Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας. (Μάθημα επιλογής για όλες τις κατευθύνσεις)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας. (Μάθημα επιλογής για όλες τις κατευθύνσεις)"

Transcript

1 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας (Μάθημα επιλογής για όλες τις κατευθύνσεις) 219

2 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΟΜΑΔΑ ΠΡΩΤΗ ΘΕΜΑ Α Α1. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη. α. Ο νόμος της φθίνουσας απόδοσης ισχύει, επειδή μεταβάλλονται οι αναλογίες που υπάρχουν κάθε φορά ανάμεσα στους σταθερούς και μεταβλητούς συντελεστές. β. Το πραγματικό κόστος ενός αγαθού είναι τα άλλα αγαθά, που θυσιάστηκαν για την παραγωγή του. γ. Όταν το οριακό προϊόν της εργασίας αρχίζει να μειώνεται, αρχίζει να μειώνεται και το μέσο προϊόν της εργασίας. δ. Mια γεωργική έκταση, όσο παραμένει ακαλλιέργητη, είναι εν δυνάμει συντελεστής παραγωγής. ε. Όταν παρουσιάζεται έλλειμμα στην αγορά ενός αγαθού, τότε με κάθε μείωση της τιμής του αγαθού θα μειώνεται και το έλλειμμα. Μονάδες 15 Στις παρακάτω προτάσεις Α2 και Α3 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α2. Για την παραγωγή 60 μονάδων του αγαθού Υ θυσιάζονται 30 μονάδες του αγαθού Χ. Το κόστος ευκαιρίας του αγαθού Χ σε όρους του αγαθού Υ είναι: α. 0,5 β. 2 γ. 0,2 δ. 30 Α3. Η συνολική δαπάνη των καταναλωτών για ένα αγαθό μειώνεται, όταν: α. η τιμή του αγαθού μειώνεται και η ζήτησή του είναι ανελαστική β. η τιμή του αγαθού αυξάνεται και η ζήτησή του είναι ανελαστική γ. η τιμή του αγαθού μειώνεται και η ζήτησή του είναι ελαστική δ. η τιμή του αγαθού μειώνεται και η ελαστικότητα της ζήτησής του είναι ίση με τη μονάδα. ΟΜΑΔΑ ΔΕΥΤΕΡΗ ΘΕΜΑ Β Με βάση το χρονικό ορίζοντα της επιχείρησης, η οικονομική επιστήμη διακρίνει δύο περιόδους παραγωγής. Β1. Να περιγράψετε αυτές τις περιόδους (μονάδες 16). Πώς γίνεται η διάκριση αυτή;(μονάδες 6) Να αναφέρετε παραδείγματα (μονάδες 3). Μονάδες

3 ΟΜΑΔΑ ΤΡΙΤΗ ΘΕΜΑ Γ Δίνεται ο παρακάτω πίνακας που αναφέρεται στην τιμή (P X ) και στην ζητούμενη ποσότητα (Q X ) του αγαθού X, καθώς και στο εισόδημα (Y) και στην τιμή (P Z ) ενός αγαθού Z, υποκατάστατου του αγαθού X. Συνδυασμοί PX QX Y PZ Α Β Γ Δ Ε Γ1. Nα αιτιολογήσετε μεταξύ ποιων συνδυασμών υπολογίζεται η τοξοειδής ελαστικότητα ζήτησης του αγαθού X και να την υπολογίσετε (μονάδες 7). Πώς μεταβάλλεται η συνολική δαπάνη μεταξύ των συνδυασμών αυτών; Nα εξηγήσετε την παραπάνω μεταβολή με τη χρήση της τοξοειδούς ελαστικότητας ζήτησης του αγαθού X (μονάδες 7). Μονάδες 14 Γ2. Nα αιτιολογήσετε μεταξύ ποιων συνδυασμών υπολογίζεται η εισοδηματική ελαστικότητα, να την υπολογίσετε καθώς το εισόδημα αυξάνεται και να χαρακτηρίσετε το είδος του αγαθού. Μονάδες 6 Γ3. Γιατί η γνώση της ελαστικότητας ζήτησης ενός αγαθού είναι πολύ σημαντική για τις επιχειρήσεις και το κράτος; ΟΜΑΔΑ ΤΕΤΑΡΤΗ ΘΕΜΑ Δ Τα δεδομένα του παρακάτω πίνακα αναφέρονται σε μία επιχείρηση που λειτουργεί στη βραχυχρόνια περίοδο. Η εργασία (L) αποτελεί τον μοναδικό μεταβλητό συντελεστή παραγωγής και η τιμή (αμοιβή) της είναι σταθερή. Αριθμός Εργατών (L) Συνολικό Προϊόν (Q) Μέσο Προϊόν (ΑΡ) Οριακό Προϊόν (ΜΡ) Μέσο Μεταβλητό Κόστος (AVC) Μεταβλητό Κόστος (VC) Δ1. Να μεταφέρετε στο τετράδιό σας τον παραπάνω πίνακα. Με δεδομένο ότι το Μέσο Προϊόν (ΑΡ) γίνεται μέγιστο, όταν η επιχείρηση απασχολεί σαράντα (40) εργάτες, να συμπληρώσετε τα κενά του πίνακα, παρουσιάζοντας τους σχετικούς υπολογισμούς. Μονάδες

4 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ2. Αν η επιχείρηση αυξήσει την παραγωγή της από 330 μονάδες, σε 430 μονάδες με τι κόστος θα επιβαρυνθεί; Μονάδες 6 Δ3. α. Nα κατασκευάσετε τον πίνακα προσφοράς της επιχείρησης. (μονάδες 4) β. Αν ο κλάδος παραγωγής περιλαμβάνει 100 όμοιες επιχειρήσεις, να κατασκευάσετε τον πίνακα αγοραίας προσφοράς. (μονάδες 2) Μονάδες 6 Δ4. Αν η τιμή ισορροπίας στην αγορά είναι 72 χρηματικές μονάδες, ποια ποσότητα πρέπει να παράγει η επιχείρηση για να μεγιστοποιεί τα κέρδη της; Μονάδες 2 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: 10:00 π.μ. 222

5 Γενικής Παιδείας 2013 Βιολογία 223

6 Γενικής Παιδείας 2013 Βιολογία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Η απομάκρυνση του νερού μέσω των στομάτων των φύλλων ονομάζεται: α. κυτταρική αναπνοή β. επιδερμική εξάτμιση γ. διαπνοή δ. φωτοσύνθεση Α2. Η ενέργεια, η οποία μεταφέρεται από ένα κατώτερο τροφικό επίπεδο στο αμέσως ανώτερό του: α. αυξάνεται κατά 10% β. ελαττώνεται κατά 90% γ. ελαττώνεται κατά 10% δ. αυξάνεται κατά 90% Α3. Το νόσημα το οποίο μπορεί να αντιμετωπιστεί με αντιβιοτικά είναι: α. η γονόρροια β. η ηπατίτιδα C γ. η πολιομυελίτιδα δ. το AIDS Α4. Καψίδιο διαθέτουν: α. οι μύκητες β. τα βακτήρια γ. τα πρωτόζωα δ. οι ιοί Α5. Το σύνολο των διαφορετικών πληθυσμών που ζουν σε μια περιοχή, αλλά και οι σχέσεις που αναπτύσσονται μεταξύ τους αποτελούν: α. ένα οικοσύστημα β. μία βιοκοινότητα γ. τη βιόσφαιρα δ. ένα βιότοπο 224

7 ΘΕΜΑ Β Β1. Τι ονομάζεται ομοιόσταση (μονάδες 2) και ποιους ομοιoστατικούς μηχανισμούς γνωρίζετε στον ανθρώπινο οργανισμό (μονάδες 5); Μονάδες 7 Β2. Ποιες προϋποθέσεις πρέπει να ικανοποιεί μία ασθένεια για να θεωρηθεί λοιμώδης; Μονάδες 6 Β3. Με ποιο τρόπο το διοξείδιο του άνθρακα και οι υδρατμοί της ατμόσφαιρας συνετέλεσαν, ώστε η μέση θερμοκρασία της Γης να είναι 15 C και όχι -20 C; Μονάδες 6 Β4. Ποιες είναι οι πιθανές πορείες του νερού μετά την πτώση του στην ξηρά; Μονάδες 6 ΘΕΜΑ Γ Ένας άνθρωπος μολύνεται από ένα βακτήριο. Στο παρακάτω διάγραμμα απεικονίζεται, σε συνάρτηση με το χρόνο, η μεταβολή της συγκέντρωσης των αντισωμάτων που παράγονται για να το εξουδετερώσουν. Γ1. Να εξηγήσετε το είδος της ανοσοβιολογικής απόκρισης με βάση την καμπύλη του παραπάνω διαγράμματος. Μονάδες 3 Γ2. Να εξηγήσετε τις διαδικασίες στην παραπάνω ανοσοβιολογική απόκριση, από τη στιγμή που ενεργοποιούνται τα βοηθητικά Τ-λεμφοκύτταρα μέχρι την παραγωγή και την έκκριση μεγάλης ποσότητας αντισωμάτων. Μονάδες 8 Γ3. Να περιγράψετε τις διαδικασίες με τις οποίες αυξάνεται η συγκέντρωση της αμμωνίας στο έδαφος. Μονάδες 6 Γ4. Να περιγράψετε τις ανθρώπινες παρεμβάσεις που μπορούν να οδηγήσουν σε ελάττωση της συγκέντρωσης του οξυγόνου, που είναι διαλυμένο στο νερό. Μονάδες 8 225

8 Γενικής Παιδείας 2013 Βιολογία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Δ Δίνεται το φυλογενετικό δέντρο ορισμένων οργανισμών διαφορετικού είδους που ζουν σήμερα. Οι αριθμοί στις θέσεις 1, 2, 3 και 4 απεικονίζουν τις προγονικές μορφές των οργανισμών που δίνονται στο φυλογενετικό δέντρο. Δ1. Να εξηγήσετε ποια από τα παραπάνω είδη είναι περισσότερο συγγενικά μεταξύ τους. Μονάδες 4 Δ2. Να εντοπίσετε και να αναφέρετε ποιος είναι ο πιο πρόσφατα κοινός πρόγονος του σκύλου και του γορίλα. Μονάδες 2 Δ3. Σε ποιες περιπτώσεις κατά την ταξινόμηση των οργανισμών χρησιμο-ποιείται το τυπολογικό κριτήριο; Μονάδες 8 Δ4. Οι πάπιες έχουν τη δυνατότητα να κολυμπάνε στις λίμνες, όπου συλλέγουν την τροφή τους. Στην κολύμβηση τις βοηθούν οι μεμβράνες που διαθέτουν ανάμεσα στα δάκτυλα των ποδιών τους, τα οποία χρησιμοποιούν σαν κουπιά. Με βάση τη θεωρία του Δαρβίνου να ερμηνεύσετε την επικράτηση του συγκεκριμένου μορφολογικού χαρακτηριστικού στις πάπιες. Μονάδες 8 Δ5. Τι υποστηρίζει η αρχή της χρήσης και της αχρησίας των οργάνων σύμφωνα με τη θεωρία του Λαμάρκ; Μονάδες 3 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μην γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και ΜΟΝΟ για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. 226

9 Γενικής Παιδείας 2013 Ιστορία 227

10 Γενικής Παιδείας 2013 Ιστορία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΟΜΑΔΑ ΠΡΩΤΗ ΘΕΜΑ Α1 Να δώσετε το περιεχόμενο των παρακάτω όρων: α. Νεοτουρκικό Κίνημα β. Ψυχρός Πόλεμος γ. Συμβούλιο της Ευρώπης Μονάδες 15 ΘΕΜΑ Α2 Να συνδυάσετε τα ονόματα των ηγετών με τα ονόματα των χωρών των οποίων ηγήθηκαν, αντιστοιχίζοντας κάθε φορά ένα γράμμα της πρώτης στήλης με έναν αριθμό της δεύτερης στήλης. (Περισσεύουν δύο ονόματα χωρών). ΣΤΗΛΗ Α ΣΤΗΛΗ Β α. Ρίτσαρντ Νίξον 1. Κύπρος β. Γκαμάλ Αμπντέλ Νάσερ 2. Νότια Αφρική γ. Μαχάτμα Γκάντι 3. Ινδία δ. Νέλσον Μαντέλα 4. Μεγάλη Βρετανία ε. Γλαύκος Κληρίδης 5. Ελλάδα 6. ΗΠΑ 7. Αίγυπτος Μονάδες 10 ΘΕΜΑ Β1 Να παρουσιάσετε: α) Τους κατευθυντήριους στόχους των νικητριών δυνάμεων του Α Παγκοσμίου Πολέμου στο Συνέδριο Ειρήνης των Παρισίων (μονάδες 4) και β) Το περιεχόμενο της συνθήκης των Βερσαλλιών (μονάδες 8). Μονάδες 12 ΘΕΜΑ Β2 Ποια ήταν η γενικότερη σημασία: α) Της επικράτησης των Ελλήνων στον ελληνοϊταλικό πόλεμο (μονάδες 7) και β) Του ελληνογερμανικού πολέμου (μονάδες 6). Μονάδες

11 ΟΜΑΔΑ ΔΕΥΤΕΡΗ ΘΕΜΑ Γ1 Αξιοποιώντας τα στοιχεία που περιέχονται στο κείμενο που σας δίνεται και με βάση τις ιστορικές σας γνώσεις, να παρουσιάσετε τις ρυθμίσεις του Πρωτοκόλλου της Ανεξαρτησίας (22 Ιανουαρίου/3 Φεβρουαρίου 1830) σχετικά με την εθνική ανεξαρτησία, την εδαφική έκταση και τη μορφή του πολιτεύματος στο υπό ίδρυση Ελληνικό Κράτος. Μονάδες 25 ΚΕΙΜΕΝΟ [Τὸ πρωτόκολλο τῆς 3ης Φεβρουαρίου 1830] Στὶς 22 Ἰανουαρίου/3 Φεβρουαρίου 1830, ἡ Διάσκεψη τοῦ Λονδίνου, ὕστερα ἀπὸ ἀγγλικὴ πρόταση, διακήρυξε τὴν πολιτικὴ ἀνεξαρτησία τῆς Ἑλλάδος, μὲ τὸ ἄρθρο 1 τοῦ πρωτοκόλλου ποὺ ὑπογράφεται ἀπὸ τοὺς πληρεξουσίους τῆς Ἀγγλίας, τῆς Γαλλίας καὶ τῆς Ρωσίας, Ἄμπερντην, Μονμορανσὺ Λαβὰλ καὶ Λίβεν. Τὸ ἄρθρο 1 τοῦ πρωτοκόλλου τῆς 3ης Φεβρουαρίου 1830 ὅριζε: «Ἡ Ἑλλὰς θέλει σχηματίσει ἓν Κράτος ἀνεξάρτητον, καὶ θέλει χαίρει ὅλα τὰ δίκαια, πολιτικά, διοικητικὰ καὶ ἐμπορικά, τὰ προσπεφυκότα 1 εἰς ἐντελῆ ἀνεξαρτησίαν». [ ] Τὸ ἄρθρο 2 τοῦ πρωτοκόλλου τῆς 3ης Φεβρουαρίου 1830 ὅριζε: «Ἡ διοριστικὴ γραμμὴ τῶν συνόρων τῆς Ἑλλάδος, ἀρξαμένη ἀπὸ τὰς ἐκβολὰς τοῦ Ἀσπροποτάμου 2, θέλει ἀνατρέξει τὸν ποταμὸν αὐτὸν [ ] καὶ θέλει καταλήξει εἰς τὸ ὄρος Ἀρτοτίνα, ἐξ οὗ θέλει ἀκολουθήσει τὴν [ ] κορυφὴν τοῦ ὄρους Οἴτης, ἕως τὸν κόλπον τοῦ Ζητουνίου 3. [ ]» Ἡ συνοριακὴ γραμμὴ τοῦ πρωτοκόλλου τῆς 3ης Φεβρουαρίου 1830 κρατάει ἔξω ἀπὸ τὸ ἔδαφος τῆς Ἑλλάδος μεγάλο τμῆμα τῆς Στερεᾶς Ἑλλάδος, ἰδιαίτερα τῆς δυτικῆς. [ ] Τὸ ἄρθρο 3 τοῦ πρωτοκόλλου ὅριζε: «Ἡ ἑλληνικὴ Κυβέρνησις θέλει εἶναι μοναρχικὴ καὶ κληρονομικὴ κατὰ τάξιν πρωτοτοκίας θέλει ἐμπιστευθῆ εἰς ἕνα ἡγεμόνα, ὅστις [ ] θέλει φέρει τὸν τίτλον Ἡγεμὼν Κυριάρχης τῆς Ἑλλάδος. [ ]» Τὸ ἄρθρο 8 τοῦ πρωτοκόλλου ὅριζε: «Ἑκάστη τῶν τριῶν Αὐλῶν φυλάττει τὴν [ ] ἐξουσίαν τοῦ νὰ ἐγγυᾶται περὶ τοῦ ὅλου τῶν προηγουμένων συμβιβασμῶν καὶ ἄρθρων. Αἱ περὶ ἐγγυήσεως πράξεις, ἐὰν γενῶσι, θέλουν συνταχθῆ χωριστά. [ ]» Οἱ Δυνάμεις ἔβλεπαν στὸ πρωτόκολλο τὴν ὁριστικὴ διευθέτηση ἐνοχλητικοῦ ζητήματος. Οἱ Ἕλληνες ἀντίθετα ἔβλεπαν σ αὐτό, καὶ ἰδιαίτερα στὸ πρῶτο ἄρθρο του, ἁπλῶς τὴν ἀπαρχὴ τοῦ ἐλεύθερου πολιτικοῦ βίου τοῦ Ἔθνους. Καὶ πραγματικά, μὲ τὸ πρωτόκολλο τοῦ Λονδίνου τῆς 3ης Φεβρουαρίου τοῦ 1830 τερματιζόταν ἡ Ἑλληνικὴ Ἐπανάσταση, ἀλλὰ καὶ ἄρχιζε νὰ ὑπάρχη ἐπίσημα στὴ διεθνῆ κοινωνία τὸ Ἑλληνικὸ Κράτος. Ἔτσι πραγματοποιοῦνταν κρίσιμη καμπή τῆς Ἑλληνικῆς Ἱστορίας. Ἱστορία τοῦ Ἑλληνικοῦ Ἐθνους, τομ. ΙΒ : Ἡ Ἑλληνικὴ Ἐπανάσταση καὶ ἡ ἵδρυση τοῦ Ἑλληνικοῦ Κράτους ( ), Ἀθήνα: Ἐκδοτικὴ Ἀθηνῶν Α.Ε., 22000, σσ ΘΕΜΑ Δ1 Αντλώντας στοιχεία από τα κείμενα που σας δίνονται και με βάση τις ιστορικές σας γνώσεις, να αναφερθείτε στην οικονομική και κοινωνική συγκυρία, όπως αυτή παρουσιάζεται στην Ευρώπη και τις ΗΠΑ κατά τη δεκαετία Μονάδες 25 1 Τὰ προσπεφυκότα, δηλ. αυτά που αρμόζουν. 2 του Ἀσπροποτάμου, δηλ. του Αχελώου 3 του Ζητουνίου, δηλ. της Λαμίας. 229

12 Γενικής Παιδείας 2013 Ιστορία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΚΕΙΜΕΝΟ Α Μαζική κατανάλωση και μαζική ψυχαγωγία Η μαζική κατανάλωση και η μαζική παραγωγή αγαθών δημιούργησαν την ευημερία της δεκαετίας του 20 [ ]. Περισσότεροι άνθρωποι μπορούσαν να αγοράσουν αυτοκίνητο, μικρές ηλεκτρικές συσκευές, όπως ραδιόφωνα και φωνογράφους, καθώς και ενδύματα από συνθετικά υφάσματα, την κατασκευή των οποίων έκαναν δυνατή τα επιτεύγματα της χημείας. [ ] Με τη σταδιακή επικράτηση της οκτάωρης εργασίας, όλο και περισσότερη προσοχή δινόταν στον ελεύθερο χρόνο ως μια θετική πλέον πηγή ανθρώπινης ικανοποίησης για όλους και όχι μόνο για τους πλουσίους. Τα παραθαλάσσια θέρετρα της Ευρώπης άρχισαν να γεμίζουν από παραθεριστές καθώς όλο και περισσότεροι άνθρωποι είχαν τον χρόνο και τα μέσα να απολαμβάνουν τις διακοπές τους. Μια έκρηξη ενδιαφέροντος για το ποδόσφαιρο μεταξύ των Ευρωπαίων μπορούσε να συγκριθεί μόνο με την παράλληλη ανάπτυξη του επαγγελματικού μπέιζ-μπολ και του ποδοσφαίρου στα κολέγια των ΗΠΑ. Τεράστια στάδια άρχισαν να χτίζονται σε όλη την Ευρώπη. F.W. Pethick Lawrence (ed.), Τhe Trial of the Suffragette Leaders, στο: Noble et al., Western Civilization. The Continuing Experiment, τ. 2, London: Houghton Mifflin Co., 2005, σ. 898, στο: Ιστορία του νεότερου και του σύγχρονου κόσμου (από το 1815 έως σήμερα), Γ Γενικού Λυκείου & Δ Εσπερινού Λυκείου Γενικής Παιδείας, Αθήνα:ΙΤΥΕ Διόφαντος, 2013, σ. 98. ΚΕΙΜΕΝΟ Β [Τα όρια της ευημερίας] Η ευημερία έχει ωστόσο και τα όριά της. Πρώτα πρώτα δεν είναι καθόλου πανευρωπαϊκό φαινόμενο. Όσες χώρες αποζούν κατ εξοχήν από τη γεωργία και την εξαγωγή αγροτικών προϊόντων υποφέρουν από τη συσσώρευση αποθεμάτων και την πτώση των τιμών που χαρακτηρίζουν αυτό τον τομέα. Η κεντρική και ανατολική Ευρώπη, απ όπου αντλούσε προπολεμικά το υπόλοιπο τμήμα της ηπείρου το μισό των εισαγωγών του σε σιτάρι, έχει περιοριστεί στο 10% της αγοράς, εξαιτίας του αμερικανικού ανταγωνισμού. Ακόμη και στη Γαλλία, όπου η αγροτική παραγωγή προστατεύεται από υψηλούς τελωνειακούς δασμούς, οι αγρότες με δυσκολία συναγωνίζονται τα ξένα προϊόντα. Το ίδιο και στη Γερμανία, όπου οι αγρότες καταχρεώνονται και υποθηκεύουν τη γη τους (ανατολικά του Έλβα το ύψος των χρεών ξεπερνάει στα 1929 την αξία των κτημάτων σε ποσοστό 50 ως 100%). S. Berstein και P. Milza, Ιστορία της Ευρώπης, τ.3: Διάσπαση και Ανοικοδόμηση της Ευρώπης, 1919 έως σήμερα, Αθήνα: Αλεξάνδρεια, 1997, σ

13 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής 231

14 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Α Α1. Να αποδείξετε ότι η παράγωγος της ταυτοτικής συνάρτησης f (x)=x είναι f (x)=1, για κάθε x R Μονάδες 7 Α2. Έστω μια συνάρτηση f με πεδίο ορισμού Α. Πότε λέμε ότι η συνάρτηση f παρουσιάζει τοπικό ελάχιστο στο x 0 Α; Μονάδες 4 Α3. Να δώσετε τον ορισμό της διαμέσου (δ) ενός δείγματος ν παρατηρήσεων. Μονάδες 4 Α4. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας, δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη. 1 α) Για τη συνάρτηση f (x) = x, x 0 ισχύει ότι f (x) = 1 (μονάδες 2) x 2 β) Για το γινόμενο δύο παραγωγίσιμων συναρτήσεων f, g ισχύει ότι (f (x) g(x)) = f (x) g(x)+f (x) g (x) (μονάδες 2) γ) Το ραβδόγραμμα χρησιμοποιείται για τη γραφική παράσταση των τιμών μιας ποσοτικής μεταβλητής. (μονάδες 2) δ) Η διάμεσος είναι ένα μέτρο θέσης, το οποίο επηρεάζεται από τις ακραίες παρατηρήσεις. (μονάδες 2) ε) Για δύο ενδεχόμενα Α και Β ενός δειγματικού χώρου Ω με Α Β, ισχύει ότι Ρ(Α) > Ρ(Β) (μονάδες 2) Μονάδες 10 ΘΕΜΑ Β Δίνεται ο δειγματικός χώρος Ω = {ω ω ω ω } ,,, και τα ενδεχόμενα Α = {ω 1, ω 4 } και Β = {ω 1, ω 3 } Για τις πιθανότητες των απλών ενδεχομένων {ω 1 } και { ω 3 } του Ω ισχύει ότι: H P(ω 3 ) είναι ίση με το ρυθμό μεταβολής της f (x) ως προς x, όταν x =1, όπου x f (x) = ln x, x > Β1. Να αποδείξετε ότι P(ω 1 ) = 4 και P(ω ) = Μονάδες 10 1 Β2. Να αποδείξετε ότι 3 P(A ) 3 5, όπου A το συμπληρωματικό του A. Μονάδες 7 3 Β3. Αν P(A ) = 4, τότε να βρείτε τις πιθανότητες P(ω ), P(ω ) P[(A B) (B A)] και P(Α -Β ), όπου Β το συμπληρωματικό του Β 2 4. Μονάδες 8 232

15 ΘΕΜΑ Γ Θεωρούμε ένα δείγμα ν παρατηρήσεων μιας συνεχούς ποσοτικής μεταβλητής X, τις οποίες ομαδοποιούμε σε 4 ισοπλατείς κλάσεις. Δίνεται ότι: η μικρότερη παρατήρηση είναι 50 η κεντρική τιμή της τέταρτης κλάσης είναι x 4 = 85 η σχετική συχνότητα της τέταρτης κλάσης είναι διπλάσια της σχετικής συχνότητας της τρίτης κλάσης η διάμεσος των παρατηρήσεων του δείγματος είναι δ = 75 και η μέση τιμή των παρατηρήσεων του δείγματος είναι _ x = 74 Γ1. Να αποδείξετε ότι το πλάτος είναι c = 10 Μονάδες 4 Γ2. Να μεταφέρετε στο τετράδιό σας τον παρακάτω πίνακα συμπληρωμένο σωστά Kλάσεις Κεντρικές Τιμές x i Σχετική Συχνότητα f i [, ) [, ) [, ) [, ) Σύνολο Μονάδες 8 Γ3. Δίνεται ότι f 1 = 0,1, f 2 = 0,3, f 3 = 0,2 και f 4 = 0,4 Να αποδείξετε ότι η μέση τιμή των παρατηρήσεων, που είναι μικρότερες του 80, είναι Μονάδες 7 Γ4. Επιλέγουμε κ παρατηρήσεις του αρχικού δείγματος με κ < ν, οι οποίες ακολουθούν κανονική κατανομή με το 2,5% των παρατηρήσεων αυτών να είναι τουλάχιστον 74 το 16% των παρατηρήσεων αυτών να είναι το πολύ 68 Να βρείτε τη μέση τιμή και την τυπική απόκλιση των παρατηρήσεων αυτών καθώς και να εξετάσετε αν το δείγμα των παρατηρήσεων αυτών είναι ομοιογενές. ΘΕΜΑ Δ Μονάδες 6 Θεωρούμε τη συνάρτηση f(x) = xln x + κ, x > 0, όπου κ ακέραιος με κ > 1 και την εφαπτομένη (ε) της γραφικής παράστασης της f στο σημείο (1,f(1)), η οποία σχηματίζει με τους άξονες, τρίγωνο εμβαδού E, με E < 2 Δ1. Να αποδείξετε ότι κ = 2 233

16 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ2. Έστω x 1, x 2,..., x 50 οι τετμημένες 50 σημείων της (ε) των οποίων οι αντίστοιχες τεταγμένες τους έχουν μέση τιμή _ y =31 α) Να αποδείξετε ότι _ x = 30 (μονάδες 2) β) Για τις τετμημένες των παραπάνω σημείων θεωρούμε ότι : Κάθε μία από τις τετμημένες x 1, x 2,..., x 20 αυξάνεται κατά 3, οι επόμενες 15 τετμημένες παραμένουν σταθερές και κάθε μία από τις υπόλοιπες ελαττώνεται κατά λ R με λ > 0. Να βρείτε το λ, ώστε η νέα μέση τιμή των τετμημένων να είναι ίση με 31 (μονάδες 4) Μονάδες 6 1 Δ3. Αν e < α < β < γ < e με αα β β γ γ = e 7, τότε να βρείτε το εύρος R και τη μέση τιμή των τιμών f(α), f(β), f(γ), f(e), f 1 e, όπου f(x) xln x + 2 Μονάδες 7 Δ4. Θεωρούμε τον δειγματικό χώρο Ω = t n, n = 1, 2, 3,..., 30: 0 < t 1 < t 2 <... < t 10 < 1 e < t 11 <... < t 30 = 1 με ισοπίθανα απλά ενδεχόμενα, καθώς και τα ενδεχόμενα Α= { t Ω: η εφαπτομένη της γραφικής παράστασης της f στο σημείο (t,f(t)), να σχηματίζει με τον άξονα x x οξεία γωνία}, Β = { t Ω: f(t) > f (t)+1}, όπου f(t) = t lnt + 2 Να βρεθούν οι πιθανότητες: α) να πραγματοποιηθεί το ενδεχόμενο Α (μονάδες 3) β) να πραγματοποιηθούν συγχρόνως τα ενδεχόμενα Α και Β (μονάδες 4) Μονάδες 7 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μην γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και ΜΟΝΟ για πίνακες, διαγράμματα κλπ.. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. 234

17 Γενικής Παιδείας 2013 Νεοελληνική Γ λώσσα 235

18 Γενικής Παιδείας 2013 Νεοελληνική Γλώσσα ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΚΕΙΜΕΝΟ Τη ζωή στη Γη ο άνθρωπος ελάχιστα την σέβεται, η ζωή όμως σε άλλους κόσμους διεγείρει το ενδιαφέρον και τη φαντασία του. Είναι άραγε περιέργεια, κατακτητική διάθεση ή απλώς ένα διανοητικό παιχνίδι; Ίσως όλα μαζί, ταυτόχρονα όμως κι ένα βαθύ αίσθημα μοναξιάς. Άλλωστε τη ζωή του εδώ ο άνθρωπος την έχει καταστήσει πιεστική και ανούσια. Περιμένει λοιπόν ένα χέρι βοηθείας και παρηγοριάς από τους πλανήτες και τα μακρινά άστρα. Ακόμη όμως και αν δεχθούμε με αισιοδοξία ότι η ζωή δεν ανθίζει μόνον στη Γη, αλλά ότι αφθονεί στο Σύμπαν, ένας άλλος καθοριστικός παράγοντας ορθώνεται. Είναι ανάγκη να συνειδητοποιηθεί όσο και αν αντιτίθεται στις ενδόμυχες επιθυμίες μας ότι με τη ζωή αυτή η επικοινωνία εμφανίζεται, για το ορατό τουλάχιστον μέλλον, ανέφικτη. Με τη ζωή λοιπόν στο Σύμπαν είναι αδύνατο να επικοινωνήσουμε, η ζωή όμως γύρω μας ανθίζει. Η ζωή εδώ, σ έναν μικρό και πανέμορφο πλανήτη, ανέδειξε ύστερα από σιωπηλές διεργασίες που διήρκεσαν δισεκατομμύρια χρόνια μια θαυμαστή ποικιλία έμβιων όντων. Οι θάλασσες και τα δάση της Γης, τα βουνά και οι πεδιάδες της αποκαλύπτουν κάθε στιγμή τη γοητεία που κρύβουν τα χιλιάδες όμοια ή ανόμοια δημιουργήματα της εξελίξεως. Η ανεμώνη και το δελφίνι, ο αίλουρος αλλά και ο γυπαετός, τα ανθρώπινα όντα στις πολλαπλές φυλετικές τους παραλλαγές, είναι δίπλα μας, συμμέτοχα του ίδιου πλανήτη και του μέλλοντός του. Αποκαλύπτεται όμως επίσης σε όλη του την τραγική αντίφαση ότι ο άνθρωπος, αυτή η περιούσια κορύφωση της εξελίξεως, έχει διπλή υπόσταση. Από τη μια είναι ικανός για μεγάλες πράξεις, έμαθε με την επιστημονική του γνώση να κατανοεί τον κόσμο αλλά και γέννησε αριστουργήματα στον λόγο και στην τέχνη. Από την άλλη, ο ίδιος ο άνθρωπος σφραγίζει την ιστορική πορεία του με πολέμους και αγριότητες, θεοποιεί τα υλικά αγαθά και συντηρεί την αδικία και τις ανισότητες. Ελάχιστα, τέλος, σέβεται τις πολλαπλές εκφράσεις της ζωής, ενώ η φύση και οι θάλασσες του πλανήτη είναι συχνά τα θύματα των συμφερόντων του. Η υπερφίαλη αυτή στάση του ανθρώπου έχει αλλοιώσει έτσι ένα θαυμαστό περιβάλλον, που ωστόσο υπήρξε και το λίκνο της δικής του υπάρξεως. Είναι λοιπόν καιρός να κατανοήσει ο άνθρωπος ότι η ζωή αλλού ίσως υπάρχει, αλλά η προσδοκία να την συναντήσει δεν θα πραγματωθεί εύκολα. Η ζωή όμως στη Γη ανθίζει ακόμα και τον περιμένει. Αν όσο είναι ακόμα καιρός τείνει το χέρι του προς τη ζωή αυτή, το φυτικό και ζωικό της θαύμα, τον Άλλο και τους άλλους, ίσως αισθανθεί λίγο πιο άξιος έποικος της Γης. Έτσι είναι σοφότερο να εξαντλήσουμε τις προσπάθειες για καλύτερη επικοινωνία, εδώ στη Γη. Το περίεργο ωστόσο είναι ότι, όσο η επικοινωνία αυτή πυκνώνει με το ηλεκτρονικό ταχυδρομείο, το διαδίκτυο και τα κινητά τηλέφωνα, τόσο η μοναξιά μας, η ανθρώπινη, μεγαλώνει και η αποξένωση κυριαρχεί. Φαίνεται ότι αυτό που απαιτείται είναι κάτι περισσότερο από την τεχνολογική έκρηξη της εποχής: απαιτείται βαθύτερη παιδεία και ουσιαστικότερες αξίες του πολιτισμού. Οι εφιάλτες, άλλωστε, από τα περιβαλλοντικά προβλήματα πληθαίνουν, και η Γη δεν φαίνεται να αντέχει για καιρό ακόμα την αφροσύνη μας. Σημασία επομένως δεν έχει να συναντηθούμε αν ποτέ συναντηθούμε στο πολύ μακρινό μέλλον με κάποια όμοια ή ανόμοια με μας δημιουργήματα της εξελίξεως. Το σπουδαίο θα ήταν να μπορούμε τότε να υπερηφανευθούμε, σε χιλιάδες ή εκατομμύρια χρόνια, ότι το ανθρώπινο είδος έχει κατακτήσει υψηλά επίπεδα ισότητας και αξιών, και ότι οι πόλεμοι έχουν εκλείψει και ότι η Γη, το λίκνο της ανθρώπινης ζωής, έχει επουλώσει τις πληγές στις θάλασσες, τα δάση 236

19 ή την ατμόσφαιρά της, και είναι πάλι ένας πανέμορφος πλανήτης. Διάσπαρτα άλλωστε, εδώ ή εκεί, θα βρίσκονται πάντοτε τα επιτεύγματα των σπουδαίων πολιτισμών, που αιώνες τώρα συνοδεύουν τη διαδρομή του ανθρώπου. Η «εξωγήινη μοναξιά», λοιπόν, δεν φαίνεται ότι θα εγκαταλείψει εύκολα τον άνθρωπο. Η γήινή του ωστόσο μοναξιά, που είναι επικίνδυνη και πιο ανάλγητη, είναι μεγάλη ανάγκη να απαλυνθεί. Τότε θα αναδειχθεί η μοναδικότητα του κάθε ανθρώπου, και η αναζήτηση της εξωγήινης ζωής θα αποκτήσει άλλο περιεχόμενο και νόημα. Γιώργος Γραμματικάκης, Ένας Αστρολάβος του Ουρανού και της Ζωής. Πανεπιστημιακές Εκδόσεις Κρήτης, Ηράκλειο η έκδοση (Διασκευή). A1. Να γράψετε στο τετράδιό σας την περίληψη του κειμένου που σας δόθηκε ( λέξεις). Μονάδες 25 Β1. Να αναπτύξετε σε μία παράγραφο 100 έως 120 λέξεων το περιεχόμενο του αποσπάσματος που ακολουθεί: «όσο η επικοινωνία [ ] πυκνώνει με το ηλεκτρονικό ταχυδρομείο, το διαδίκτυο και τα κινητά τηλέφωνα, τόσο η μοναξιά μας, η ανθρώπινη, μεγαλώνει και η αποξένωση κυριαρχεί». Μονάδες 10 Β2. α) Να βρείτε τα δομικά στοιχεία της τρίτης παραγράφου του κειμένου: «Αποκαλύπτεται όμως υπάρξεως». Μονάδες 3 β) Να βρείτε μέσα στο κείμενο τέσσερα παραδείγματα μεταφορικής χρήσης του λόγου. Μονάδες 4 Β3. α) Να γράψετε ένα συνώνυμο για καθεμιά από τις παρακάτω λέξεις του κειμένου: ταυτόχρονα, γέννησε, αισθανθεί, πληθαίνουν, ανάλγητη β) Να γράψετε ένα αντώνυμο για καθεμιά από τις παρακάτω λέξεις του κειμένου: ανούσια, εμφανίζεται, ανέφικτη, πυκνώνει, υψηλά Β4. α) Να αιτιολογήσετε τη χρήση του ερωτηματικού («Είναι άραγε περιέργεια, κατακτητική διάθεση ή απλώς ένα διανοητικό παιχνίδι;») (μονάδες 3), καθώς και της διπλής παύλας («όσο και αν αντιτίθεται στις ενδόμυχες επιθυμίες μας») που υπάρχουν στην πρώτη παράγραφο του κειμένου (μονάδες 2). β) Να μετατρέψετε την ενεργητική σύνταξη σε παθητική στο απόσπασμα που ακολουθεί: «Από την άλλη, ο ίδιος ο άνθρωπος σφραγίζει την ιστορική πορεία του με πολέμους και αγριότητες, θεοποιεί τα υλικά αγαθά και συντηρεί την αδικία και τις ανισότητες». Μονάδες 3 Γ1. Σε άρθρο που πρόκειται να αναρτηθεί στην επίσημη ιστοσελίδα του σχολείου σας να εκθέσετε τις απόψεις σας σχετικά με: α) τις επιπτώσεις που έχει προκαλέσει η έλλειψη σεβασμού του ανθρώπου προς το φυσικό περιβάλλον και β) τους τρόπους με τους οποίους μπορεί ο άνθρωπος να αποκαταστήσει τη σχέση του με αυτό ( λέξεις). Μονάδες

20 Γενικής Παιδείας 2013 Νεοελληνική Γλώσσα ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα Ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. 4. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. 238

21 Γενικής Παιδείας 2013 Φυσική 239

22 Γενικής Παιδείας 2013 Φυσική ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. A1. Η τιμή του δείκτη διάθλασης του χαλαζία α) είναι ανεξάρτητη από την τιμή του μήκους κύματος της ορατής ακτινοβολίας στο κενό β) ελαττώνεται, όταν ελαττώνεται η τιμή του μήκους κύματος της ορατής ακτινοβολίας στο κενό γ) ελαττώνεται, όταν αυξάνεται η τιμή του μήκους κύματος της ορατής ακτινοβολίας στο κενό δ) είναι ανεξάρτητη από τη συχνότητα της ορατής ακτινοβολίας. A2. Εάν U είναι η δυναμική ενέργεια και Κ η κινητική ενέργεια του ηλεκτρονίου, όταν βρίσκεται σε ορισμένη κυκλική τροχιά στο άτομο του υδρογόνου, σύμφωνα με το πρότυπο του Bohr, τότε ισχύει: α) U = K β) U = K γ) U = K 2 δ) U = 2 K A3. Δίνονται οι πυρήνες C, 8 O, 16, Si, ,46 MeV, 7,57 MeV. Ο σταθερότερος πυρήνας είναι ο πυρήνας του: α) 12 6 C β) 16 8 O γ) Si U με αντίστοιχες ενέργειες σύνδεσης ανά νουκλεόνιο 7,68 MeV, 7,97 MeV, δ) U A4. Το πρότυπο του Rutherford (Ράδερφορντ) για το άτομο ενός στοιχείου: α) εξηγεί τα γραμμικά φάσματα εκπομπής των αερίων β) εξηγεί την απόκλιση των σωματιδίων α κατά γωνίες που πλησιάζουν τις στο πείραμα του Rutherford γ) προβλέπει κατανομή του θετικού φορτίου στο άτομο όμοια με αυτήν του προτύπου του Thomson (Τόμσον) δ) προβλέπει ότι η στροφορμή του ηλεκτρονίου είναι κβαντωμένη. Α5. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιο σας, δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή τη λέξη Λάθος, αν η πρόταση είναι λανθασμένη. α) Κατά τη διάδοση του ηλεκτρομαγνητικού κύματος στο κενό οι εντάσεις των πεδίων Ε και Β διαδίδονται με την ίδια ταχύτητα. β) Η ακτινοβολία που έχει μήκος κύματος στο κενό 800 nm είναι υπέρυθρη. γ) Οι αποστάσεις μεταξύ των ενεργειακών σταθμών στον πυρήνα είναι μερικά ΜeV. 240

23 δ) Τα οστά του ανθρώπου απορροφούν λιγότερο τις ακτίνες Χ από ό,τι οι ιστοί του. ε) Η ισχυρή πυρηνική δύναμη υπερνικά την αμοιβαία ηλεκτρική άπωση μεταξύ των πρωτονίων ενός σταθερού πυρήνα. Θέμα Β Β1. Πυρήνας Β με ατομικό αριθμό Ζ 1 και μαζικό αριθμό Α 1 μεταστοιχειώνεται σε πυρήνα Δ με ατομικό αριθμό Ζ 2 και μαζικό αριθμό Α 2 μέσω μιας διάσπασης β και μιας διάσπασης α, περνώντας από την ενδιάμεση κατάσταση Γ, όπως φαίνεται στην αντίδραση Τότε ισχύει : i Α 2 = Α 1 4 και Ζ 2 = Ζ 1 1 ii Α 2 = Α και Ζ 2 = Ζ 1 1 iii Α 2 = Α 1 4 και Ζ 2 = Ζ α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 Β2. Αν αυξήσουμε κατά 25% την τάση μεταξύ ανόδου-καθόδου κατά την παραγωγή ακτίνων Χ, τότε το ελάχιστο μήκος κύματος: i αυξάνεται κατά 25% ii μειώνεται κατά 25% iii μειώνεται κατά 20% α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 Β3. Δύο ραδιοφωνικοί σταθμοί Α και Β εκπέμπουν σε συχνότητες f A και f Β με f A > f Β, ενώ έχουν την ίδια ακτινοβολούμενη ισχύ. Αν στον ίδιο χρόνο ο σταθμός Α εκπέμπει Ν A φωτόνια και ο σταθμός Β εκπέμπει Ν Β φωτόνια, τότε ισχύει ότι: i ΝA > ΝΒ ii ΝA = ΝΒ iii ΝA < ΝΒ α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 7 241

24 Γενικής Παιδείας 2013 Φυσική ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Γ Το ιόν του ηλίου He + είναι ένα υδρογονοειδές, για το οποίο ισχύει το πρότυπο του Bohr. Το διάγραμμα των τεσσάρων πρώτων επιτρεπόμενων ενεργειακών σταθμών του ιόντος ηλίου He+ φαίνεται στο παρακάτω σχήμα: Γ1. Πόση ενέργεια (σε ev) απαιτείται για τον ιονισμό του He +, αν το ηλεκτρόνιο βρίσκεται αρχικά στη θεμελιώδη κατάσταση; Μονάδες 6 Το ιόν του ηλίου He + απορροφά ένα φωτόνιο ενέργειας 51eV και μεταβαίνει από τη θεμελιώδη κατάσταση σε άλλη διεγερμένη. Γ2. Αν το ηλεκτρόνιο στη θεμελιώδη κατάσταση κινείται σε κυκλική τροχιά ακτίνας r 1 = 0, m, πόση θα είναι η ακτίνα της κυκλικής τροχιάς του ηλεκτρονίου στη διεγερμένη κατάσταση που θα προκύψει; Μονάδες 6 Γ3. Πόσες φορές θα αυξηθεί το μέτρο της στροφορμής του ηλεκτρονίου μετά τη διέγερση του ιόντος; Μονάδες 6 Γ4. Να μεταφέρετε το σχήμα των τεσσάρων πρώτων ενεργειακών σταθμών του He+ στο τετράδιό σας και να σχεδιάσετε όλες τις δυνατές μεταβάσεις του ηλεκτρονίου από τη διεγερμένη κατάσταση σε καταστάσεις χαμηλότερης ενέργειας, υπολογίζοντας τις τιμές ενέργειας των φωτονίων που εκπέμπονται. Μονάδες 7 Θέμα Δ Στο παρακάτω σχήμα φαίνεται η κάθετη τομή διάταξης που αποτελείται από δύο οπτικά υλικά Ι και ΙΙ με δείκτες διάθλασης n Ι = 1,5 και n ΙI = 1,8, αντίστοιχα. Οι γεωμετρικές διαστάσεις της διάταξης είναι: ΑΒ = ΒΓ = ΕΖ = ΖΗ = AH 2 = 1 cm, ΔΓ = ΔΕ = _ 2 cm ενώ οι τρεις γωνίες Â, Δˆ, Ηˆ, είναι όλες Τα σημεία Κ και Λ βρίσκονται στο μέσο των αποστάσεων ΔΕ και ΔΓ, αντίστοιχα. 242

25 Μία μονοχρωματική ακτίνα φωτός με μήκος κύματος λ 0 = 400 nm στο κενό διέρχεται από τη διάταξη, ακολουθώντας τη διαδρομή που δείχνει το σχήμα. Δίνεται ότι η ακτίνα εισέρχεται κάθετα στη διάταξη από την επιφάνεια ΑΗ στο σημείο Μ, ανακλάται πλήρως στα σημεία Κ και Λ των επιφανειών ΔΕ και ΔΓ, αντίστοιχα, και στη συνέχεια εξέρχεται από τη διάταξη κάθετα στην επιφάνεια ΑΗ στο σημείο Ν. Δ1. Ποια είναι η ενέργεια καθενός φωτονίου της φωτεινής ακτίνας, όταν αυτή διέρχεται από το υλικό Ι; Δ2. Σε πόσα μήκη κύματος της ακτινοβολίας στο υλικό ΙΙ αντιστοιχεί η συνολική διαδρομή της ακτίνας στο υλικό αυτό; Μονάδες 6 Δ3. Να βρεθεί ο συνολικός χρόνος που απαιτείται για τη διέλευση της ακτίνας από τη διάταξη, από τη στιγμή εισόδου της στο σημείο Μ μέχρι τη στιγμή εξόδου της από το σημείο Ν. Μονάδες 7 Στη συνέχεια, αφαιρούμε το υλικό Ι από την οπτική διάταξη και επαναλαμβάνουμε το πείραμα με την ίδια μονοχρωματική ακτίνα, τοποθετώντας το υλικό ΙΙ που απομένει σε θερμικά μονωμένο περιβάλλον. Δ4. Αν γνωρίζουμε ότι το υλικό ΙΙ απορροφά το 5% της διαδιδόμενης σε αυτό ακτινοβολίας, να υπολογίσετε τον αριθμό των φωτονίων που πρέπει να εισέλθουν στο υλικό αυτό για να αυξηθεί η θερμοκρασία του κατά 2 0 C. Δίνεται ότι για να αυξηθεί η θερμοκρασία του υλικού ΙΙ κατά 2 0 C απαιτούνται 20 J. Μονάδες 7 Δίνονται : η ταχύτητα του φωτός στο κενό : c 0 = m/s, η σταθερά του Planck h = 6, J s, 1 nm = 10 9 m, ημ = 45 0 = συν 45 0 = _

26 Γενικής Παιδείας 2013 Φυσική ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μην γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και ΜΟΝΟ για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 244

27 Θετικής Κατεύθυνσης 2013 Βιολογία 245

28 Θετικής Κατεύθυνσης 2013 Βιολογία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το α. νουκλεοτίδιο β. πολύσωμα γ. νουκλεόσωμα δ. κεντρομερίδιο Α2. Επιδιορθωτικά ένζυμα χρησιμοποιούνται από το κύτταρο κατά α. τη μεταγραφή β. την αντιγραφή γ. την ωρίμανση δ. τη μετάφραση Α3. Το ένζυμο που προκαλεί τη διάσπαση των δεσμών υδρογόνου στη θέση έναρξης της αντιγραφής είναι α. η DNA ελικάση β. η RNA πολυμεράση γ. η DNA δεσμάση δ. το πριμόσωμα Α4. Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας α. πρωτεΐνες β. πλασμίδια γ. αντισώματα δ. μικροοργανισμοί Α5. Το σύνδρομο φωνή της γάτας (cri-du-chat) οφείλεται α. σε έλλειψη ενός τμήματος χρωμοσώματος β. σε γονιδιακή μετάλλαξη γ. σε έλλειψη ενός χρωμοσώματος δ. σε διπλασιασμό ενός χρωμοσωμικού τμήματος 246

29 ΘΕΜΑ Β Β1. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για πρώτη φορά το 1990 στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Μονάδες 8 Β2. Να περιγράψετε τη μέθοδο της μικροέγχυσης. Μονάδες 6 Β3. Ποιες πληροφορίες περιέχει το μιτοχονδριακό DNA και γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια; Μονάδες 6 Β4. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; ΘΕΜΑ Γ Σε ένα είδος εντόμου το χρώμα των ματιών μπορεί να είναι είτε κόκκινο είτε άσπρο, ενώ το μέγεθος των φτερών είτε φυσιολογικό είτε ατροφικό. Τα παραπάνω χαρακτηριστικά οφείλονται σε γονίδια που εδράζονται σε διαφορετικά χρωμοσώματα. Στο έντομο αυτό, το φύλο καθορίζεται όπως και στον άνθρωπο. Τα γονίδια για το κόκκινο χρώμα ματιών και το φυσιολογικό μέγεθος φτερών είναι επικρατή και το γονίδιο του μεγέθους των φτερών είναι αυτοσωμικό. Από τη διασταύρωση δύο εντόμων προέκυψαν 800 απόγονοι με τις παρακάτω αναλογίες: 150 θηλυκά με φυσιολογικά φτερά και κόκκινα μάτια 150 αρσενικά με φυσιολογικά φτερά και κόκκινα μάτια 150 θηλυκά με φυσιολογικά φτερά και άσπρα μάτια 150 αρσενικά με φυσιολογικά φτερά και άσπρα μάτια 50 θηλυκά με ατροφικά φτερά και κόκκινα μάτια 50 αρσενικά με ατροφικά φτερά και κόκκινα μάτια 50 θηλυκά με ατροφικά φτερά και άσπρα μάτια 50 αρσενικά με ατροφικά φτερά και άσπρα μάτια Γ1. Να γράψετε τους γονοτύπους των γονέων όσον αφορά το μέγεθος των φτερών (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Μονάδες 6 Γ2. Με βάση τις αναλογίες των απογόνων της συγκεκριμένης διασταύρωσης να διερευνήσετε τους πιθανούς τρόπους κληρονόμησης του χαρακτήρα για το χρώμα των ματιών και να γράψετε τους πιθανούς γονοτύπους των γονέων (μονάδες 6). Να αιτιολογήσετε την απάντησή σας (μονάδες 8). Μονάδες 14 Γ3. Μερικές φορές οι φαινοτυπικές αναλογίες των απογόνων δεν είναι αυτές που αναμένονται από τους νόμους του Mendel. Να αναφέρετε ονομαστικά πέντε τέτοιες περιπτώσεις. 247

30 Θετικής Κατεύθυνσης 2013 Βιολογία ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Δ Παρακάτω σας δίνονται τέσσερις μονόκλωνες αλυσίδες DNA: AAATGAAACCAGGATAAG AATTCGGGGGGC AATTCTTATCCTGGTTTCATTT AATTGCCCCCCG-3 Οι αλυσίδες αυτές τοποθετούνται σε κατάλληλο περιβάλλον υβριδοποίησης. Δ1. Να γράψετε τα μόρια DNA που θα προκύψουν μετά την υβριδοποίηση, τα οποία θα ονομάσετε υβριδοποιημένο μόριο 1 και υβριδοποιημένο μόριο 2. Μονάδες 2 Δ2. Στο ένα από τα δύο υβριδοποιημένα μόρια DNA που θα προκύψουν εμπεριέχεται γονίδιο, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. Να γράψετε το mrna που θα προκύψει (μονάδα 1) και να αιτιολογήσετε την απάντησή σας (μονάδες 2). Μονάδες 3 Δ3. Το πεπτίδιο που προκύπτει από τη μετάφραση του παραπάνω mrna είναι: H 2 N Μεθειονίνη Λυσίνη Προλίνη Γλυκίνη COOH Ποιο είναι το αντικωδικόνιο του trna που θα τοποθετηθεί στο ριβόσωμα μετά την αποσύνδεση του trna, το οποίο μεταφέρει το αμινοξύ λυσίνη (μονάδες 2); Να αιτιολογήσετε την απάντησή σας (μονάδες 6). Μονάδες 8 Δ4. Στα υβριδοποιημένα μόρια 1 και 2 προστίθεται το ένζυμο DNA δεσμάση. Να γράψετε τα πιθανά ανασυνδυασμένα μόρια DNA που θα προκύψουν από την δράση της DNA δεσμάσης, σημειώνοντας τους προσανατολισμούς των αλυσίδων (μονάδες 4) και αιτιολογώντας την απάντησή σας (μονάδες 4). Εάν στη συνέχεια προστεθεί η περιοριστική ενδονουκλεάση EcoRI, να εξηγήσετε πόσα τμήματα DNA θα προκύψουν (μονάδες 4). Μονάδες 12 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. 248

31 Θετικής Κατεύθυνσης 2013 Μαθηματικά 249

32 Θετικής Κατεύθυνσης 2013 Μαθηματικά ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΘΕΜΑ Α A1. Έστω f μια συνεχής συνάρτηση σε ένα διάστημα [α, β]. Αν G είναι μια παράγουσα της f στο [α, β], τότε να αποδείξετε ότι: A2. Να διατυπώσετε το Θεώρημα Μέσης Τιμής του Διαφορικού Λογισμού (Θ.Μ.Τ.) A3. Πότε λέμε ότι μια συνάρτηση f είναι παραγωγίσιμη σε ένα κλειστό διάστημα [α, β] του πεδίου ορισμού της; Μονάδες 7 Μονάδες 4 Μονάδες 4 A4. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη. α) Η εξίσωση z z 0 = ρ, ρ>0 παριστάνει τον κύκλο με κέντρο το σημείο K (z 0 ) και ακτίνα ρ 2, όπου z, z 0 μιγαδικοί αριθμοί. β) Αν lim f(x) < 0, τότε f (x) < 0 κοντά στο x 0 x x 0 γ) Ισχύει ότι: ημx x για κάθε x R δ) Ισχύει ότι: ε) Μια συνεχής συνάρτηση f διατηρεί πρόσημο σε καθένα από τα διαστήματα στα οποία οι διαδοχικές ρίζες της f χωρίζουν το πεδίο ορισμού της. Μονάδες 10 ΘΕΜΑ Β Θεωρούμε τους μιγαδικούς αριθμούς z για τους οποίους ισχύει: (z 2)( _ z 2) + z 2 = 2 B1. Να αποδείξετε ότι ο γεωμετρικός τόπος των εικόνων των μιγαδικών z, είναι κύκλος με κέντρο K(2,0) και ακτίνα ρ = 1 (μονάδες 5) Στη συνέχεια, για κάθε μιγαδικό z που ανήκει στον παραπάνω γεωμετρικό τόπο, να αποδείξετε ότι z 3 (μονάδες 3) Μονάδες 8 B2. Αν οι μιγαδικοί αριθμοί z 1, z 2 που ανήκουν στον παραπάνω γεωμετρικό τόπο είναι ρίζες της εξίσωσης w 2 + βw + γ = 0, με w μιγαδικό αριθμό, β,γ R, και Im (z 1 ) Im (z 2 ) = 2 τότε να αποδείξετε ότι: β = 4 και γ = 5 Μονάδες 9 250

33 B3. Θεωρούμε τους μιγαδικούς αριθμούς α 0, α 1, α 2 οι οποίοι ανήκουν στον γεωμετρικό τόπο του ερωτήματος Β1. Αν ο μιγαδικός αριθμός v ικανοποιεί τη σχέση: v 3 + α 2 v 2 + α 1 v + α 0 = 0 τότε να αποδείξετε ότι: v < 4 ΘΕΜΑ Γ Θεωρούμε τις συναρτήσεις f,g :R R, με f παραγωγίσιμη τέτοιες ώστε: (f (x) + x) (f (x) + 1) = x, για κάθε x R f (0) = 1 και g(x) = x 3 + 3x2 2 1 Μονάδες 8 Γ1. Να αποδείξετε ότι: Μονάδες 9 Γ2. Να βρείτε το πλήθος των πραγματικών ριζών της εξίσωσης f (g(x)) = 1 Μονάδες 8 Γ3. Να αποδείξετε ότι υπάρχει τουλάχιστον ένα x 0 τέτοιο, ώστε: Μονάδες 8 ΘΕΜΑ Δ Έστω f: (0, + ) R μια παραγωγίσιμη συνάρτηση για την οποία ισχύουν: Η f είναι γνησίως αύξουσα στο (0, + ) f (1) = 1 lim f(1 + 5h) f(1 h) = 0 h 0 h Θεωρούμε επίσης τη συνάρτηση Να αποδείξετε ότι: Δ1. f (1) = 0 (μονάδες 4), καθώς επίσης ότι η f παρουσιάζει ελάχιστο στο x 0 = 1 (μονάδες 2). Μονάδες 6 251

34 Θετικής Κατεύθυνσης 2013 Μαθηματικά ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ2. η g είναι γνησίως αύξουσα (μονάδες 3), και στη συνέχεια, να λύσετε την ανίσωση στο R (μονάδες 6) Μονάδες 9 Δ3. η g είναι κυρτή, καθώς επίσης ότι η εξίσωση έχει ακριβώς μια λύση. Μονάδες 10 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μην γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, και μόνο για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. 252

35 Θετικής Κατεύθυνσης 2013 Φυσική 253

36 Θετικής Κατεύθυνσης 2013 Φυσική ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. A1. Περιπολικό ακολουθεί αυτοκίνητο που έχει παραβιάσει το όριο ταχύτητας. Τα δύο αυτοκίνητα κινούνται με ίσες ταχύτητες. Αν η σειρήνα του περιπολικού εκπέμπει ήχο συχνότητας f S, τότε, η συχνότητα f A που αντιλαμβάνεται ο οδηγός του άλλου αυτοκινήτου είναι: α) f A = 2 f S 1 β) f Α = 2 f S γ) f A = f S δ) f A = 0 A2. Διακρότημα δημιουργείται από τη σύνθεση δύο απλών αρμονικών ταλαντώσεων ίδιας διεύθυνσης, με ίδιο πλάτος, γύρω από την ίδια θέση ισορροπίας, όταν οι ταλαντώσεις αυτές έχουν: α) ίσες συχνότητες και ίδια φάση β) ίσες συχνότητες και διαφορά φάσης γ) παραπλήσιες συχνότητες δ) ίσες συχνότητες και διαφορά φάσης π. π 2 A3. Σε μια μηχανική ταλάντωση της οποίας το πλάτος φθίνει χρονικά ως Α = Α 0 e Λt, όπου Α 0 είναι το αρχικό πλάτος της ταλάντωσης και Λ είναι μια θετική σταθερά, ισχύει ότι: α) οι μειώσεις του πλάτους σε κάθε περίοδο είναι σταθερές β) η δύναμη αντίστασης είναι F αντ = - b υ 2, όπου b είναι η σταθερά απόσβεσης και υ η ταχύτητα του σώματος που ταλαντώνεται γ) η περίοδος Τ της ταλάντωσης μειώνεται με το χρόνο για μικρή τιμή της σταθεράς απόσβεσης b δ) η δύναμη αντίστασης είναι F αντ = - b υ, όπου b είναι η σταθερά απόσβεσης και υ η ταχύτητα του σώματος που ταλαντώνεται. A4. Κατά τη διάδοση ηλεκτρομαγνητικού κύματος στο κενό, σε μεγάλη απόσταση από την πηγή, ισχύει ότι: α) στη θέση που η ένταση Ε του ηλεκτρικού πεδίου είναι μηδέν, η ένταση Β του μαγνητικού πεδίου είναι μέγιστη β) τα διανύσματα των εντάσεων Ε του ηλεκτρικού και Β του μαγνητικού πεδίου είναι παράλληλα μεταξύ τους γ) το διάνυσμα της έντασης Ε του ηλεκτρικού πεδίου είναι κάθετο στη διεύθυνση διάδοσης του ηλεκτρομαγνητικού κύματος δ) το διάνυσμα της έντασης Β του μαγνητικού πεδίου είναι παράλληλο στη διεύθυνση διάδοσης του ηλεκτρομαγνητικού κύματος. 254

37 Α5. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιο σας, δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή τη λέξη Λάθος, αν η πρόταση είναι λανθασμένη. α) Το όζον της στρατόσφαιρας απορροφά κατά κύριο λόγο την επικίνδυνη υπεριώδη ακτινοβολία. β) Σε μια απλή αρμονική ταλάντωση αυξάνεται το μέτρο της ταχύτητας του σώματος που ταλαντώνεται καθώς αυξάνεται το μέτρο της δύναμης επαναφοράς. γ) Κατά τη διάδοση μηχανικού κύματος μεταφέρεται ορμή από ένα σημείο του μέσου στο άλλο. δ) Σε στερεό σώμα σφαιρικού σχήματος που στρέφεται με σταθερή γωνιακή ταχύτητα γύρω από άξονα διερχόμενο από το κέντρο του ισχύει πάντα ΣF = 0. ε) Έκκεντρη ονομάζεται η κρούση κατά την οποία οι ταχύτητες των κέντρων μάζας των δύο σωμάτων που συγκρούονται είναι παράλληλες αλλά μη συγγραμμικές. Θέμα Β Β1. Στο κύκλωμα του σχήματος ο πυκνωτής χωρητικότητας C = F είναι φορτισμένος σε τάση V c = 20 V και το ιδανικό πηνίο έχει συντελεστή αυτεπαγωγής L = H. Τη χρονική στιγμή t 0 = 0 κλείνουμε το διακόπτη δ. Κάποια μεταγενέστερη χρονική στιγμή t 1, το φορτίο του πυκνωτή είναι μηδέν και η ένταση του ρεύματος που διαρρέει το πηνίο είναι 6 Α. Από τη στιγμή t 0 έως τη στιγμή t 1 η συνολική ενέργεια της ηλεκτρικής ταλάντωσης μειώθηκε κατά: i) J ii) J iii) J α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 Β2. Δύο σύγχρονες πηγές κυμάτων Π 1 και Π 2 που βρίσκονται αντίστοιχα στα σημεία Κ και Λ της επιφάνειας υγρού παράγουν πανομοιότυπα εγκάρσια αρμονικά κύματα με ίδιο πλάτος, ίσες συχνότητες f 1 και ίσα μήκη κύματος λ 1. Αν η απόσταση των σημείων Κ και Λ είναι d = 2 λ 1, τότε δημιουργούνται τέσσερις υπερβολές απόσβεσης, μεταξύ των σημείων Κ και Λ. 255

38 Θετικής Κατεύθυνσης 2013 Φυσική ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Αλλάζοντας την συχνότητα των δύο πηγών σε f 2 = 3 f 1 και διατηρώντας το ίδιο πλάτος, ο αριθμός των υπερβολών απόσβεσης, που δημιουργούνται μεταξύ των δύο σημείων Κ και Λ, είναι: i) 6 ii) 8 iii) 12 α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 7 Β3. Ένας δίσκος Δ 1 με ροπή αδράνειας Ι 1 στρέφεται με γωνιακή ταχύτητα ω 1 και φορά περιστροφής όπως φαίνεται στο σχήμα, γύρω από σταθερό κατακόρυφο άξονα που διέρχεται από το κέντρο του και είναι κάθετος στο επίπεδό του. Ένας δεύτερος δίσκος Δ 2 με ροπή αδράνειας I 2 = I 14, που αρχικά είναι ακίνητος, τοποθετείται πάνω στο δίσκο Δ1, ενώ αυτός περιστρέφεται, έτσι ώστε να έχουν κοινό άξονα περιστροφής, που διέρχεται από τα κέντρα των δύο δίσκων, όπως δείχνει το σχήμα. Μετά από λίγο οι δύο δίσκοι αποκτούν κοινή γωνιακή ταχύτητα ω. Αν L 1 είναι το μέτρο της αρχικής στροφορμής του δίσκου Δ 1, τότε το μέτρο της μεταβολής της στροφορμής του δίσκου Δ 1 είναι: i) 0 ii) 1 5 L 1 iii) 2 5 L 1 α) Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 β) Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 256

39 Θέμα Γ Σώμα Σ 1 με μάζα m 1 κινείται σε οριζόντιο επίπεδο ολισθαίνοντας προς άλλο σώμα Σ 2 με μάζα m 2 = 2 m 1, το οποίο αρχικά είναι ακίνητο. Έστω υ 0 η ταχύτητα που έχει το σώμα Σ 1 τη στιγμή t 0 = 0 και ενώ βρίσκεται σε απόσταση d = 1m από το σώμα Σ 2. Αρχικά, θεωρούμε ότι το σώμα Σ 2 είναι ακίνητο πάνω στο επίπεδο δεμένο στο ένα άκρο οριζόντιου ιδανικού ελατηρίου με αμελητέα μάζα και σταθερά ελατηρίου k, και το οποίο έχει το φυσικό του μήκος l 0. Το δεύτερο άκρο του ελατηρίου είναι στερεωμένο σε ακλόνητο τοίχο, όπως φαίνεται στο σχήμα: Αμέσως μετά τη κρούση, που είναι κεντρική και ελαστική, το σώμα Σ 1 αποκτά ταχύτητα με μέτρο υ 1 = _ 10 m/s και φορά αντίθετη της αρχικής ταχύτητας. Δίνεται ότι ο συντελεστής τριβής ολίσθησης των δύο σωμάτων με το οριζόντιο επίπεδο είναι μ = 0,5 και ότι η επιτάχυνση της βαρύτητας είναι g = 10 m/s 2. Γ1. Να υπολογίσετε την αρχική ταχύτητα υ 0 του σώματος Σ 1. Μονάδες 6 Γ2. Να υπολογίσετε το ποσοστό της κινητικής ενέργειας που μεταφέρθηκε από το σώμα Σ 1 στο σώμα Σ 2 κατά την κρούση. Μονάδες 6 Γ3. Να υπολογίσετε το συνολικό χρόνο κίνησης του σώματος Σ 1 από την αρχική χρονική στιγμή t 0 μέχρι να ακινητοποιηθεί τελικά. Δίνεται : _ 10 3,2 Μονάδες 6 Γ4. Να υπολογίσετε τη μέγιστη συσπείρωση του ελατηρίου, αν δίνεται ότι m 2 = 1kg και k = 105 N/m. Μονάδες 7 Θεωρήστε ότι η χρονική διάρκεια της κρούσης είναι αμελητέα και ότι τα δύο σώματα συγκρούονται μόνο μία φορά. 257

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ

Διαβάστε περισσότερα

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΑΡΑΣΚΕΥΗ 0 ΜΑÏΟΥ 011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ ο ΑΡΧΗ ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ου ΓΕΛ ΠΕΤΡΟΥΠΟΛΗΣ ΔΕΥΤΕΡΑ 3 ΜΑΪΟΥ 200 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ : ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ () Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΠΕΜΠΤΗ 27 MAΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5 ΘΕΜΑ 1 ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 29 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΠΤΑ (7) Για τις ημιτελείς

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 0 ΜΑΪΟΥ 015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Θέμα Α Στις ερωτήσεις Α1-Α4

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2008 ΘΕΜΑΤΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 29 ΜΑÏΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2002 ΘΕΜΑΤΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

3. Σε στάσιμο κύμα δύο σημεία του ελαστικού μέσου βρίσκονται μεταξύ δύο διαδοχικών δεσμών. Τότε τα σημεία αυτά έχουν

3. Σε στάσιμο κύμα δύο σημεία του ελαστικού μέσου βρίσκονται μεταξύ δύο διαδοχικών δεσμών. Τότε τα σημεία αυτά έχουν ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΕΥΤΕΡΑ 25 ΜΑÏΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Διαβάστε περισσότερα

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 53 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΣΑΒΒΑΪΔΗ-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 26 : Τηλ.: 2107601470 ΔΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 2013 ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 0 0 5 Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΘΕΜΑ 1 o Για τις ερωτήσεις 1 4, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ο Στι ερωτήσει - 4 να γράψετε στο τετράδιό σα τον αριθµό των ερώτηση και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Τροχό κυλίεται πάνω σε οριζόντιο

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΘΕΜΑ Α Ηµεροµηνία: Κυριακή 13 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ 1. ύο µονοχρωµατικές ακτινοβολίες Α και Β µε µήκη κύµατος στο κενό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 20 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΗΣ ΘΕΤΙΗΣ-ΤΕΧΝΟΛΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΕΙΟΥ Θέμα ο. ύλινδρος περιστρέφεται γύρω από άξονα που διέρχεται από το κέντρο μάζας του με γωνιακή ταχύτητα ω. Αν ο συγκεκριμένος κύλινδρος περιστρεφόταν

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΡΙΤΗ 10 ΙΟΥΝΙΟΥ 014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ

Διαβάστε περισσότερα

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ

ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ ΘΕΜΑ Α : Για να απαντήσετε στις παρακάτω ερωτήσεις πολλαπλής

Διαβάστε περισσότερα

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ ΘΕΜΑ Α Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί η σωστή απάντηση 1. Δίσκος κυλίεται χωρίς να ολισθαίνει με την επίδραση σταθερής οριζόντιας

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 17 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 17 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 17 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΚΕΙΜΕΝΟ Τη ζωή στη Γη ο άνθρωπος ελάχιστα

Διαβάστε περισσότερα

Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 2000-2015

Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 2000-2015 Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 000-05 Περιεχόµενα Θέµατα Επαναληπτικών 05............................................. 3 Θέµατα 05......................................................

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ) Θέμα Α Στις

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΣΤΗΝ ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ

ΕΚΦΩΝΗΣΕΙΣ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΣΤΗΝ ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΕΚΦΩΝΗΣΕΙΣ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΣΤΗΝ ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΚΕΙΜΕΝΟ Τη ζωή στη Γη ο άνθρωπος ελάχιστα την σέβεται, η ζωή όμως σε άλλους κόσμους διεγείρει το ενδιαφέρον και τη φαντασία του. Είναι άραγε περιέργεια,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 MAΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε

Διαβάστε περισσότερα

ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα φυσικά µεγέθη από τη Στήλη Ι και, δίπλα σε καθένα, τη µονάδα της Στήλης ΙΙ που αντιστοιχεί σ' αυτό.

ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα φυσικά µεγέθη από τη Στήλη Ι και, δίπλα σε καθένα, τη µονάδα της Στήλης ΙΙ που αντιστοιχεί σ' αυτό. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΕΣΠΕΡΙΝΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 5 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΠΤΑ (7) ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑ.Λ. (ΟΜΑ Α Β ) ΠΡΟΣΟΜΟΙΩΣΗ ΘΕΜΑΤΩΝ ΔΕΥΤΕΡΑ, 22 ΑΠΡΙΛΙΟΥ 201 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 20 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Δύο χορδές μιας κιθάρας Χ1, Χ2

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις 1 έως 4 να γράψετε στο τετράδιο σας τον αριθµό

Διαβάστε περισσότερα

Α1. Πράσινο και κίτρινο φως προσπίπτουν ταυτόχρονα και µε την ίδια γωνία πρόσπτωσης σε γυάλινο πρίσµα. Ποιά από τις ακόλουθες προτάσεις είναι σωστή:

Α1. Πράσινο και κίτρινο φως προσπίπτουν ταυτόχρονα και µε την ίδια γωνία πρόσπτωσης σε γυάλινο πρίσµα. Ποιά από τις ακόλουθες προτάσεις είναι σωστή: 54 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΣΑΒΒΑΪΔΗ-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 26 : Τηλ.: 2107601470 ΔΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 2014 ΘΕΜΑ Α Α1. Πράσινο και κίτρινο φως

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 MAΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ γ) Για την παράγωγο μιας σύνθετης συνάρτησης ισχύει (f(g(x))) =f (g(x)) g (x) Μονάδες 2

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ γ) Για την παράγωγο μιας σύνθετης συνάρτησης ισχύει (f(g(x))) =f (g(x)) g (x) Μονάδες 2 ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΣΑΒΒΑΤΟ 14 MAΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ

Διαβάστε περισσότερα

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ 9η Ολυμπιάδα Φυσικής Γ Λυκείου (Β φάση) Κυριακή 9 Μαρτίου 01 Ώρα:.00-1.00 ΟΔΗΓΙΕΣ: 1. Το δοκιμιο αποτελειται απο εννεα (9) σελιδες και επτα (7) θεματα.. Να απαντησετε σε ολα τα θεματα του δοκιμιου.. Μαζι

Διαβάστε περισσότερα

Για το Θέμα 1 στα Μαθηματικά Γενικής Παιδείας Γ Λυκείου

Για το Θέμα 1 στα Μαθηματικά Γενικής Παιδείας Γ Λυκείου Για το Θέμα 1 στα Μαθηματικά Γενικής Παιδείας Γ Λυκείου Διαφορικός Λογισμός 1. Ισχύει f (g())) ) f ( = f (g())g () όπου f,g παραγωγίσιµες συναρτήσεις 2. Αν µια συνάρτηση f είναι παραγωγίσιµη σε ένα διάστηµα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Φυσικών της Ώθησης 1 Τετάρτη, 20 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΦΥΣΙΚΗ ΘΕΜΑ Στις ημιτελείς προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα

Διαβάστε περισσότερα

α. f A = f s β. f A = f s υ + υ γ. f A = f s δ. f A =

α. f A = f s β. f A = f s υ + υ γ. f A = f s δ. f A = ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2001 ΘΕΜΑΤΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 29 ΜΑΪΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ ΘΕΜΑ 1 ο

Διαβάστε περισσότερα

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ;

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ; 45 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Χρυσ Σµύρνης 3 : Τηλ.: 107601470 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 006 ΘΕΜΑ 1 1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και, δίπλα, το γράμμα που αντιστοιχεί στη σωστή φράση η οποία συμπληρώνει σωστά την ημιτελή

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΤΑΞΗ: ΜΑΘΗΜΑ: Β ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 3 Μαΐου 015 ιάρκεια Εξέτασης: ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A Στις ηµιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθµό

Διαβάστε περισσότερα

ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ

ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ ΘΕΜΑ Α Στις ερωτήσεις -4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί η σωστή απάντηση. Ένας ακίνητος τρoχός δέχεται σταθερή συνιστάμενη ροπή ως προς άξονα διερχόμενο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 4 ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση..

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 5 ΧΡΟΝΙΑ ΕΜΠΕΙΡΙΑ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και, δίπλα, το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

: Γ ΛΥΚΕΙΟΥ. : Φυσική γενικής παιδείας. Εξεταστέα Ύλη : : ΝΙΚΟΛΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ. Ημερομηνία : 07-12-2014 ΘΕΜΑ 1 Ο

: Γ ΛΥΚΕΙΟΥ. : Φυσική γενικής παιδείας. Εξεταστέα Ύλη : : ΝΙΚΟΛΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ. Ημερομηνία : 07-12-2014 ΘΕΜΑ 1 Ο Τάξη Μάθημα : Γ ΛΥΚΕΙΟΥ : Φυσική γενικής παιδείας Εξεταστέα Ύλη : Καθηγητής : ΝΙΚΟΛΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ Ημερομηνία : 07-12-2014 ΘΕΜΑ 1 Ο Στις παρακάτω ερωτήσεις να βρείτε τη σωστή απάντηση: Α. Σύμφωνα με το

Διαβάστε περισσότερα

ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ

ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ Υλικό Φυσικής-Χημείας 1 ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ Υλικό Φυσικής-Χημείας 2 Το Φως 1) Δέσμη λευκού φωτός προσπίπτει στην επιφάνεια ενός πρίσματος όπως δείχνει το σχήμα και κατά την έξοδο από

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ ÎÕÓÔÑÁ

Γ' ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ ÎÕÓÔÑÁ 1 Γ' ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΦΥΣΙΚΗ ΘΕΜΑ 1 ο ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό κάθε µιας από τις παρακάτω ερωτήσεις 1- και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση 1. Ο ραδιενεργός

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 10 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΘΕΜΑ Στις ηµιτελείς προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ 28 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑΔΑ ΦΥΣΙΚΗΣ Β ΛΥΚΕΙΟΥ Κυριακή, 13 Απριλίου, 2014 Ώρα: 10:00-13:00 Παρακαλώ διαβάστε πρώτα τα πιο κάτω, πριν απαντήσετε οποιαδήποτε ερώτηση. Γενικές οδηγίες: 1.

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΑΓΙΟΥ ΣΠΥΡΙΔΩΝΑ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ

ΛΥΚΕΙΟ ΑΓΙΟΥ ΣΠΥΡΙΔΩΝΑ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ ΛΥΚΕΙΟ ΑΓΙΟΥ ΠΥΡΙΔΩΝΑ ΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 ΓΡΑΠΤΕ ΠΡΟΑΓΩΓΙΚΕ ΕΞΕΤΑΕΙ ΦΥΙΚΗ ΚΑΤΕΥΘΥΝΗ Β ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 31-05-2012 ΔΙΑΡΚΕΙΑ: 07.45 10.15 Οδηγίες 1. Το εξεταστικό δοκίμιο αποτελείται από 9 σελίδες.

Διαβάστε περισσότερα

α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος.

α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος. ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ. ΦΡΟΝΤΙΣΤΗΡΙΟ ΓΝΩΣΗ ΘΕΜΑ 1 1. Σε μια ελαστική κρούση δύο σωμάτων διατηρείται: α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος.

Διαβάστε περισσότερα

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ΘΕΜΑ 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘEMA 1 ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση A1.

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός)

Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός) 4 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός) Κυριακή, 5 Απριλίου, 00, Ώρα:.00 4.00 Προτεινόμενες Λύσεις Άσκηση ( 5 μονάδες) Δύο σύγχρονες πηγές, Π και Π, που απέχουν μεταξύ τους

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ ο Α) Στις ερωτήσεις 4 να σημειώσετε την σωστή. ) Σώμα εκτελεί απλή αρμονική ταλάντωση. Η συνολική δύναμη που δέχεται: (α) είναι σταθερή.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 03-01-11 ΘΕΡΙΝΑ ΣΕΙΡΑ Α ΘΕΜΑ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Οδηγία: Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη

Διαβάστε περισσότερα

23 2011 ΘΕΜΑ Α A1. Έστω μια συνάρτηση f ορισμένη σε ένα διάστημα Δ και x 0 ένα εσωτερικό σημείο του Δ. Αν η f παρουσιάζει τοπικό ακρότατο στο x 0 και είναι παραγωγίσιμη στο σημείο αυτό, να αποδείξετε ότι:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗ: ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΙΑΓΩΝΙΣΜΑ Ηµεροµηνία: Τετάρτη 7 Ιανουαρίου 05 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ A ΕΚΦΩΝΗΣΕΙΣ Στις ηµιτελείς προτάσεις Α Α4 να γράψετε

Διαβάστε περισσότερα

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΜΑΘΗΜΑ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Ένα σώµα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Για τις προτάσεις από Α1 µέχρι και Α5 να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς και δίπλα σε κάθε αριθµό τη λέξη Σωστό, αν η πρόταση είναι

Για τις προτάσεις από Α1 µέχρι και Α5 να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς και δίπλα σε κάθε αριθµό τη λέξη Σωστό, αν η πρόταση είναι ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ ΓΙΑ ΟΛΕΣ ΤΙΣ ΚΑΤΕΥΘΥΝΣΕΙΣ ΟΜΑ Α Α Για τις προτάσεις από Α1 µέχρι και Α5 να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς και δίπλα σε κάθε

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 014 Ε_3.ΦλΓΑΘΤ(ε) ΤΑΞΗ: Β ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗ: ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ & ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 7 Απριλίου 014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ A ΕΚΦΩΝΗΣΕΙΣ

Διαβάστε περισσότερα

Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ

Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ 1 Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ερωτήσεις 1 έως 4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 9 Μάθημα: ΦΥΣΙΚΗ 4ωρο Τ.Σ. Ημερομηνία και ώρα εξέτασης: Τρίτη Ιουνίου 9 11. 14. ΤΟ

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ. Αρµονικό κύµα διαδίδεται σε ένα εθύγραµµο ελαστικό µέσο. Όλα τα σηµεία το µέσο διάδοσης, πο ταλαντώνονται λόγω της διέλεσης

Διαβάστε περισσότερα

Μονάδες 5 Απαντήσεις Α5. Σ, Σ, Λ, Λ, Σ

Μονάδες 5 Απαντήσεις Α5. Σ, Σ, Λ, Λ, Σ ΠΑΝΕΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΟΥ ΥΕΙΟΥ & ΕΠΑ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΕΥΗ 5 ΜΑÏΟΥ 0 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΗ ΘΕΤΙΗΣ & ΤΕΧΝΟΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α-Α4 να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 Μάθηµα: ΦΥΣΙΚΗ Ηµεροµηνία και ώρα εξέτασης: Σάββατο, 4 Ιουνίου 2011 8:30 11:30

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Ο Να επιλέξετε τη σωστή απάντηση σε κάθε μία από τις ερωτήσεις - που ακολουθούν: Η ενεργός ταχύτητα των μορίων ορισμένης ποσότητας

Διαβάστε περισσότερα

ÊÏÑÕÖÇ ÊÁÂÁËÁ Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ. U 1 = + 0,4 J. Τα φορτία µετατοπίζονται έτσι ώστε η ηλεκτρική δυναµική ενέργεια

ÊÏÑÕÖÇ ÊÁÂÁËÁ Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ. U 1 = + 0,4 J. Τα φορτία µετατοπίζονται έτσι ώστε η ηλεκτρική δυναµική ενέργεια 1 ΘΕΜΑ 1 ο Β' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ 1. οχείο σταθερού όγκου περιέχει ορισµένη ποσότητα ιδανικού αερίου. Αν θερµάνουµε το αέριο µέχρι να τετραπλασιαστεί η απόλυτη θερµοκρασία

Διαβάστε περισσότερα

Επαναληπτικό διαγώνισµα στα Κύµατα

Επαναληπτικό διαγώνισµα στα Κύµατα ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 Επαναληπτικό διαγώνισµα στα Κύµατα Θέµα 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ 2014 ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ 2014 ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ 4 ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. Έστω μια συνάρτηση f ορισμένη σε ένα διάστημα Δ. Αν Η f είναι συνεχής στο Δ και f = για κάθε εσωτερικό σημείο του Δ τότε να αποδείξετε

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 9 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 6 : Τηλ.: 076070 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΥΚΕΙΟΥ 009 ΘΕΜΑ Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. Για τις παρακάτω ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και το γράµµα που αντιστοιχεί στην σωστή απάντηση

ΕΚΦΩΝΗΣΕΙΣ. Για τις παρακάτω ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και το γράµµα που αντιστοιχεί στην σωστή απάντηση B' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΖΗΤΗΜΑ 1 ΕΚΦΩΝΗΣΕΙΣ Για τις παρακάτω ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και το γράµµα που αντιστοιχεί στην σωστή απάντηση

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 00 ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α A. Έστω μια συνάρτηση ορισμένη σε ένα διάστημα. Αν F είναι μια παράγουσα της στο, τότε να αποδείξετε ότι:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ÅÐÉËÏÃÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ÅÐÉËÏÃÇ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 15 ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Α ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 1 Μαΐου 15 ιάρκεια Εξέτασης: ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ηµιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθµό

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ HMEΡΗΣΙΩΝ ΚΑΙ ΕΣΠΕΡΙΝΩΝ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α A ) ΚΑΙ ΜΑΘΗΜΑΤΩΝ ΕΙ ΙΚΟΤΗΤΑΣ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α Β ) ΤΡΙΤΗ 9 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΗΛΕΚΤΡΟΤΕΧΝΙΑ

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΙΣ ΤΑΛΑΝΤΩΣΕΙΣ

ΕΡΓΑΣΙΑ ΣΤΙΣ ΤΑΛΑΝΤΩΣΕΙΣ ΕΡΓΑΣΙΑ ΣΤΙΣ ΤΑΛΑΝΤΩΣΕΙΣ ΕΡΩΤΗΣΗ 1 Ένα σώμα εκτελεί κίνηση που οφείλεται στη σύνθεση δύο απλών αρμονικών ταλαντώσεων ίδιας διεύθυνσης, που γίνονται γύρω από το ίδιο σημείο, με το ίδιο πλάτος A και συχνότητες

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ ΓΙΑ ΟΛΕΣ ΤΙΣ ΚΑΤΕΥΘΥΝΣΕΙΣ ΟΜΑ Α Α

ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ ΓΙΑ ΟΛΕΣ ΤΙΣ ΚΑΤΕΥΘΥΝΣΕΙΣ ΟΜΑ Α Α ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ ΜΑΘΗΜΑ ΕΠΙΛΟΓΗΣ ΓΙΑ ΟΛΕΣ ΤΙΣ ΚΑΤΕΥΘΥΝΣΕΙΣ ΟΜΑ Α Α Για τις προτάσεις από Α1 µέχρι και A5 να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς και δίπλα σε κάθε αριθµό τη λέξη Σωστό,

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 0 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΘΕΜΑ Α Α. Αν η συνάρτηση f είναι παραγωγίσιμη στο R και c σταθερός πραγματικός αριθμός, να αποδείξετε με τη χρήση του

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα