ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη"

Transcript

1 ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Βιοφυσική - Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων Βιοπολυμερή Κυτταρική μεμβράνη Ακαδ. έτος Διδάσκουσα: Μυρσίνη Μακροπούλου

2 Από τον ορισμό της Βιοφυσικής: «Η Βιοφυσική είναι ο κλάδος εκείνος των φυσικών επιστημών που ασχολείται με: 1) τη μελέτη των φυσικών φαινομένων που υπεισέρχονται στη δομή, οργάνωση και λειτουργία των βιολογικών συστημάτων, 2) τη χρησιμοποίηση των αρχών και μεθόδων της Φυσικής στην έρευνα των φαινομένων της ζωής, 3) τη μελέτη των βιολογικών αποτελεσμάτων από την επίδραση των φυσικώνπαραγόντωνστηνέμβιαύλη».

3 Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων: Φυγοκέντρηση Η φυγοκέντρηση και η υπερφυγοκέντρηση χρησιμοποιούνται πλατιά για το διαχωρισμό ή την μελέτη μακρομορίων, συμβάλλοντας κύρια στη γνώση της μορφής και του μοριακού βάρους βιοπολυμερών, όπως π.χ. οι πρωτεΐνες, τα νουκλεϊνικά οξέα κ.λ.π. Στην υπερφυγόκεντρο οι ουσίες κινούνται με τον ίδιο τρόπο που κινούνται σε πεδίο βαρύτητας, με τη διαφορά ότι η φυγόκεντρος δύναμη υπερτερεί κατά πολύ της βαρύτητας. Με τη φυγοκέντρηση επιτυγχάνεται η επιλεκτική καθίζηση μακρομορίων σε διάλυμα ή κυτταρικό εναιώρημα.

4 Υπερφυγοκέντρηση (2) Αν ένα μόριο περιστρέφεται με γωνιακή ταχύτητα ω (rad/s) θεωρούμε ότι υφίσταται μια φυγόκεντρο δύναμη μέτρου F C =mω 2 r, όπου m ημάζατουμορίου και r ηαπόστασητουαπότοκέντροπεριστροφής. Το μόριο εκτοπίζει κάποια μάζα διαλύματος, ασκώντας μια δύναμη μέτρου F α =-m 0 ω 2 r, όπου m 0 ημάζατου εκτοπιζόμενου διαλύματος. Επιπλέον υπάρχει η δύναμη τριβής, με μέτρο F f =-fu, όπου f ο συντελεστής τριβής και u το μέτρο της ταχύτητας που αποκτά το μόριο. Αν θεωρήσουμε ένα μόριο σφαιρικής μορφής με ακτίνα r 0, το οποίο βρίσκεται σε διάλυμα του οποίου ο συντελεστής ιξώδους είναι η, τότε ηδύναμητριβής (δύναμη Stokes) γράφεται: F f =6πηr 0 u Στη φυγοκέντρηση μπορεί να ορισθεί ο παράγοντας επιτάχυνσης, β, ο οποίος δείχνει πόσες φορές είναι μεγαλύτερη η φυγόκεντρος δύναμη, την οποία υφίσταται το μόριο, από τη δύναμη της γήινης βαρύτητας, ή πόσες φορές είναι μεγαλύτερη η κεντρομόλος επιτάχυνση, g, της επιτάχυνσης της βαρύτητας, g 0, όπου θεωρούμε ότι g 0 =9,81 m/s 2. Έτσι β=g/g 0.

5 Υπερφυγοκέντρηση (3) Ανάλογα με την τιμή του παράγοντα β οι συσκευές φυγοκέντρησης που χρησιμοποιούνται στην βιοφυσική έρευνα αλλά και στην κλινική πράξη διακρίνονται στους παρακάτω τύπους: a) Συνήθεις, επιτραπέζιες, φυγόκεντροι, 1000<β<6240 b) Φυγόκεντροι υψηλής ταχύτητας, <β< c) Υπερφυγόκεντροι, <β< , d) Υπερ-υπερφυγόκεντροι, β> Οιφυγόκεντροιυψηλήςταχύτηταςκαιοιυπερφυγόκεντροιέχουνενσωματωμένο σύστημα ψύξης για την αποφυγή υπερθέρμανσης των βιολογικών δειγμάτων λόγω τριβών και διατήρηση της θερμοκρασίας σε κανονικά, βιοσυμβατά, επίπεδα. Σε ταχύτητες άνω των απαιτείται επίσης λειτουργία σε πολύ υψηλό κενό, γιατί οι θερμοκρασίες που αναπτύσσονται είναι υπερβολικά υψηλές.

6 Υπερφυγοκέντρηση (4) Με τον προσδιορισμό της ταχύτητας καθίζησης και άλλων μετρήσιμων μεγεθών λαμβάνονται πληροφορίες για το μοριακό βάρος και άλλες παραμέτρους των υπό εξέταση μακρομορίων. Η οριακή ταχύτητα που αποκτά το μόριο στη φυγόκεντρο υπολογίζεται από τον δεύτερο νόμο του Νεύτωνα με τη συνθήκη η συνισταμένη των δυνάμεων να είναι μηδέν: F α F f + FC = F α + F f + F C = 0 0 και επομένως η οριακή ταχύτητα που αποκτά το μόριο καθορίζεται από τη σχέση: ω rv(ρ ρ f 2 0 u = όπου ρ, ρ 0 οι πυκνότητες του μορίου και του διαλύματος αντίστοιχα και V ο όγκος του σωματιδίου. Στη φυγοκέντρηση χρησιμοποιείται ο όρος S=u/ω 2 r, ο οποίος ονομάζεται συντελεστής καθίζησης και μετριέται σε μονάδες χρόνου, s. Συνήθως ο συντελεστής καθίζησης εκφράζεται σε μονάδες S (απότοόνοματουερευνητήπου μελέτησε το θέμα αυτό, του Svedberg). Ητιμή10-13 s ορίζεται ως 1 S. )

7 Υπερφυγοκέντρηση (5) Ο συντελεστής S χαρακτηρίζει τις διάφορες πρωτεΐνες, έτσι για παράδειγμα αν τα μόρια της αιμοσφαιρίνης περιστρέφονται με γωνιακή ταχύτητα στροφές/λεπτό, σε ακτίνα περιστροφής r=10 cm, αποκτούν ταχύτητα u=1,6 mm/h και τότε ο συντελεστής καθίζησης έχει την τιμή 4,4 S ή 0.44 ps. Αν μια άγνωστη πρωτεΐνη στις ίδιες συνθήκες παρουσιάζει τον ίδιο συντελεστή S, χαρακτηρίζεται σαν αιμοσφαιρίνη. Ο ρυθμός καθίζησης του ολικού αίματος αυξάνεται σε οξείες μολύνσεις και σε μερικές χρόνιες παθήσεις (π.χ. φυματίωση). 100 πλάσμα 60 λευκά κύτταρα 0 ερυθρά κύτταρα Κατανομή των συστατικών του αίματος σε σωλήνα φυγοκέντρησης. Το ύψος της στήλης των ερυθρών κυττάρων, ως ποσοστό του όλου ύψους του σωλήνα φυγοκέντρησης, εκφράζει τον αιματοκρίτη.

8 Φυσικές μέθοδοι μελέτης βιολογικών φαινομένων: Ηλεκτροφόρηση Η ηλεκτροφόρηση είναι μια μέθοδος διαχωρισμού φορτισμένων ουσιών, κύρια πρωτεϊνών. Κατά την ηλεκτροφόρηση, ηλεκτρικά φορτισμένα μακρομόρια μεταναστεύουν προς τον ένα ή τον άλλο πόλο ενός ηλεκτρικού πεδίου. Η μέθοδος αυτή εφαρμόζεται ευρύτατα για το διαχωρισμό, απομόνωση και ανάλυση των πρωτεϊνικών μιγμάτων και ιδιαίτερα σε κλινικές αιματολογικές εξετάσεις. Είναι μια κλασσική εργαστηριακή μέθοδος ανάλυσης τόσο στη βιοϊατρική έρευνα, αλλά, κυρίως, στην καθημερινή κλινική πράξη. Electrophoresis

9 Ηλεκτροφόρηση (2) Οι πρωτεΐνες σε διάλυμα παρουσιάζονται ιονισμένες χάρη κυρίως στις ομάδες - COO - και -NH 3+ των αμινοξέων και αυτή η ηλεκτρική συμπεριφορά εξαρτάται βέβαια από τη χημική τους σύσταση, αλλά επίσης και από το ph του διαλύματος. Οι δυνάμεις που ασκούνται στη φορτισμένη πρωτεΐνη (την οποία υποθέτουμε σφαιρική) είναι: Η δύναμη Coulomb, F e, λόγω ηλεκτρικού πεδίου έντασης E σε φορτίο q, F e =qe. Η δύναμη τριβής (νόμος Stokes), F f, η οποία ασκείται σε μόριο ακτίνας R, που βρίσκεται σε υγρό με συντελεστή ιξώδους η, F f =6πηRu. Η δύναμη του πεδίου βαρύτητας, F g =mg. Η δύναμη βαρύτητας θεωρείται αμελητέα και επομένως για ομαλή κίνηση του μορίου πρέπει: F e =F f και άρα qe=6πηru Από τα παραπάνω συνάγεται η ταχύτητα με την οποία κινούνται τα μόρια, έχοντας καθαρό φορτίο q, σ' ένα ηλεκτρικό πεδίο έντασης Ε: u = qe 6πηR

10 Ηλεκτροφόρηση (3) Η ηλεκτροφόρηση μπορεί να γίνει είτε σε αέρια ή σε υγρή φάση, η οποία είναι και η πλέον διαδεδομένη και γίνεται με διάφορους τρόπους: ηλεκτροφόρηση σε στήλη υγρού, σε χαρτί διηθητικό, σε συνήθη τάση, σε υψηλή τάση κ.α. Η ηλεκτροφόρηση ανήκει στα ηλεκτροκινητικά φαινόμενα των βιολογικών υγρών, παραλλαγές των οποίων φαινομένων είναι η ηλεκτρο-ώσμωση, η καθίζηση και η ροή υγρού μέσα από πορώδες διάφραγμα κ.ά.. Ηλεκτροκινητικά φαινόμενα εμφανίζουν τα βιολογικά μακρομόρια, τα κολλοειδή σωματίδια, καθώς και υποκυτταρικά σωματίδια και κύτταρα σε ηλεκτρολυτικό φυσιολογικό διάλυμα. Ως φυσιολογικό διάλυμα θεωρούμε το ισοτονικό προς κάποιο βιολογικό υγρό διάλυμα (π.χ. το πλάσμα του αίματος) όπου σε θερμοκρασία 37 ο C παρουσιάζει ph=7,2. Με ορισμένες ηλεκτροφορητικές τεχνικές μπορεί να προσδιορισθεί επίσης το μοριακό βάρος ή ο μοριακός όγκος ενός άγνωστου βιομορίου, γεγονός που έχει ιδιαίτερη ερευνητική αλλά και κλινική σημασία στην ανίχνευση π.χ. γενετικών ανωμαλιών του αίματος και άλλων παθολογικών καταστάσεων. Η ηλεκτροφόρηση χρησιμοποιείται και σε μεγάλη κλίμακα για βιομηχανικούς σκοπούς. Έτσι σήμερα, σε μεγάλες βιομηχανικές εγκαταστάσεις χρησιμοποιούνται τα λεγόμενα ηλεκτροστατικά φίλτρα καπνού ή αλλιώς ηλεκτροφορητικοί βιομηχανικοί θύλακες για την κατακράτηση στερεών σωματιδίων (π.χ. άνθρακα) και αποφυγή μόλυνσης του περιβάλλοντος.

11 Ηλεκτροφόρηση ένα παράδειγμα Ο ηλεκτροστατικός διαχωρισμός γίνεται πάντα σε πηκτή παρά σε υγρό, κυρίως για δύο λόγους. Κατ' αρχάς η πηκτή καταστέλλει τα ρεύματα που δημιουργούνται από μικρές βαθμιδώσεις θερμοκρασίας - απαραίτητη προϋπόθεση για σωστό διαχωρισμό. Δεύτερον η πηκτή λειτουργεί ως μοριακός ηθμός καθιστώντας έτσι ευκολότερους τους διαχωρισμούς των μορίων. Τα μόρια που είναι μικρά σε σχέση με τους πόρους της πηκτής μετακινούνται εύκολα δια μέσου της πηκτής, ενώ τα μεγάλα μόρια μένουν σχεδόν αμετακίνητα. Μόρια ενδιάμεσου μεγέθους μετακινούνται μέσα από την πηκτή σε διάφορες ταχύτητες. Οι πηκτές πολυακρυλαμιδίου είναι προτιμητέες για ηλεκτροφόρηση, γιατί αποτελούνται από χημικά ουδέτερες ενώσεις και σχηματίζονται εύκολα. Ισοηλεκτρικό σημείο μιας πρωτεΐνης καλείται εκείνο το ph για το οποίο η ηλεκτροφορητική κινητικότητα της πρωτεΐνης μηδενίζεται.

12 Ηλεκτροφόρηση - ένα παράδειγμα (συνέχεια) Οι πρωτεΐνες μπορούν να διαχωριστούν ηλεκτροφορητικά βάσει του σχετικού περιεχομένου τους σε όξινα και βασικά αμινοξέα. Το ισοηλεκτρικό σημείο (pι) μιας πρωτείνης είναι το ph όπου το ολικό φορτίο της είναι μηδέν. Σ' αυτό το ph, η ηλεκτροκινητικότητά της είναι μηδέν. Για παράδειγμα, το pι του κυτοχρώματος c μιας πολύ βασικής πρωτεΐνης -μεταφορέα ηλεκτρονίων είναι 10,6, ενώ της λευκωματίνης ορού, μιας όξινης πρωτεΐνης στο αίμα, είναι 4,8. Ας υποθέσουμε ότι ένα μείγμα πρωτεϊνών ηλεκτροφορείται σε μια διαβάθμιση ph σε πηκτή απουσία SDS. Κάθε πρωτεΐνη θα μετακινηθεί μέχρι να συναντήσει μια θέση στην πηκτή όπου το ph ισούται με το pι της πρωτεΐνης. Αυτή η μέθοδος διαχωρισμού πρωτεϊνών ανάλογα με το ισοηλεκτρικό τους σημείο λέγεται ισοηλεκτρικός εστιασμός. Η διαβάθμιση ph στην πηκτή σχηματίζεται με ηλεκτροφόρηση πρώτα των πολυαμφολυτών (μικρών - πολυφορτισμένων πολυμερών) που έχουν πολλές τιμές pι. Ο ισοηλεκτρικός εστιασμός μπορεί εύκολα να διαχωρίσει πρωτεΐνες που διαφέρουν σε pι, ακόμη και κατά 0,01 που σημαίνει ότι μπορούν να διαχωριστούν πρωτεΐνες που διαφέρουν και κατά ένα μόνο αρνητικό φορτίο.

13 DNA Forensics Problem Set 1 Problem 1: Southern hybridization technique DNA fingerprint analysis is based on the "Southern" hybridization technique. In this method: Tutorial DNA fingerprinting, also termed DNA profile analysis is based on the use of the "Southern" hybridization technique to analyze polymorphic regions of human DNA. Polymorphisms are explained in more detail in problem 5. The experimental steps used in a forensics laboratory for DNA profile analysis are as follows:

14 1. DNA extraction DNA can be extracted from almost any human tissue. Sources of DNA found at a crime scene might include blood, semen, tissue from a deceased victim, cells in a hair follicle, and even saliva. DNA extracted from items of evidence is compared to DNA extracted from reference samples from known individuals, normally from blood. 2. Digestion of DNA with a restriction endonuclease Extracted DNA is treated with a restriction endonuclease, which is an enzyme that will cut double stranded DNA whenever a specific DNA sequence occurs. The enzyme most commonly used for forensic DNA analysis is HaeIII, which cuts DNA at the sequence 5'-GGCC-3'. 3. Agarose gel electrophoresis Following DNA digestion, the resulting DNA fragments are separated by size via electrophoresis in agarose gels. During electrophoresis, DNAs which are negatively charged migrate toward the positive electrode. As DNA fragments move, their migration rate is slowed by the matrix of the agarose gel. Smaller DNA fragments move more rapidly through the pores of the gel matrix than larger DNA fragments. The result is a continuous separation of the DNA fragments according to size, with the smallest DNA fragments moving the greatest distance away from the origin.

15 5. Hybridization with radioactive probe 4. Preparation of a "Southern blot Following electrophoresis, the separated DNAs are denatured while still in the agarose gel by soaking the gel in a basic solution. Following neutralization of the basic solution, the single strand DNA molecules are transferred to the surface of a nylon membrane by blotting. This denaturation/blotting procedure is known as a "Southern blot" after the inventor, Edwin Southern. Just as the blotting of wet ink on a dry paper transfers a replica of the image to the paper, the blotting of DNA to a nylon membrane preserves the spatial arrangement of the DNA fragments that existed after electrophoresis. A single locus probe is a DNA or RNA sequence that is able to hybridize (i.e. form a DNA-DNA or DNA-RNA duplex) with DNA from a specific restriction fragment on the Southern blot. Duplex formation depends on complementary base pairing between the DNA on the Southern blot and the probe sequence. Single locus probes are usually tagged with a radioactive label for easy detection, and are chosen to detect one polymorphic genetic locus on a single human chromosome. The Southern blot from step 4 is incubated in a solution containing a radioactive, single locus probe under conditions of temperature and salt concentration that favor hybridization. After hybridization, the unbound probe is washed away, so that the only radioactivity remaining bound to the nylon membrane is associated with the DNA of the targeted locus.

16 6. Detection of RFLPs via autoradiography The locations of radioactive probe hybridization on the Southern blot are detected by autoradiography. In this technique, the washed nylon membrane is placed next to a sheet of X-ray film in a light tight container. The X-ray film records the locations of radioactive decay. After exposure and development of the X-ray film, the resulting record of the Southern hybridization is termed an "autoradiograph," or "autorad" for short. 7. Re-probe southern blot with additional probes In a typical forensics DNA analysis, DNA polymorphisms on several different chromosomes are characterized. After an autorad has been developed for the first single locus probe, the radioactivity on the Southern blot can be washed away with a high temperature solution, leaving the DNA in place. The Southern blot can be hybridized with a second radioactive single locus probe, and by repetition of steps 5-7, a series of different single locus probes. The set of autorads from a Southern blot is known as a "DNA profile."

17 Βιοπολυμερή (δομή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες Οι πρωτεΐνες αποτελούν δομικά και λειτουργικά συστατικά των κυττάρων και των ιστών. Οι πρωτεΐνες είναι μεγαλομοριακές ενώσεις, αποτελούμενες από αλληλουχία διαφόρων αμινοξέων ενωμένων μεταξύ τους με πεπτιδικό δεσμό Στη πρωτεϊνική δομή συμμετέχουν υδρογονικοί δεσμοί μεταξύ των πλευρικών αλυσίδων των αμινοξέων, μεταξύ των ατόμων υδρογόνου και οξυγόνου του πεπτιδικού δεσμού και μεταξύ ατόμων της πρωτεϊνικής επιφάνειας και του περιβάλλοντος νερού. Οι μη πολικές πλευρικές αλυσίδες των ουδέτερων αμινοξέων συνδέονται με υδρόφοβες ομάδες.

18 Secondary structure: the a-helix hemoglobin

19 Lysozyme; the second protein structure and the first enzyme (1965)

20 Ο ρόλος των πρωτεϊνών είναι σημαντικός για όλες σχεδόν τις λειτουργίες των έμβιων συστημάτων. Η σημασία τους διαφαίνεται από τις παρακάτω λειτουργίες: Ενζυμική δράση. Όλα τα γνωστά ένζυμα-καταλύτες των βιοχημικών αντιδράσεων είναι πρωτεϊνικής φύσης. Συνήθως τα ένζυμα αυξάνουν την ταχύτητα κάποιων αντιδράσεων τουλάχιστον 10 6 φορές. Μηχανική στήριξη. Η μεγάλη αντοχή του δέρματος και των οστών οφείλονται στην παρουσία του κολλαγόνου, μιας πρωτεΐνης που σχηματίζει ίνες. Κίνηση - συστολή. Οι πρωτεΐνες είναι τα κύρια συστατικά των μυών, των οποίων η συστολή επιτυγχάνεται με την ολισθητική κίνηση δύο ειδών πρωτεϊνικών νηματίων, της ακτίνης και της μυοσίνης. Επίσης η κίνηση των χρωμοσωμάτων στη μίτωση και η μέσω μαστιγίων προώθηση του σπέρματος επιτυγχάνεται με συσταλτά πρωτεϊνικά συγκροτήματα. Μεταφορά και αποθήκευση. Οι πρωτεΐνες χρησιμεύουν στη μεταφορά μικρομορίων και ιόντων. Π.χ. η αιμοσφαιρίνη μεταφέρει οξυγόνο στα ερυθροκύτταρα και η μυοσφαιρίνη στους μυς. Η τρανσφερρίνη μεταφέρει σίδηρο στο πλάσμα του αίματος, ο οποίος αποθηκεύεται στο συκώτι σαν σύμπλοκο με φερριτίνη, μια άλλη πρωτεΐνη.

21 Έλεγχος της ανάπτυξης και διαφοροποίησης. Οι πρωτεΐνες χρησιμεύουν στην ελεγχόμενη έκφραση των γενετικών πληροφοριών, ουσιώδη διαδικασία για την κανονική ανάπτυξη και διαφοροποίηση των κυττάρων. Ρύθμιση λειτουργιών. Πολλές λειτουργίες ρυθμίζονται από ειδικές πρωτεΐνες, όπως π.χ. η όραση που ρυθμίζεται από τη ροδοψίνη (πρωτεΐνη-φωτοϋποδοχέας στα ραβδία του αμφιβληστροειδή), η μετάδοση των νευρικών παλμών που ρυθμίζεται από την ακετυλχολίνη κ.ά. Ανοσοπροστασία. Τα αντισώματα είναι πολύ ειδικές πρωτεΐνες που αναγνωρίζουν ξένους εισβολείς, όπως οι ιοί, τα βακτήρια και κύτταρα άλλων οργανισμών και προσδένονται σε αυτούς με σκοπό την εξουδετέρωση του εισβολέα.

22 Ταξινόμηση πρωτεϊνών με βάση τον βιολογικό τους ρόλο ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ ΑΝΤΙΠΡΟΣΩΠΕΥΤΙΚΑ ΕΙΔΗ Ένζυμα Καταλυτική δράση Οξειδοαναγωγάσες, τρανσφεράσες, υδρολάσες, λυάσες, ισομεράσες, λιγάσες Στηρικτικές Μηχανική στήριξη και σύνδεση ιστών Κολλαγόνο, ελαστίνη, κερατίνη, λιποπρωτεΐνη Συσταλτές Μυϊκές κινήσεις Μυοσίνη, ακτίνη Μεταφορικές Μεταφορά αδιάλυτων ή τοξικών ουσιών Αιμοσφαιρίνη, αλβουμίνες Γενετικές Ρύθμιση γονιδίων Ιστόνες, νουκλεοπρωτεϊνες Ρυθμιστικές ή ορμονικές Ρύθμιση λειτουργίας οργάνων, ιστών και αδένων Ινσουλίνη, γλυκαγόνη, ACTH Ανοσοπρωτεϊνες Ανοσολογική προστασία Ιντερφερόνη, γ-σφαιρίνες

23 Βιοπολυμερή (δομή και βιοφυσικές ιδιότητες) Περίθλαση ακτίνων - Χ Η ανακάλυψη της περίθλασης των ακτίνων - Χ από κρυστάλλους το 1912, από τον Max von Laue αρχικά και τους W.H. Bragg και W.L. Bragg στη συνέχεια, σημείωσε τη γέννηση της κρυσταλλογραφίας ακτίνων Χ. Σημαντικοί σταθμοί στην πορεία της βιοφυσικής έρευνας με τη βοήθεια αυτής της μεθόδου είναι οι ανακαλύψεις της δεκαετίας πάνω στη δομή σφαιρικών πρωτεϊνών (Perutz και συν., 1953), στη δομή του DNA (εργασίες των Wilkins και Franklin, στις οποίες βασίστηκαν οι Watson και Crick για να διατυπώσουν την περίφημη δομή της διπλής έλικας για το μόριο του DNA, το 1953). Η περίθλαση των ακτίνων - Χ έδωσε επίσης πολύτιμες πληροφορίες για τη δομή των ιών, ενώ σχετικά πρόσφατα η μέθοδος αυτή, σε συνδυασμό με την περίθλαση νετρονίων, έδωσε αποτελέσματα πάνω στη δομή των μεμβρανών και υποκυτταρικών σχηματισμών όπως τα ριβοσώματα και η χρωματίνη.

24 Η περίθλαση των ακτίνων - Χ ως βιοφυσική μεθοδολογία προσδιορισμού της δομής βιομορίων και βιολογικών δομών βασίζεται στις φυσικές αρχές της περίθλασης ηλεκτρομαγνητικών κυμάτων. Επειδή πολλά πρωτεϊνικά μόρια έχουν διαστάσεις μερικών δεκάδων Å και οι χημικέςομάδεςτουςέχουνδιαστάσειςμερικώνå, είναι φανερό ότι για να διακρίνουμε λεπτομέρειες της μοριακής δομής πρέπει να χρησιμοποιήσουμε ''φως'' με μήκος κύματος της τάξης του 1 Å, άρα ηλεκτρομαγνητικά κύματα ή σωματίδια που ισοδυναμούν με ηλεκτρομαγνητικό κύμα αυτού του μήκους κύματος. Οι ακτίνες -Χ, τα νετρόνια και τα ηλεκτρόνια, με επιμέρους πλεονεκτήματα και μειονεκτήματα, χρησιμοποιούνται στη μελέτη και αποτύπωση βιοδομών. Τα περιθλασίμετρα ακτίνων -Χ είναι συνήθως μεγάλες διατάξεις που περιλαμβάνουν μηχανικά μέρη για τον κατάλληλο προσανατολισμό των κρυστάλλων-δειγμάτων ως προς τη δέσμη των ακτίνων-χ, συστήματα καταγραφής των διαγραμμάτων περίθλασης (φωτογραφικά φιλμ ή απαριθμητές), καθώς και κατάλληλα υπολογιστικά συστήματα για υπολογισμούς και καταγραφή των ποσοτικών δεδομένων (π.χ. εντάσεις των ανακλώμενων δεσμών).

25 Βιοπολυμερή (δομή και βιοφυσικές ιδιότητες) Ο προσδιορισμός της τρισδιάστατης δομής ενός βιολογικού μακρομορίου είναι ένα πολύ δύσκολο πρόβλημα. Ενδεικτικά αναφέρουμε τα διάφορα στάδια για τη ''λύση'' της δομής μια πρωτεΐνης: Απομόνωση - καθαρισμός: Στο στάδιο αυτό επιδιώκεται η απομόνωση του μακρομορίου και η λήψη μιας καθαρής ποσότητας της τάξης των μg, στην οποία βρίσκονται ίδια μακρομόρια. Κρυστάλλωση: Στο στάδιο αυτό επιδιώκεται η κρυστάλλωση του μακρομορίου, π.χ. της πρωτεΐνης, γιαναληφθούνδιαγράμματαπερίθλασης πολύ καλής ποιότητας. Αυτό είναι ένα πολύ δύσκολο στάδιο, γιατί κάθε πρωτεΐνη παρουσιάζει ιδιαιτερότητες και απαιτούνται πολλές προσπάθειες μέχρι να επιτευχθεί η βέλτιστη κρυστάλλωση (μικρή διάσταση κρυστάλλου, απουσία ''προσμίξεων'' ή άλλων ελαττωμάτων στο πλέγμα). Στο στάδιο αυτό παρασκευάζονται και παράγωγα του μακρομορίου με ''βαριά'' άτομα, ισόμορφα της φυσικής δομής του κρυστάλλου.

26 Περίθλαση ακτίνων -Χ (συλλογή - καταγραφή διαγραμμάτων περίθλασης): Στο στάδιο αυτό καταγράφονται τα διαγράμματα περίθλασης των κρυστάλλων και τουλάχιστον δύο ισόμορφων παραγώγων τους, αρχίζοντας από χαμηλή διακριτική ικανότητα ( 5Å) και φθάνοντας σε καλύτερες τιμές διακριτικής ικανότητας της τάξης του μεγέθους των χημικών δεσμών ( 2Å). Παραγωγή χαρτών ηλεκτρονικής πυκνότητας: Στο στάδιο αυτό γίνεται πρώτα ο προσδιορισμός των ηλεκτρονικών πυκνοτήτων με τη βοήθεια της ανάλυσης Fourier και υπολογιστή. Έπειτα γίνεται η αναπαράσταση σε χώρους δύο και τριών διαστάσεων των ηλεκτρονικών πυκνοτήτων που έχουν υπολογισθεί (χάρτης ηλεκτρονικής πυκνότητας) που δίνει μια στερεοσκοπική άποψη του μακρομορίου. Ερμηνεία των χαρτών - βελτίωση της δομής: Στο στάδιο αυτό συνδυάζονται οι πληροφορίες που δίνει ο χάρτης ηλεκτρονικής πυκνότητας με αυτές της δευτεροταγούς και πρωτοταγούς δομής του μακρομορίου για να κατασκευαστεί ένα ατομικό ή μοριακό μοντέλο. Στη συνέχεια ακολουθούν διορθώσεις της δομής, με διαδοχικές συσχετίσεις με διάφορους συντελεστές ακριβείας, που καταλήγουν στη βελτίωση της προτεινόμενης δομής. Η αύξηση της υπολογιστικής ικανότητας των σύγχρονων ηλεκτρονικών υπολογιστών έχει συμβάλλει θεαματικά στην επιτάχυνση των διαδικασιών ερμηνείας - βελτίωσης της δομής μακρομορίων και στην ανάπτυξη ευκολότερου στη χρήση λογισμικού για την τεχνική της περίθλασης των ακτίνων -Χ σεβιοδομές.

27

28 ΚΡΥΣΤΑΛΛΩΣΗ ΠΡΩΤΕΙΝΩΝ Η κρυστάλλωση των πρωτεϊνών είναι βιοχημική τεχνική που αρχικά χρησιμοποιήθηκε για την απομόνωση και τον έλεγχο καθαρότητας των πρωτεϊνών, καθώς η μικροκρυσταλλικότητα των μορίων είναι ένδειξη καθαρότητάς τους. Τα τελευταία χρόνια η χρήση της κρυστάλλωσης για το σκοπό αυτόν έχει εγκαταλειφθεί καθώς οι κρύσταλλοι μπορούν να περιέχουν μέχρι και 10% άλλες προσμίξεις. Για την δομική μελέτη μορίων με ακτίνες Χ η κρυστάλλωση του μορίου αποτελεί το πρωταρχικό βήμα. Τα πρώτα περιθλασιγράμματα ακτίνων-χ από κρυστάλλους πρωτεϊνών πάρθηκαν από κρυστάλλους πεψίνης από τους Bernal και Crowfoot (D.Hodgkin) το (Πηγή: Κυριακή Σ. Παύλου & Σταύρος Ι. Χαμόδρακας, Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας Πανεπιστήμιο Αθηνών)

29 Βιοπολυμερή (δομή και βιοφυσικές ιδιότητες) Τα βιολογικά μακρομόρια ως πολυμερή αμινοξικών καταλοίπων ή νουκλεοτιδίων διπλώνονται σε τριτοταγή και τεταρτοταγή δομή κυρίως λόγω αλληλεπιδράσεων Van der Waals, διπόλου-διπόλου, δεσμών υδρογόνου (C-O... H-N), γεφυρών S-S και περιστασιακά λόγω γεφυρών άλατος μεταξύ φορτισμένων αμινοξικών καταλοίπων (-COO H3N-). Οι υδατοδιαλυτές πρωτεΐνες διατάσσουν τις υδροφοβικές ομάδες τους προς τον πυρήνα εκθέτοντας τις υδρόφιλες ομάδες στην επιφάνεια, με αποτέλεσμα να θεωρούνται σαν πολυηλεκτρολύτες, ικανοί να διαλυτοποιηθούν στο νερό (πρωτικός πολικός διαλύτης). Η σταθερότητα των μακρομορίων στο διάλυμα βασίζεται στον ανταγωνισμό μεταξύ αλληλεπιδράσεων διαλύτη-διαλελυμένης ουσίας και ενδομοριακών αλληλεπιδράσεων που οδηγούν στην απόκτηση της τεταρτοταγούς δομής.

30 Η ισορροπία μεταξύ των αλληλεπιδράσεων που ελέγχουν την διαλυτότητα και/ή την διαμόρφωση των πρωτεϊνών στον χώρο τροποποιείται από τους παρακάτω παράγοντες: α) θερμοκρασία: αύξηση της θερμοκρασίας,προκαλεί αύξηση της αταξίας των διαλελυμένων μορίων αλλά επίσης επιτρέπει μακρομοριακές διευθετήσεις υψηλότερης ελεύθερης ενέργειας. β) ph: Αλλαγές του ph επηρεάζουν τόσο τον διαλύτη όσο και την διαλελυμένη ουσία γ) Αλάτια: δρουν με διαφόρους τρόπους: (i) Είναι υπεύθυνα για την ιοντική ισχύ και επηρεάζουν τις μακρομοριακές ηλεκτροστατικές αλληλεπιδράσεις. Η άπωση μεταξύ ηλεκτρολυτών του ιδίου φορτίου μειώνεται. (ii) Μπορούν να σχηματίζουν απ ευθείας αλληλεπιδράσεις με φορτισμένα αμινοξικα κατάλοιπα (αργινίνη, λυσίνη ασπαρτικο, γλουταμικο) στην επιφάνεια των πρωτεϊνών (iii) Δρουν με διπολικές-μονοπολικές αλληλεπιδράσεις με τις διπολικές ομάδες των μακρομορίων (πεπτιδικοί δεσμοί, αμινο, υδροξυ, καρβοξυλικές ομάδες και αμίδια) και μπορούν να οδηγήσουν.σε μερική αποδιάταξη της πρωτεΐνης). (iv) Σχηματίζουν μη πολικές αλληλεπιδράσεις μεταξύ των υδροφοβικών καταλοίπων εκτεθειμένων στο διαλύτη και των υδροφοβικών τμημάτων των οργανικών αλατιών (σουλφονικών, καρβοξυλικών, αμμωνιακών ).

31 δ) Ανταγωνιστές δεσμών υδρογόνου. Μόρια όπως η ουρία, το φορμαμιδία, τα γουανιδινικά αλάτια σε υψηλές συγκεντρώσεις (>=4 Μ) ανταγωνίζονται τους δεσμούς υδρογόνου των μορίων του νερού και τους ενδομοριακούς δεσμούς υδρογόνου της πρωτεΐνης δρώντας σαν αποδιατακτικοί παράγοντες, ενώ στην αντίθετη περίπτωση σταθεροποιούν τους υδροφοβικούς δεσμούς. ε) Οργανικοί διαλύτες: Τροποποιούν την διηλεκτρική σταθερά και έτσι προκαλούν αλλαγές σε διάφορες αλληλεπιδράσεις. Οι αλληλεπιδράσεις που κρατούν τις πρωτεΐνες στο κρυσταλλικό πλέγμα ονομάζονται κρυσταλλικές επαφές και είναι ίδιες σε κάθε οργανωμένη βασική μονάδα μορίων που περιέχεται στην στοιχειώδη κυψελίδα του κρυσταλλικού πλέγματος.

32 Δεσοξυριβοζονουκλεϊνικό οξύ (DNA) Το DNA είναιτοχημικόμόριοστοοποίοέχειαποτυπωθείογενετικόςκώδικας τωνέμβιωνόντων. Το DNA είναι ένα μεγάλου μήκους, υπό μορφή διπλής έλικας, μεγαλομόριο πολυδεσοξυριβοζονουκλεοτιδίων. Κάθε μόριο δεσοξυριβοζο-νουκλεοτιδίου αποτελείται από τρία τμήματα: την αζωτούχο βάση (τύπου πουρίνης ή πυριμιδίνης), ένα σάκχαρο (δεσοξυριβόζη) και ένα φωσφορικό οξύ. Το DNA περιέχει 4 είδη αζωτούχων βάσεων: την αδενίνη (Α) και τη γουανίνη (G) (πουρίνες διπλής αλυσίδας), τη θυμίνη (Τ) και την κυτοσίνη (C) (πυριμιδίνες απλής αλυσίδας). Το 1953, o J. Watson και ο F. Crick πρότειναν μια τρισδιάστατη δομή του DNA βασισμένη σε πρότυπα που ανέπτυξαν ως αποτέλεσμα ανάλυσης φασμάτων ακτίνων -Χ ινώνdna ο M. Wilkins και η R. Franklin.

33

34 Το DNA περιέχει 4 είδη αζωτούχων βάσεων: την αδενίνη (Α) και τη γουανίνη (G) (πουρίνες διπλής αλυσίδας), τη θυμίνη (Τ) και την κυτοσίνη (C) (πυριμιδίνες απλής αλυσίδας).

35 Σύμφωνα με το μοντέλο της ''διπλής έλικας'', το μόριο του DNA αποτελείται από δυο αντιπαράλληλους κλώνους που περιελίσσονται γύρω από έναν κοινό άξονα. Το ''βήμα'' της έλικας είναι 34 Å και έχει 10 νουκλεοτίδες. Κάθε κλώνος του DNA αποτελείται από την εναλλαγή των τεσσάρων βάσεων, διαταγμένων με συγκεκριμένη σειρά κατά μήκος του κάθε κλώνου. Οι ''οδηγίες'' για την αναπαραγωγή των κυττάρων βρίσκονται κωδικοποιημένες στη διαδοχή των βάσεων, το αλφάβητο της ζωής! Δηλαδή η γενετική πληροφορία αποτελείται από ''μηνύματα'' γραμμένα στο αλφάβητο των 4 γραμμάτων: Α C G T (σύμβολα των αζωτούχων βάσεων του DNA). Μια σειρά μερικών χιλιάδων βάσεων αποτελεί ένα γονίδιο και κάθε μόριο DNA περιλαμβάνει χιλιάδες γονίδια. Ένα συγκεκριμένο γονίδιο καθορίζει την αντίστοιχη δομή μιας ειδικής πρωτεΐνης, ή τμήματος πρωτεΐνης.

36 Πριν από τη διαίρεση ενός κυττάρου, η οποία θα οδηγήσει σε δυο θυγατρικά κύτταρα, τα μόρια του DNA του κυττάρου - γονέα διπλασιάζονται έτσι, ώστε τα θυγατρικά κύτταρα να έχουν από ένα πλήρες set γονιδίων. Δηλαδή τα μόρια του DNA αυτοαντιγράφονται. Κατά μέσο όρο υπάρχουν κύτταρα στο σώμα ενός ανθρώπου και, με μερικές εξαιρέσεις, το καθένα τους περιέχει ένα τέλειο αντίγραφο του DNA αυτού του ανθρώπου, ίδιο με αυτό του αρχικού κυττάρου της γονιμοποίησης.

37

38

39 Η κυτταρική μεμβράνη Tο κύτταρο και τα οργανίδια του (π.χ. ο πυρήνας, τα μιτοχόνδρια, οι χλωροπλάστες) χωρίζονται από το περιβάλλον τους και επικοινωνούν με αυτό με μεμβράνες (με το γενικό όνομα βιολογικές μεμβράνες) που επιτελούν σπουδαίο ρόλο στην εξέλιξη της ζωής. To κύτταρο έχει πολλές μεμβράνες, την εξωτερική που ονομάζεται πλασματική μεμβράνη και εσωτερικές: στο ενδοπλασματικό δίκτυο, στα μιτοχόνδρια, τους χλωροπλάστες κ.λ.π. Οι μεμβράνες εξυπηρετούν και δομικούς αλλά και λειτουργικούς σκοπούς στο κύτταρο (διαχωριστικές επιφάνειες, ρύθμιση διαπερατότητας ιόντων και μορίων, αγωγή νευρικού παλμού και διάδοση πληροφορίας από και προς το κύτταρο, μετατροπή φωτός σε βιοχημική ενέργεια, μορφογένεση, αναγνώριση προτύπων κ.λ.π.). Ταυτόχρονα, οι μεμβράνες αποτελούν συνήθως και τον πρωταρχικό στόχο στην εισβολή βακτηρίων και ιών, στη δράση χημικών και φαρμακευτικών ουσιών, καθώς και στην έκθεση σε φυσικούς παράγοντες του περιβάλλοντος κόσμου.

40 Συνοπτικά, ο ρόλος τους είναι ιδιαίτερα σημαντικός στις εξής τέσσερις κύριες διεργασίες: Μετατροπή ενέργειας, Μεταφορά ύλης, Μετάδοση σήματος, Επεξεργασία πληροφορίας. Σύνθεση και αρχιτεκτονική δομή των μεμβρανών Στη σύνθεση όλων των κυτταρικών μεμβρανών συμμετέχουν, σε διαφορετικό ποσοστό, τα εξής κύρια συστατικά: πρωτεΐνες, λιπίδια, υδρογονάθρακες, γλυκοπρωτεΐνες, λιποπρωτεΐνες, ιόντα και νερό. Ο τρόπος με τον οποίο συντάσσονται τα επιμέρους συστατικά των μεμβρανών για να σχηματίσουν τη χωρική δομή της μεμβράνης των έμβιων συστημάτων, προϋποθέτει την ύπαρξη μιας λιπιδικής διπλοστοιβάδας στη δομήόλωντωνβιολογικώνμεμβρανών, που ταιριάζει με τη χαρακτηριστική θερμοδυναμική σταθερότητα τους. Οι λιπιδικές διπλοστοιβάδες είναι αυτοσυναρμολογούμενες δομές, επίπεδες ή σφαιρικές (λιποσώματα) και έχουν χρησιμοποιηθεί μέχρι σήμερα σε ποικίλες βιο-εφαρμογές.

41 Η βασική δομή όλων των βιολογικών μεμβρανών είναι ενιαία και αποτελείται σχηματικά από ένα βασικό πλέγμα φωσφολιπιδίων, τα οποία είναι διατεταγμένα σε διπλοστοιβάδα, με τις πολικές κεφαλές προς την εξωτερική υδατική φάση και τις υδρόφοβες λιπαρές αλυσίδες προς το εσωτερικό. Βυθισμένες σε αυτό το λιπιδικό πλέγμα με τυχαία κατανομή βρίσκονται οι πρωτεΐνες. Άλλες είναι βυθισμένες στο εσωτερικό της μεμβράνης, άλλες διαχέονται παράλληλα με την επιφάνεια της μεμβράνης (περιφερειακές) και άλλες διασχίζουν τη φωσφολιπιδική διπλοστοιβάδα (διαμεμβρανικές), σχηματίζοντας με αυτόν τον τρόπο ένα μωσαϊκό, το οποίο όμως δεν είναι άκαμπτο αλλά δυναμικά «ρευστό». Με τον όρο μεμβράνη δεν εννοούμε μόνο τη δομική οργάνωση στο χώρο αλλά και τη δυναμική της, δηλαδή: Τις διάφορες γρήγορες δομικές διαταράξεις που μπορούν να συμβούν μέσα στη μεμβράνη (ρευστό μωσαϊκό), Την αλλαγή της σύστασης της μεμβράνης υπό την επίδραση εξωτερικών διεγέρσεων, Τη συμμετοχή των πρωτεϊνών και των φωσφολιπιδίων της μεμβράνης στην ανακύκλωση των μορίων μέσα στο κύτταρο.

42

43 Bi-phasic hydrophilic / hydrophobic arrangements water in liquid oil: emulsion monolayer separating water and oil micelle bilayer Bilayered vesicle (liposom)

44 Οι κύριες δυνάμεις που προσδιορίζουν την οργάνωση της μεμβρανικής δομής είναι δυνάμεις ηλεκτροστατικής υφής (ανάμεσα σε ιόντα) και δυνάμεις Van der Waals (υδρόφοβες/υδρόφιλες αλληλεπιδράσεις και δεσμοί υδρογόνου στο υδάτινο περιβάλλον της κυτταρικής μεμβράνης). Οι κυτταρικές μεμβράνες έχουν πάχη που ποικίλλουν από 50 έως 90 Å. Πρώτοι οι Fricke και Hober στις αρχές του 20 ου αιώνα υπολόγισαν το πάχος της κυτταρικής μεμβράνης, αφού μέτρησαν πειραματικά την ηλεκτρική αγωγιμότητα και τη χωρητικότητα αιωρήματος ερυθροκυττάρων σε ισοτονικό διάλυμα. Ο Fricke προσδιόρισε τη χωρητικότητα (C m ) των ερυθρών σε 0.81 μf/cm 2 και, υποθέτοντας τιμές της διηλεκτρικής σταθεράς (ε) των βιομεμβρανών ίσες με 3 και 10, υπολόγισε το πάχος τους σε 3,3 nm και 11,0 nm αντίστοιχα, εφαρμόζοντας τη σχέση της χωρητικότητας επίπεδου πυκνωτή: όπου d το πάχος της μεμβράνης. C m = ε/4πd,

45 Τα μόρια των φωσφορολιπιδίων μπορούν να μετακινούνται, οριζόντια, αλλάζοντας θέση, και κάθετα, μεταπηδώντας από τη μια στιβάδα στην άλλη. Διαρκή κίνηση παρουσιάζουν και τα υπόλοιπα συστατικά μόρια, της μεμβράνης. Έτσι η κυτταρική μεμβράνη χαρακτηρίζεται ότι βρίσκεται σε ρευστή (υγρή) και όχι στατική (στερεή) κατάσταση.

46 Φαινόμενα μεταφοράς μέσω των κυτταρικών μεμβρανών Η διαβατότητα ή εκλεκτική διαπερατότητα της βιολογικής μεμβράνης είναι μια από τις σπουδαιότερες ιδιότητες αυτής της βιολογικής δομής. Ανάλογα με το μέγεθος των μεταφερομένων ουσιών, διακρίνουμε δυο κύριους τρόπους μεταφοράς ουσιών μέσω των κυτταρικών μεμβρανών, τη μικρομεταφορά και τη μακρομεταφορά. Η μικρομεταφορά αναφέρεται στη μεταφορά μικροσωματιδίων μέσω της μεμβράνης, όπως τα ιόντα, τα μικρομόρια, το νερό. Η μακρομεταφορά αναφέρεται στη μεταφορά κάποιων μοριακών συμπλεγμάτων, στερεών ή υγρών, όπως στην περίπτωση της φαγοκύττωσης ή της κυτταροφαγία ή φαγοκύττωση οδηγεί στον εγκλωβισμό, μεγάλων σχετικά, στερεών σωματιδίων που επιτυγχάνεται με προεκτάσεις του πρωτοπλάσματος (ψευδοπόδια) που αγκαλιάζουν το σωματίδιο και ενώνονται πίσω του, φέρνοντάς το έτσι στο εσωτερικό του κυτταροποσία ή πινοκύττωση οδηγεί στον εγκλωβισμό μικροσκοπικών σταγόνων υγρού, στο οποίο αιωρούνται σωματίδια και μακρομόρια. Αυτά τα σωματίδια προσκολλώνται στην επιφάνεια του κυττάρου, η οποία εγκολπώνεται και τα ''καταπίνει''.

47 Mεταφορά με ενδοκυττάρωση/εξωκυττάρωση Υλικάαπότονεξωκυττάριοχώροκαθώςεπίσηςκαιαπότηνέξωεπιφάνειατηςμεμβράνης, μπορούν να ενσωματωθούν μέσα στο κύτταρο με μια εγκόλπωση που συμβαίνει στην επιφάνεια του κυττάρου, με ένα μηχανισμό ο οποίος ονομάζεται ενδοκυττάρωση. Το τμήμα της κυτταρικής μεμβράνης εγκολπούμενο, συνενώνεται στα δύο άκρα του και δημιουργεί ένα ενδοκυτταρικό κυστίδιο ή όπως αλλιώς λέγεται, ένα ενδόσωμα, που είναι ένα μικρό, σφαιρικό σωματίδιο το οποίο περιβάλλεται από μεμβράνη. Το υλικό που έχει εγκλειστεί μέσα σε ένα τέτοιο κυστίδιο, στη συνέχεια μπορεί να υποστεί επεξεργασία μέσα στο κύτταρο. Η εξωκυττάρωση είναι μηχανισμός αντίστροφος της ενδοκυττάρωσης και περιγράφει τη συνένωση ενός κυστιδίου που περιβάλλεται από μεμβράνη, με την επιφανειακή κυτταρική μεμβράνη με σκοπό την απέκκριση του περιεχομένου του στο γύρω εξωκυττάριο χώρο. Αυτή η συνένωση των δύο μεμβρανών έχει επίσης σαν αποτέλεσμα την ενσωμάτωση ενός νέου μεμβρανικού τμήματος στην επιφάνεια του κυττάρου.

48 Η απλούστερη διαδικασία μικρομεταφοράς, με την οποία μόρια ύλης διαπερνούν τη μεμβράνη, είναι η ελεύθερη διάχυση. Ο ρυθμός διάχυσης είναι συνάρτηση της διαλυτότητας των μορίων στα λιπίδια, που εκφράζεται με το λόγο της συγκέντρωσης της ουσίας στα λίπη ως προς την αντίστοιχη συγκέντρωση στο νερό (C λίπη / C νερό ). Για ουσίες που δεν διαλύονται στα λιπίδια (π.χ. Na +, K +, Cl -, γλυκόζη, αμινοξέα κ.ά), ο ρυθμός διάχυσης είναι συνάρτηση του μεγέθους των μορίων συγκρινόμενου με αυτό των ''πόρων'' της μεμβράνης. Όλα τα παραπάνω (ελεύθερη διάχυση, διάλυση μορίων στα λιπίδια, διέλευση μικρών ουσιών από πόρους) συνιστούν διαδικασίες παθητικής μεταφοράς μορίων μέσα από τη μεμβράνη, χωρίς κατανάλωση ενέργειας.

49 Σε πολλές περιπτώσεις η ανταλλαγή ύλης με το περιβάλλον της κυτταρικής μεμβράνης γίνεται με ενεργό μεταφορά ουσιών ήκαιμεδιευκολυνόμενη διάχυση. Με διευκολυνόμενη διάχυση μεταφέρονται μόρια που δεν μπορούν να περάσουν μέσα από ιοντικά κανάλια, ούτε και από το στρώμα των λιπιδίων (μη λιποδιαλυτά μόρια), όπως είναι π.χ. ορισμένα σάκχαρα απαραίτητα στο μεταβολισμό του κυττάρου. Τα μόρια που αναλαμβάνουν ρόλο ''μεσάζοντα'' στη διευκολυνόμενη διάχυση λέγονται ιονοφόρα και παίζουν το ρόλο τους είτε σαν μεταφορείς αυτοί καθαυτοί, είτε σχηματίζοντας προσωρινούς πόρους για να περάσουν ουσίες.

50 Τα ιονοφόρα δρουν με έναν από τους παρακάτω τρόπους: α) παραλαμβάνουν κατιόντα από το εξωτερικό περιβάλλον της μεμβράνης και, παρέχοντας τους ένα υδροφοβικό κάλυμμα, τα μεταφέρουν και τα αποθέτουν στο εσωτερικό, β) δημιουργούν ''κανάλια'' στη μεμβράνη μέσα από τα οποία περνούν εκλεκτικά τα κατάλληλα ιόντα. Ένα παράδειγμα ιονοφόρου μεταφορέα είναι η βαλινομυκίνη (valinomycin), η οποία ''ενσωματώνεται'' στην κυτταρική μεμβράνη, λόγω των υδρόφοβων απολήξεων του μορίου της, αυξάνοντας σημαντικά την ταχύτητα μεταφοράς των ιόντων K +. Ένα μόνο μόριο βαλινομυκίνης διευκολύνει την (παθητική) διάχυση των ιόντων K + έτσι, ώστε ηταχύτηταδιάχυσηςναφθάνειτα10 4 K + /s. Ένα άλλο παράδειγμα ιονοφόρου μορίου είναι ένα αντιβιοτικό, η γραμισιδίνη Α (gramicydin A), το οποίο ''ενσωματώνεται'' στη λιπιδική διπλοστοιβάδα αυξάνοντας σημαντικά την ηλεκτρική αγωγιμότητα της μεμβράνης, μέσω της δημιουργίας πόρων, πολύ επιλεκτικών στη διαπερατότητα ιόντων Να +. Η ροή ιόντων Να + ανά πόρο γραμισιδίνης φθάνει τα 10 7 Να + /s. Τα ιονοφόρα-μεταφορείς ιόντων είναι κυρίως αντιβιοτικά ή ουσίες βακτηριακής προέλευσης (π.χ. τοξίνες βακτηρίων), που ανταγωνίζονται τη δράση άλλων, βλαβερών, μικροοργανισμών (βακτήρια, βάκιλοι) διαταράσσοντας τις μεμβρανικές λειτουργίες τους.

51

52 Ιονοφόρα Η Βαλινομυκίνη είναι ιονοφόρο για το Κ + (Valinomycin is a carrier for K + ). Puckering of the ring, stabilized by H- bonds, allows valinomycin to closely surround a single unhydrated K + ion. Six oxygen atoms of the ionophore interact with the bound K +, replacing O atoms of waters of hydration. Valinomycin is highly selective for K+ relative to Na +. H 3 C CH 3 CH O N CH C O H C H H 3 C Valinomycin CH O C N H CH 3 H 3 C H C O CH CH 3 CH 3 C O CH L-valine D-hydroxy- D-valine L-lactic isovaleric acid acid O C 3 The smaller Na + ion cannot simultaneously interact with all 6 oxygen atoms within valinomycin. Thus it is energetically less favorable for Na + to shed its waters of hydration to form a complex with valinomycin. Whereas the interior of the valinomycin-k + complex is polar, the surface of the complex is hydrophobic. This allows valinomycin to enter the lipid core of the bilayer, to solubilize K + within this hydrophobic milieu.

53 Η ενεργός μεταφορά πραγματοποιείται με ταυτόχρονη κατανάλωση ενέργειας, η οποία προέρχεται από τον μεταβολισμό των τροφών και βρίσκεται αποθηκευμένη στο μόριο της τριφωσφορικής αδενοσίνης (ΑΤΡ). Η διευκολυνόμενη διάχυση γίνεται με τη βοήθεια φορέων, δηλαδή πολύ ειδικών πρωτεϊνών. Κάθε μια από τις πρωτεΐνες-φορείς μπορεί να αντιδράσει μόνο με μια ειδική χημική ομάδα της ουσίας που διαχέεται και, τελικά, μετά την πρόσκαιρη αυτή σύνδεση, η ουσία αποδίδεται στην άλλη πλευρά της μεμβράνης και ο φορές παραμένει ανέπαφος. Τομή λιποσώματος όπου διακρίνονται τα σημεία εγκλωβισμού, λιπόφιλων και υδρόφιλων μορίων, και οι τροποποιήσεις που μπορούν να γίνουν στην επιφάνειά του.

54 Figure 1. Working models of the cell after the Second World War. Upper left: for biophysicists it was enough to assume that the only relevant feature of the cell is its plasma membrane containing specific translocating mechanisms. The cytoplasm was supposed to be a well-stirred solution where diffusion coefficients have an infinite value, activities were identical to concentrations, and the nucleus as well as other organelles were not taken into consideration. Upper right: Gilbert N. Ling disregarded the membrane as the seat of translocating mechanisms. He considered that the cytoplasm is an entangled mesh of macromolecules with enough fixed electric charges and hydrogen binding sites to insure that water and ions would not be entirely free. Bottom left: cell biologists observed that the cell contains densely packed organelles, such as the nucleus, endoplasmic reticulum, Golgi apparatus, lysosomes, endosomes, peroxisomes, mitochondria, microfilaments, microtubes and shuttling vesicles. Bottom center: biochemists demonstrated that different organelles have different molecular species, membranes have domains, and proteins have different life spans. Bottom right: physiologists study the mechanisms and signals that enable a given protein species to move through a labyrinth of organelles, and travel from the point of synthesis to very specific targets. Από το άρθρο: «Membrane targeting, M. Cereijido, R. G. Contreras, L. Shoshani and M. R. García-Villegas, Progress in Biophysics and Molecular Biology, Vol. 81, Issue 2, February 2003, Pages

55 Βιβλιογραφία ''Θέματα Μοριακής Βιοφυσικής'', Στ. Χαμόδρακα, Εκδόσεις Συμμετρία, Biophysique, M. Volkenstein, (στα γαλλικά) (Editions Mir, Moscou), Medical Instrumentation Application and Design, J.G. Webster, (John Wiley and Sons, Inc.), Biophysics and biochemistry at low temperatures, F. Franks, (Cambridge University Press), "Crystallization of Nucleic Acids and Proteins. A Practical Approach" (1992) A.Ducruix and R.Giege, Oxford University Press, Oxford-New York-Tokyo. 3. "Protein Crystallography" (1976) Blundell, T.L. & Johnson, L.N., Academic Press, London-New York-San Francisco. "Ο ρόλος των μειωτών ισχύος στη διαλυτότητα των βιομορίων στα μικτά υδατικά ηλεκτρολυτικά διαλύματα και εφαρμογές στη χρωματογραφία και στην κρυστάλλωση" (1995) Διδακτορική Διατριβή Ι.Παπανικολάου, Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης. Πολλές εικόνες σχήματα είναι από εκπαιδευτικό υλικό ή δημοσιεύσεις που διατίθενται ελεύθερα στο διαδίκτυο. Η ιστοσελίδα μου είναι στη διεύθυνση:

Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες

Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες Βιοπολυµερή (δοµή, λειτουργία και βιοφυσικές ιδιότητες) Πρωτεΐνες Οι πρωτεΐνες αποτελούν δοµικά και λειτουργικά συστατικά των κυττάρων και των ιστών. Οι πρωτεΐνες είναι µεγαλοµοριακές ενώσεις, αποτελούµενες

Διαβάστε περισσότερα

Φυσικές µέθοδοι µελέτης βιολογικών φαινοµένων

Φυσικές µέθοδοι µελέτης βιολογικών φαινοµένων Φυσικές µέθοδοι µελέτης βιολογικών φαινοµένων Υπερφυγοκέντρηση Η υπερφυγοκέντρηση χρησιµοποιείται πλατιά για το διαχωρισµό ή την µελέτη µακροµορίων, συµβάλλοντας κύρια στη γνώση της µορφής και του µοριακού

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2015 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Λέξεις-κλειδιά Κυτταρική ή πλασματική μεμβράνη... Βασικές ιδιότητες της πλασματικής μεμβράνης... Βασικές λειτουργίες

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Βιοϊατρική τεχνολογία

Βιοϊατρική τεχνολογία Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοϊατρική τεχνολογία Ενότητα 2: Βιοϊατρική Τεχνολογία - Biomedical Technology Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Νέα Οπτικά Μικροσκόπια

Νέα Οπτικά Μικροσκόπια Νέα Οπτικά Μικροσκόπια Αντίθεση εικόνας (contrast) Αντίθεση πλάτους Αντίθεση φάσης Αντίθεση εικόνας =100 x (Ι υποβ -Ι δειγμα )/ Ι υποβ Μικροσκοπία φθορισμού (Χρησιμοποιεί φθορίζουσες χρωστικές για το

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ

ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ ΜΑΘΗΜΑ: Τεχνολογία Μετρήσεων ΙΙ ΔΙΔΑΣΚΩΝ: Αν. Καθ. Δρ Μαρία Α. Γούλα ΤΜΗΜΑ: Μηχανικών Περιβάλλοντος & Μηχανικών Αντιρρύπανσης 1 Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ Διάχυση Η διάχυση είναι το κύριο φαινόμενο με το οποίο γίνεται η παθητική μεταφορά διαμέσου ενός διαχωριστικού φράγματος Γενικά στη διάχυση ένα αέριο ή

Διαβάστε περισσότερα

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg Αυγό Τα αυγά αποτελούνται από το κέλυφος (10 %), το ασπράδι ή λευκό (50-60 %), τον κρόκο ή κίτρινο (30 %). Το κέλυφος αποτελείται κατά 95 % από ανόργανα συστατικά όπως ανθρακικό ασβέστιο, ανθρακικό μαγνήσιο

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 2: Στοιχεία Μικροβιολογίας και Βιοχημείας των Βιομηχανικών Ζυμώσεων(1/5), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ 19-21 -10681 210 3824614 210 3847670 www.irakleitos.gr ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης.

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. (α) Να ονομάσετε τα

Διαβάστε περισσότερα

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ Θερινό εξάμηνο 2011 Ο ρόλος του νερού στο φυτό Βασικότερο συστατικό των ιστών

Διαβάστε περισσότερα

ΒΙΟΦΥΣΙΚΗ. Αναλυτική περιγραφή της ύλης

ΒΙΟΦΥΣΙΚΗ. Αναλυτική περιγραφή της ύλης Αναλυτική περιγραφή της ύλης ΒΙΟΦΥΣΙΚΗ Εισαγωγή (τι είναι Βιοφυσική, η σχέση της µε τις άλλες Φυσικές επιστήµες και τη Βιολογία, κλάδοι της Βιοφυσικής) υνάµεις - αλληλεπιδράσεις µεταξύ µορίων Το νερό και

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Η κίνηση του νερού εντός των φυτών (Soil-Plant-Atmosphere Continuum) Δημήτρης Κύρκας

Η κίνηση του νερού εντός των φυτών (Soil-Plant-Atmosphere Continuum) Δημήτρης Κύρκας Η κίνηση του νερού εντός των φυτών (Soil-Plant-Atmosphere Continuum) Δημήτρης Κύρκας Η Σεκόγια (Sequoia) «Redwood» είναι το ψηλότερο δέντρο στο κόσμο και βρίσκεται στην Καλιφόρνια των ΗΠΑ 130 μέτρα ύψος

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου Οργανική Χημεία Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου 1. Γενικά Δυνατότητα προσδιορισμού δομών με σαφήνεια χρησιμοποιώντας τεχνικές φασματοσκοπίας Φασματοσκοπία μαζών Μέγεθος, μοριακός τύπος

Διαβάστε περισσότερα

Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού. Πηκτώματα αγαρόζης / ακρυλαμιδίου

Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού. Πηκτώματα αγαρόζης / ακρυλαμιδίου Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού Πηκτώματα αγαρόζης / ακρυλαμιδίου Ηλεκτροφόρηση Μέθοδος διαχωρισμού και ανάλυσης μορίων DNA, RNA και πρωτεϊνών σύμφωνα με το μέγεθος και το φορτίο τους Η ιδέα να χρησιμοποιηθεί

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ. ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας

ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ. ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ Τμήμα Βιοχημείας κ Βιοτεχνολογίας ΑΝΝΑ-ΜΑΡΙΑ ΨΑΡΡΑ 1 ΣΥΣΤΗΜΑ ΧΡΩΜΑΤΟΓΡΑΦΙΑΣ Αντλία Στήλη Υγρό Έκλουσης Συλλέκτης κλασμάτων ΧΡΩΜΑΤΟΓΡΑΦΙΚΕΣ ΜΕΘΟΔΟΙ ΔΙΑΧΩΡΙΣΜΟΥ

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΑΓΙΟΥ ΣΠΥΡΙΔΩΝΑ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ

ΛΥΚΕΙΟ ΑΓΙΟΥ ΣΠΥΡΙΔΩΝΑ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ ΛΥΚΕΙΟ ΑΓΙΟΥ ΠΥΡΙΔΩΝΑ ΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕ ΠΡΟΑΓΩΓΙΚΕ ΕΞΕΤΑΕΙ ΦΥΙΚΗ ΚΑΤΕΥΘΥΝΗ Β ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 31-05-2012 ΔΙΑΡΚΕΙΑ: 07.45 10.15 Οδηγίες 1. Το εξεταστικό δοκίμιο αποτελείται από 9 σελίδες.

Διαβάστε περισσότερα

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ εσµός Υδρογόνου 1) Τι ονοµάζεται δεσµός υδρογόνου; εσµός ή γέφυρα υδρογόνου : είναι µια ειδική περίπτωση διαµοριακού δεσµού διπόλου-διπόλου,

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 04/06/2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ Α A1. γ A2. δ A3. α) Σ β) Λ

Διαβάστε περισσότερα

1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα

1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα 1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα Θεωρία 3.1. Ποια είναι τα δομικά σωματίδια της ύλης; Τα άτομα, τα μόρια και τα ιόντα. 3.2. SOS Τι ονομάζεται άτομο

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΗ ΣΧΟΛΗ ΑΓΡΙΝΙΟΥ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΕΤΟΣ ΣΠΟΥΔΩΝ 1ο Ζωολογία Δ. Ματθόπουλος 1 ΥΠΕΥΘΥΝΟΙ Από έδρας Δ. Ματθόπουλος Ζωολογία Δ. Ματθόπουλος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΥΣ ΚΑΘΗΓΗΤΕΣ κύριο ΚΕΦΑΛΛΩΝΙΤΗ ΓΙΑΝΝΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr

Διαβάστε περισσότερα

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 7 Το κυκλοφορικό μας σύστημα

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 7 Το κυκλοφορικό μας σύστημα jk ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 7 Το κυκλοφορικό μας σύστημα Εισαγωγή στο Κυκλοφορικό μας Σύστημα (ΚΣ) Το ΚΣ αποτελείται από - τα αιμοφόρα αγγεία την καρδιά Αέρας που εισπνέουμε Αέρας που εκπνέουμε

Διαβάστε περισσότερα

Η ανόργανη θρέψη των φυτών

Η ανόργανη θρέψη των φυτών Η ανόργανη θρέψη των φυτών Οργανικά θρεπτικά στοιχεία σάκχαρα που προέρχονται από τη διαδικασία της φωτοσύνθεσης με τις επακόλουθες μετατροπές Ανόργανα θρεπτικά στοιχεία προέρχονται από το έδαφος, με τη

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2010 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Η κυτταρική ή πλασματική μεμβράνη αποτελεί το εξωτερικό όριο του κυττάρου από το περιβάλλον και περικλείει

Διαβάστε περισσότερα

Αιωρήματα & Γαλακτώματα

Αιωρήματα & Γαλακτώματα Αιωρήματα & Γαλακτώματα Εαρινό εξάμηνο Ακ. Έτους 2014-15 Μάθημα 2ο 25 February 2015 Αιωρήματα Γαλακτώματα 1 Παρασκευή αιωρημάτων Οι μέθοδοι παρασκευής αιωρημάτων κατατάσσονται σε δύο μεγάλες κατηγορίες

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

6. ιαμοριακές δυνάμεις

6. ιαμοριακές δυνάμεις 6. ιαμοριακές δυνάμεις ΣΚΟΠΟΣ Σκοπός αυτού του κεφαλαίου είναι να γνωρίσουμε τα είδη των ελκτικών δυνάμεων που αναπτύσσονται μεταξύ των μορίων των ομοιοπολικών ενώσεων και την επίδραση που ασκούν οι δυνάμεις

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα