6η η ιάλεξη. Αντιγραφή του DNA. Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή. αντιγραφής του DNA

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "6η η ιάλεξη. Αντιγραφή του DNA. Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή. αντιγραφής του DNA"


1 Σχολή Γεωπονικών Επιστηµών Τµήµα Γεωπονίας Φυτικής Παραγωγής και Αγροτικού Περιβάλλοντος Μοριακοί µηχανισµοί της αντιγραφής του DNA Μηχανισµοί επιδιόρθωσης του DNA Μεταγραφή 6η η ιάλεξη ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ Εργαστήριο Γενετικής & Βελτίωσης φυτών Αντιγραφή του DNA Ηµι-συντηρητικός τρόπος αντιγραφής του DNA Στηρίζεται στη συµπληρωµατικότητα των βάσεων (Α-Τ, C-G) Αφετηρίες αντιγραφής (origins( of replication) DNA συντίθεται µε κατεύθυνση 5 to 3 διότι τα καινούργια νουκλεοτίδια προσθέτονται στην 3 -OH οµάδα του τελευταίου νουκλεοτιδίου της αλυσίδας DNA πολυµεράση Φάση S του κυτταρικού κύκλου 1

2 Το γενετικό µας υλικό αντιγράφεται µε εξαιρετική πιστότητα και ταχύτητα (1000 νουκλεοτίδια/sec) Ο ένας από τους δύο κλώνους λειτουργεί ως εκµαγείο (template) 1. ιαχωρισµός DNA κλώνων στα σηµεία έναρξης αντιγραφής, αντιγραφική θηλιά (replication bubble) 2. Σχηµατισµός διχάλας αντιγραφής (replication fork) 3. Πρωτεϊνική µηχανή, οµάδα πρωτεϊνών διενεργούν την αντιγραφή Εναρκτήριες πρωτεΐνες (initiator proteins) συνδέονται µε τοdna 2

3 ΕΙΚΟΝΑ 11.5 Έναρξη της αντιγραφής στην E. coli. Η εναρκτήρια πρωτεΐνη DnaA προ- σδένεται στο oric (αντιγραφέας) και διεγείρει την αποδιάταξη του DNA. Επιστρατεύονται οι DNA ελικάσες και αρχίζουν να ξετυλίγουν το DNA για να σχηµατιστούν δύο διχάλες αντιγραφής µε διάταξη κεφαλής προς κεφαλή. igenetics Ακαδηµαϊκές Εκδόσεις ιχάλες αντιγραφής 1 αφετηρία αντιγραφής = 2 διχάλες Ανοίγουν το DNA προς αντίθετες κατευθύνσεις Ταχύτητα (100 bp/sec) Αντιγραφή διπλής κατεύθυνσης DNA πολυµεράση (3-5 ) Η διχάλα αντιγραφής είναι ασύµµετρη 3

4 Η χηµεία της σύνθεσης του DNA. Η προσθήκη ενός δεοξυριβονουκλεοτιδίου στο 3 άκρο µιας πολυνουκλεοτιδικής αλυσίδας είναι η θεµελιώδης αντίδραση µε την οποία γίνεται η σύνθεση του DNA. Το ζευγάρωµα των βάσεων µεταξύ του εισερχόµενου τριφωσφορικού δεοξυριβονουκλεοτιδίου και του υπάρχοντος κλώνου εκµαγείου του DNA καθοδηγεί το σχηµατισµό του νέου κλώνου µε συµπληρωµατική ακολουθία Η ενέργεια για την αντίδραση πολυµερισµού απελευθερώνεται από τη διάσπαση ενός φωσφοανυδριτικού δεσµού στο εισερχόµενο τριφωσφορικό νουκλεοσίδιο Πρόβληµα: ασύµµετρη διχάλα αντιγραφής Λύση: Πισωβελονιά (backstitching) Κλάσµατα Okazaki Καθυστερηµένος κλώνος (lagging strand) Προπορευόµενος κλώνος (leading strand) 4

5 ΕΙΚΟΝΑ 11.6 Μοντέλο του µοριακού µηχανισµού που λαµβάνει χώρα σε µία αντιγραφική διχάλα του χρωµοσώµατος της E. coli. igenetics Ακαδηµαϊκές Εκδόσεις ΕΙΚΟΝΑ 11.6 Μοντέλο του µοριακού µηχανισµού που λαµβάνει χώρα σε µία αντιγραφική διχάλα του χρωµοσώµατος της E. coli. (γ) Περαιτέρω ξετύλιγµα και συνέχιση της σύνθεσης του DNA. (δ)( Αφαίρεση του εκκινητή από την DNA πολυµεράση Ι.. (ε)( Ένωση γειτονικών τµηµάτων DNA µέσω της δράσης της DNA λιγάσης. Πράσινο = RNA, κόκκινο = νεοσυντιθέµενο DNA. igenetics Ακαδηµαϊκές Εκδόσεις

6 ΕΙΚΟΝΑ 11.8 Μοντέλο του σωµατίου αντιγραφής, του συµπλόκου των κύριων πρωτεϊνών της αντιγραφής, µε το DNA στην αντιγραφική διχάλα. Η DNA πολυµεράση ΙΙΙ στη µήτρα της καθυστερηµένης αλυσίδας (επάνω µέρος εικόνας) µόλις ολοκληρώνει τη σύνθεση ενός τµήµατος Okazaki. igenetics Ακαδηµαϊκές Εκδόσεις ιορθωτική δράση της πολυµεράσης 1 λάθος /10 7 bp «διόρθωση δοκιµίων» (proofreading) 3-5 ενεργότητα νουκλεάσης ιαφορετικές δράσεις, διαφορετικές περιοχές του ένζυµου Εικόνα

7 Γιατί η αλυσίδα DNA αυξάνεται µόνο µε κατεύθυνση 5-3 ; A. Επιµήκυνση µε κατεύθυνση 3 5 της αλυσίδας DNA θα είχε ως αποτέλεσµα την παύση της επιµήκυνσης του DNA κλώνου µετά την επιδιορθωτική δράση της πολυµεράσης Β. Επιµήκυνση µε κατεύθυνση 5 3 της αλυσίδας DNA της επιτρέπει να επιµηκύνεται και µετά την αποµάκρυνση νουκλεοτιδίου από την επιδιορθωτική δράση της πολυµεράσης Ο ρόλος του RNA στην αντιγραφή του DNA Τµήµα RNA 10 νουκλεοτιδίων Λειτουργεί ως εκκινητής Πριµάση (primase) καταλύει τη σύνθεση Νουκλεάση (nuclease) αποδοµεί τον εκκινητή Πολυµεράση επιδιόρθωσης (repair polymerase) Λιγάση του DNA (DNA ligase) 7

8 Πρωτεΐνες που συµµετέχουν στην αντιγραφή DNA πολυµεράση Πριµάση Λιγάση Ελικάση (helicase) Πρωτεΐνη που συνδέεται σε µονούς κλώνους (single-strand strand binding protein) «ολισθαίνων συνδετήρας» (sliding clamp) Περίληψη της διαδικασίας αντιγραφής του DNA 8

9 Αντιγραφή των τελοµερών- τελοµεράση Η δοµή της τελοµεράσης (telomerase) Η τελοµεράση έιναι ένα σύµπλοκο πρωτείνης-rna Η τελοµεράση κουβαλά ένα εκµαγείο RNA για τη σύνθεση µιας επανάληπτικής πτικής πλούσιας σε G ακολουθίας DNA. H αντίστροφη µεταγραφάση (reverse transcriptase) είναι µια ειδική µορφή ενζύµου πολυµεράσης που χρησιµοποιεί ένα εκµαγείο RNA φτιάξει έναν κλώνο DNA Στον άνθρωπο η ακολουθία που επαναλαµβάνεται είναι GGGGTTA Στα ανθρώπινα κύτταρα η έκφραση της τελοµεράσης είναι από µικρή ως µη-ανιχνεύσιµη Ο ρόλος των τελοµερών Το φαινόµενο της κυτταρικής γήρανσης περιγράφηκε για πρώτη φορά από τον Hayflick και την οµάδα του ως το πεπερασµένο διάστηµα αναπαραγωγής των ανθρωπίνων ινοβλαστών στην καλλιέργεια. (όριο Hayflick, Hayflick limit) ) [Hayflick[ Hayflick,, 1965]. Ο έρευνες που ακολούθησαν στις επόµενες δεκαετίες οδήγησαν στο συµπέρασµα πως τα πολλαπλασιαζόµενα κύτταρα φθάνουν στο όριο Hayflick διότι η επαναλαµβανόµενη αντιγραφή του DNA απουσία τελοµεράσης ελαττώνει διαρκώς το µήκος των τελοµερών [Campisi,, 2005]. Τα τελοµερή είναι απαραίτητα για τη διατήρηση της ακεραιότητας του DNA συνεπώς η δυσλειτουργία τους οδηγεί σε χρωµοσωµικές ανωµαλίες και σε κακοήθη κυτταρικό µετασχηµατισµό [Artandi[ and DePinho,, 2000]. Η γήρανση οδηγεί το κύτταρο σε µία µορφή µόνιµης κυτταρικής παύσης εξασφαλίζοντας την αποµάκρυνση των κυττάρων µε µη λειτουργικά τελοµερή και αποτρέποντας την ανάπτυξη καρκίνου. 9

10 Επιδιόρθωση του DNA ιορθωτική δράση της DNA πολυµεράσης (proofreading activity) Σύστηµα επιδιόρθωσης αταίριαστων βάσεων στο DNA (mismatch repair) Επιδιόρθωση µε τη δράση της φωτολύασης Επιδιόρθωση µε αποµάκρυνση νουκλεοτιδίων (nucleotide excision repair) Επιδιόρθωση µε ανασυνδυασµό (recombination repair) SOS επιδιόρθωση (SOS repair) Επιδιόρθωση του DNA Εφεδρικό σύστηµα υποστήριξης σύστηµα επιδιόρθωσης αταίριαστων βάσεων του DNA Επιδιορθώνει το 99% των λαθών Για να είναι αποτελεσµατικός πρέπει να διορθώνει µόνο το αταίριαστο νουκλεοτίδιο από τον νεοσυντιθέµενο κλώνο 10

11 Μηχανισµός επιδιόρθωσης αταίριαστων βάσεων (DNA mismatch repair system) 1. Σύµπλοκο πρωτεϊνών αναγνωρίζει και αφαιρεί τα αταίριαστα ζεύγη του DNA 2. Το κενό συµπληρώνεται από µία DNA πολυµεράση 3. Τα επιµέρους τµήµατα συνενώνονται από το ένζυµο λιγκάση του DNA. Η εγκοπή είναι το σήµα που αναγνωρίζουν οι πρωτεΐνες επιδιόρθωσης για να διακρίνουν τον νεοσυντιθέµενο κλώνο του DNA Εγκοπές όµως συµβαίνουν και στους καθυστερηµένους κλώνους όπως και στους προπορευόµενους (πολύ σπανιότερα) οι οποίες διατηρούνται για πολύ λίγο χρόνο. Συνεπώς η επιδιόρθωση πρέπει να πραγµατοποιηθεί πολύ γρήγορε Αιτίες µεταβολών του DNA στα κύτταρα Το DNA των κυττάρων µας υφίσταται συνεχώς θερµικές συγκρούσεις οι οποίες προκαλούν χηµικές µεταβολές Αποπουρίνωση (depurination) απώλεια A και G βάσεων οδηγεί στη δηµιουργία χασµάτων Απαµίνωση (deamination) απώλεια αµινοµάδας από την C µε αποτέλεσµα τη δηµιουργία U 11

12 Αιτίες µεταβολών του DNA στα κύτταρα ραστικά παραπροϊόντα του µεταβολισµού µεταβάλουν την ιδιότητα σχηµατισµού ζευγών Υπεριώδης ακτινοβολία του ήλιου οµοιοπολική σύνδεση δύο γειτονικών βάσεων πυριµιδίνης πχ διµερές θυµίνης Αποτελέσµατα των χηµικών µεταβολών του DNA Μη επιδιόρθωση της απαµίνωσης της C οδηγεί σε αντικατάσταση της από άλλη βάση. Π.χ. απαµίνωση C σε U σηµαίνει ότι η U σχηµατίζει ζεύγος µε A Συνεπώς κατά την αντιγραφή όπου U στον παλαιό κλώνο θα ενσωµατώνεται Α στον καινούργιο Μη επιδιόρθωση της αποπουρίνωσης οδηγεί σε απώλεια ζέυγους νουκλεοτιδίων. Κατά την αντιγραφή η θέση στην οποία βρισκόταν µπορεί να παρακαµφτεί Συνεπώς, θα διαγραφεί ένα νουκλεοτίδιο στο νεοσυντιθέµενο κλώνο. Τα διµερή θυµίνης καθυστερούν το σύστηµα αντιγραφής στο σηµείο της βλάβης 12

13 Τα στάδια του βασικού µηχανισµού επιδιόρθωσης Εξιδικευµένο στάδιο Παρόµοια σε όλους τους τύπους επιδιόρθωσης 1. Αναγνώριση και αφαίρεση της βλάβης από νουκλεάσες 2. Η DNA πολυµεράση επιδιόρθωσης (DNA( repair polymerase) συµπληρώνει το κενό 3. Κλείσιµο της εγκοπής από το ένζυµο λιγκάση του DNA Λιγκάση του DNA (DNA ligase) 13

14 Κληρονοµικές διαταραχές της επιδιόρθωσης του DNA Οι ατέλειες στο µηχανισµό NER είναι αρµόδιες για διάφορες γενετικές διαταραχές που περιλαµβάνουν: 1. pigmentosum xeroderma: υπερευαισθησία σε υπεριώδης ηλιακή ακτινοβολία, µε συνέπεια την αυξανόµενη εµφάνιση καρκίνου του δέρµατος και την πρόωρη γήρανση 2. Σύνδροµο Cockayne: υπερευαισθησία σε UV και χηµικούς παράγοντες 3. Τrichothiodystrophy: ευαίσθητο δέρµα, εύθραυστη τρίχα Η διανοητική καθυστέρηση συνοδεύει συχνά τις τελευταίες δύο αναταραχές, που προτείνουν την αυξανόµενη ευπάθεια των αναπτυξιακών νευρώνων. Άλλες αναταραχές επισκευής DNA περιλαµβάνουν: 1. Σύνδροµο Werner: πρόωρη γήρανση και καθυστερηµένη ανάπτυξη 2. Σύνδροµο Blomm: υπερευαισθησία φωτός του ήλιου, υψηλή συχνότητα κακοηθιών. 3. Ataxia telangiectasia: ευαισθησία στην ακτινοβολία και µερικούς χηµικούς παράγοντες Όλες οι ανωτέρω ασθένειες προκαλούν πρόωρη γήρανση Άλλες ασθένειες που συνδέονται µε τη µειωµένη λειτουργία επισκευής DNA περιλαµβάνουν αναιµία Fanconi, κληρονοµικός καρκίνος του µαστού και κληρονοµικός καρκίνοs παχέως εντέρου. Επιδιόρθωση του DNA και καρκίνος BRCA1 κα BRCA2, δύο πολύ γνωστές µεταλλάξεις οι οποίες αυξάνουν την πιθανότητα ανάπτυξης καρκίνου του µαστού στις γυναίκες σχετίζονται µε βλάβες στις πορείες επιδιόρθωσης του DNA 14

15 Το κεντρικό δόγµα Μεταγραφή: από το DNA στο RNA Επεξεργασία του RNA - Μάτισµα Πως διαβάζουν τα κύτταρα το γονιδίωµα Οι γενετικές πληροφορίες κωδικοποιούνται από τα 4 νουκλεοτίδια του DNA Πως όµως αποκωδικοποιούνται από το κύτταρο; Οι γενετικές πληροφορίες κατευθύνουν τη σύνθεση των πρωτεϊνών Οι ιδιότητες και η λειτουργία µιας πρωτεΐνης καθορίζονται από την - µοναδική για κάθε πρωτεΐνη - αλληλουχία των αµινοξέων που σχηµατίζουν την πολυπεπτιδική αλυσίδα Οι γενετικές πληροφορίες καθορίζουν την αλληλουχία των αµινοξέων των πρωτεϊνών Το DNA δεν κατευθύνει την πρωτεΐνοσύνθεση αλλά δρα σαν επόπτης, δηλαδή αναθέτει τις απαραίτητες εργασίες σε οµάδα µορίων 15

16 Tο ο Κεντρικό όγµα της Βιολογίας Σεόλατακύτταρααπόταβακτήριαέωςτονάνθρωποηροήτων γενετικών πληροφοριών είναι από το DNA στο RNA και από το RNA στις πρωτεΐνες Οι ρετροϊοί (retroviruses) παράγουν DNA από RNA: Αντιστροφή του κεντρικού δόγµατος. 16

17 Από το DNA στο RNA: : Μεταγραφή Τα γονίδια εκφράζονται µέσω της αντιγραφής και της µετάφρασης Ένα γονίδιο µπορεί να παράγει πολλά πανοµοιότυπα αντίγραφα RNA Κάθε µόριο RNA είναι ικανό να κατευθύνει τη σύνθεση πολλών πανοµοιότυπων µορίων µίας πρωτεΐνης. Η διαδικασία αυτή επιτρέπει τη σύνθεση της αναγκαίας ποσότητας µιας πρωτεΐνης ταχύτερα τη χρήση του DNA ως απευθείας εκµαγείο Το κύτταρο ρυθµίζει την έκφραση των γονιδίων του. Κάθε γονίδιο µεταγράφεται και µεταφράζεται µε διαφορετική αποτελεσµατικότητα και έτσι τα κύτταρα µπορούν να συνθέτουν την απαραίτητα ποσότητα πρωτεΐνης ανάλογα µε τις ανάγκες τους οµή του RNA Ριβονουκλεϊκό οξύ Σάκχαρο = ριβόζη,, διαθέτει µία επιπλέον οµάδα -OH Ουρακίλη (U) οµόλογη µε την Τ στο DNA, έχει µία λιγότερη CH3 οµάδα από την Τ και ζευγαρώνει µε Α Μονόκλωνο µόριο Ικανότητα δίπλωσης σε πολλαπλές δοµές Η δίπλωση σε πολύπλοκες τρισδιάστατες δοµές προσδίδει, δοµικές, πληροφοριακές και καταλυτικές λειτουργίες 17

18 Το RNA µπορεί να σχηµατίσει ενδοµοριακά,, συµβατικά και µη συµβατικά ζεύγη βάσεων Οι σχηµατισµοί αυτοί επιτρέπου στο RNA να πτυχώνεται σε µία τρισδιάστατη δοµή η οποία καθορίζεται από την αλληλουχία των νουκλεοτιδίων A. ιάγραµµα πτυχωµένης δοµής µόνο µε συµβατικά ζεύγη βάσεων B. οµή µε συµβατικά (κόκκινο) και µη συµβατικά (πράσινο) ζεύγη βάσεων C. οµή µορίου RNA που εµπλέκεται στη συρραφή του RNA (γέφυρες = συµβατικό ζεύγος, σπασµένες γέφυρες = µη συµβατικό ζεύγος) Μεταγραφή (transcription) Η αντιγραφή του κατάλληλου γονιδίου σε µία αλληλουχία νουκλεοτιδίων του RNA Οµοιότητες µε την αντιγραφή του DNA 1. Έναρξη της µεταγραφής µε µε το άνοιγµα και το ξείπλωµα µικρού τµήµατος της διπλής έλικας του DNA 2. Ένας από τους δύο κλώνους DNA δρα ως εκµαγείο 3. Η αλληλουχία του της αλυσίδας RNA καθορίζεται από τους κανόνες της συµπληρωµατικότητας των βάσεων ιαφορές µε την αντιγραφή του DNA 1. Ο νεοσχηµατισµένος κλώνος δεν παραµένει συνδεδεµένος µε δεσµούς υδρογόνου µε το εκµαγείο. Πίσω από την περιοχή σύνθεσης το η έλικα του DNA αναδιοργανώνεται και εκτοπίζει τα νουκλεοτίδια. 2. Τα µόρια που παράγονται είναι µονόκλωνα 3. Αντιγράφονται από περιορισµένη περιοχή του DNA συνεπώς έχουν µικρότερο µήκος. Ένα χρωµόσωµα εώς και 250 εκ. bp DNA, ένα µόριο RNA λίγες χιλιάδες νουκλεοτιδια ή και λιγότερα ΗνέααλυσίδαRNA ονοµάζεται µετάγραφο ((transcript) 18

19 Η µεταγραφή επιτελείται από RNA πολυµεράσες (RNA polymerases) Οι πολυµεράσες καταλύουν το σχηµατισµό των φωσφοδιεστερικών δεσµών και δηµιουργούν τον σακχαροφωσφορικό σκελετό της αλυσίδας του RNA Η πολυµεράση µετακινείται νουκλεοτίδιο-νουκλεοτίδιο κατά µήκος του DNA ξετυλίγοντας στην πορεία της τη διπλή έλικα Η αλυσίδα του RNA αυξάνεται κατά ένα νουκλεοτίδιο τη φορά µε κατεύθυνση 5-3 Τα εισερχόµενα νουκλεοτίδια έχουν τη µορφή Τα εισερχόµενα νουκλεοτίδια έχουν τη µορφή τριφοσφωρικών νουκλεοσιδίων ATP,UTP,CTP,GTP Ηυδρόλυσητους παρέχει ενέργεια για την αντίδραση του πολυµερισµού 1 µόριο πολυµεράσης µεταγράφει 1500 bp σε 50sec Το µετάγραφο RNA απελευθερώνεται σχεδόν άµεσα Έως και 15 µόρια RNA πολυµεράσης σε ένα τµήµα DNA, µπορούν να συνθέσουν χιλιάδες µετάγραφα σε λιγότερο από 1 ώρα 1 λάθος / 10 4 νουκλεοτίδια Η µεταγραφή όπως γίνεται ορατή µε το ηλεκτρονικό µικροσκόπιο Γονίδιο 1 Γονίδιο 2 19

20 Είδη RNA trna µεταφορικό (transfer) snrna Είδος RNA mrna Αγγελιοφόρο (messenger) rrna ριβοσωµατικό (ribosomal) Λειτουργία Κωδικοποιεί πρωτεΐνες Είναι συστατικό του ριβοσωµατίου και συµµετέχει στην πρωτεϊνοσύνθεση Χρησιµοποιείται στην πρωτεϊνοσύνθεση ως µόριο προσαρµογής µεταξύ του mrna και των αµινοξέων Χρησιµοποιούνται στη συρραφή του προmrna, στη µεταφορά των πρωτεϊνών στο ενδοπλασµατικό δίκτυο και σε άλλες διεργασίες του κυττάρου Υποκινητής (ή προαγωγέας, promoter) Παράγοντας σ (σ factor) Αναγνώριση αλληλουχίας εκκινητή 20

21 ΕΙΚΟΝΑ 13.7 Συγκρότηση της µεταγραφικής µηχανής κατά την έναρξη. igenetics Ακαδηµαϊκές Εκδόσεις Σύγκριση µεταγραφής προκαρυωτικών και ευκαρυωτικών γονιδίων Βακτηριακή Μεταγραφή στο κυτταρόπλασµα µεταγραφή/µετάφραση σε ένα στάδιο όχι επεξεργασία του RNA µία RNA πολυµεράση Υποκινητές µε 2 σηµαντικές αλληλουχίες έναρξης της µεταγραφής. Εναρξη απο την RNA pol. µεταγράφηµα δεν περιέχει ιντρόνια Ευκαρυωτική Μεταγραφή στο κυτταρόπλασµα µεταγραφή/µετάφραση σ ένα στάδιο όχι επεξεργασία του RNA µία RNA πολυµεράση Υποκινητές µε 2 σηµαντικές αλληλουχίες έναρξης της µεταγραφής. Εναρξη απο την RNA pol. µεταγράφηµα δεν περιέχει ιντρόνια 21

22 Επεξεργασία (processing) του ευκαρυωτικού mrna Συµβαίνουν ταυτόχρονα µε τη µεταγραφή Σχηµατισµός καλύπτρας (RNA capping): : κάλυψη του 5 µε µία µεθυλιωµένη G µόλις η RNA pol συνθέσει 25 νουκλεοτίδια Πολυαδενυλίωση (polyadenylation) προσθήκη ουράς πολύ(α) [poly(a)tail] Ωρίµανση του mrna 1η τροποποίηση: 5' άκρο --> προσθήκη καλύµµατος. 2η τροποποίηση: 3' άκρο --> προσθήκη πολυaουράς. Ύστερα,ακολουθεί,η αφαίρεση των ιντρονίων,κι η συρραφή των εξωνίων. Εν συνεχεία,ελέγχεται από το εσωτερικό της πυρηνικής µεµβράνης,κι αν βρεθεί ότι έχει συντεθεί σωστά, τότε, περνά από τον πυρηνικό πόρο. 22

23 ΕΙΚΟΝΑ 13.7 Συγκρότηση της µεταγραφικής µηχανής κατά την έναρξη. igenetics Ακαδηµαϊκές Εκδόσεις Ευκαρυωτικά γονίδια Ιντρόνια: µη κωδικοποιητικές αλληλουχίες, νουκλεοτίδια Εξόνια: κωδικοποιητικές αλληλουχίες, βραχύτερες από τα ιντρόνια 23

24 Πως διαβάζουν τα κύτταρα το γονιδίωµα ; Ο γενετικός κώδικας 24

25 Χαρακτηριστικά του γενετικού κώδικα 1. Κώδικας τριπλέτας 2. Συνεχής Μη επικαλυπτόµενος 4. Εκφυλισµένος 5. Σχεδόν καθολικός 6. Κωδικόνια έναρξης και λήξης 1. Κώδικας τριπλέτας Ο γενετικός κώδικας αποτελείται από τριπλέτες νουκλεοτιδίων που ονοµάζονται κωδικόνια 25

26 2. Συνεχής 5 3 5'-UCUAAAAUGGGUGACAGGCCA UCUAAAAUGGGUGACAGGCCA -3' 3. Μη επικαλυπτόµενος 26

27 4. Εκφυλισµένος Τα αµινοξέα µπορούν να καθοριστούν από περισσότερα από ένα κωδικόνια Thr καθορίζεται από ACG, ACA, ACC, ACU 5. Σχεδόν καθολικός Σπάνιες εξαιρέσεις Μιτοχόνδρια (AUA ( Met όχι Ile) Μερικά πρωτόζωα 27

28 6. Κωδικόνια έναρξης και λήξης Ανοικτό πλαίσιο ανάγνωσης (open reading frame ORF) 1)UCU AAA AUG GGU GAC 2)..CUA AAA UGG GUG AC 3)...UAA AAU GGG UGA C 28

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

"It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic

It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic Αντιγραφή του DNA "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material." Τρία μοντέλα αντιγραφής του DNA

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς

ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) 1 Τι σηµαίνει αντιγραφή του γενετικού υλικού Το γενετικό υλικό πρέπει να έχει τη δυνατότητα να περάσει από µια γενιά στην επόµενη, άρα πρέπει να αντιγραφεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΑΡΧΕΣ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΕΠΙΣΚΟΠΗΣΗ ΤΩΝ ΓΟΝΙΔΙΩΝ ΚΑΙ ΤΗΣ ΓΟΝΙΔΙΑΚΗΣ ΕΚΦΡΑΣΗΣ Μακρομόρια και γενετική πληροφορία Τι είναι ένα γονίδιο ΑΡΧΕΣ ΤΗΣ ΜΙΚΡΟΒΙΑΚΗΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΕΠΙΣΚΟΠΗΣΗ ΤΩΝ ΓΟΝΙΔΙΩΝ ΚΑΙ ΤΗΣ ΓΟΝΙΔΙΑΚΗΣ ΕΚΦΡΑΣΗΣ Μακρομόρια και γενετική πληροφορία Τι είναι ένα γονίδιο και ποια η λειτουργία του; Τα περισσότερα γονίδια είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Το δόγμα της Μοριακής Βιολογίας

Το δόγμα της Μοριακής Βιολογίας Το δόγμα της Μοριακής Βιολογίας To DNA είναι το βασικό μόριο φορέας και διατηρησης της γενετικής πληροφορίας. Με τη διαδικασία της αντιγραφής του DNA το μητρικό μόριο διπλασιάζετα σε δυο θυγατρικά και

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα


ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA Μεταλλάξεις DNA Επιδιόρθωση DNA Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA 1 Tι είναι µετάλλαξη Τι προκαλεί τις µεταλλάξεις Τύποι των µεταλλάξεων Tύποι των µεταλλαξογόνων Μεταλλάξεις και ασθένειες

Διαβάστε περισσότερα