Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Blast

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Blast"

Transcript

1 Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) & Blast

2 Στοίχιση κατά ζεύγη Αντιστοίχιση των νουκλεοτιδίων/αµινοξέων δυο ακολουθιών, ώστε να εντοπιστούν οι οµοιότητες και οι διαφορές τους. Χρησιµοποιείται για: Εντοπισµό µεταλλάξεων αναζήτηση οµόλογων γονιδίων/πρωτεϊνών σε βάσεις δεδοµένων

3 Στοίχιση κατά ζεύγη Τοποθετούνται οι αντίστοιχοι χαρακτήρες ο ένας κάτω από τον άλλο και µπορεί να γίνει χρήση κενών (gaps) Δύο χαρακτήρες µπορεί να είναι: Ίδιοι Παρόµοιοι (κοινές φυσικοχηµικές ιδιότητες, π.χ. Ισολευκίνη - βαλίνη) Διαφορετικοί

4 Λίγη εξέλιξη: οµολογία Οµόλογα γονίδια: κοινός εξελικτικός πρόγονος. Ορθόλογα γονίδια: προέρχονται από ειδογένεση. Ουσιαστικά, ένα γονίδιο α (µεταλλαγµένο) σε δύο διαφορετικούς οργανισµούς. Συχνά έχουν την ίδια λειτουργία Παράλογα γονίδια: προέρχονται από γονιδιακό διπλασιασµό. Ανήκουν στην ίδια οικογένεια Ξενόλογα γονίδια: από οριζόντια µεταφορά Παράδειγµα µε Πυρηνικούς υποδοχείς

5 Λίγη εξέλιξη: οµολογία (ιι)

6 Βασικότερα είδη µεταλλάξεων Μεταλλάξεις σηµείου (point mutations) Συνώνυµες (synonymous) Μη-συνώνυµες (non-synonymous) Αµινοξέα µε παρόµοιες φυσικοχηµικές ιδιότητες Αµινοξέα µε διαφορετικές φυσικοχηµικές ιδιότητες Κωδικόνια τερµατισµού

7 Μεταπτώσεις-µεταστροφές Μεταπτώσεις (Transitions) Δηµιουργούνται µε µεγαλύτερη συχνότητα Συνήθως οδηγούν σε συνώνυµες µεταλλάξεις Eίναι πιο συχνές στα SNPs

8 Κατηγοριοποίηση αµινοξέων

9 Βασικότερα είδη µεταλλάξεων Δοµικές Αναδιατάξεις Προσθήκες/απαλείψεις (insertions/deletions) Αναστροφές Διπλασιασµοί

10 Βασικότερα είδη µεταλλάξεων (ιι) Αναδιάταξη αυτόνοµων λειτουργικών περιοχών µιας πρωτεΐνης (domain rearrangements)

11 Όλες οι περιοχές µιας πρωτεΐνης δεν µεταλλάσονται µε τον ίδιο ρυθµό Αυτόνοµες λειτουργικές περιοχές (domains): πολύ συντηρηµένες Περιοχές ενδογενούς δοµικής αστάθειας (intrinsically disordered regions). Π.χ, ευέλικτες συνδετικές περιοχές (flexible linkers). Μεταβαλλόµενο µήκος και περιεκτικότητα αµινοξέων, µε παρόµοιες όµως φυσικοχηµικές ιδιότητες. Μεταλλάσονται γρήγορα. Το εξελικτικό σήµα µπορεί να χαθεί σύντοµα Συχνά δεν υπάρχει περιορισµός θέσης (π.χ φωσφορυλίωση)

12 Γλοβίνες πολύ συντηρηµένη τριτοταγής δοµή, λίγο συντηρηµένη πρωτοταγής δοµή (~10-20% οµοιότητα)

13 Είδη στοίχισης (ι) Ολική στοίχιση (global alignment) Προσπαθεί να στοιχίσει όσο το δυνατό περισσότερους χαρακτήρες σε ΟΛΟ το µήκος των δύο αλληλουχιών Για ακολουθίες που δεν έχουν αποκλείνει σε µεγάλο βαθµό και επίσης έχουν παρόµοιο µέγεθος Κλασσική µέθοδος: Needleman-Wunsch. Βασίζεται στον δυναµικό προγραµµατισµό

14 Eίδη στοίχισης (ιι) Τοπική στοίχιση (local alignment) Νησίδες στοίχισης. Για ακολουθίες που έχουν αποκλείνει αρκετά και έχουν αποµείνει συντηρηµένες µόνο κάποιες περιοχές (domains) Για αντιστοίχιση mrna µε γενωµικό DNA Κλασσικές µέθοδοι: Smith-Waterman (δυναµικός προγραµµατισµός) Blast (ευρετικές µέθοδοι-heuristics)

15 Eίδη στοίχισης (ιιι)

16 Δυναµικός προγραµµατισµός Δίνει την βέλτιστη στοίχιση (Μαθηµατικά αποδεδειγµένο). Και για ολικές και για τοπικές στοιχίσεις. Η στοίχιση εξαρτάται από το βαθµολογικό σύστηµα που εφαρµόζεται.

17 Δυναµικός προγραµµατισµός Το βαθµολογικό σύστηµα

18 Δυναµικός προγραµµατισµός Το βαθµολογικό σύστηµα πρέπει: Να δίνει βαθµούς για κάθε θέση που οι χαρακτήρες ταιριάζουν απόλυτα Να δίνει βαθµούς (λιγότερους) για κάθε θέση που οι χαρακτήρες έχουν παρόµοιες ιδιότητες Να µην δίνει βαθµούς για µια θέση που οι χαρακτήρες είναι τελείως διαφορετικοί Να βάζει ποινή για κάθε κενό που εισάγεται Να βάζει ποινή (µικρότερη) για κάθε κενό που επεκτείνεται

19 Δυναµικός προγραµµατισµός Ενδείκνυται για τοπική στοίχιση µακροµόρια διαφορετικού µεγέθους Συντηρηµένη µόνο µια µικρή περιοχή Στοίχιση ώριµου mrna µε το γονίδιό του 2 γονίδια µε συντηρηµένα εξόνια αλλά αποκλείνοντα ιντρόνια Αλγόριθµος Smith-Waterman (1981)

20 Δυναµικός προγραµµατισµός τοπική στοίχιση Αλγόριθµος παρόµοιος µε ολική στοίχιση Διαφορές: Οι ασυµφωνίες δίνουν αρνητική βαθµολογία. Όταν µια τιµή του πίνακα βγαίνει αρνητική, µηδενίζεται.

21 Πίνακες αντικατάστασης Στο παράδειγµα, όλες οι συµφωνίες/ασυµφωνίες είχαν το ίδιο σκορ. Στην πράξη, πιο περίπλοκα συστήµατα βαθµολόγισης. Μια ασυµφωνία µεταξύ δύο πουρινών δεν είναι το ίδιο µε µια ασυµφωνία µεταξύ πουρίνης-πυριµιδίνης. Διαφορετικές συχνότητες µεταλλάξεων. Το ίδιο και για τις πρωτεΐνες. Χρειαζόµαστε πίνακες που βασίζονται σε συγκεκριµµένα εξελικτικά µοντέλα και λαµβάνουν υπόψην την συχνότητα του κάθε χαρακτήρα

22 Πίνακες αντικατάστασης Για πρωτεΐνες: Για αµινοξέα µε παρόµοιες φυσικοχηµικές ιδιότητες, µεγαλύτερη πιθανότητα αντικατάστασης (συντηρητικές αντικαταστάσεις). Πίνακες PAM Πίνακες BLOSUM

23 Συχνότητα αµινοξέων από Swissprot

24 Πίνακες PAM Dayhoff et al., 1978 PAM -> Percent Accepted Mutations Βασίστηκε σε 1572 αποδεκτές αντικαταστάσεις από 71 groups εξελικτικά κοντινών οµόλογων ακολουθιών. 1 PAM -> µονάδα εξελικτικής απόκλισης, όπου 1% των αµινοξέων έχει αλλάξει. Ανοµοιογενής ρυθµός εξέλιξης για τις οικογένειες πρωτεϊνών. Άρα, 1 PAM σηµαίνει διαφορετικό χρόνο εξέλιξης για την κάθε οικογένεια. Για 250 µονάδες PAM, θα υπάρχει απόκλιση 100% µεταξύ δύο οµόλογων ακολουθιών;

25 Πίνακες PAM (ii) Όχι. Απόκλιση ~80%. Μερικές θέσεις µπορεί να έχουν υποστεί περισσότερες από µία αντικαταστάσεις, ή ακόµα και να έχουν επανέλθει στο αρχικό αµινοξύ! Το κάθε αµινοξύ θα έχει αποκλίνει σε διαφορετικό βαθµό. Π.χ. αµετάβλητες θα παραµείνουν 55% Trp, 6% Asn.

26 Πίνακες PAM (iii) Θετική τιµή στον πίνακα, µεταξύ δύο αµινοξέων -> πιο πιθανό να συναντήσουµε αυτό το ζεύγος σε µια στοίχιση µεταξύ οµόλογων ακολουθιών Αρνητική τιµή στον πίνακα, µεταξύ δύο αµινοξέων -> πιο απίθανο να συναντήσουµε αυτό το ζεύγος σε µια στοίχιση µεταξύ οµόλογων ακολουθιών Αµινοξέα µε παρόµοιες ιδιότητες έχουν θετικές τιµές log-odds

27 Πίνακες PAM (iv) Στις στοιχίσεις χρησιµοποιήθηκαν ακολουθίες που είχαν αποκλείνει πολύ λίγο µεταξύ τους (απόσταση 1 PAM). Αναγωγή σε απόσταση 250 PAM (Πίνακας PAM250). Πολλαπλασιάστηκε ο PAM1 Χ 250 φορές µε τον εαυτό του Σειρά πινάκων. Εµπειρικά προτάθηκε για γενική χρήση ο PAM250 Όσο µεγαλώνει το νούµερο, µεγαλώνει και η εξελικτική απόσταση. Για στοίχιση ακολουθιών µε µικρή εξελικτική απόσταση, χρησιµοποιούµε πίνακες PAM µε µικρά νούµερα. Οι πίνακες PAM δηµιουργήθηκαν από ακολουθίες µε µικρή εξελικτική απόσταση και εποµένως είναι προτιµότερο να χρησιµοποιούνται για στοίχιση κοντινών ακολουθιών

28 Πίνακες PAM (iv) Εγγενείς ατέλειες: Δεν λαµβάνεται υπόψην ο διαφορετικός βαθµός συντήρησης των περιοχών µιας πρωτεΐνης. Κάθε αντικατάσταση θεωρείται: ανεξάρτητη από προηγούµενες αντικαταστάσεις στην ίδια θέση. Ανεξάρτητη από τα γειτονικά αµινοξέα

29 Πίνακες BLOSUM BLOcks SUbstitution Matrix Henikoff & Henikoff, Χρησιµοποίησαν τοπικές πολλαπλές στοιχίσεις από συντηρηµένες περιοχές εξελικτικά αποµακρυσµένων ακολουθιών (Β.Δ BLOCKS). Και εδώ σειρά πινάκων µε διαφορετικά νούµερα. BLOSUM62 : Ακολουθίες µε οµοιότητα 62% και παραπάνω οµαδοποιούνται. Δεν κάνουν αναγωγές στην εξελικτική απόσταση σε αντίθεση µε τις PAM.

30 Βασικές διαφορές µεταξύ PAM-BLOSUM Ο κάθε πίνακας BLOSUM δηµιουργείται από πραγµατικά δεδοµένα και όχι από αναγωγή ενός αρχικού πίνακα. Οι PAM δηµιουργήθηκαν από ολική στοίχιση, ενώ οι BLOSUM από τοπική στοίχιση καλά συντηρηµένων περιοχών.

31 Βαθµολόγιση Κενών Γραµµική ποινή για τα κενά (affine gap penalty) Μια πολύ υψηλή τιµή για την εισαγωγή ενός κενού και χαµηλότερη τιµή για την επέκταση του κενού Επιλογή παραµέτρων εµπειρική! Θεωρείται σπάνιο γεγονός η εισαγωγή κενού, όταν όµως συµβαίνει, η επεκτασή του δεν είναι τόσο σπάνια Π.χ. Για BLOSUM62: εισαγωγή κενού -> Ποινή Επέκταση κενού -> ποινή 1-2

32 Βαθµολόγιση µιας στοίχισης µε πίνακα αντικατάστασης και affine gap penalty

33 Στατιστική σηµαντικότητα µιας στοίχισης κατά ζεύγη Περισσότερες πληροφορίες στο: Στατιστική σηµαντικότητα µιας στοίχισης σηµαίνει ότι οι δύο ακολουθίες είναι οµόλογες (κοινή εξελικτική προέλευση)

34 Στατιστική σηµαντικότητα ολικής στοίχισης (i) Δεν µπορούµε να γνωρίζουµε την κατανοµή τυχαίων τιµών µιας ολικής στοίχισης τυχαία επιλεγµένων (µη οµόλογων) ακολουθιών. Για κάθε στοίχιση, µπορούµε να πάρουµε την µια ακολουθία και να την ανακατέψουµε πολλές φορές (προσοµοίωση). Έτσι διατηρείται η συχνότητα των αµινοξέων στην ακολουθία. Για το κάθε ανακάτεµα, υπολογίζουµε τη βαθµολογία της στοίχισης του τυχαίου ζεύγους. Θα ήταν λάθος να υποθέσουµε ότι η υπολογισµένη µε προσοµοιώσεις κατανοµή τυχαίων τιµών είναι κανονική. Ζ-score δεν µπορεί να µετατραπεί σε P-value

35 Στατιστική σηµαντικότητα ολικής στοίχισης (ii) Αν πραγµατοποιηθεί το ανακάτεµα 100 φορές και η µέγιστη βαθµολογία στοίχισης δεν υπερβαίνει την βαθµολογία που παρατηρήσαµε για την στοίχιση των 2 πραγµατικών ακολουθιών, τότε η στοίχιση είναι στατιστικά σηµαντική σε επίπεδο P-value < 0.01 Μεγάλο υπολογιστικό κόστος Χρησιµοποιείται για ολικές στοιχίσεις,εντούτοις δεν ενδείκνυται η ολική στοίχιση για να αποφασίσουµε αν δύο ακολουθίες είναι οµόλογες

36 Στατιστική σηµαντικότητα τοπικής στοίχισης (i) Για τοπικές στοιχίσεις χωρίς κενά: αναλυτική µαθηµατική θεωρία κατανοµής τυχαίων βαθµολογιών. Κατανοµή ακραίων τιµών (Extreme value distribution - Gumbel). Γιατί όχι κανονική κατανοµή; Γιατί σε µια οµοπαράθεση δύο ακολουθιών χρησιµοποιούµε µόνο την βέλτιστη από όλες τις δυνατές στοιχίσεις

37 Στατιστική σηµαντικότητα τοπικής στοίχισης (iii) Για µια δεδοµένη τοπική στοίχιση (χωρίς κενά) δύο ακολουθιών µε score S, πόσες τυχαίες στοιχίσεις θα µπορούσαν να δώσουν το ίδιο score; E = Kmne -λs (E-value) m,n µήκη των ακολουθιών S score στοίχισης Κ, λ εξαρτώνται από τη συχνότητα νουκλεοτιδίων/αµινοξέων και το σύστηµα βαθµολόγισης. Τι σηµαίνει για µια στοίχιση, E-value = 1; Συνήθως η σηµαντικότητα ορίζεται: E-value < 10e-4

38 Στατιστική σηµαντικότητα τοπικής στοίχισης (iv) Το raw score µιας τοπικής στοίχισης εξαρτάται από το βαθµολογικό σύστηµα που χρησιµοποιήθηκε. Χρειάζεται να κανονικοποιηθεί (normalization). Είναι σαν να µιλάµε για απόσταση χωρίς να διευκρινίζουµε αν είναι σε µέτρα ή πόδια. Bit score S είναι το κανονικοποιηµένο raw score. To E-value για το κανονικοποιηµένο score (bit score)

39 Αναζήτηση οµόλογων ακολουθιών σε βάσεις δεδοµένων (i) Οµόλογες ακολουθίες πιθανόν να έχουν παρόµοιες λειτουργίες. Ακολουθία επερώτησης (query sequence) Υποκείµενες ακολουθίες στην βάση δεδοµένων (subject sequences). 1 ακολουθία Χ Β.Δ Ν ακολουθίες Χ Β.Δ Αναζήτηση µε δυναµικό προγραµµατισµό: Smith-Waterman, SSearch Ευρετικοί αλγόριθµοι για ανίχνευση οµόλογων ακολουθιών. FASTA BLAST 50 φορές γρηγορότεροι από δυναµικό προγραµµατισµό, αλλά ενδέχεται να µην εντοπίσουν κάποιες αποµακρυσµένες οµόλογες ακολουθίες.

40 Αναζήτηση οµόλογων ακολουθιών σε βάσεις δεδοµένων (ii) Για κάθε στοίχιση µιας ακολουθίας Α µε ακολουθίες από την Β.Δ., υπολογίζεται µια βαθµολογία S και κανονικοποιείται (bit score). Για µια αναζήτηση σε Β.Δ. γίνονται πολλές στοιχίσεις. Αυτό πρέπει να ληφθεί υπόψην στον υπολογισµό της στατιστικής σηµαντικότητας (multiple testing correction). Διορθωµένο E-value = E-value X N (N=αριθµός ακολουθιών στην Β.Δ.) Υπάρχουν παραλλαγές του τρόπου υπολογισµού της στατιστικής σηµαντικότητας, για το κάθε πρόγραµµα. Διαφορετικός υπολογισµός µεταξύ FASTA - BLAST.

41 Αλγόριθµος BLAST words: λέξεις µήκους W που δεν απαιτείται να ταιριάζουν απόλυτα µεταξύ των πρωτεϊνικών ακολουθιών πρέπει να ταιριάζουν απόλυτα µεταξύ των νουκλεοτιδικών ακολουθιών. Πρωτεΐνες: w=3 Νουκλεϊκά οξέα: w=11 E-value Default: 10 (για να µη χαθούν οµόλογες ακολουθίες) Συνήθως E-value < 1e-3 (για να αποµείνουν οµόλογες ακολουθίες υψηλής εµπιστοσύνης)

42 PQG 20 X 20 X 20 = words PQG X words PQG X PEG = =15 Όριο τιµής Τ Αλγόριθµος BLAST

43 Αλγόριθµος BLAST

44 Περιοχές χαµηλής πολυπλοκότητας Low complexity regions Επαναλήψεις: poly-a tails Poly-proline tracts Tandem repeats: KTPKTPKTPKTPKTP Interspersed repeats: KTPAKTPKTPKTP (i) Προκύπτουν από λάθη: Στην µιτωτική αντιγραφή (mitotic replication slippage) Στον µειωτικό ανασυνδυασµό

45 Περιοχές χαµηλής πολυπλοκότητας (ii) 2 µη οµόλογες ακολουθίες. Μεταλλάξεις στην ακολουθία 1. Μεταλλάξεις στην ακολουθία 2. Αν δεν φιλτραριστούν οι περιοχές χαµηλής πολυπλοκότητας: Η στοίχιση θα δείξει οµολογία

46 Φιλτράρισµα περιοχών χαµηλής πολυπλοκότητας Φιλτράρισµα (masking) Και για BLAST και για FASTA. Φιλτράρεται η ακολουθία επερώτησης µόνο. Χ για πρωτεΐνες και Ν για νουκλεϊκά οξέα Άλλες ακολουθίες που φιλτράρονται: Επαναλήψεις Alu Φορείς κλωνοποίησης Φίλτρα του Blast: Dust: νουκλεοτίδια Seg: πρωτεΐνες

47 Blast Blast

48 Blastn / MegaBlast Blastn Νουκλεοτίδια Χ νουκλεοτίδια Για στοίχιση trna, rrna, mrna, γενωµικό DNA MegaBlast 10Χ ταχύτερο από Blastn Για στοίχιση ακολουθιών που διαφέρουν πολύ λίγο µεταξύ τους Κυρίως για στοίχιση mrna µε ολόκληρο το γενωµικό DNA

49 Blastn Παράδειγµα: Έλεγχος εξειδίκευσης ζεύγους εκκινητών (primers)

50 Blastn Παράδειγµα: Eντοπισµός SNPs σε ακολουθίες του ιού HIV-1 για ανθεκτικότητα σε φάρµακα

51 Blastp Πρωτεΐνη Χ πρωτεΐνες Παράδειγµα: Πρόβλεψη λειτουργίας µιας άγνωστης πρωτεΐνης. Εντοπισµός ορθόλογης πρωτεΐνης σε άλλα είδη. Εντοπισµός όλων των µελών της πρωτεϊνικής οικογένειας στο ίδιο ή σε άλλα είδη

52 Translated Blast Η νουκλεοτιδική ακολουθία ενός γονιδίου εµφανίζεται λιγότερο συντηρηµένη από την αµινοξική ακολουθία της πρωτεΐνης του. Πιο ευαίσθητες µέθοδοι από Blastn για ανίχνευση οµόλογων περιοχών (για περιοχές που κωδικοποιούν πρωτεΐνες). Μετάφραση µε συγκεκριµµένο γενετικό κώδικα ακολουθίας επερώτησης (query sequence) ακολουθιών στην Β.Δ. και των δύο ταυτόχρονα

53 tblastn Πρωτεΐνη (query) X Β.Δ. νουκλεοτιδικών ακολουθιών µεταφρασµένων και στα 6 αναγνωστικά πλαίσια. Η Β.Δ. περιέχει νουκλεοτιδικές ακολουθίες µε άγνωστη λειτουργία. Π.χ. Η Β.Δ. µπορεί να είναι µια συλλογή ESTs ή αµορφοποίητα δεδοµένα από την αλληλούχιση ενός γενώµατος (draft genome records) Αντιµετωπίζει το πρόβληµα λαθών στην αλληλούχιση, που θα µπορούσε να καταστρέψει το αναγνωστικό πλαίσιο.

54 Blastx Νουκλεοτιδική ακολουθία επερώτησης (query) που µεταφράζεται στα 6 αναγνωστικά πλαίσια και συγκρίνεται µε Β.Δ. πρωτεϊνικών ακολουθιών. Παράδειγµα: εντοπισµός µετάλλαξης που αλλάζει το αναγνωστικό πλαίσιο.

55 tblastx Νουκλεοτιδική ακολουθία επερώτησης (query) που µεταφράζεται στα 6 αναγνωστικά πλαίσια και συγκρίνεται µε Β.Δ. νουκλεοτιδικών ακολουθιών µεταφρασµένων και στα 6 αναγνωστικά πλαίσια. 6X6 blastp Αναζήτηση (διαειδική) για γονίδια που δεν έχουν εντοπιστεί µε τις κλασσικές µεθόδους ή για γονίδια που οι πρωτεΐνες τους δεν υπάρχουν στην B.Δ.

56 Blast και φυλογένεση

57 PSI-Blast

58 PSI-Blast PSI-Blast: Position-specific iterated Blast Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) Altschul et al., Η αναζήτηση µακρινών οµολόγων σε Β.Δ. είναι πιο ευαίσθητη µε τη χρήση αυτών των πινάκων. Για οµόλογες ακολουθίες το PSI-Blast βρίσκει µέχρι και 3 φορές περισσότερες µακρινές οµόλογες ακολουθίες (οµοιότητα < 30%) σε σχέση µε το Blastp.

59 PSI-Blast Σε µια ακολουθία οι διάφορες θέσεις δεν είναι το ίδιο συντηρηµένες/ευέλικτες λόγω δοµικών/λειτουργικών περιορισµών. Χρησιµοποιώντας οµόλογες ακολουθίες από τον ίδιο ή άλλους οργανισµούς κατανοούµε την ευελιξία κάθε θέσης µιας ακολουθίας. Π.χ. Σε µια ακολουθία Α, στην θέση 123 (ενεργό κέντρο ενζύµου) βλέπουµε ένα µόνο αµινοξύ. Σε µια πολλαπλή στοίχιση της Α µε οµόλογες ακολουθίες βλέπουµε για την ίδια θέση (123) ποιά άλλα αµινοξέα επιτρέπονται και σε τί συχνότητες. Το PSSM χρησιµοποιεί αυτή την πληροφορία για να αναζητήσει µακρινά οµόλογα σε µια Β.Δ.

60 PSSM Αρχικά γίνεται πολλαπλή στοίχιση των ακολουθιών Στη συνέχεια, για ακολουθία µήκους L δηµιουργείται πίνακας: L X 4 (nucleotides) L X 20 (proteins)

61 PSSM Γίνεται καταµέτρηση των συχνοτήτων των χαρακτήρων για την κάθε θέση.

62 PSSM Ακολουθεί µια σειρά µετασχηµατισµών Συντελεστής βαρύτητας της κάθε ακολουθίας µε βάση την οµοιότητά της µε άλλες. Pseudocounts Λαµβάνεται υπόψην η συχνότητα υποβάθρου του κάθε χαρακτήρα Υπολογισµός των odds (παρατηρούµενη συχνότητα / συχνότητα υποβάθρου). Log-odds Ο πίνακας αυτός χρησιµοποιείται για τοπική στοίχιση µε ακολουθίες σε µια Β.Δ. (αντικαθιστά την ακολουθία επερώτησης).

63 PSI-Blast Πρώτο στάδιο: Blast µε την ακολουθία επερώτησης σε µια Β.Δ. (Ε<0.001 default). Οι τοπικές στοιχίσεις που βρέθηκαν (E-value < cutoff) χρησιµοποιούνται για τη δηµιουργία µιας πολλαπλής στοίχισης M µε σηµείο αναφοράς την ακολουθία επερώτησης (L θέσεις). Δεν επιτρέπονται κενά στην ακολουθία επερώτησης. Αυτή η πολλαπλή στοίχιση (ακολουθία - σηµείο αναφοράς) διαφέρει από τις τυπικές πολλαπλές στοιχίσεις Απαλοιφή ακολουθιών µε πολύ µεγάλη οµοιότητα. Δηµιουργία PSSM.

64 PSI-Blast Δεύτερο στάδιο: Νέα αναζήτηση στη Β.Δ. µε το PSSM αντί της αρχικής ακολουθίας επερώτησης. Οι νέες ακολουθίες που βρέθηκαν και ξεπερνούν το κατώφλι E-value ανανεώνουν την πολλαπλή στοίχιση και δηµιουργείται ένα νέο PSSM. Η διαδικασία επαναλαµβάνεται µέχρι να µη βρεθούν νέες ακολουθίες µε Evalue < τιµή κατωφλίου (convergence). Συνήθως, 3-5 κύκλοι αρκούν για να βρεθούν τα περισσότερα µακρινά οµόλογα.

65 PSI-Blast

66 PSI-Blast

67 PSI-Blast Πριν κάνουµε PSI-Blast πρέπει να ξέρουµε τι αναζητάµε!!! Κάποιες περιοχές/επικράτειες συναντώνται σε πολλές πρωτεΐνες. Προσοχή στην αναζήτηση όταν υπάρχουν τέτοιες περιοχές Αν ξεκινήσουµε µε άλλη οµόλογη ακολουθία επερώτησης δεν είναι σίγουρο ότι θα φτάσουµε στο ίδιο αποτέλεσµα! Προσοχή ποιές ακολουθίες συµπεριλαµβάνουµε στο PSSM. Αν εισέλθουν λάθος ακολουθίες, το λάθος θα ανατροφοδοτείται σε κάθε κύκλο (profile drift)

68 Επικράτειες (Domains) Κάποιες επικράτειες συνδυάζονται πολύ συχνά µε άλλες, στην ίδια πρωτεΐνη. content/18/3/449.full

69 Επικράτειες και αναζήτηση σε Β.Δ.

70 Χρησιµοποιώντας το PSI-Blast

71 Χρησιµοποιώντας το PSI-Blast

72 Χρησιµοποιώντας το PSI-Blast

73 Χρησιµοποιώντας το PSI-Blast

74 Χρησιµοποιώντας το PSI-Blast Πράσινο σφαιρίδιο για ακολουθίες που είχαν βρεθεί σε προηγούµενο γύρο αναζήτησης. Μπορούµε να επιλέξουµε τον αποκλεισµό κάποιων ακολουθιών

75 Χρησιµοποιώντας το PSI-Blast

76 Χρησιµοποιώντας το PSI-Blast Αν περιλαµβάνονταν οι 2 µεθυλ-τρανσφεράσες

77 Χρησιµοποιώντας το PSI-Blast Αποθήκευση αποτελεσµάτων

78 Άσκηση Μέρος 1ο

79 Blast (1a) Βρείτε την ακολουθία του Estrogen receptor alpha (σε µορφή FASTA) ως: mrna από την EMBL bank (accesion number: X03635). ως πρωτεΐνη από την Uniprot (accesion number: P03372).

80 Blast (1a) Τα προγράµµατα του Blast θα τα βρείτε στο: Θέλετε να βρείτε τις οµόλογες πρωτεΐνες του ανθρώπινου estrogen receptor alpha (πρωτεΐνη) στη µύγα Drosophila melanogaster, χρησιµοποιώντας τη ΒΔ Swissprot. Ποιό πρόγραµµα του Blast πρέπει να χρησιµοποιήσετε; Οι παράµετροι της αναζήτησης: ΒΔ Swissprot οργανισµός: Drosophila melanogaster Expect threshold: 1e-5 Low-complexity filtering

81 Blast (1a) Δείτε τα συντηρηµένα domains. Ποιά είναι; Ποιό είναι το καλύτερο blast hit; µε ποιό score & Evalue; Τι πρωτεΐνη είναι; Για το καλύτερο blast hit, δείτε στην τοπική στοίχιση: Identities Positives Low complexity regions

82 Blast (1a) Βρείτε την πρωτεϊνική ακολουθία (σε µορφή FASTA) του καλύτερου blast hit και µε αυτή κάνετε την αντίστροφη διαδικασία. Δηλαδή, blast έναντι της ΒΔ Swissprot, για τον οργανισµό Homo sapiens, χρησιµοποιώντας ως ακολουθία επερώτησης (query sequence) το προηγούµενο καλύτερο Blast hit. Όλες οι προηγούµενες παράµετροι του blast παραµένουν ίδιες. Βρίσκετε ως νέο καλύτερο blast hit το estrogen receptor alpha; Είναι ανταποδοτικό το blast; Τι σηµαίνει αυτό για τις εξελικτικές σχέσεις µεταξύ των δύο ακολουθιών;

83 Blast (1b) Χρησιµοποιώντας ως ακολουθία επερώτησης το mrna του estrogen receptor alpha από τον άνθρωπο (EMBL-bank accession: Χ03635), βρείτε αν υπάρχουν οµόλογες νουκλεοτιδικές ακολουθίες στη Drosophila melanogaster, χρησιµοποιώντας τη νουκλεοτιδική ΒΔ nucleotide collection (nr/nt). Ποιό πρόγραµµα του Blast πρέπει να χρησιµοποιήσετε; Παράµετροι του blast που θα κάνετε: νουκλεοτιδική ΒΔ nucleotide collection (nr/nt) Οργανισµό Drosophila melanogaster Optimize for somewhat similar sequences Expect threshold 1e-5 Filter low-complexity regions Βρέθηκαν οµόλογες νουκλεοτιδικές ακολουθίες στη Drosophila; Γιατί;

84 Blast (1c) Ποιό άλλο πρόγραµµα του Blast πρέπει να χρησιµοποιήσετε, για να δείτε αν υπάρχουν οµόλογες πρωτεΐνες για το mrna σας, στη Drosophila melanogaster; Παράµετροι του Blast. Genetic code standard Database: non-redundant protein sequences (nr) Οργανισµός: Drosophila melanogaster Expectation threshold 1e-5 Low complexity regions filtering Τι βρίσκετε;

85 Άσκηση Μέρος 2ο

86 Άσκηση (2) Βρείτε την πρωτεϊνική ακολουθία του human estrogen receptor alpha (Uniprot id: P03372) σε µορφή FASTA. Με την ακολουθία αυτή (P03372), βρείτε τις οµόλογες πρωτεϊνικές ακολουθίες της, στη Drosophila melanogaster και στον άνθρωπο ταυτόχρονα, µε τη βοήθεια του PSI-BLAST. Κάνετε το PSI-Blast στην ιστοσελίδα του NCBI, χρησιµοποιώντας την Swissprot, expectation value 1e-10 και low-complexity filtering. Επαναλάβετε τους κύκλους του PSI-blast µέχρι να συγκλίνει ο αλγόριθµος. Αποθηκεύεστε σε ένα αρχείο (µε όνοµα sequences.fasta) µε µορφή FASTA τις ακολουθίες από την παραπάνω αναζήτηση.

87 Αποθήκευση ακολουθιών από το Blast Select all Get selected sequences

88 Αποθήκευση ακολουθιών από το Blast Send to -> File -> Format: FASTA -> Creat file

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης)

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) PSI-Blast PSI-Blast PSI-Blast: τι είναι PSI-Blast: Position-specific iterated Blast Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) Altschul et al., 1997 http://www.ncbi.nlm.nih.gov/pmc/articles/pmc146917/pdf/253389.pdf

Διαβάστε περισσότερα

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Αναζήτηση οµοιοτήτων ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Σελίδα 1 εδοµένα Ακολουθία επερώτησης (query sequence) Ακολουθίες στη Βάση εδοµένων (subject sequences) Αναζήτηση Μέθοδοι δυναµικού

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 12: Αναζήτηση ομοιοτήτων έναντι βάσεων δεδομένων με τη χρήση ευρετικών αλγορίθμων Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr

Διαβάστε περισσότερα

Στοίχιση Ακολουθιών. Μέθοδοι σύγκρισης ακολουθιών. Είδος στοίχισης. match. gap. mismatch

Στοίχιση Ακολουθιών. Μέθοδοι σύγκρισης ακολουθιών. Είδος στοίχισης. match. gap. mismatch Οµολογία ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ ΑΝΑ ΖΕΥΓΗ Σελίδα 1 Σελίδα 2 Οµολογία Οµολογία Οµολογία κοινή εξελικτική καταγωγή Ορθόλογα γονίδια ειδογένεση συνήθως, ίδια βιολογική λειτουργία Παράλογα γονίδια γονιδιακός

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 5: Πίνακες αντικατάστασης BLOSUM και οπτική σύγκριση αλληλουχιών Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Ενότητα 1 η : Εισαγωγή Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB

ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB ΣΧΟΛΗ ΙΑΤΡΙΚΗΣ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΠΛΗΡΟΦΟΡΙΚΗ ΕΠΙΣΤΗΜΩΝ ΖΩΗΣ ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB ΔΡΙΤΣΟΠΟΥΛΟΥ ΕΛΕΝΗ Α.Μ. 1003 ΠΕΡΙΕΧΟΜΕΝΑ ΠΕΡΙΕΧΟΜΕΝΑ 2

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Σηµειώσεις Βιοπληροφορικής

Σηµειώσεις Βιοπληροφορικής Σηµειώσεις Βιοπληροφορικής Αναζήτηση Οµοιοτήτων σε Βάσεις εδοµένων Ακολουθιών Βάσεις εδοµένων Βιολογικών Ακολουθιών - Πρακτικά Ζητήµατα Προσεγγιστικοί Ευριστικοί Αλγόριθµοι Στατιστική Σηµαντικότητα Εφαρµογές

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ (ΒΙΟ 650) Ειδικά Θέματα Βιοπληροφορικής Διδάσκων: Βασίλειος Ι. Προμπονάς, Ph.D. Λέκτορας Βιοπληροφορικής ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ Διαλέξεις Δευτέρα και Πέμπτη

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση των μοντέλων πολλαπλής στοίχισης. κατανόηση των εφαρμογών

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Εισαγωγή στη θεωρία ακραίων τιμών

Εισαγωγή στη θεωρία ακραίων τιμών Εισαγωγή στη θεωρία ακραίων τιμών Αντικείμενο της θεωρίας ακραίων τιμών αποτελεί: Η ανάπτυξη και μελέτη στοχαστικών μοντέλων με σκοπό την επίλυση προβλημάτων που σχετίζονται με την εμφάνιση «πολύ μεγάλων»

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Διαλέξεις Βιολογίας ΙI 2014-20152015 Τμήμα Ιατρικής Πανεπιστήμιο Θεσσαλίας Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Κυτταρική Βιολογία Είναι η ακαδημαϊκή περιοχή που μελετά τα κύτταρα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ 3.1 Τυχαίοι αριθμοί Στην προσομοίωση διακριτών γεγονότων γίνεται χρήση ακολουθίας τυχαίων αριθμών στις περιπτώσεις που απαιτείται η δημιουργία στοχαστικών

Διαβάστε περισσότερα

Σηµειώσεις στις σειρές

Σηµειώσεις στις σειρές . ΟΡΙΣΜΟΙ - ΓΕΝΙΚΕΣ ΕΝΝΟΙΕΣ Σηµειώσεις στις σειρές Στην Ενότητα αυτή παρουσιάζουµε τις βασικές-απαραίτητες έννοιες για την µελέτη των σειρών πραγµατικών αριθµών και των εφαρµογών τους. Έτσι, δίνονται συστηµατικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Γ... 3 1.1 Σαψάκη Δ. - Σαψάκη Π.... 3 1.2 Βλάχου - Γεωργοπούλου... 3 1.3 Μπέρτσου - Τσάμη... 4 1.4 Καραγιάννη

Διαβάστε περισσότερα

Οι πράξεις που χρειάζονται για την επίλυση αυτών των προβληµάτων (αφού είναι απλές) µπορούν να τεθούν σε µια σειρά και πάρουν µια αλγοριθµική µορφή.

Οι πράξεις που χρειάζονται για την επίλυση αυτών των προβληµάτων (αφού είναι απλές) µπορούν να τεθούν σε µια σειρά και πάρουν µια αλγοριθµική µορφή. Η Αριθµητική Ανάλυση χρησιµοποιεί απλές αριθµητικές πράξεις για την επίλυση σύνθετων µαθηµατικών προβληµάτων. Τις περισσότερες φορές τα προβλήµατα αυτά είναι ή πολύ περίπλοκα ή δεν έχουν ακριβή αναλυτική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Πρότυπα και ρυθμοί υποκαταστάσεων

Πρότυπα και ρυθμοί υποκαταστάσεων Πρωτεϊνική Εξέλιξη Πρότυπα και ρυθμοί υποκαταστάσεων Ένα σημαντικό ερώτημα στη μελέτη της εξέλιξης αναφέρεται στο πώς είναι δυνατό να διαφέρουν τα πρότυπα και οι ρυθμοί των υποκαταστάσεων ανάμεσα στα διάφορα

Διαβάστε περισσότερα

1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος

1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος Έλεγχοι Υποθέσεων 1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος µ = 100 Κάθε υπόθεση συνοδεύεται από µια εναλλακτική: Ο

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ Στα πλαίσια της ΣΤΑΤΙΣΤΙΚΗΣ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑΣ προσπαθούµε να προσεγγίσουµε τα χαρακτηριστικά ενός συνόλου (πληθυσµός) δια της µελέτης των χαρακτηριστικών αυτών επί ενός µικρού

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ. Ερωτήσεις πολλαπλής επιλογής. Συντάκτης: Δημήτριος Κρέτσης

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ. Ερωτήσεις πολλαπλής επιλογής. Συντάκτης: Δημήτριος Κρέτσης ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Ερωτήσεις πολλαπλής επιλογής Συντάκτης: Δημήτριος Κρέτσης 1. Ο κλάδος της περιγραφικής Στατιστικής: α. Ασχολείται με την επεξεργασία των δεδομένων και την ανάλυση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση

Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση ΤΨΣ 50 Ψηφιακή Επεξεργασία Εικόνας Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση Τµήµα ιδακτικής της Τεχνολογίας και Ψηφιακών Συστηµάτων Πανεπιστήµιο Πειραιώς Περιεχόµενα Βιβλιογραφία

Διαβάστε περισσότερα

ΕΣ 08 Επεξεργαστές Ψηφιακών Σηµάτων. Βιβλιογραφία Ενότητας

ΕΣ 08 Επεξεργαστές Ψηφιακών Σηµάτων. Βιβλιογραφία Ενότητας ΕΣ 08 Επεξεργαστές Ψηφιακών Σηµάτων Βελτιστοποίηση κώδικα σε επεξεργαστές ΨΕΣ Τµήµα Επιστήµη και Τεχνολογίας Τηλεπικοινωνιών Πανεπιστήµιο Πελοποννήσου Βιβλιογραφία Ενότητας Kehtarnavaz [2005]: Chapter

Διαβάστε περισσότερα

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική»

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Μεταπτυχιακή Διατριβή Τίτλος Διατριβής Ονοματεπώνυμο Φοιτητή Πατρώνυμο Αριθμός Μητρώου Επιβλέπων ΑΝΑΓΝΩΡΙΣΗ ΜΟΡΙΑΚΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών

Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Σύγκριση και κατηγοριοποίηση πρωτεϊνικών δομών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

ΤΟΠΟΓΡΑΦΙΚΑ ΔΙΚΤΥΑ ΚΑΙ ΥΠΟΛΟΓΙΣΜΟΙ ΑΝΑΣΚΟΠΗΣΗ ΘΕΩΡΙΑΣ ΣΥΝΟΡΘΩΣΕΩΝ

ΤΟΠΟΓΡΑΦΙΚΑ ΔΙΚΤΥΑ ΚΑΙ ΥΠΟΛΟΓΙΣΜΟΙ ΑΝΑΣΚΟΠΗΣΗ ΘΕΩΡΙΑΣ ΣΥΝΟΡΘΩΣΕΩΝ ΤΟΠΟΓΡΑΦΙΚΑ ΔΙΚΤΥΑ ΚΑΙ ΥΠΟΛΟΓΙΣΜΟΙ ΑΝΑΣΚΟΠΗΣΗ ΘΕΩΡΙΑΣ ΣΥΝΟΡΘΩΣΕΩΝ Βασίλης Δ. Ανδριτσάνος Δρ. Αγρονόμος - Τοπογράφος Μηχανικός ΑΠΘ Επίκουρος Καθηγητής ΤΕΙ Αθήνας 3ο εξάμηνο http://eclass.teiath.gr Παρουσιάσεις,

Διαβάστε περισσότερα

Kalman Filter Γιατί ο όρος φίλτρο;

Kalman Filter Γιατί ο όρος φίλτρο; Kalman Filter Γιατί ο όρος φίλτρο; Συνήθως ο όρος φίλτρο υποδηλώνει µια διαδικασία αποµάκρυνσης µη επιθυµητών στοιχείων Απότολατινικόόροfelt : το υλικό για το φιλτράρισµα υγρών Στη εποχή των ραδιολυχνίων:

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ Α. Εισαγωγικά Στοιχεία Βιολογίας 1. DNA (Δεοξυριβονουκλεϊκό Οξύ) Φορέας γενετικής πληροφορίας Το DNA είναι ένα επίμηκες μόριο

Διαβάστε περισσότερα

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τοµέας Μαθηµατικών, Σχολή Εφαρµοσµένων Μαθηµατικών και Φυσικών Επιστηµών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόµενα Εισαγωγή στη

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα