνεύμονα ΓΡΑΦΙΚΕΣ ΠΑΡΑΣΤΑΣΕΙΣ Γραφική παράσταση 1: Σωστά ταξινομημένες περιπτώσεις για κάθε αλγόριθμο Γραφική παράσταση 2: Λανθασμένα ταξινομημένες περιπτώσεις για κάθε αλγόριθμο Γραφική παράσταση 3: Ακρίβεια για κάθε αλγόριθμο ΕΙΚΟΝΕΣ Εικόνα 2.1: Φυτικό και ζωικό κύτταρο Εικόνα 2.2: Προκαρυωτικό κύτταρο (Wikipedia 2012) Εικόνα 2.3: Ζωικό ευκαρυωτικό κύτταρο (Wikipedia 2012) Εικόνα 2.4: Γονίδιο (Wikipedia 2012) Εικόνα 2.5: Νουκλεοτίδιο του DNA (Life Sciences Cyberbridge2007) Εικόνα 2.7: Μοντέλο διπλής έλικας του DNA (Lodish, Darnell et al. 2003) Εικόνα 2.6: Το βέλος δείχνει τον φωσφοδιεστερικό σκελετό με προσανατολισμό 5'->3' (Μαρμάρα Β., Λαμπροπούλου- Μαρμάρα Μ. 2005) Εικόνα 2.8: Το πακετάρισμα της χρωματίνης και ο σχηματισμός χρωμοσωμάτων (Ψηφιακό Σχολείο Βιολογία (Γ Γενικού Λυκείου - Θετικής Κατεύθυνσης) Εικόνα 2.9: ομή του RNA (Wikipedia 2012) Εικόνα 2.10: Κεντρικό δόγμα της βιολογίας (Wikipedia 2012) Εικόνα 2.11: Επισκόπηση των 4 βασικών μοριακών γενετικών διαδικασιών (Lodish, Darnell et al. 2003) Εικόνα 2.12: Το αμινοξύ ως δομική μονάδα των πρωτεϊνών και ο πεπτιδικός δεσμός. (α) Ένα αμινοξύ περιέχει μία αμινομάδα (-NH2), μία καρβοξυλομάδα (-COOH), ένα άτομο υδρογόνου, και μία πλευρική αλυσίδα (-R). Η πλευρική αλυσίδα ποικίλει ανάλογα με το αμινοξύ. (β) Ο πεπτιδικός δεσμός σχηματίζεται, όταν η αμινομάδα του ενός αμινοξέος ενωθεί με ομοιοπολικό δεσμό με την καρβοξυλομάδα του άλλου, με ταυτόχρονη απελευθέρωση ενός μορίου νερού. (Johnson, Raven P., 2001) Εικόνα 2.13: Οι τρεις ρόλοι του RNA στην πρωτεϊνοσύνθεση (Lodish, Darnell et al. 2003) Εικόνα 2.14: Ενισχυτής (Βικιπαίδεια 2012) Εικόνα 2.15: Η RNA pol II περιέχει επαναλήψεις tyr-ser-pro-thr-ser-pro-ser στο CTD (C-terminal domain) που αποτελούν στόχο για φωσφορυλίωση. Η TFIIH είναι μια από τις κινάσες που φωσφορυλιώνουν την RNA pol II.( Βικιπαίδεια 2012) Εικόνα 2.16: Τρισδιάστατη δομή της TBP (tata-δεσμευτική πρωτεΐνη) που δεσμεύεται στο DNA. Η TBP είναι μία ενιαία πολυπεπτιδική αλυσίδα που είναι διπλωμένη σε δύο πολύ παρόμοιες περιοχές (μπλε και πράσινη) (Alberts 2002)

11 Εικόνα 3.1: Οργάνωση επιπέδων στη συστημική βιολογία Εικόνα 3.2: Αποτύπωση κατά Southern Εικόνα 3.3: Αποτύπωση κατά Northern Εικόνα 3.4: cdna βιβλιοθήκη (Alberts 2002) Εικόνα 3.5: ημιουργία cdna βιβλιοθήκης σε κατάλληλο φορέα Εικόνα 4.1: Σχηματοποιημένη πειραματική διαδικασία ενός πειράματος μικροσυστοιχιών Εικόνα 4.2: Τυπωμένες cdna μικροσυστοιχίες (Lee 2004) Εικόνα 4.3: Τεχνολογία Affymetrix GeneChip. 1) Επιλογή ολιγονουκλεοτιδίου PM & MM. 2) Προετοιμασία δείγματος και υβριδοποίηση. 3) Σάρωση & εξαγωγή εικόνας. 4) εδομένα που προκύπτουν προς επεξεργασία Εικόνα 6.1: Από τα αδενικά λόβια (κόκκινα) που παράγουν το γάλα προέρχεται ο λοβιακός καρκίνος (μπλε) και από τους πόρους που μεταφέρουν το γάλα (πράσινο) ο πορογενής (μπλε) (Φύσσας Γ.) Εικόνα 6.2: ιάγραμμα που απεικονίζει την επικάλυψη μεταξύ του TNBC, του ΒLBC και των γυναικών με καρκίνο του μαστού που παρουσιάζουν μεταλλάξεις στο γονίδιο BRCA (ΦΥΣΣΑΣ, Γ., Είδη Καρκίνου του μάστου) Εικόνα 6.3: Το λογισμικό Adjuvant! (Screenshot of the Adjuvant! software program) Εικόνα 7.1: Κατά τη διάρκεια της ανάπτυξης, τα ευκαρυωτικά κύτταρα συνεχώς περνούν από τις 4 φάσεις του κυτταρικού κύκλου, δημιουργώντας νέα θυγατρικά κύτταρα (Lodish, Darnell et al. 2003) Εικόνα 7.2: Πραγματικοί ανοσοφαινότυποι για δείγματα οξείας λευχαιμίας από το στάδιο Ι Εικόνα 7.3: Εξερευνητική ανάλυση του Margin Tree.Η ταξινόμηση με Margin Tree είναι μία SVM μέθοδος ταξινόμησης με επίβλεψη Εικόνα 8.1: Επικύρωση του προγνωστικού προφίλ των 72 γονιδίων στα ανεξάρτητα δείγματα. Κάθε σειρά αντιπροσωπεύει ένα δείγμα και κάθε στήλη αντιπροσωπεύει ένα γονίδιο Εικόνα 8.2: Προσδιορισμός κατωτάτου ορίου για το χαμηλό κίνδυνο που προκύπτει από συνημιτονικούς συσχετισμούς Εικόνα 8.3: Εκτιμήσεις επιβίωσης OS και RFS με τη μέθοδο Kaplan-Meier των 103 δειγμάτων με τη χρήση των 72 γονιδίων ανιχνευτών υψηλού και χαμηλού κινδύνου Εικόνα 8.4: ιάκριση των φυσιολογικών ιστών από τους καρκινικούς όγκους με τη χρήση της ιεραρχικής ταξινόμησης Εικόνα 8.5: Συσχετιστικό δενδρόγραμμα παραγόμενο από την συσσωρευτική ιεραρχική ταξινόμηση των 91 NSCLC δειγμάτων με τη χρήση 518 ανιχνευτών γονιδιακής υπογραφής

12 1. ΕΙΣΑΓΩΓΗ Η ανάπτυξη της τεχνολογίας των cdna μικροσυστοιχιών επιτρέπει σήμερα στους επιστήμονες να καθορίσουν - με ένα μόνο πείραμα - τα επίπεδα έκφρασης χιλιάδων γονιδίων μέσα σε ένα κύτταρο. Εφαρμόζοντας τη μεθοδολογία της υβριδοποίησης σε κλινικά δείγματα, μπορεί κανείς να λάβει συγκεκριμένες πληροφορίες για την παθογένεια μιας ασθένειας και να τις ομαδοποιήσει σε λογικές και λειτουργικές κατηγορίες στην έκφραση του γονιδιώματος. Ο καρκίνος είναι αποδεδειγμένα η νόσος που έχει προσελκύσει το μεγαλύτερο ενδιαφέρον, κυρίως για δύο σημαντικούς λόγους: - Υπάρχει η δυνατότητα λήψης δείγματος ιστού από τον όγκο, ώστε να γίνει μέτρηση της έκφρασης των γονιδίων με τη χρήση της DNA μικροσυστοιχίας. - Με την υβριδοποίηση του DNA μπορούν να ξεχωρίσουν τα διαφορετικά αλληλόμορφα γονίδια (μεταλλάξεις) στο DNA, μερικά από τα οποία έχουν επιπτώσεις στον καρκίνο. Η τεχνολογία των μικροσυστοιχιών έχει χρησιμοποιηθεί αρκετά στη διάγνωση κακοηθειών, στην ταυτοποίηση αιματολογικών νεοπλασιών, στον προσδιορισμό γονιδίων ανιχνευτών, αλλά και στην εύρεση νέων καρκινικών υποτύπων. ιάφορες είναι οι τεχνικές που χρησιμοποιούνται στην ανάλυση των δεδομένων, καθώς ο προσδιορισμός προτύπων γονιδιακής έκφρασης και η ταξινόμηση των γονιδίων σε ομάδες έκφρασης παρέχει καλύτερη κατανόηση του βιολογικού τους ρόλου και της μεταξύ τους σχέσης. Στην παρούσα διπλωματική εργασία γίνεται αναλυτική επισκόπηση και αξιολόγηση διαφορετικών μεθοδολογιών κατηγοριοποίησης δεδομένων, όπως η ιεραρχική ομαδοποίηση (hierarchical clustering), η ομαδοποίηση k- μέσων (k-means clustering), οι αλγόριθμοι Microarray Innovations in Leukemia (MILE) και Naïve Bayesian, καθώς και οι μηχανές υποστήριξης διανυσμάτων (SVM-Support Vector Machines), που βασίζονται στην τεχνολογία των νευρωνικών δικτύων, για τρεις κατηγορίες καρκίνου, καρκίνου του μαστού, λευχαιμίας και καρκίνου του πνεύμονα. Η διπλωματική εργασία περιλαμβάνει τα ακόλουθα κεφάλαια: To κεφάλαιο 1, περιλαμβάνει μία εισαγωγή στο ερευνητικό πρόβλημα, το στόχο της διπλωματικής εργασίας και τη δομή της εργασίας. Στο κεφάλαιο 2 της εργασίας, περιγράφεται όλο το σχετικό βιολογικό υπόβαθρο. Συγκεκριμένα, γίνεται αναφορά στη δομή του DNA και του RNA, στο σχηματισμό των χρωμοσωμάτων, στο κεντρικό δόγμα της Μοριακής Βιολογίας, στην πρωτεϊνοσύνθεση και τη γονιδιακή έκφραση. Στο κεφάλαιο 3, γίνεται αναφορά στις θεμελιώδεις τεχνικές της Μοριακής Βιολογίας, όπως η υβριδοποίηση (που αποτελεί τη θεμελιώδη βάση των DNA μικροσυστοιχιών), η αποτύπωση κατά Northern, η αλυσιδωτή αντίδραση πολυμεράσης PCR, ο σχηματισμός cdna βιβλιοθηκών, και η μέθοδος SAGE, που χρησιμοποιείται στη μέτρηση της γονιδιακής έκφρασης. 12

13 Στο κεφάλαιο 4, αναλύονται οι βασικές αρχές της τεχνολογίας των μικροσυστοιχιών. Ανάλογα με το βιολογικό σύστημα που μελετάται, επιλέγονται κατάλληλα δείγματα RNA (δείγμα αναφοράς και προς εξέταση δείγμα) και μετατρέπονται σε cdna με παράλληλη σήμανσή τους με χρωστικές ουσίες που έχουν διαφορετικά μήκη κύματος διέγερσης και εκπομπής. Στη συνέχεια τα δείγματα αυτά τυπώνονται στις μικροσυστοιχίες, σε κουκίδες που κάθε μία αντιστοιχεί συνήθως σε ένα γονίδιο. Σε όλες τις τεχνικές των μικροσυστοιχιών που χρησιμοποιούνται υπάρχουν μερικά κοινά σημεία. Όλες οι τεχνικές είναι βασισμένες στην καταγραφή των mrna ποσοτήτων έχοντας ως στόχο τη μέτρηση του επιπέδου έκφρασης ενός μεγάλου συνόλου γονιδίων. Στο κεφάλαιο 5, παρουσιάζονται οι λόγοι της καρκινογένεσης που στηρίζεται στην ύπαρξη δύο τύπων γονιδίων, στα ογκογονίδια και στα ογκοκατοσταλτικά γονίδια καθώς και η κατηγοριοποίηση του καρκίνου που ουσιαστικά περιγράφει τη σοβαρότητά του και στηρίζεται στην έκταση του αρχικού όγκου. Ένα από τα ευρύτατα γνωστά συστήματα ταξινόμησης είναι το TNM. Το σύστημα αυτό έχει γίνει αποδεκτό τόσο από τη διεθνή ένωση κατά του καρκίνου (Union for International Cancer Control UICC) όσο και από την αμερικάνικη (American Joint Committee on Cancer AJCC). Στηρίζεται στην έκταση του όγκου (T=tumor), στην έκταση της διάδοσης στους λεμφαδένες (N=node) και στην παρουσίαση μετάστασης (M=metastasis). Στα κεφάλαια 6, 7 και 8, γίνεται εκτενής αναφορά και παρουσίαση ερευνών που πραγματοποιήθηκαν σε διαφορετικά ερευνητικά κέντρα και αφορούν σε δείγματα από τρία είδη καρκινικών όγκων, καρκίνου του μαστού, λευχαιμία και καρκίνο του πνεύμονα αντίστοιχα εστιάζοντας στις μεθοδολογίες κατηγοριοποίησης δεδομένων που χρησιμοποιήθηκαν και στα αποτελέσματά τους. Στο κεφάλαιο 6, παρουσιάζεται η κατηγοριοποίηση των καρκίνων του μαστού με τη χρήση γονιδιακής έκφρασης, όπου σημαντική είναι η ανακάλυψη της υποκατηγορίας Claudin-low της οποίας η ονομασία προκύπτει από τις αντίστοιχες πρωτεΐνες και για τον προσδιορισμό της οποίας χρησιμοποιήθηκαν μικροσυστοιχίες Affymetrix. Ακολουθεί η έρευνα από το Ολλανδικό Καρκινικό Ερευνητικό Κέντρο που ανέπτυξαν μια γονιδιακή υπογραφή η οποία μετρά την έκφραση 70 γονιδίων και ένα προγνωστικό αποτέλεσμα το οποίο κατηγοριοποιεί τους ασθενείς σε γκρουπ υψηλού και χαμηλού κινδύνου. Στη συνέχεια παρουσιάζεται η ανάλυση της μοριακής δοκιμής Oncotype DX, η οποία αναλύει το ρόλο του υποψήφιου γονιδίου στην έκβαση του αποτελέσματος. Τέλος παρουσιάζεται το πρότυπο Genius με υψηλά ποσοστά πρόβλεψης, μιας και είναι σε θέση να κατηγοριοποιεί ασαφείς μοριακές υποκατηγορίες στον ολικό πληθυσμό και στους υποτύπους του καρκίνου του μαστού. Στο κεφάλαιο 7, αναφέρονται οι 4 συνήθεις τύποι λευχαιμίας, Οξεία Λεμφοβλαστική Λευχαιμία (Acute Lymphoblastic Leukaemia ALL) με δύο τύπους λευχαιμίας B & T (B-ALL και T-ALL), Χρόνια Λεμφοβλαστική Λευχαιμία (Chronic Lymphoblastic Leukaemia - CLL), Οξεία Μυελοειδής Λευχαιμία (Acute Myeloid Leukaemia - AML) και Χρόνια Μυελοειδής Λευχαιμία (Chronic Myeloid Leukaemia - CML). Σημαντική στις έρευνες για τη λευχαιμία είναι η χρήση της τεχνολογίας GEP, όπου το προφίλ της γονιδιακής έκφρασης GEP(gene expression profile) είναι μία από τις τεχνολογίες στην οποία οι cdna ή οι ολιγονουκλεοτιδικοί ανιχνευτές των DNA μικροσυστοιχιών χρησιμοποιούνται ταυτόχρονα τα επίπεδα πολλών διαφορετικών mrna-μεταγραφών. Σε μία πρώτη μελέτη το 1999 ο Golub και οι συνεργάτες του μπόρεσαν να χρησιμοποιήσουν τη μέθοδο GEP ώστε να ξεχωρίσουν το λευχαιμικό τύπο AML από τον ALL. Η έρευνά τους πρότεινε 3 σημαντικές εφαρμογές της τεχνολογίας GEP: ανακάλυψη κατηγορίας, πρόβλεψη και σύγκριση. Σημαντικό επίσης είναι το πρόγραμμα έρευνας MILE, που είχε ως σκοπό να αξιολογηθεί η κλινική ακρίβεια των 13

14 προφίλ γονιδιακής έκφρασης (συγκριτικά με την τρέχουσα στερεότυπη διαγνωστική διαδικασία) 16 υποτύπων οξείας και χρόνιας λευχαιμίας, συνδρόμων μυελοδυσπλασίας (MDSs) και ενός γκρουπ ελέγχου που ονομαζόταν «none of the target classes», που περιελάμβανε καλοήθεις δυσλειτουργίες και φυσιολογικό μυελό των οστών. Στο συγκεκριμένο ερευνητικό πρόγραμμα προσδιορίστηκαν 18 ερευνητικές κατηγορίες (C1 έως C18) στις οποίες ταξινομήθηκαν δείγματα. Τέλος ενδιαφέρον παρουσιάζει η τεχνολογία ανάσυρσης δεδομένων για τη διάγνωση ALL και AML λευχαιμιών, όπου χρησιμοποιήθηκαν τρεις αλγόριθμοι Naïve Bayesian, K Nearest Neighbors και SVM από τους οποίους ακριβέστερα αποτελέσματα έδωσε ο πρώτος. Το κεφάλαιο 8, παρουσιάζει και αξιολογεί αλγορίθμους που χρησιμοποιήθηκαν για την ιστολογική ταξινόμηση του καρκίνου του πνεύμονα στους τέσσερις βασικούς τύπους: µικροκυτταρικό καρκίνο, πλακώδες καρκίνωµα, αδενοκαρκίνωµα και µεγαλοκυτταρικό καρκίνο. Ο µικροκυτταρικός καρκίνος του πνεύµονα αναφέρεται ως µια κατηγορία και οι άλλοι τρεις τύποι: το πλακώδες καρκίνωµα, το αδενοκαρκίνωµα και ο µεγαλοκυτταρικός καρκίνος αναφέρονται ως µη- µικροκυτταρικοί καρκίνοι του πνεύµονα (NSCLC). Για τον καρκίνο του πνεύμονα, που είναι μία από τις κυριότερες αιτίες καρκίνου η έρευνα στρέφεται κυρίως στον προσδιορισμό γονιδίων-ανιχνευτών που συμβάλλουν στην καλύτερη ταξινόμηση των καρκινικών υποτύπων. Σημαντική είναι η επίτευξη μιας αλάνθαστης γονιδιακής υπογραφής 72 γονιδίων για το πρόωρο στάδιο NSCLC καρκίνου. Με τη συνεργασία του European Lung Cancer Microarray Consortium αναπτύχθηκε και επικυρώθηκε ένα σύνολο 72 γονιδίων ταξινομητών για το πρόωρο στάδιο NSCLC που είναι βασισμένο σε ένα απλό πρότυπο ανιχνευτών. Τέλος ενδιαφέρον παρουσιάζουν η γονιδιακή υπογραφή 5 γονιδίων-ανιχνευτών καθώς και η υπογραφή 75 γονιδίων-ανιχνευτών που διακρίνουν με ακρίβεια NSCLC καρκίνους από υγιή ιστό του πνεύμονα. Τα αποτελέσματα προτείνουν ότι το σύνολο των 75 ανιχνευτών και των 5 ανιχνευτών ιστολογικής υπογραφής μπορούν να βοηθήσουν στη σωστή ιστολογική ταξινόμηση σε διφορούμενες περιπτώσεις NSCLC. Στο κεφάλαιο 9, παρουσιάζονται τα συμπεράσματα από την εκτενή μελέτη και παρουσίαση αλγορίθμων κατηγοριοποίησης δεδομένων στους τρεις καρκίνους. Για κάθε τύπο καρκίνου, παρουσιάζονται σε μορφή πίνακα, το όνομα της μελέτης που παρουσιάστηκε, ο στόχος, ο τύπος καρκίνου, τα δεδομένα που χρησιμοποιήθηκαν, η μέθοδος που χρησιμοποιήθηκε για την επεξεργασία των δεδομένων, ο αλγόριθμος κατηγοριοποίησης και τα ευρήματα/αποτελέσματα. Συνοψίζοντας, απώτερος στόχος της παρούσας διπλωματικής εργασίας είναι η παρουσίαση και αξιολόγηση αλγορίθμων κατηγοριοποίησης δεδομένων και των αποτελεσμάτων που προκύπτουν από διάφορες μελέτες σε 3 τύπους καρκίνου, καρκίνο του μαστού, λευχαιμία και καρκίνο του πνεύμονα. Για κάθε μία κατηγορία καρκίνου γίνεται αναφορά στη χρήση διάφορων τεχνολογιών και αλγορίθμων καθώς και στην ανακάλυψη γονιδίων ανιχνευτών. Στηριζόμενοι στις μελέτες αυτές, μελλοντικά είναι πολύ πιθανό νέες έρευνες να οδηγηθούν σε συμπεράσματα που σχετίζονται με την: - πρόγνωση των ασθενών με μεγαλύτερη ακρίβεια - αναγνώριση ομάδων ασθενών που θα επωφεληθούν από συγκεκριμένες επιλεγμένες θεραπείες - ανάπτυξη και παραγωγή νέων φαρμάκων - αναγνώριση και ταυτοποίηση γονιδίων που εμπλέκονται στη φαρμακευτική αντίσταση και ευαισθησία 14

15 2. ΚΥΤΤΑΡΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Τα κύτταρα είναι οι βασικές μονάδες της ζωής. Όλοι οι οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα τα οποία αποτελούνται από τα ίδια είδη μορίων που συμμετέχουν στους ίδιους τύπους χημικών αντιδράσεων. Σε όλα τα έμβια όντα, οι γενετικές οδηγίες (τα γονίδια) αποθηκεύονται σε μόρια DNA που γράφονται με τον ίδιο χημικό μηχανισμό και διπλασιάζονται κατά τον ίδιο τρόπο προκειμένου να επιτρέψουν σ έναν οργανισμό να αναπαραχθεί. Εικόνα 2.1: Φυτικό και ζωικό κύτταρο [Ψηφιακό Σχολείο Βιολογία (Γ Γενικού Λυκείου - Θετικής Κατεύθυνσης] 2.1 ΓΟΝΙ ΙΩΜΑ Το γονιδίωμα ενός κυττάρου, δηλαδή το σύνολο των γενετικών πληροφοριών στο DNA του, παρέχει ένα γενετικό πρόγραμμα που καθοδηγεί το κύτταρο πως να λειτουργήσει και, στα φυτικά και ζωικά κύτταρα, πως να αναπτυχθεί σ έναν οργανισμό με εκατοντάδες διαφορετικά είδη κυττάρων. Σε ένα φυτό ή ένα ζώο τα κύτταρα αυτά μπορεί να εμφανίζουν εντυπωσιακή ποικιλότητα. Τα λιποκύτταρα, τα δερματικά κύτταρα, τα οστεοκύτταρα και τα νευρικά κύτταρα δημιουργούνται κατά την εμβρυική ανάπτυξη από ένα μόνο γονιμοποιημένο ωάριο και όλα περιέχουν ταυτόσημα αντίγραφα του DNA του συγκεκριμένου είδους. Τα διαφορετικά χαρακτηριστικά τους απορρέουν από τον τρόπο με τον οποίο χρησιμοποιούν τις γενετικές οδηγίες. ιαφορετικά κύτταρα εκφράζουν διαφορετικά γονίδια. Αυτό σημαίνει ότι ενεργοποιούν επιλεκτικά την παραγωγή ορισμένων μόνο πρωτεϊνών, ανάλογα με τις ενδείξεις που παρέλαβαν τόσο τα ίδια όσο και οι πρόγονοί τους από το περιβάλλον. Κάθε κύτταρο είναι σε θέση να επιτελεί ποικίλες βιολογικές λειτουργίες, ανάλογα με το περιβάλλον και την ιστορία του, χρησιμοποιώντας τις πληροφορίες που κωδικοποιούνται στο DNA του σαν κατευθυντήριο άξονα των δραστηριοτήτων του. 15

16 2.2 ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΑΙ ΕΥΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Υπάρχουν δύο σημαντικές κατηγορίες κυττάρων: τα προκαρυωτικά και τα ευκαρυωτικά. Οι οργανισμοί των οποίων τα κύτταρα έχουν πυρήνα αποκαλούνται ευκαρυώτες, ενώ εκείνοι που αποτελούνται από κύτταρα χωρίς πυρήνα αποκαλούνται προκαρυώτες. Οι περισσότεροι προκαρυώτες όπως τα βακτήρια διαβιούν ως μονοκύτταροι οργανισμοί, ενώ οι ευκαρυώτες μπορούν να διαμορφώσουν τους πολυκύτταρους οργανισμούς. Απ όλα τα είδη κυττάρων που αποκαλύπτονται με το μικροσκόπιο, τα βακτήρια έχουν την απλούστερη δομή. Οι όροι βακτήρια και προκαρυώτες θεωρούνται ισοδύναμοι. Τα βακτήρια συνήθως είναι σφαιρικά, ραβδόμηχα ή σπειροειδή κύτταρα μήκους λίγων μικρόμετρων. Συχνά φέρουν ένα αδρό προστατευτικό περίβλημα, γνωστό ως κυτταρικό τοίχωμα κάτω από το οποίο βρίσκεται η κυτταρική μεμβράνη που περικλείει ένα μοναδικό χώρο ο οποίος περιέχει το κυτταρόπλασμα, συμπεριλαμβανομένου και του DNA. Εικόνα 2.2: Προκαρυωτικό κύτταρο (Wikipedia 2012) Τα ευκαρυωτικά κύτταρα είναι γεvικά μεγαλύτερα και πιο περίτεχνα. Η ιδιότητα του πυρήνα συμβαδίζει με την κατοχή ποικίλων άλλων οργανιδίων, τα περισσότερα από τα οποία είναι κοινά σε όλους τους ευκαρυωτικούς οργανισμούς. Ο πυρήνας συνήθως είναι το πιο εμφανές οργανίδιο του ευκαρυωτικού κυττάρου. Περικλείεται από δύο ομόκεντρες μεμβράνες που συνιστούν το πυρηνικό περίβλημα και περιέχει μόρια DNA (Alberts 2002). 16

17 Εικόνα 2.3: Ζωικό ευκαρυωτικό κύτταρο (Wikipedia 2012) 2.3 ΓΟΝΙ ΙΑ Γονίδια ονομάζονται οι αλληλουχίες νουκλεοτιδίων τμήματος του DNA, οι οποίες ελέγχουν τα κληρονομικά γνωρίσματα ενός οργανισμού. Ένα γονίδιο αποτελεί πρότυπο για τη σύνθεση ενός λειτουργικού μορίου RNA. Το γενετικό υλικό ενός κυττάρου αποτελεί το γονιδίωμά του. Εικόνα 2.4: Γονίδιο (Wikipedia 2012) Το γονιδίωμα καθορίζει τη γενετική κατασκευή ενός οργανισμού ή ενός κυττάρου, το γονότυπο του. Ο φαινότυπος, είναι το σύνολο των χαρακτηριστικών που εμφανίζει ένας οργανισμός υπό την επιρροή ενός συνόλου περιβαλλοντικών παραγόντων (Lee 2004). 17

18 2.4 Η ΟΜΗ ΤΟΥ DNA Η διαδικασία της ζωής περιλαμβάνει μια ποικιλία μορίων, από το νερό ως τις μικρές οργανικές ενώσεις (π.χ., λιπαρά οξέα και σάκχαρα), και τα μακρομόρια (DNA, πρωτεΐνες, και πολυσακχαρίτες) που καθορίζουν τη δομή των κυττάρων. Τα μακρομόρια ελέγχουν και κυβερνούν τις περισσότερες από τις δραστηριότητες της ζωής. Το DNA ενός οργανισμού είναι το μοριακό πρόγραμμα που περιέχει ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και τη λειτουργία του κυττάρου. Ένα μόριο DNA συνίσταται από δύο μακριές πολυνουκλεοτιδικές αλυσίδες οι οποίες αποτελούνται από τέσσερα είδη νουκλεοτιδίων. Καθεμία από αυτές τις αλυσίδες αναφέρεται ως αλυσίδα ή κλώνος DNA. Οι δύο αλυσίδες συγκρατούνται με δεσμούς υδρογόνου μεταξύ των βάσεων των νουκλεοτιδίων Νουκλεοτίδια Τα νουκλεοτίδια αποτελούνται από μία πεντόζη, με την οποία συνδέονται μία ή περισσότερες φωσφορικές ομάδες, και μια αζωτούχος βάση. Στην περίπτωση του DNA, η πεντόζη είναι δεοξυριβόζη που συνδέεται με μια φωσφορική ομάδα, ενώ η βάση μπορεί να είναι αδενίνη(a), κυτοσίνη(c), γουανίνη(g) ή θυμίνη(t). Τα νουκλεοτίδια συνδέονται ομοιοπολικά μεταξύ τους σε μια αλυσίδα μέσω των σακχάρων και των φωσφορικών ομάδων τους, που σχηματίζουν έτσι ένα «σκελετό» εναλλασσόμενων μονάδων σακχάρου-φωσφορικής ομάδας-σακχάρου-φωσφορικής ομάδας. Εικόνα 2.5: Νουκλεοτίδιο του DNA (Life Sciences Cyberbridge2007) Ο τρόπος με τον οποίο συνδέονται μεταξύ τους τα νουκλεοτίδια προσδίδει σε έναν κλώνο DNA χημική πολικότητα. Η πολικότητα μιας αλυσίδας DNA υποδεικνύεται ορίζοντας το ένα άκρο ως 3 και το άλλο ως 5. Οι δύο πολυνουκλεοτιδικές αλυσίδες στη διπλή έλικα του DNA συγκρατούνται με δεσμούς υδρογόνου μεταξύ των βάσεων των διαφορετικών κλώνων. Οι βάσεις δε ζευγαρώνουν στην τύχη: η A πάντα ζευγαρώνει με την T και η G με την C. To ζευγάρωμα ανάμεσα στις συμπληρωματικές βάσεις επιτρέπει στα ζεύγη των βάσεων να συσκευάζονται στο εσωτερικό της διπλής έλικας στην πιο ευνοϊκή, από ενεργειακή άποψη, διάταξη. 18

19 Εικόνα 2.6: Το βέλος δείχνει τον φωσφοδιεστερικό σκελετό με προσανατολισμό 5'->3' (Μαρμάρα Β., Λαμπροπούλου- Μαρμάρα Μ. 2005). Σε αυτή τη διάταξη, κάθε ζεύγος βάσεων έχει παρόμοιο εύρος, ώστε να διατηρεί τον σακχαρο-φωσφορικό σκελετό σε ίση απόσταση κατά μήκος του μορίου του DNA, ενώ, επιπρόσθετα, οι σακχαρο-φωσφορικοί σκελετοί περιελίσσονται ο ένας γύρω από τον άλλο για να σχηματίσουν μια διπλή έλικα, που περιέχει 10 βάσεις ανά στροφή. Αυτή η περιέλιξη επίσης συνεισφέρει στην ενεργειακά ευνοϊκή διαμόρφωση της διπλής έλικας του DNA. Τα μέλη κάθε ζεύγους βάσεων προσαρμόζεται μέσα στη διπλή έλικα μόνο όταν η πολικότητα του ενός κλώνου έχει αντίθετο προσανατολισμό από την πολικότητα του άλλου. Για αυτό το λόγο ο κάθε κλώνος ενός μορίου DNA περιέχει μια αλληλουχία νουκλεοτιδίων η οποία είναι ακριβώς συμπληρωματική προς την αλληλουχία των νουκλεοτιδίων του άλλου κλώνου. Τέλος άλλη μια σημαντική λειτουργία του DNA είναι ότι περιέχει την πληροφορία για τον αυτοδιπλασιασμό του, εξασφαλίζοντας έτσι τη μεταβίβαση των γενετικών πληροφοριών από το μητρικό στα θυγατρικά κύτταρα και από τον οργανισμό στους απογόνους του μέσω της διαδικασίας της αντιγραφής (replication). Οι εντολές που λαμβάνει το κύτταρο για να εκτελέσει ορισμένες διαδικασίες δίδονται μέσω των παραγομένων πρωτεϊνών. Εικόνα 2.7: Μοντέλο διπλής έλικας του DNA (Lodish, Darnell et al. 2003) 19

20 Χρωματίνη Ήδη από τις αρχές του εικοστού αιώνα οι βιολόγοι είχαν αναγνωρίσει ότι τα γονίδια βρίσκονται στα χρωμοσώματα, τα οποία τότε ήταν γνωστά ως νηματοειδείς δομές στον πυρήνα των ευκαρυωτικών κυττάρων, που γίνονται ορατά καθώς το κύτταρο αρχίζει να διαιρείται. Αργότερα, με την εφαρμογή βιοχημικών αναλύσεων, βρέθηκε ότι τα χρωμοσώματα αποτελούνται από DNA και πρωτεΐνες. Στους ευκαρυώτες τα τεράστια δίκλωνα μόρια DNA συσκευάζονται σε μια ομάδα διαφορετικών χρωμοσωμάτων που χωρούν στον πυρήνα και κατανέμονται εύκολα στα δύο θυγατρικά κύτταρα κατά την κυτταρική διαίρεση. Το δύσκολο έργο της συσκευασίας του DNA διεκπεραιώνεται από πρωτεΐνες που διασυνδέονται με το DNA στα χρωμοσώματα, εμπλέκονται στη συσκευασία του DNΑ και εξασφαλίζουν όλο και ανώτερα επίπεδα οργάνωσης. Στον άνθρωπο το DNA του πυρήνα κατανέμεται σε μια ομάδα διαφορετικών χρωμοσωμάτων. Το ανθρώπινο γονιδίωμα περιέχει περίπου 3.2 x 10 9 νουκλεοτίδια που κατανέμονται σε 24 χρωμοσώματα. Κάθε χρωμόσωμα αποτελείται από ένα μοναδικό, εξαιρετικά μακρύ γραμμικό μόριο που αλληλεπιδρά με πρωτεΐνες οι οποίες διπλώνουν και συσκευάζουν τη λεπτή ίνα του DNA σε μια πιο συμπαγή δομή. Το σύμπλοκο του DNA και των πρωτεϊνών αποκαλείται χρωματίνη. Η χρωματίνη έχει σκοπό το πακετάρισμα του γενετικού υλικού σε μικρό όγκο για να χωράει στον πυρήνα, την ενδυνάμωσή του κατά τη μείωση και τη μίτωση, όπως επίσης δρα ως μηχανισμός ελέγχου της γονιδιακής έκφρασης. Η χρωματινική δομή επηρεάζεται κυρίως από τη μεθυλίωση (DNA και πρωτεΐνες) και την ακετυλίωση (πρωτεΐνες). Η οργάνωση της χρωματίνης μπορεί να χωριστεί σε τρία επίπεδα: Η βασική επαναλαμβανόμενη μονάδα, ονομάζεται νουκλεόσωμα. Το νουκλεόσωμα αποτελείται από 1.67 υπερελικωμένες στροφές DNA, συνολικού μήκους 147bp, συνδεδεμένο με ένα οκταμερές ιστονών. Το οκταμερές σχηματίζεται από δύο ετεροδιμερή των ιστονών Η2Α-Η2Β και ένα σταθερό τετραμερές των ιστονών Η3-Η4. Τα άκρα των ιστονών είναι ιδιαίτερα ευέλικτα και προεξέχουν από τη συμπαγή δομή του νουκλεοσώματος, συμβάλλοντας στις αλληλεπιδράσεις μεταξύ των νουκλεοσωμάτων και στη δημιουργία των δευτερευόντων χρωματινικών δομών. Και οι τέσσερις πυρηνικές ιστόνες εμφανίζουν δομή ίδιου τύπου, στην οποία τρεις α-έλικες συνδέονται με δύο ενδιάμεσα (συνδετικά) τμήματα. Αυτή η δομή ονομάζεται αναδίπλωση ιστονών (histone fold). Το τμήμα αυτό περιλαμβάνει θέσεις για αλληλεπιδράσεις με το DNA αλλά και μεταξύ των ιστονών κατά το διμερισμό τους. Το κάθε νουκλεόσωμα συνδέεται με το διπλανό του με 10-60bp DNA που ονομάζεται συνδετικό (linker), και η συστοιχία των νουκλεοσωμάτων διαμορφώνει μια χρωματινική ίνα διαμέτρου 10nm. Σε αυτό εντοπίζονται συνδετικές ιστόνες όπως η Η1 ή τα ανάλογά της, πρωτεΐνες HMG (high mobility group) και SIR (silent information regulator). Η ιστόνη συνδέσμου, όπως έχει ονομαστεί η Η1, βρίσκεται σε περιοχές linker DNA ανάμεσα στα νουκλεοσώματα και συντελεί στην περαιτέρω συμπύκνωση της συστοιχίας των νουκλεοσωμάτων στο δεύτερο επίπεδο. Το δεύτερο επίπεδο είναι η 30nm χρωματινική ίνα. Πρόκειται για ελικοειδή δομή, διαμέτρου 30nm, που προκύπτει από την περιέλιξη των νουκλεοσωμάτων. Αυτή η αναδίπλωση αυξάνει το βαθμό συμπύκνωσης του DNA κατά σαράντα φορές, ενώ η ακριβής δομή της δεν είναι γνωστή. Με μελέτες ηλεκτρονικής μικροσκοπίας έχει δειχθεί να είναι πολύ δυναμική και να μπορεί να ξεδιπλώσει γρήγορα σε ίνα των 10nm παρουσία RNA πολυμεράσης. Ο τελικός βαθμός συμπύκνωσης της χρωματίνης καθορίζεται στο τρίτο επίπεδο οργάνωσης, την περαιτέρω αναδίπλωση του ίδιου του ινιδίου 30nm σε ανώτερες δομές όπως η μεσοφασική χρωματίνη και 20

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ 1. Ούλωφ Πάλμε & Επάφου & Χρυσίππου 1 Ζωγράφου, 210 74 88 030 2. Φανερωμένης 13 Χολαργός, 210 65 36 551 www.en-dynamei.gr ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα