ΟΕΦΕ ΜΑΘΗΜΑΤΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΟΕΦΕ ΜΑΘΗΜΑΤΑ 2013 83"

Transcript

1 ΟΕΦΕ ΜΑΘΗΜΑΤΑ

2 84

3 Γενικής Παιδείας 2013 Νεοελληνική Γ λώσσα 85

4 Γενικής Παιδείας 2013 Νεοελληνική Γλώσσα ΟΕΦΕ ΚΕΙΜΕΝΟ Οι «δηµοκρατικοί» αντίπαλοι της ηµοκρατίας «Σε µια δηµοκρατία», έγραψε ο Αµερικανός δικαστής Φίλιξ Φρανκφούρτερ, «το υψηλότερο αξίωµα είναι αυτό του πολίτη». Αυτό είναι µια άλλη ανάγνωση του πρώτου άρθρου στα συντάγµατα όλων των χωρών, που περίπου λένε ό,τι και το ελληνικό: «Θεµέλιο του πολιτεύµατος είναι η λαϊκή κυριαρχία. Όλες οι εξουσίες πηγάζουν από το λαό...». Αυτό δεν σηµαίνει ότι κάθε πολίτης από µόνος, κατέχοντας το υψηλότερο αξίωµα, µπορεί να κάνει ό,τι γουστάρει, αλλά οι περισσότεροι πολίτες µαζί ορίζουν την τύχη µιας χώρας είτε προς το καλύτερο είτε προς το χειρότερο. Την περασµένη Κυριακή, οι Έλληνες άσκησαν την ύψιστη εξουσία τους και ίσως πρέπει να ξεκαθαρίσουµε µερικά πράγµατα. Και αυτό, διότι όπως συµβαίνει και µε όλα τα άλλα πράγµατα, στην Ελλάδα και η έννοια της δηµοκρατίας έχει κακοποιηθεί τόσο πολύ ώστε τα πάντα κατέληξαν πολτός. Τα πολιτικά δικαιώµατα συγχέονται µε τα ατοµικά ο νόµος της πλειοψηφίας µε το «δίκιο» µιας τάξης η υποχρέωση τήρησης των νόµων µε το δικαίωµα (υπό όρους) της πολιτικής ανυπακοής η δηµοκρατία µε την οχλοκρατία η πολιτική µε τον χουλιγκανισµό το δικαίωµα της ελευθερίας του λόγου µε τις βιαιότητες το δικαίωµα της συνάθροισης µε τις καταλήψεις η νόµιµη βία, που οφείλει να ασκεί τηρώντας τους κανόνες το κράτος, µε την παράνοµη βία εκείνου που θεωρεί ότι αδικείται. [ ] Όµως, η δηµοκρατία δεν είναι ένα σύστηµα απόλυτης ελευθερίας είναι το πιο ελεύθερο σύστηµα που έχουµε γνωρίσει µέχρι τώρα. εν ευλογεί την παραβίαση των κανόνων συµβίωσης, απλώς επιτρέπει σε όλους να συµµετάσχουν στον ορισµό αυτών των κανόνων. εν είναι ένα σύστηµα που επιτρέπει στις µειοψηφίες να κάνουν ό,τι θέλουν είναι ένα σύστηµα που επιτρέπει στις µειοψηφίες να λένε ό,τι θέλουν, έτσι ώστε να πείσουν και να γίνουν µε τη σειρά τους κάποια στιγµή πλειοψηφία για να ορίσουν τους κανόνες. εν επιτρέπει καν στην πλειοψηφία να κάνει ό,τι θέλει. Υπάρχουν τα θεµελιώδη δικαιώµατα κάθε ατόµου, που δεν µπορεί να καταπατήσει ούτε το 99,9% του υπόλοιπου λαού. [ ] Η δηµοκρατία δεν εξασφαλίζει σοφά αποτελέσµατα µην ξεχνάµε ότι δηµοκρατικά εξελέγη ο Αλκιβιάδης, που οδήγησε στην καταστροφή της Αθήνας, αλλά ότι οι άνθρωποι θα δρέπουν τους καρπούς των σωστών αποφάσεων και υφίστανται τις συνέπειες των λαθών τους. Όπως γράφει ο Ρεζίς Ντεµπρέ: «Ο ρόλος της δηµοκρατίας δεν είναι να κάνει τους ανθρώπους ευτυχισµένους. Ούτε σκοπός της είναι να αγαπιόµαστε όλοι µεταξύ µας. Είναι µόνο µία συµφωνία που µας επιτρέπει να διαχειριζόµαστε καλύτερα τις διαφωνίες µας. Ή, τέλος πάντων, να τις διαχειριζόµαστε µε το µικρότερο δυνατό κόστος». Φυσικά, το πολίτευµα της ηµοκρατίας δεν είναι τέλειο. Όχι µε την έννοια ότι δεν παράγει άριστα αποτελέσµατα. Το πρόβληµα µε τη δηµοκρατία είναι και ως διαδικασία, όπως λέει ο Ντεµπρέ, «έχει κι αυτό τα όριά του, τις σκιές του, τις µαύρες τρύπες του». Γι αυτό και το αίτηµα για περισσότερη δηµοκρατία είναι πάντα ζωντανό. Είναι το µόνο πολίτευµα που έχει µηχανισµούς αυτοαξιολόγησης και διαρκούς αναθεώρησης. Έχει διαδικασίες αναθεώρησης του Συντάγµατος, πλην φυσικά των θεµελιωδών ατοµικών δικαιωµάτων. [ ] Η δηµοκρατία δεν πραγµατώνεται κάθε τέσσερα χρόνια. Βεβαίως, µετά την αποµάκρυνση εκ της κάλπης ουδέν λάθος αναγνωρίζεται. Οι πολίτες εκλέγουν για µία τετραετία εκείνους καλούς, κακούς, ποδοσφαιριστές, τραγουδιστές δεν έχει σηµασία που θα τους εκπροσωπήσουν. Επιλέγουν πολιτικές και διαµορφώνουν, εν πολλοίς, την πορεία που 86

5 θα πάρει ο τόπος. Συνήθως απογοητεύονται διότι η δηµοκρατία για να προχωρήσει χρειάζεται τόσο τις διαφωνίες όσο και τους συµβιβασµούς. Ουδέποτε µια συλλογική απόφαση µπορεί να ικανοποιήσει πλήρως ένα άτοµο. Γι αυτό ακριβώς εφευρέθηκε η ηµοκρατία για να θεσπίζει εκείνους τους συµβιβασµούς που θα ικανοποιούν σε µεγάλο βαθµό τους περισσότερους ανθρώπους. Κανόνες που ικανοποιούν πλήρως µόνο έναν άνθρωπο είναι η απολυταρχική µοναρχία. Η δηµοκρατία, τέλος, έχει κόστος. Την αιώνια επαγρύπνηση που έλεγε ο Τόµας Τζέφερσον. Η δηµοκρατία δεν τελειώνει µε τις εκλογές. Οι πολίτες έχουν υποχρέωση διαρκούς συµµετοχής στη διαδικασία λήψης αποφάσεων. Ελέγχουν αυτούς που εξέλεξαν, πιέζουν µε δηµοκρατικά µέσα µόνο για τη λήψη των αποφάσεων που θεωρούν σωστές, εναντιώνονται σε κάθε απόπειρα καταστρατήγησης των νόµων είτε αυτή επιχειρείται από τα πάνω είτε από τα κάτω, δηλαδή από οµάδες πολιτών που θέλουν να επιβάλουν µε παράνοµες πράξεις τη θέλησή τους. Στη δηµοκρατία, κανένας σκοπός δεν αγιάζει τα αντιδηµοκρατικά µέσα και η καταστρατήγηση των νόµων δηλαδή η ακύρωση της θέλησης της πλειοψηφίας δεν µπορεί ποτέ να νοηθεί ως δηµοκρατική πράξη. Κείµενο του Π. Μανδραβέλη από τον τύπο, ελαφρά διασκευασµένο, 13 Μαΐου ΠΑΡΑΤΗΡΗΣΕΙΣ Α. Να γράψετε την περίληψη του κειµένου σε λέξεις περίπου. Μονάδες 25 Β1. Από το κείµενο προκύπτει ότι: «Η ηµοκρατία εφευρέθηκε για να θεσπίζει εκείνους τους συµβιβασµούς, οι οποίοι θα ικανοποιούν τους περισσότερους ανθρώπους, ενώ η απολυταρχική µοναρχία για να καλύπτει µόνο έναν άνθρωπο». Να αναπτύξετε το νόηµα αυτής της φράσης µε τη µέθοδο της σύγκρισης-αντίθεσης σε µια παράγραφο λέξεων. Μονάδες 10 Β2. Να εντοπίσετε δύο τρόπους πειθούς και τα µέσα τους στην 4 η παράγραφο του κειµένου. («Η δηµοκρατία δεν εξασφαλίζει µικρότερο δυνατό κόστος»). Να δικαιολογήσετε την απάντησή σας εντοπίζοντας τα σχετικά χωρία. Β3. Με ποιον τρόπο-µέθοδο αναπτύσσεται η 3η παράγραφος («Όµως η δηµοκρατία του υπόλοιπου λαού») του κειµένου; Να δικαιολογήσετε την απάντησή σας. Β4. α) «για να θεσπίζει εκείνους τους συµβιβασµούς που θα ικανοποιούν σε µεγάλο βαθµό τους περισσότερους ανθρώπους»: Να χαρακτηριστεί το είδος της σύνταξης και να µετατραπεί στην αντίθετή της. (Μονάδες 3) β) Να αιτιολογήσετε τη χρήση των ρηµατικών προσώπων στα παρακάτω παραδείγµατα: - «που έχουµε γνωρίσει µέχρι τώρα» - «Οι πολίτες έχουν υποχρέωση διαρκούς συµµετοχής στη διαδικασία λήψης αποφάσεων» (Μονάδες 2) 87

6 Γενικής Παιδείας 2013 Νεοελληνική Γλώσσα ΟΕΦΕ Β5. α) Να γράψετε ένα συνώνυµο για καθεµιά από τις παρακάτω λέξεις: συνάθροισης, καταπατήσει, αίτηµα, λάθος, εναντιώνονται. () β) Να γράψετε ένα αντώνυµο για καθεµιά από τις παρακάτω λέξεις: συγχέονται, επιτρέπει, θεµελιωδών, απογοητεύονται, επαγρύπνηση. () Μονάδες 10 Γ. Σε ηµερίδα που διοργανώνει το σχολείο σας µε θέµα «Η ηµοκρατία στη σύγχρονη Ελλάδα», συµµετέχετε ως εκπρόσωπος του δεκαπενταµελούς συµβουλίου µε µια εισήγηση λέξεων. Στην εισήγηση να αναδείξετε τα φαινόµενα κακοποίησης της δηµοκρατίας και να προτείνετε τρόπους προκειµένου το σχολείο να διαµορφώσει πολίτες µε δηµοκρατικό φρόνηµα, ικανούς να συµβάλουν στην οµαλή λειτουργία της. Μονάδες 40 88

7 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας 89

8 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας ΟΕΦΕ ΟΜΑ Α ΠΡΩΤΗ Α1. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας δίπλα στο γράµµα που αντιστοιχεί σε κάθε πρόταση τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασµένη. α. Οι ροές αγαθών, παραγωγικών συντελεστών και χρήµατος µεταξύ των επιχειρήσεων, των νοικοκυριών και του κράτους είναι συνεχείς και έχουν πάντοτε το ίδιο µέγεθος. β. Ο αριθµός των καταναλωτών αφορά τόσο την ατοµική όσο και την αγοραία καµπύλη ζήτησης. γ. Το οριακό προϊόν της εργασίας, είναι το προϊόν που παράγει κάθε φορά ο επιπλέον εργάτης που προστίθεται στην παραγωγή. δ. Η επιχείρηση δεν προσφέρει για τιµές που είναι µικρότερες από το µέσο µεταβλητό κόστος. ε. Οι τιµές παρέµβασης ή ασφάλειας των γεωργικών προϊόντων είναι µια κατηγορία ανώτατων τιµών, προκειµένου να προστατευτεί το εισόδηµα των αγροτών. Μονάδες 15 Στις παρακάτω προτάσεις Α2 και Α3 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. Α2. Η καµπύλη ζήτησης του κατώτερου αγαθού Κ µετατοπίστηκε προς τα αριστερά. Αυτό προήλθε από: α. τη µείωση του εισοδήµατος των καταναλωτών. β. την πρόβλεψη για µελλοντική µείωση της τιµής του αγαθού Κ. γ. την αύξηση του αριθµού των καταναλωτών. δ. την αύξηση της τιµής του αγαθού Λ, το οποίο είναι υποκατάστατο του αγαθού Κ. Α3. Για ένα αγαθό µε γραµµική συνάρτηση ζήτησης (QD = α + β Ρ, α > 0, β < 0, QD 0, Ρ 0) και γραµµική συνάρτηση προσφοράς (QS = γ + δ Ρ, δ > 0, QS 0, Ρ 0) αν µειωθεί ο αριθµός των καταναλωτών που επιλέγουν το αγαθό αυτό και ταυτόχρονα αυξηθεί ο αριθµός των επιχειρήσεων που παράγουν και προσφέρουν το αγαθό αυτό, µε την υπόθεση «ceteris paribus», τότε η τιµή ισορροπίας του αγαθού: α. θα αυξηθεί. β. θα µειωθεί. γ. θα παραµείνει σταθερή. δ. µπορεί, ή να αυξηθεί ή να µειωθεί ή να παραµείνει σταθερή. ΟΜΑ Α ΕΥΤΕΡΗ Β1. Να εξηγήσετε µε τη βοήθεια των κατάλληλων διαγραµµάτων την περίπτωση της µεταβολής µόνο της προσφερόµενης ποσότητας ενός αγαθού, καθώς και την περίπτωση της µεταβολής µόνο της προσφοράς του. Μονάδες 12 Β2. Να εξηγήσετε µε τη βοήθεια του κατάλληλου διαγράµµατος την περίπτωση της ταυτόχρονής µεταβολής προ- 90

9 σφερόµενης ποσότητας και προσφοράς ενός αγαθού, λόγω ταυτόχρονης αύξησης της τιµής του και µείωσης του κόστους παραγωγής του. Μονάδες 13 ΟΜΑ Α ΤΡΙΤΗ Τα δεδοµένα του παρακάτω πίνακα αναφέρονται σε µια υποθετική οικονοµία, η οποία, µε δεδοµένη τεχνολογία παράγει µόνο τα αγαθά Χ και Ψ χρησιµοποιώντας αποδοτικά όλους τους παραγωγικούς συντελεστές της. Συνδυασµοί Ποσοτήτων Παραγόµενες Ποσότητες Αγαθού Χ Παραγόµενες Ποσότητες Αγαθού Ψ Α ; ; Β 400 ; Γ ; ; 0 Κόστος Ευκαιρίας Αγαθού Χ (σε µονάδες Ψ) Κόστος Ευκαιρίας Αγαθού Ψ (σε µονάδες Χ) ; ; 4 ; ; ; Γ1. Να µεταφέρετε στο τετράδιό σας τον πίνακα και να συµπληρώσετε τα δέκα (10) κενά στα οποία υπάρχουν ερωτηµατικά, παρουσιάζοντας τους σχετικούςυπολογισµούς, αν είναι γνωστό ότι: όταν η οικονοµία παράγει στο συνδυασµό Α, όλοι οι παραγωγικοί συντελεστές απασχολούνται στην παραγωγή του αγαθού Ψ. όταν η οικονοµία παράγει στο συνδυασµό Β, η ποσότητα του αγαθού Ψ που παράγεται είναι αυξηµένη κατά 80% σε σχέση µε την ποσότητα του αγαθού Ψ που παράγεται στο συνδυασµό Γ. για να παραχθεί µια (1) επιπλέον µονάδα του αγαθού Χ σε µονάδες του αγαθού Ψ από το συνδυασµό Α στο Β, θα πρέπει να θυσιαστούν 2 µονάδες από το αγαθό Ψ. για να παραχθεί µια (1) επιπλέον µονάδα του αγαθού Ψ σε µονάδες του αγαθού Χ από το συνδυασµό Γ στο, θα πρέπει να θυσιαστούν 1/8 µονάδες από το αγαθό Χ. Γ2. α. Να κατασκευάσετε την καµπύλη παραγωγικών δυνατοτήτων (Κ.Π..) της υποθετικής αυτής οικονοµίας. Μονάδες 2 β. Να αιτιολογήσετε τις πιθανές επιπτώσεις που θα έχει στην καµπύλη παραγωγικών δυνατοτήτων (Κ.Π..) η εµφάνιση στην οικονοµία ποσοστού ανεργίας 25%. Μονάδες 2 Γ3. α. Εάν µοναδικό κριτήριο αποτελεί το κόστος ευκαιρίας, να αιτιολογήσετε µεταξύ ποιων συνδυασµών συµφέρει την οικονοµία να παράγει µια µονάδα από το αγαθό Χ. Μονάδες 3 91

10 Γενικής Παιδείας 2013 Αρχές Οικονομικής Θεωρίας ΟΕΦΕ β. Κάτω από ποίες προϋποθέσεις θα µπορούσε αυτή η οικονοµία να παράγει το συνδυασµό Λ, που περιλαµβάνει 800 µονάδες από το αγαθό Χ και µονάδες από το αγαθό Ψ; Μονάδες 3 Γ4. α. i. Με τη βοήθεια του κόστους ευκαιρίας (υπολογιστικά) να εξετάσετε αν ο συνδυασµός Κ (Χ = 50 και Ψ = 4.250) είναι εφικτός ή ανέφικτος. Μονάδες 3 ii. Να σχολιάσετε την οικονοµική σηµασία του συνδυασµού Κ (Χ = 50 και Ψ = 4.250). Μονάδες 2 iii. Να υπολογίσετε πόσο πρέπει να µεταβληθεί η παραγωγή του αγαθού Ψ, ώστε ο συνδυασµός Κ (Χ = 50 και Ψ = 4.250) να µετατραπεί σε µέγιστο συνδυασµό. Μονάδες 2 β. Να υπολογίσετε πόσες µονάδες από το αγαθό Χ πρέπει να θυσιαστούν, αν η οικονοµία αποφασίσει να αυξήσει την παραγωγή του αγαθού Ψ από τις στις µονάδες. Μονάδες 3 ΟΜΑ Α ΤΕΤΑΡΤΗ Με βάση την αγοραία συνάρτηση ζήτησης του αγαθού Χ, η οποία είναι γραµµική, προκύπτει ο παρακάτω πίνακας. Τιµή (Ρ) (σε ευρώ) Ζητούµενη Ποσότητα (Q D ) (σε κιλά) Συνολική απάνη Καταναλωτών (Σ ) (σε ευρώ) Ελαστικότητα Ζήτησης (Ε D ) Α 90 Q D(A) ,5 Β Ρ (Β) Η ατοµική συνάρτηση προσφοράς του αγαθού Χ, δίνεται από τη σχέση: Q S = P 1. α. Να µεταφέρετε στο τετράδιό σας τον πίνακα και υπολογίσετε τη ζητούµενη ποσότητα Q D(A) καθώς και την τιµή Ρ (Β), παρουσιάζοντας τους σχετικούς υπολογισµούς. Μονάδες 2 β. Να βρείτε την αγοραία συνάρτηση ζήτησης (Q D ) του αγαθού Χ. Μονάδες 2 γ. Αν το αγαθό Χ παράγεται από δέκα (10) πανοµοιότυπες επιχειρήσεις, να βρείτε την αγοραία συνάρτηση προσφοράς (Q S1 ) του αγαθού Χ. Μονάδες 2 δ. Να υπολογίσετε (αλγεβρικά) την τιµή και την ποσότητα ισορροπίας του αγαθού Χ. Μονάδες 2 92

11 2. Μια µεταβολή των τιµών (αµοιβών) των συντελεστών παραγωγής του αγαθού Χ είχε ως αποτέλεσµα να αυξηθεί η προσφερόµενη ποσότητα του αγαθού Χ, σε κάθε τιµή κατά µονάδες. α. Να βρείτε τη νέα αγοραία συνάρτηση της προσφοράς (Q S2 ) του αγαθού Χ. Μονάδες 2 β. Να υπολογίσετε (αλγεβρικά) την νέα τιµή και την νέα ποσότητα ισορροπίας του αγαθού Χ. Μονάδες 2 γ. i. Οι τιµές (αµοιβές) των συντελεστών παραγωγής του αγαθού Χ, αυξήθηκαν ή µειώθηκαν; Μονάδες 1 ii. Να αιτιολογήσετε την απάντησή σας. Μονάδες 3 3. α. Να υπολογίσετε την µεταβολή της συνολικής δαπάνης των καταναλωτών, εξαιτίας της µεταβολής της προσφοράς του αγαθού Χ. Μονάδες 3 β. Να αιτιολογήσετε την απάντησή σας. Μονάδες 3 4. Να υπολογίσετε το έλλειµµα ή το πλεόνασµα το οποίο θα δηµιουργηθεί στην αγορά του αγαθού Χ, στην αρχική τιµή ισορροπίας, µετά τη µεταβολή των συντελεστών παραγωγής του αγαθού Χ. Μονάδες 3 93

12 94

13 Γενικής Παιδείας 2013 Βιολογία 95

14 Γενικής Παιδείας 2013 Βιολογία ΟΕΦΕ ΘΕΜΑ A Να επιλέξετε την φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: Α1. Τα πολυδύναµα αιµοποιητικά κύτταρα βρίσκονται: α. στο ήπαρ. β. στον θύµο αδένα. γ. στον νωτιαίο µυελό. δ. στον µυελό των οστών. Α2. Οι ετερότροφοι οργανισµοί: α. παράγουν διοξείδιο του άνθρακα και καταναλώνουν οξυγόνο. β. παράγουν οξυγόνο και καταναλώνουν διοξείδιο του άνθρακα. γ. παράγουν οξυγόνο και διοξείδιο του άνθρακα. δ. καταναλώνουν οξυγόνο και διοξείδιο του άνθρακα. Α3. Στο στάδιο κατά το οποίο ένα άτοµο είναι φορέας του HIV, το γενετικό υλικό του ιού είναι:: α. ύο µονόκλωνα µόρια DNA. β. ίκλωνο µόριο DNA. γ. Μονόκλωνο µόριο RNA. δ. Μονόκλωνο DNA. Α4. Η εξασθένιση της στιβάδας του όζοντος στη στρατόσφαιρα οφείλεται κυρίως: α. στο διοξείδιο του άνθρακα. β. στα οξείδια του αζώτου. γ. στους χλωροφθοράνθρακες. δ. στο διοξείδιο του θείου. Α5. Τα αστικά λύµατα: α. περιέχουν λιπάσµατα και βιοµηχανικούς ρύπους. β. επιβαρύνουν κυρίως τα χερσαία οικοσυστήµατα. γ. είναι υπεύθυνα για τη διάδοση σοβαρών ασθενειών και τον ευτροφισµό. δ. προκαλούν µείωση του µικροβιακού φορτίου των νερών. Μονάδες 25 ΘΕΜΑ B Β1. Να γράψετε τα χαρακτηριστικά των ερηµικών οικοσυστηµάτων και σε ποιες περιοχές του πλανήτη βρίσκονται. Β2. Να εξηγήσετε τη διαφορά της εξάτµισης από τη διαπνοή των φυτικών οργανισµών. Μονάδες 6 96

15 Β3. Να γράψετε τα όργανα του ανοσοβιολογικού συστήµατος του ανθρώπου και να αναφέρετε τον ρόλο τους. Μονάδες 6 Β4. α. Να εξηγήσετε τους λόγους για τους οποίους οι επιστήµονες θεωρούν απαραίτητη την ταξινόµηση των οργανισµών σε οµάδες. β. Σε ένα µεσογειακό οικοσύστηµα µελετήθηκε ο πληθυσµός των αλεπούδων κατά την διάρκεια ενός έτους. Τα αποτελέσµατα αυτής της µελέτης έδειξαν ότι τον Ιανουάριο προσµετρήθηκαν συνολικά 30 αλεπούδες, ενώ µετά την αναπαραγωγική περίοδο του Μαΐου ο πληθυσµός τους είχε αυξηθεί στα 90 περίπου άτοµα. Ωστόσο, τον επόµενο χειµώνα ο πληθυσµός τους προσµετρήθηκε στις 35 αλεπούδες. Πώς εξηγούνται αυτές οι διακυµάνσεις του πληθυσµού των διαφόρων ειδών; Μονάδες 8 (2+6) ΘΕΜΑ Γ Γ1. Στη γραφική παράσταση απεικονίζεται η µεταβολή του αριθµού διαφόρων πληθυσµών βακτηρίων σε ένα γαλακτοκοµικό προϊόν, συναρτήσει του χρόνου. Η χρονική περίοδος t 1 -t 2 αντιστοιχεί στην περίοδο παστερίωσης του προϊόντος. Αριθμός βακτηρίων t1 t2 χρόνος α. Να εξηγήσετε µε ποιο κριτήριο θα καταταγούν σε είδη οι διάφοροι πληθυσµοί βακτηρίων που διαβιούν στο γαλακτοκοµικό προϊόν. β. Να περιγράψετε την κυτταρική δοµή των βακτηρίων. γ. Να γράψετε µε ποιο τρόπο συµβαίνει η παστερίωση των διαφόρων τροφίµων και πού αποσκοπεί. δ. Να εξηγήσετε πού οφείλεται η ανάπτυξη βακτηρίων µετά τον χρόνο t2. Μονάδες 12 ( ) 97

16 Γενικής Παιδείας 2013 Βιολογία ΟΕΦΕ Γ2. Η λύσσα είναι νόσος του κεντρικού νευρικού συστήµατος που οφείλεται σε ιό και µεταδίδεται στον άνθρωπο µε το σάλιο µολυσµένου ζώου. Κατά τη διάρκεια µιας εκδροµής σε περιοχή όπου είχαν καταγραφεί κρούσµατα ζώων µολυσµένων µε λύσσα, ο ηµήτρης δέχτηκε επίθεση από αδέσποτο σκυλί. Ο ηµήτρης δεν είχε προηγουµένως εµβολιαστεί και διακοµίστηκε στο πλησιέστερο νοσοκοµείο για να του χορηγηθεί αντιλυσσικός ορός αντισωµάτων. α. Με ποιον τρόπο θα λειτουργήσουν τα αντισώµατα του ορού στην αντιµετώπιση του αντιγόνου; β. Η χορήγηση στον ηµήτρη ορού έτοιµων αντισωµάτων ενάντια στον ιό της λύσσας δεν του εξασφαλίζει µόνιµη ανοσία. Για ποιο λόγο συµβαίνει αυτό; γ. Για ποιο λόγο τα αντισώµατα που περιέχει ο ορός της λύσσας εξουδετερώνουν µόνο το συγκεκριµένο αντιγόνο; δ. Θα ήταν σωστό να χορηγηθεί στον ηµήτρη αντιβιοτικό; Μονάδες 13 ( ) ΘΕΜΑ Στο πλέγµα απεικονίζονται οι διατροφικές αλληλεξαρτήσεις ειδών που διαβιούν σε µία ελληνική παράκτια περιοχή. Πελαργοί Τσιπούρες Βάτραχος Στρείδια Σκουλήκια Ζωοπλαγκτόv Πεταλούδες Φυτοπλαγκτόν Αγριολούλουδα 1. Η συνολική ενέργεια που εµπεριέχεται στο ζωοπλαγκτόν υπολογίζεται περίτα KJ. α. Να υπολογίσετε τις απώλειες ενέργειας από τα στρείδια στις τσιπούρες. β. Να εξηγήσετε πού µεταφέρεται η ενέργεια αυτή. Μονάδες 8 (4+4) 2. Κατά το παρελθόν µετρήσεις που πραγµατοποιήθηκαν στους υδρόβιους οργανισµούς της περιοχής έδειξαν την παρουσία ποσοτήτων DDT στους ιστούς των οργανισµών τους καθώς και στους πελαργούς. Στο διάγραµµα που ακολουθεί απεικονίζεται η συγκέντρωση του DDT στους πελαργούς, τις τσιπούρες και τα στρείδια, συναρτήσει του χρόνου ανά τροφικό επίπεδο. 98

17 300 Συγκέντρωση DDT (mg/kg) β γ 3 α Χρόνος α. Να αντιστοιχίσετε τις καµπύλες α, β και γ µε τη συγκέντρωση DDT στους ιστούς του κάθε ενός από τα τρία αυτά είδη. β. Πώς ερµηνεύεται ο δεκαπλασιασµός της συγκέντρωσης του DDT στους οργανισµούς που αντιστοιχίσατε στην καµπύλη β συγκριτικά µε εκείνους της α; γ. Για ποιο λόγο δεν παρατηρείται οµοίως δεκαπλάσια συγκέντρωση στους οργανισµούς που αντιστοιχούν στην καµπύλη γ; δ. Η παρουσία DDT στους ιστούς των πελαργών µείωσε τον ρυθµό αναπαραγωγής τους. Να εξηγήσετε για ποιο λόγο συνέβη αυτό. Μονάδες 17 ( ) 99

18 100

19 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής 101

20 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής ΟΕΦΕ ΘΕΜΑ Α Α.1. Να αποδείξετε ότι η παράγωγος της συνάρτησης f(x) = x 2 είναι f (x) = (x 2 ) = 2x, για κάθε x R. (7 µονάδες) Α.2. Να ορίσετε το σταθµισµένο αριθµητικό µέσο ή σταθµικό µέσο για τις τιµές x 1, x,..., x ενός συνόλου δεδοµένων 2 ν που έχουν διαφορετική βαρύτητα και η οποία εκφράζεται µε τους λεγόµενους συντελεστές βαρύτητας w 1, w 2,..., w ν. Α.3. Πότε µια συνάρτηση f µε πεδίο ορισµού Α λέγεται συνεχής; 4 µονάδες 4 µονάδες Α.4. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας, δίπλα στο γράµµα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασµένη. α) Αν οι συναρτήσεις f και g είναι παραγωγίσιµες στο Α και g(x) 0 για κάθε x A τότε ισχύει ότι: f(x) g(x) = ʹ g(x) fʹ(x) gʹ(x) f(x), για κάθε x A (g(x)) 2 β) Ο συντελεστής µεταβλητότητας CV παριστάνει ένα µέτρο απόλυτης διασποράς και όχι ένα µέτρο σχετικής διασποράς. γ) Η διάµεσος δ ενός δείγµατος ν παρατηρήσεων είναι πάντα µία από τις παρατηρήσεις. δ) Το ενδεχόµενο «ιαφορά του Β από το Α» πραγµατοποιείται όταν πραγµατοποιείται το Α αλλά όχι το Β. ε) ύο συµπληρωµατικά ενδεχόµενα είναι ασυµβίβαστα. 2Χ5 µονάδες ΘΕΜΑ Β Ο χρόνος αναµονής σε min των µαθητών ενός σχολείου στη στάση του λεωφορείου έχει οµαδοποιηθεί σε 5 κλάσεις ίσου πλάτους. Το εύρος είναι R = 20 min, η κεντρική τιµή της τρίτης κλάσης είναι 10 min, 3 µαθητές περιµένουν λιγότερο από 4 min, 20 µαθητές λιγότερο από 12 min, το 84% περιµένουν χρόνο λιγότερο από 16 min, N 5 = 50 και F 2 = 0. Β.1. Να αποδείξετε ότι το πλάτος c της κάθε κλάσης είναι 4 και να µεταφέρετε στο τετράδιο σας σωστά συµπληρωµένο τον παρακάτω πίνακα χρόνος σε min x i ν i N i f i F i F i % [...,...) [...,...) [...,...) [...,...) [...,...) Σύνολο (8 µονάδες) Β.2. Να υπολογίσετε τη µέση τιµή, τη διασπορά και τη διάµεσο του χρόνου αναµονής των µαθητών του δείγµατος (7 µονάδες) 102

21 Β.3. Θεωρούµε ότι όλοι οι χρόνοι των µαθητών είναι οµοιόµορφα κατανεµηµένοι σε κάθε µία από τις παραπάνω κλάσεις. Επιλέγουµε έναν µαθητή στην τύχη και θεωρούµε τα ενδεχόµενα: A: ο χρόνος αναµονής του µαθητή είναι µικρότερος από 10 min B: ο χρόνος αναµονής του µαθητή είναι τουλάχιστον 8 min και λιγότερος από 17 min α) Να βρείτε τις πιθανότητες P(A) και P(B) (5 µονάδες) β) Να βρείτε τις πιθανότητες P(A B), P(A B), P((A B) A). (5 µονάδες) ΘΕΜΑ Γ Θεωρούµε µια µεταβλητή X η οποία µετράει σε mmhg τη συστολική πίεση ενός δείγµατος Α ν ατόµων µιας πόλης και η οποία ακολουθεί περίπου την κανονική κατανοµή. ίνεται ότι η διάµεσος δ της κατανοµής είναι δ = 13 lim 5x 5 σε mmhg και ότι το 84% του δείγµατος έχει συστολική πίεση µεγαλύτερη από 125 mmhg. x 1 2 x+3 4 Γ.1. Να βρείτε τη µέση τιµή x A, την τυπική απόκλιση s A του δείγµατος Α και να εξετάσετε αν το δείγµα Α είναι οµοιογενές. (8 µονάδες) Γ.2. Έστω ότι για το δείγµα Α ισχύει ότι x A =130 mmhg και s A = 5mmHg. Ένα δεύτερο δείγµα Β, επίσης ν ατόµων, παρουσιάζει συστολική πίεση y i = x i + 10 mmhg, για κάθε i =1,...,ν, όπου x i η συστολική πίεση των ατόµων του δείγµατος Α. α) Να βρείτε τη µέση τιµή y B, την τυπική απόκλιση s B και να συγκρίνετε ως προς την οµοιογένεια τα δύο δείγµατα. (7 µονάδες) β) Αν επιπλέον το πλήθος των ατόµων του δείγµατος Α, των οποίων η συστολική πίεση παίρνει τιµές στο διάστηµα ( x A + s A, x A + 2s A ), είναι 540, i. να βρείτε το µέγεθος ν του δείγµατος Α. (5 µονάδες) ii. Να βρείτε πόσα συνολικά άτοµα και από τα δύο δείγµατα έχουν συστολική πίεση κάτω από 135mmHg. (5 µονάδες) ΘΕΜΑ ίνεται η συνάρτηση f (x) = γραφικής της παράστασης..1. α) Να δείξετε ότι α = β =1. 1 αx β) Να µελετήσετε την f ως προς τη µονοτονία και τα ακρότατα. (5 µονάδες), x R, µε a > 0, και η εφαπτοµένη (ε:) y = 1 x + β στο σηµείο Α(,1f)1() της 2 (5 µονάδες) 103

22 Γενικής Παιδείας 2013 Μαθηματικά & Στοιχεία Στατιστικής ΟΕΦΕ.2. Θεωρούµε τα ενδεχόµενα Α, Β, Γ, ενός δειγµατικού χώρου Ω, που οι πιθανότητες των ενδεχοµένων του δίνονται από τις τεταγµένες y, σηµείων (x y) της εφαπτοµένης (ε). α) Για τις τετµηµένες x των παραπάνω σηµείων (x y), να αποδείξετε ότι 0 x 2. (2 µονάδες) β) Έστω τα σηµεία K 2 5, y 1, M 4 5, y 2, N 7 5, y 3 της εφαπτοµένης (ε). Αν οι πιθανότητες των ενδεχοµένων (A B), A B και A είναι διαφορετικές ανά δύο και στοιχεία του συνόλου {y 1, y 2, y 3 }, τότε: i. Να αποδείξετε ότι P(A) = 3 10, P(A B) = 3 5 και P(A B) = 1 5 (5 µονάδες) ii. Να αποδείξετε ότι f (P(A B))'>f (P(A B)') (4 µονάδες) iii. Αν P Γ = 3 10 να αποδείξετε ότι 1 5 P(ΒΓ_5) 1 2 (4 µονάδες) 104

23 Θετικής Κατεύθυνσης 2013 Βιολογία 105

24 Θετικής Κατεύθυνσης 2013 Βιολογία ΟΕΦΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συµπληρώνει σωστά την ηµιτελή πρόταση. Α1. Από γονείς φορείς της κυστικής ίνωσης και της δρεπανοκυτταρικής αναιµίας η πιθανότητα να γεννηθεί παιδί µε αµφότερες τις ασθένειες είναι: α. 1/16 β. 1/2 γ. 1/4 δ. 1/8 Α2. Για την κατασκευή cdna βιβλιοθήκης δεν χρησιµοποιείται το ένζυµο: α. αντίστροφη µεταγραφάση. β. DNA ελικάση. γ. περιοριστική ενδονουκλεάση. δ. DNA πολυµεράση. Α3. Η α-θαλασσαιµία οφείλεται στις περισσότερες περιπτώσεις σε έλλειψη: α. γονιδίου. β. ενζύµου. γ. νουκλεοτιδίου. δ. κωδικονίου. Α4. Στην περίπτωση των ατελώς επικρατών γονιδίων: α. Άτοµα µε διαφορετικό γονότυπο µπορεί να έχουν ίδιο φαινότυπο. β. Άτοµα µε διαφορετικό γονότυπο έχουν διαφορετικό φαινότυπο. γ. Στο φαινότυπο των ετερόζυγων ατόµων εκφράζονται και τα δύο αλληλόµορφα. δ. εν ισχύουν οι νόµοι του Mendel. Α5. Ο αριθµός των µικροβίων σε κλειστή καλλιέργεια παραµένει σχεδόν σταθερός κατά την: α. λανθάνουσα και στατική φάση. β. εκθετική φάση. γ. εκθετική και στατική φάση. δ. στατική φάση και φάση θανάτου. 106

25 ΘΕΜΑ B Β1. Από την παρατήρηση των καρυότυπων τεσσάρων εφήβων διαπιστώθηκε ότι στον ένα παρουσιάζεται µονοσωµία, στον δεύτερο τρισωµία, στον τρίτο αναστροφή, ενώ ο τέταρτος είναι καρυότυπος φυσιολογικού ατόµου. Πόσα µόρια DNA απεικονίζονται στον καρυότυπο του κάθε ατόµου; Να αιτιολογήσετε την απάντησή σας. Μονάδες 8 Β2. Κύριος στόχος της Βιοτεχνολογίας είναι η εφαρµογή των γνώσεων που έχουν αποκτηθεί από τη µελέτη ζωντανών οργανισµών για την παραγωγή σε ευρεία κλίµακα χρήσιµων προϊόντων. Οι µικροβιακές καλλιέργειες αποτελούν ένα σηµαντικό εργαλείο για τη Βιοτεχνολογία. Ένας από τους παράγοντες από τους οποίους εξαρτάται ο ρυθµός ανάπτυξης µιας µικροβιακής καλλιέργειας είναι το οξυγόνο. Με ποιο τρόπο το οξυγόνο επηρεάζει τον ρυθµό ανάπτυξης των µικροοργανισµών; Β3. Η γνώση της µοριακής βάσης των γενετικών ασθενειών σε συνδυασµό µε την τεχνολογία του ανασυνδυασµένου DNA έδωσαν τη δυνατότητα ανάπτυξης της γονιδιακής θεραπείας. Ποιες είναι οι απαραίτητες προϋποθέσεις που πρέπει να ισχύουν για την εφαρµογή της γονιδιακής θεραπείας; Β4. Στο γονιδίωµα ενός βακτηρίου υπάρχουν δύο οπερόνια. Το ένα οπερόνιο αποτελείται από δύο (2) δοµικά γονίδια και το άλλο από τρία (3) δοµικά γονίδια. Το καθένα από τα οπερόνια έχει το δικό του ρυθµιστικό γονίδιο. α) Πόσα γονίδια υπάρχουν συνολικά και στα δύο οπερόνια; β) Πόσα mrna παράγονται από το κάθε οπερόνιο; γ) Πόσες πρωτεΐνες κωδικοποιούνται από το κάθε οπερόνιο; Μονάδες 7 ΘΕΜΑ Γ Γ1. Στο σχήµα απεικονίζεται το πλασµίδιο Ti του βακτηρίου Agrobacterium tumefaciens. Το γράµµα Γ αντιστοιχεί στο γονίδιο που προκαλεί όγκους στα φυτά, το γράµµα Π αντιστοιχεί σε γονίδιο που προσδίδει ανθεκτικότητα στο αντιβιοτικό πενικιλίνη και το Υ στους υποκινητές τους. Τα γράµµατα Ν και Β αντιστοιχούν στις θέσεις αναγνώρισης στο πλασµίδιο των περιοριστικών ενδονουκλεασών NotI και BamI αντίστοιχα. 107

26 Θετικής Κατεύθυνσης 2013 Βιολογία ΟΕΦΕ i. Να εξηγήσετε ποιες ρυθµιστικές περιοχές ενός πλασµιδίου είναι απαραίτητες για την αντιγραφή του και τη µεταγραφή των γονιδίων του. ii. Γονίδιο που προσδίδει ανθεκτικότητα στον παγετό αποµονώθηκε από φυτό και µε τη βοήθεια του πλασµιδίου του σχήµατος µεταφέρθηκε σε καλλιέργεια φυτικών κυττάρων ντοµάτας. Να περιγράψετε την τεχνική που πραγµατοποιήθηκε και να εξηγήσετε ποια περιοριστική ενδονουκλεάση (NotI ή BamI) χρησιµοποιήθηκε. iii. Να γράψετε τρεις λόγους για τους οποίους γνωρίζετε ότι δηµιουργούνται σήµερα διαγονιδιακά φυτά. Μονάδες 12 (3+4+5) Γ2. Στο γενεαλογικό δένδρο απεικονίζεται η κληρονοµικότητα της µερικής αχρωµατοψίας στο πράσινο και κόκκινο σε µία οικογένεια. Σε ένα από τα άτοµα του δένδρου παρατηρείται αριθµητική χρωµοσωµική ανωµαλία και για αυτό ο φαινότυπός του δεν είναι αναµενόµενος. I 1 2 II III i. Να γράψετε και να εξηγήσετε τους γονότυπους όλων των ατόµων, συµπεριλαµβανοµένου του ατόµου µε τη χρωµοσωµική ανωµαλία. ii. Να εξηγήσετε τον µηχανισµό εµφάνιση του ατόµου µε τον µη αναµενόµενο φαινότυπο. Να περιγράψετε επίσης τα λοιπά χαρακτηριστικά του φαινότυπου του ατόµου αυτού. Μονάδες 13 (8+5) ΘΕΜΑ Στο σχήµα απεικονίζεται το µόριο του trna που µεταφέρει το αµινοξύ τρυπτοφάνη (trp). OH trna ACC Αντικωδικόνιο 108

27 1. Το trna αυτό κωδικοποιείται από το γονίδιο: Αλυσίδα α: CGCTCCCGGGTTGTCTCAAAGC Αλυσίδα β: GCGAGGGCCCAACAGAGTTTCG i. Να εξηγήσετε ποια από τις δύο αλυσίδες (α ή β) είναι η µη κωδική αλυσίδα του γονιδίου και να σηµειώσετε τα 5 και 3 άκρα των δύο αλυσίδων. ii. Να γράψετε την αλληλουχία των βάσεων του trna που προκύπτει από τη µεταγραφή του εν λόγω γονιδίου και να αιτιολογήσετε την απάντησή σας. Μονάδες 8 (4+4) 2. Η ακόλουθη αλληλουχία αποτελεί γονίδιο προκαρυωτικού κυττάρου που µεταγράφεται σε mrna και µεταφράζεται σε πεπτιδική αλυσίδα. Αλυσίδα 1: GGGGATCTGCGTACTCCAGGTAAATCTGTAGCC Αλυσίδα 2: CCCCTAGACGCATGAGGTCCATTTAGACATCGG i. Να εξηγήσετε ποια από τις δύο αλυσίδες (1 ή 2) είναι η κωδική αλυσίδα του γονιδίου και να σηµειώσετε τα 5 και 3 άκρα των δύο αλυσίδων, αν γνωρίζετε ότι στη µετάφραση που θα ακολουθήσει της µεταγραφής συµµετέχει το παραπάνω trna. ii. Να εξηγήσετε σε ποιο άκρο της µη κωδικής αλυσίδας (5 ή 3 ) βρίσκεται ο υποκινητής του γονιδίου. iii. Να γράψετε τα αντικωδικόνια όλων των trna µε τη σειρά που θα χρησιµοποιηθούν κατά τη µετάφραση. Μονάδες 12 (6+2+4) 3. Τα γονίδια που κωδικοποιούν trna αποτελούν αλληλουχίες του γονιδιώµατος των οργανισµών που µεταγράφονται αλλά δεν µεταφράζονται. Να αναφέρετε ποια άλλα τµήµατα του γονιδιώµατος των ευκαρυωτικών κυττάρων µεταγράφονται αλλά δεν µεταφράζονται. 109

28 110

29 Θετικής Κατεύθυνσης 2013 Μαθηματικά 111

30 Θετικής Κατεύθυνσης 2013 Μαθηματικά ΟΕΦΕ ΘΕΜΑ Α Α1. Έστω µια συνάρτηση f παραγωγίσιµη σ ένα διάστηµα (α, β), µε εξαίρεση ίσως ένα σηµείο του x 0, στο οποίο όµως η f είναι συνεχής. Να αποδείξετε ότι, αν f (x)>0 στο (a, x 0 ) (x 0, β), τότε το f (x 0 ) δεν είναι τοπικό ακρότατο και η f είναι γνησίως αύξουσα στο (α,β). Μονάδες 9 Α2. α. Πότε το σηµείο Α(x 0, f(x 0 )) ονοµάζεται σηµείο καµπής της γραφικής παράστασης µιας συνάρτησης f. Μονάδες 3 β. Αν f, g συναρτήσεις µε πεδίο ορισµού Α, Β αντιστοίχως, τι ονοµάζουµε σύνθεση της f µε την g και ποιο είναι το πεδίο ορισµού της; Μονάδες 3 Α3. Να χαρακτηρίστε τις προτάσεις που ακολουθούν γράφοντας στο τετράδιό σας δίπλα στο γράµµα που αντιστοιχεί σε κάθε πρόταση τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασµένη. α) Αν f, g είναι συνεχείς συναρτήσεις στο [α, β] τότε, ο τύπος της ολοκλήρωσης κατά παράγοντες γράφεται β β β f (x)g (x)dx f (x)g (x)dx = [ f (x)g (x)] α α α β) Για κάθε µιγαδικό αριθµό z ισχύει z ν = z ν, ν Ν *. γ) Κάθε συνάρτηση 1 1, είναι γνησίως µονότονη. δ) Αν 0 < a <1 τότε lim log a x = +. x + ε) Για κάθε ν Ν * η συνάρτηση f (x) = x v είναι παραγωγίσιµη στο R * µε f (x) = vx v 1. Μονάδες 10 ΘΕΜΑ Β Θεωρούµε τους µιγαδικούς αριθµούς z και w για τους οποίους ισχύουν οι επόµενες σχέσεις: z ( z + 2) = 1 i 2 z 3 και w = 2 z i, Β1. Να βρείτε τον γεωµετρικό τόπο των εικόνων των µιγαδικών z. Ποιος είναι ο γεωµετρικός τόπος των εικόνων του z ; Β2. Να βρείτε την µέγιστη τιµή του z z και τις τιµές του z για τις οποίες επιτυγχάνεται. Μονάδες 7 Μονάδες 6 Β3. Αν για τους µιγαδικούς z των προηγούµενων ερωτηµάτων ισχύει z z = 2 και Im(z) > 0, τότε να υπολογίσετε την τιµή του z z Μονάδες 6 B4. Να βρείτε τον γεωµετρικό τόπο των εικόνων των µιγαδικών w και να αποδείξετε ότι η απόσταση των εικόνων των z και w είναι ίση µε την απόσταση της εικόνας του z από το σηµείο Α (0,1). Μονάδες 6 112

31 ΘΕΜΑ Γ x, αν x 0 ίνεται η συνάρτηση f (x) = e x 1 ln a, αν x=0 Γ1. Βρείτε τον a (0, + ) ώστε η f να είναι παραγωγίσιµη και δείξτε ότι f (0) = 1 2. Μονάδες 7 Έστω α = e. Γ2. α. Να µελετήσετε την f ως προς τη µονοτονία. Μονάδες 6 β. Να βρείτε το σύνολο τιµών της και τις ασύµπτωτες της γραφικής της παράστασης, εφόσον υπάρχουν. x Γ3. Να αποδείξτε ότι η εξίσωση 2x 1 f(t)+1 dt = 1 έχει µοναδική ρίζα στο (0, 1). Μονάδες ΘΕΜΑ ίνονται οι συναρτήσεις f, G και F, οι οποίες είναι ορισµένες στο διάστηµα [0, + ) µε f παραγωγίσιµη και G δύο φορές παραγωγίσιµη στο ίδιο διάστηµα. Έστω ότι ισχύουν: f (0) = 1, G(0) = 0 και για κάθε x 0 x είναι f (x) > 0, G (x) >1 και F (x) = f (t) dt Να αποδείξετε ότι F(x) 0 και G(x) x για κάθε x Να υπολογίσετε το όριο lim [F (x) ln x] και να αποδείξτε ότι υπάρχει ξ (0, 1) x 0 τέτοιο, ώστε f (ξ) lnξ + F(ξ) ξ = 0. Μονάδες 7 3. ίνεται, επιπλέον, ότι f (x) F (x) + f 2 (x) = G (x) [G (x) x] +[G (x) 1] 2, για κάθε x 0. Να αποδείξετε ότι: α. F (x) = G(x) x, για κάθε x 0. Μονάδες 7 β. Για κάθε x 0 >0, οι εφαπτόµενες των γραφικών παραστάσεων C F, C G στα σηµεία τους Β(x 0, F(x 0 )) και Γ (x 0, G(x 0 )) αντιστοίχως, τέµνονται σε σηµείο Α του άξονα y y (µονάδες 3) και το τρίγωνο ΑΒΓ είναι ισεµβαδικό µε το χωρίο, που ορίζεται από τις C F, C G και την ευθεία x = x 0 (µονάδες 3). Μονάδες 6 113

32 114

33 Θετικής Κατεύθυνσης 2013 Φυσική 115

34 Θετικής Κατεύθυνσης 2013 Φυσική ΟΕΦΕ ΘΕΜΑ Α Στις ερωτήσεις από Α1-Α4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και το γράµµα που αντιστοιχεί στην σωστή απάντηση. Α1. Όταν σε ένα γραµµικό οµογενές ελαστικό µέσο διαδίδεται ένα αρµονικό µηχανικό κύµα, τότε: α. η συχνότητα του κύµατος εξαρτάται από το µέσο διάδοσης. β. το µήκος του κύµατος είναι ανεξάρτητο από το µέσο διάδοσης. γ. η ταχύτητα διάδοσης του κύµατος καθορίζεται από το µέσο διάδοσης. δ. η περίοδος του κύµατος καθορίζεται από την πηγή και το µέσο διάδοσης. Α2. Οµογενής δίσκος εκτελεί στροφική κίνηση γύρω από σταθερό άξονα που διέρχεται από το κέντρο µάζας του. Αν διπλασιαστεί το µέτρο της στροφορµής του, τότε: α. η κινητική του ενέργεια λόγω περιστροφής τετραπλασιάζεται. β. η κινητική του ενέργεια λόγω περιστροφής διπλασιάζεται. γ. η κινητική του ενέργεια λόγω περιστροφής δεν µεταβάλλεται. δ. το µέτρο της γωνιακής του ταχύτητας τετραπλασιάζεται i C L Α3. Ένα ιδανικό κύκλωµα LC, που εκτελεί ηλεκτρική ταλάντωση, κάποια χρονική στιγµή παρουσιάζει την εικόνα του διπλανού σχήµατος. Για το κύκλωµα µπορούµε να πούµε ότι εκείνη τη στιγµή: α. η ενέργεια ηλεκτρικού πεδίου µειώνεται. β. η αλγεβρική τιµή της έντασης του ρεύµατος είναι οπωσδήποτε αρνητική. γ. η ενέργεια µαγνητικού πεδίου µειώνεται. δ. η αλγεβρική τιµή της έντασης του ρεύµατος είναι οπωσδήποτε θετική. Α4. Όταν ένα σώµα εκτελεί απλή αρµονική ταλάντωση: α. η ενέργεια της ταλάντωσης µεταβάλλεται αρµονικά µε το χρόνο. β. η κινητική του ενέργεια µεγιστοποιείται 4 φορές στη διάρκεια µιας περιόδου. γ. η δυναµική ενέργεια της ταλάντωσης µηδενίζεται 1 φορά στη διάρκεια µιας περιόδου. δ. η κινητική του ενέργεια µεγιστοποιείται 2 φορές στη διάρκεια µιας περιόδου. 116

35 Α5. Να γράψετε στο τετράδιό σας το γράµµα κάθε πρότασης και δίπλα σε κάθε γράµµα τη λέξη Σωστό, για τη σωστή πρόταση, και τη λέξη Λάθος, για τη λανθασµένη. α. Για ένα σώµα που εκτελεί απλή αρµονική ταλάντωση, η φάση της επιτάχυνσης του σώµατος προηγείται κατά π rad από τη φάση της αποµάκρυνσής του. β. Όταν σε ένα αρχικά ακίνητο ελεύθερο στερεό σώµα ασκείται ζεύγος δυνάµεων, απουσία κάθε άλλης αλληλεπίδρασης, τότε το στερεό σώµα εκτελεί µόνο στροφική κίνηση. γ. Για ένα σώµα που εκτελεί απλή αρµονική ταλάντωση, ο ρυθµός µεταβολής της κινητικής του ενέργειας είναι σε κάθε στιγµή αντίθετος µε το ρυθµό µεταβολής της δυναµικής ενέργειας ταλάντωσης. δ. Τα πρωτόνια, νετρόνια και ηλεκτρόνια έχουν spin µέτρου 2 1. ε. Σε κάθε κρούση µεταξύ δυο σωµάτων, η µεταβολή της ορµής του ενός σώµατος είναι αντίθετη της µεταβολής της ορµής του άλλου. ΘΕΜΑ Β Β1. Στο κύκλωµα εξαναγκασµένων ηλεκτρικών ταλαντώσεων του παρακάτω σχήµατος η πηγή εναλλασσόµενης τάσης δηµιουργεί εναλλασσόµενη τάση που έχει σταθερό πλάτος και συχνότητα που µπορούµε να µεταβάλλουµε. i R C L ~ Το πηνίο έχει συντελεστή αυτεπαγωγής L=10-3 Η και ο πυκνωτής έχει χωρητικότητα C=10-5 F. Μεταβάλλοντας τη συχνότητα της πηγής από f 1 = Ηz έως f π 2 = Ηz παρατηρούµε ότι το πλάτος της έντασης του π ρεύµατος που διαρρέει το κύκλωµα: α. αυξάνεται συνεχώς β. µειώνεται συνεχώς γ. αρχικά αυξάνεται και µετά µειώνεται. Να επιλέξετε τη σωστή απάντηση. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 6 Β2. Από τη σύνθεση δυο απλών αρµονικών ταλαντώσεων (Α.Α.Τ) που γίνονται στην ίδια διεύθυνση και γύρω από την ίδια θέση ισορροπίας, µε εξισώσεις: x 1 = A 0 ηµω 1 t και x 2 = 3Α 0 ηµ ω t + π 1 2 (S.I.) προκύπτει µια νέα απλή αρµονική ταλάντωση µε πλάτος Α

36 Θετικής Κατεύθυνσης 2013 Φυσική ΟΕΦΕ Από τη σύνθεση δυο Α.Α.Τ που γίνονται στην ίδια διεύθυνση και γύρω από την ίδια θέση ισορροπίας, µε εξισώσεις: x 3 = A 1 ηµω 1 t και x 4 = A1 ηµω 2 t, όπου ω 1 και ω 2 παραπλήσιες µε σχέση που τις συνδέει: ω 2 = ω 1 + π (S.I.) προκύπτει µια ιδιόµορφη περιοδική κίνηση µε πλάτος Α 2. Β2.1 Το πλάτος Α 2 µεταβάλλεται περιοδικά µε το χρόνο µεταξύ των τιµών: α. 0 A 2 A2 0 β. A2 0 A 2 A2 0 γ. 0 A 2 A4 0 Επιλέξτε τη σωστή απάντηση. Μονάδες 1 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 Β2.2 Το πλάτος Α 2 µηδενίζεται κάθε: α. 1s β. 2s γ. 4s Επιλέξτε τη σωστή απάντηση. Μονάδες 1 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 Β3. Μονοχρωµατική δέσµη φωτός προσπίπτει κάθετα στη διαχωριστική επιφάνεια αέρα υγρού, προερχόµενη από τον αέρα. Στη συνέχεια η δέσµη, διαδιδόµενη εντός του υγρού, προσπίπτει σε επίπεδο κάτοπτρο που βρίσκεται ακλόνητα τοποθετηµένο εντός του υγρού και σχηµατίζει γωνία φ=30ο µε τη διεύθυνση του πυθµένα του δοχείου, όπως φαίνεται στο παρακάτω σχήµα. Η δέσµη µετά την ανάκλασή της στο κάτοπτρο ακολουθεί την πορεία που παρουσιάζεται στο σχήµα, εξερχόµενη από το υγρό σε διεύθυνση παράλληλη στην επιφάνειά του. αέρας υγρό κάτοπτρο φ Ο δείκτης διάθλασης του υγρού έχει την τιµή: α. 3 β. 3 γ Επιλέξτε τη σωστή απάντηση. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 7 ίνονται: συν30 0 = ηµ60 0 = 3 2, ηµ300 = συν60 0 =

37 ΘΕΜΑ Γ Στην επιφάνεια ενός υγρού που ηρεµεί, βρίσκονται δύο σύγχρονες σηµειακές πηγές Π 1 και Π 2, που δηµιουργούν εγκάρσια αρµονικά κύµατα ίσου πλάτους. Τα κύµατα διαδίδονται στο υγρό µε ταχύτητα µέτρου 2m/s. Οι πηγές αρχίζουν να ταλαντώνονται τη χρονική στιγµή t 0 =0 ξεκινώντας από τη θέση ισορροπίας τους, κινούµενες κατακόρυφα προς τα πάνω, κατεύθυνση που θεωρούµε ως θετική. Σε ένα σηµείο Κ της επιφάνειας του υγρού βρίσκεται µικρή σηµαδούρα, η οποία φέρει στην κορυφή της ενσωµατωµένη πηγή ηχητικών κυµάτων συχνότητας f s =672Hz. Οι αποστάσεις του σηµείου Κ από τις δυο πηγές Π 1, Π 2 είναι αντίστοιχα r 1, r 2 µε r 1 <r 2. Σε θέση Α, που βρίσκεται σε διεύθυνση κάθετη στο επίπεδο του υγρού (ΚΑ), ακριβώς επάνω από τη σηµαδούρα, είναι στερεωµένος στην οροφή ένας ανιχνευτής ήχων. Η σηµαδούρα είναι αρχικά ακίνητη και αρχίζει να ταλαντώνεται κατά τη διεύθυνση του κατακόρυφου άξονα y y, τη χρονική στιγµή t 1 =0,4s µε πλάτος 0,2 π m, ενώ από την π χρονική στιγµή t =0,6s και έπειτα το πλάτος ταλάντωσής της 2 διπλασιάζεται. Με δεδοµένο ότι το σηµείο Κ βρίσκεται στην υπερβολή ενίσχυσης που είναι πλησιέστερη στη µεσοκάθετο του ευθύγραµµου τµήµατος Π 1 Π 2 : A Aνιχνευτής ήχων y Γ 1 Γ 2 K Π 1 Π 2 y Γ1. Να υπολογίσετε τις αποστάσεις r 1, r 2 του σηµείου Κ από κάθε πηγή. Μονάδες 4 Γ2. Να γράψετε την εξίσωση που περιγράφει την αποµάκρυνση της σηµαδούρας από τη θέση ισορροπίας της συναρτήσει του χρόνου για t 0. Μονάδες 9 Γ3. Να υπολογίσετε τη χρονική στιγµή κατά την οποία η δυναµική ενέργεια ταλάντωσης της σηµαδούρας λαµβάνει τη µέγιστη δυνατή τιµή της για πρώτη φορά. Γ4. Να βρείτε τη µέγιστη τιµή της συχνότητας του ήχου που καταγράφεται από τον ανιχνευτή Α κατά την ταλάντωση της σηµαδούρας. Μονάδες 7 ίνεται: το µέτρο της ταχύτητας διάδοσης του ήχου στον αέρα υ ηχ =340m/s. 119

38 Θετικής Κατεύθυνσης 2013 Φυσική ΟΕΦΕ ΘΕΜΑ Ο οµογενής δακτύλιος του παρακάτω σχήµατος έχει µάζα Μ=3Kg, ακτίνα R=0,4m και φέρει στερεωµένο ακλόνητα στο σηµείο Α σφαιρίδιο µάζας m=1kg. Ο δακτύλιος µπορεί να περιστρέφεται χωρίς τριβές γύρω από οριζόντιο σταθερό άξονα που διέρχεται από το σηµείο Ο και είναι κάθετος στο επίπεδό του. Το σύστηµα δακτυλίου - σφαιριδίου αρχικά ισορροπεί δεµένο µε µη εκτατό νήµα από το σηµείο Α. Το άλλο άκρο του νήµατος δένεται στο σηµείο Β, σχηµατίζοντας µε την κατακόρυφο γωνία φ=60 0. B φ Α m R R K O l Σ 1 m 1 m 2 Σ 2 1. Αν αρχικά το σύστηµα ισορροπεί να υπολογίσετε το µέτρο της τάσης του νήµατος. Μονάδες 4 Κάποια στιγµή κόβουµε το νήµα οπότε το σύστηµα δακτυλίου σφαιριδίου αρχίζει να περιστρέφεται γύρω από τον άξονα που διέρχεται από το Ο. Τη στιγµή που η διάµετρος ΟΑ του δακτυλίου γίνει κατακόρυφη το σύστηµα συγκρούεται µε το σώµα Σ 1 µάζας m 1 =1Kg, που είναι αρχικά ακίνητο πάνω σε λείο οριζόντιο δάπεδο. Μετά την κρούση του µε το σύστηµα, το σώµα Σ 1 κινείται πάνω στο οριζόντιο δάπεδο. Κάποια στιγµή συναντά το αρχικά ακίνητο σώµα Σ 2, µάζας m 2 =2Kg, µε το οποίο συγκρούεται κεντρικά και ελαστικά. Το Σ 2 είναι δεµένο στο ένα άκρο τεντωµένου κατακόρυφου αβαρούς και µη εκτατού νήµατος µήκους l=1m, το άλλο άκρο του οποίου δένεται ακλόνητα στην οροφή. Αµέσως µετά την κρούση του µε το σώµα Σ 2, το σώµα Σ 1, κινείται αντίθετα από την αρχική του φορά µε ταχύτητα µέτρου 1m/s. Να υπολογίσετε: 2. τη ροπή αδράνειας του συστήµατος δακτυλίου - σφαιριδίου ως προς τον άξονα περιστροφής του, αφού αρχικά αποδείξετε ότι η ροπή αδράνειας του δακτυλίου γύρω από άξονα κάθετο στο επίπεδό του, που διέρχεται από το κέντρο µάζας του είναι Ι cm =M R 2. Μονάδες 4 3. το µέτρο της στροφορµής του δακτυλίου, ως προς τον άξονα περιστροφής του, τη στιγµή που η διάµετρός του ΟΑ γίνεται κατακόρυφη. 4. το ποσό της κινητικής ενέργειας του συστήµατος δακτυλίου - σφαιριδίου που µετατρέπεται σε θερµική κατά την κρούση του µε το σώµα Σ 1. Μονάδες 6 5. το µέτρο του ρυθµού µεταβολής της ορµής του σώµατος Σ 2 στη θέση της µέγιστης εκτροπής του νήµατος από την κατακόρυφο. Μονάδες 6 ίνονται: g =10 m/s 2, ηµ60 0 = 3 2, συν600 = 1 2. Σε όλα τα ερωτήµατα να θεωρήσετε τις διαστάσεις του σφαιριδίου που είναι στερεωµένο στον δακτύλιο, καθώς και τις διαστάσεις των σωµάτων Σ 1 και Σ 2 αµελητέες. 120

39 Θετικής Κατεύθυνσης 2013 Χημεία 121

40 Θετικής Κατεύθυνσης 2013 Χημεία ΟΕΦΕ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως και Α4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. A1. Ποια από τις παρακάτω ηλεκτρονιακές δοµές για το άτοµο που έχει ατοµικό αριθµό Z =7 παραβιάζει τον κανόνα του Hund; 1s α) β) γ) 2s 2p 3s 1s 2s 2p 3s 1s 2s 2p 3s 1s 2s 2p 3s δ) Α2. ίνονται οι τιµές των τεσσάρων πρώτων τιµών ενεργειών ιοντισµού για ένα στοιχείο της κύριας οµάδας του Περιοδικού Πίνακα: Εi 1 = 286 kj / mol, Ei 2 = 491 kj / mol, Ei 3 = 3208 kj / mol, Ei4 = 3604 kj / mol. Σε ποιο από τα επόµενα στοιχεία είναι δυνατόν να ανήκουν; α) 11 Na β) 12 Mg γ) 13 Al δ) 10 Ne Α3. Η πρωτολυτική αντίδραση HCN + OH CN + H 2 O είναι µετατοπισµένη προς τα δεξιά. Ποιο από τα παρακάτω συµπεράσµατα αληθεύει; α) Το HCN είναι ασθενέστερο οξύ από το H 2 O. β) Το CN είναι ασθενέστερη βάση από το ΟΗ. γ) Το H 2 O είναι ασθενέστερη βάση από το HCN. δ) Το HCN και το ΟΗ είναι οξέα ενώ τα CN και H 2 O είναι βάσεις. Α4. Στο µόριο του 1,2,6 επτατριενίου (CH 2 = C = CHCH 2 CH 2 CH = CH 2 ) υπάρχουν: α) Τέσσερα άτοµα C µε υβριδισµό sp 2 και τρία άτοµα C µε υβριδισµό sp 3. β) Πέντε άτοµα C µε υβριδισµό sp 2 και δύο άτοµα C µε υβριδισµό sp 3. γ) Τέσσερα άτοµα C µε υβριδισµό sp 2, δύο άτοµα C µε υβριδισµό sp 3 και ένα άτοµο C µε υβριδισµό sp. δ) Τρία άτοµα C µε υβριδισµό άτοµο C µε υβριδισµό sp 2, δύο άτοµα C µε υβριδισµό sp 3 και ένα άτομο C µε υβριδισµό sp. 122

41 Α5. α) Κατά την θέρµανση 2 βουτανόλης παρουσία πυκνού H 2 SO 4 σε θερµοκρασία C σχηµατίζεται κύριο προϊόν το 2 βουτένιο. Να διατυπωθεί ο κανόνας µε τον οποίον καθορίζεται το κύριο προϊόν της παραπάνω αντίδρασης. β) Ποιες ουσίες ονοµάζονται αµφιπρωτικές σύµφωνα µε την θεωρία Brönsted Lowry. Να αναφέρετε ένα παράδειγµα. ΘΕΜΑ Β Β1. Για το στοιχείο Χ έχουµε τις παρακάτω πληροφορίες: ανήκει σε κύρια οµάδα του Περιοδικού Πίνακα. έχει τον ίδιο αριθµό ηλεκτρονιακών στιβάδων µε το 10 Ne. είναι αµέταλλο. σχηµατίζει την ένωση H 2 XO 3, η οποία διαθέτει ίσο αριθµό δεσµικών και µη δεσµικών ζευγών ηλεκτρονίων, ενώ κανένα στοιχείο σε αυτήν δεν αποκλίνει από τον κανόνα της οκτάδας. i. Να βρεθεί ο ατοµικός αριθµός του στοιχείου Χ. (µονάδες 2) ii. Πόσα ηλεκτρόνια του Χ έχουν δευτερεύοντα κβαντικό αριθµό µε τιµή l = 1; (µονάδες 2) iii. Να γίνει η δοµή Lewis της ένωσης H 2 XO 3 και να βρεθεί ο αριθµός των σίγµα (σ) και πι (π) δεσµών που έχει η ένωση. (µονάδες 2) ίνεται ατοµικός αριθµός οξυγόνου Z = 8, υδρογόνου Z = 1. Μονάδες 6 Β2. α) Σε V L υδατικού διαλύµατος του ασθενούς µονοπρωτικού οξέος ΗΑ συγκέντρωσης C M που βρίσκεται σε σταθερή θερµοκρασία 25 C προσθέτουµε νερό µέχρι ο τελικός όγκος του διαλύµατος να γίνει 50 V, οπότε ο βαθµός ιοντισµού του ασθενούς οξέος πενταπλασιάζεται. Να αποδείξετε ότι για τη σταθερά ιοντισµού Ka του οξέος ΗΑ ισχύει Κa = C 72. ίνεται ότι και στα δύο διαλύµατα η ποσότητα των Η 3 Ο + υπολογίζεται αποκλειστικά και µόνο από τον ιοντισµό του ΗΑ. Μονάδες 4 β. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας δίπλα στο γράµµα που αντιστοιχεί σε κάθε πρόταση τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασµένη. i. Με προσθήκη µικρής ποσότητας στερεού KF σε υδατικό διάλυµα HNO 3, όγκου V = 1 L και συγκέντρωσης C = 1 M, υπό σταθερή θερµοκρασία και σταθερό όγκο το ph του διαλύµατος αυξάνεται. ii. ιαθέτουµε ρυθµιστικό διάλυµα ορισµένου όγκου, ασθενούς µονοπρωτικού οξέος ΗΑ και άλατος ΝαΑ ίσων συγκεντρώσεων για κάθε συστατικό. Αν το διάλυµα αυτό αραιωθεί σε διπλάσιο όγκο, σε σταθερή θερµοκρασία, τότε το ph του διαλύµατος και ο βαθµός ιοντισµού του οξέος ΗΑ δεν µεταβάλλονται. Τα δεδοµένα της ερώτησης επιτρέπουν τις γνωστές προσεγγίσεις. iii. ιάλυµα άλατος NH 4 A αραιώνεται µε σταθερή θερµοκρασία, και δεν παρατηρείται µεταβολή ph του διαλύµατος. Άρα το οξύ HA είναι ισχυρό οξύ. Μονάδες 3 Να αιτιολογήσετε όλες τις απαντήσεις σας. Μονάδες 6 123

42 Θετικής Κατεύθυνσης 2013 Χημεία ΟΕΦΕ Β3. Να γραφούν οι χηµικές εξισώσεις των αντιδράσεων που γίνονται κατά την επίδραση NaOH στις παρακάτω έξι οργανικές ενώσεις: Ι. CH 3 C OH O ΙΙ. CI 3 C CH O CH 3 O CH 3 ΙΙΙ. Αιθανολικό διάλυµα CH 3 CH 2 Br IV. Υδατικό διάλυµα CH 3 CH 2 Br V. CH 3 CH O C H CH 3 O VI. C 6 H 5 OH ΘΕΜΑ Γ Μονάδες 6 Γ1. 5,6 g αλκενίου (Α) αντιδρούν µε H 2 O παρουσία οξέος H 2 SO 4 και σχηµατίζεται µίγµα δύο οργανικών ενώσεων (Β) και (Γ). Το µίγµα των (Β) και (Γ) µπορεί να αποχρωµατίσει µέχρι 80 ml διαλύµατος KMnO 4 συγκέντρωσης C = 0,1 M οξινισµένου µε H 2 SO 4. Χλωροµεθάνιο (CH 3 Cl) µετατρέπεται σε αντιδραστήριο Grignard, το οποίο αντιδρά µε κορεσµένη ένωση ( ) µε µοριακό τύπο C 3 H 6 O. Το προϊόν υδρολύεται και σχηµατίζεται η ένωση (Β). Οργανική ένωση (Ε), ισοµερής της ( ) αντιδρά µε διάλυµα Tollens και σχηµατίζει κάτοπτρο αργύρου. i) Να βρεθούν οι συντακτικοί τύποι των ενώσεων (Α), (Β), (Γ), ( ) και (Ε). ii) Να υπολογιστεί η αναλογία mol των ενώσεων (Β) και (Γ) που προέκυψαν µε την υδρόλυση της (Α). iii) Να γραφεί η χηµική εξίσωση της αντίδρασης του διαλύµατος Tollens µε την ένωση (Ε). ίνονται Ar(H) = 1, Ar(C) = 12. Γ2. ίνονται οι παρακάτω χηµικές µετατροπές: H ( )+ 2 / Ni (Z) + SOCl 2 (Θ) + CH COONa 3 (K) + Mg αιθέρας άνυδρος + Η (Μ) 2 Ο + (Π) ενδιάµεσο + Η (Λ) 2 Ο προϊόν (Γ) άνυδρος αιθέρας KMnO (Π) 4 / H + CO 2 Μονάδες 3 124

43 Αν οι οργανικές ενώσεις (Γ) και ( ) ταυτίζονται µε τις αντίστοιχες ενώσεις του Γ1 ερωτήµατος, να γραφούν οι συντακτικοί τύποι των οργανικών ενώσεων (Ζ), (Θ), (Κ), (Λ), (Μ) και (Π) ΘΕΜΑ ίνονται τα παρακάτω διαλύµατα: ιάλυµα 1: διαιθυλαµίνης (CH 3 CH 2 NH CH 2 CH 3 ) µε ph = 12 και βαθµό ιοντισµού a 1 = Μονάδες 12 ιάλυµα 2: χλωριούχου αµµωνίου (NH 4 Cl) µε συγκέντρωση 0,2 M και αµµωνίας µε συγκέντρωση 0,1M όπου η αµµωνία έχει βαθµό ιοντισµού και a 2 = α) Ποια από τις δύο βάσεις είναι ισχυρότερη; Να δικαιολογηθεί η απάντησή σας. Μονάδες 6 β) Ορισµένος όγκος από το διάλυµα 1 αραιώνεται µε νερό και προκύπτουν 100 ml διαλύµατος 3 που ογκοµετρούνται µε διάλυµα HCl συγκέντρωσης 0,25 M. Με βοήθεια κατάλληλης πειραµατικής διάταξης για τη µέτρηση του ph κατά τη διάρκεια της ογκοµέτρησης, προκύπτει η παρακάτω καµπύλη ογκοµέτρησης. Στο ογκοµετρούµενο διάλυµα έχει προστεθεί επιπλέον ηλεκτρολυτικός δείκτης, ασθενές οργανικό οξύ H, µε pk δ =7,5. ph x Ισοδύναμο σημείο 25 ml V (HCI) i. Να υπολογιστεί ο αρχικός όγκος του διαλύµατος 1 που αραιώθηκε ώστε να προκύψει το διάλυµα 3. (µονάδες 3). ii. Να υπολογιστεί ο λόγος [Δ - ] στο ογκοµετρούµενο διάλυµα, όταν κατά την διάρκεια της ογκοµέτρησης αποκτήσει ph =7,5. (µονάδες 2) [ΗΔ] iii. Να υπολογιστεί το ph στο ισοδύναµο σηµείο και να δικαιολογηθεί το χρώµα που θα αποκτήσει το διάλυµα στο ισοδύναµο σηµείο. (µονάδες 6) Μονάδες 11 γ) Πόσα mol NaOH πρέπει να προσθέσουµε σε 100 ml του διαλύµατος 2, χωρίς αλλαγή του όγκου του, ώστε να προκύψει διάλυµα όπου η συγκέντρωση οξωνίων (H 3 3 O + ) να είναι ίση µε M. Μονάδες 8 ίνονται: Όλα τα διαλύµατα βρίσκονται σε θερµοκρασία 25 C. Kw = Τα δεδοµένα του προβλήµατος επιτρέπουν τις γνωστές προσεγγίσεις. Η όξινη µορφή του δείκτη H έχει κόκκινο χρώµα ενώ η βασική του µορφή µπλε χρώµα. 125

44 126

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΧΗΜΕΙΑ Ηµεροµηνία: Κυριακή 14 Απριλίου 01 ιάρκεια Εξέτασης: ώρες ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις Α1 έως και Α4 να γράψετε στο τετράδιό σας τον αριθµό

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013. Ηµεροµηνία: Κυριακή 21 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013. Ηµεροµηνία: Κυριακή 21 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Ηµεροµηνία: Κυριακή 1 Αριλίου 013 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις αό Α1-Α4 να γράψετε στο τετράδιο

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ Επαναληπτικό στη Φυσική 1. Θέµα 1 ο

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ Επαναληπτικό στη Φυσική 1. Θέµα 1 ο ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ Επαναληπτικό στη Φυσική 1 Θέµα 1 ο 1. Το διάγραµµα του διπλανού σχήµατος παριστάνει τη χρονική µεταβολή της αποµάκρυνσης ενός σώµατος που εκτελεί απλή αρµονική ταλάντωση. Ποια από

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. ÄÉÁÍüÇÓÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. ÄÉÁÍüÇÓÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Ηµεροµηνία: Τετάρτη 23 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ηµιτελείς προτάσεις Α1 Α4 να γράψετε

Διαβάστε περισσότερα

ΘΕΜΑ Α : α. 3000 V/m β. 1500 V/m γ. 2000 V/m δ. 1000 V/m

ΘΕΜΑ Α : α. 3000 V/m β. 1500 V/m γ. 2000 V/m δ. 1000 V/m ΑΡΧΗ 1 ΗΣ ΣΕΛΙ ΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΕΠΑΝΑΛΗΠΤΙΚΟ ΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α : Για να απαντήσετε στις παρακάτω ερωτήσεις πολλαπλής επιλογής αρκεί να γράψετε

Διαβάστε περισσότερα

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ο Στι ερωτήσει - 4 να γράψετε στο τετράδιό σα τον αριθµό των ερώτηση και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Τροχό κυλίεται πάνω σε οριζόντιο

Διαβάστε περισσότερα

ÊÏÑÕÖÇ ÊÁÂÁËÁ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ

ÊÏÑÕÖÇ ÊÁÂÁËÁ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ Επαναληπτικά Θέµατα ΟΕΦΕ 007 Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ ZHTHMA Στις ερωτήσεις έως 4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 26 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 26 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 015 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 6 Απριλίου 015 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ηµιτελείς προτάσεις Α1

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β 22 ΜΑΪΟΥ 2013 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ

ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β 22 ΜΑΪΟΥ 2013 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ Θέµα Α ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β ΜΑΪΟΥ 03 ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις Α-Α να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη φράση, η οποία συµπληρώνει

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 0 0 5 Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΘΕΜΑ 1 o Για τις ερωτήσεις 1 4, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

ΘΕΜΑ 1 0. Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-5 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 0. Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-5 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. Επαναληπτικό διαγώνισµα Φυσικής Κατεύθυνσης Γ λυκείου 009 ΘΕΜΑ 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις -5 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Σώµα

Διαβάστε περισσότερα

Θέμα 1 Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Θέμα 1 Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Θέμα 1 Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Αν σε ένα ελεύθερο σώμα που είναι αρχικά ακίνητο ασκηθεί δύναμη

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις 1 έως 4 να γράψετε στο τετράδιο σας τον αριθµό

Διαβάστε περισσότερα

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5 ΘΕΜΑ 1 ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 29 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΠΤΑ (7) Για τις ημιτελείς

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ ÅÐÉËÏÃÇ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ ÅÐÉËÏÃÇ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΘΕΜΑ 1 ο ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1-1.4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.1. Οι παρακάτω

Διαβάστε περισσότερα

Θ έ μ α τ α γ ι α Ε π α ν ά λ η ψ η Φ υ σ ι κ ή Κ α τ ε ύ θ υ ν σ η ς Γ Λ υ κ ε ί ο υ

Θ έ μ α τ α γ ι α Ε π α ν ά λ η ψ η Φ υ σ ι κ ή Κ α τ ε ύ θ υ ν σ η ς Γ Λ υ κ ε ί ο υ Θ έ μ α τ α γ ι α Ε π α ν ά λ η ψ η Φ υ σ ι κ ή Κ α τ ε ύ θ υ ν σ η ς Γ Λ υ κ ε ί ο υ Αφού επαναληφθεί το τυπολόγιο, να γίνει επανάληψη στα εξής: ΚΕΦΑΛΑΙΟ 1: ΤΑΛΑΝΤΩΣΕΙΣ Ερωτήσεις: (Από σελ. 7 και μετά)

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2002 ΘΕΜΑΤΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 15 ΙΟΥΝΙΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 5 ΙΟΥΝΙΟΥ 05 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 5 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ) ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ

Διαβάστε περισσότερα

δ) µειώνεται το µήκος κύµατός της (Μονάδες 5)

δ) µειώνεται το µήκος κύµατός της (Μονάδες 5) ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ 011-01 ΜΑΘΗΜΑ / ΤΑΞΗ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ/Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: 1 η (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 30/1/11 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Οδηγία: Να γράψετε στο τετράδιό σας τον αριθµό κάθε µίας από τις παρακάτω

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 25 ΑΠΡΙΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 25 ΑΠΡΙΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣΣΕΛΙ ΑΣ ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 5 ΑΠΡΙΛΙΟΥ 009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ιαγώνισμα στη Φυσική Γ Λυκείου Κατεύθυνσης Επαναληπτικό Ι

ιαγώνισμα στη Φυσική Γ Λυκείου Κατεύθυνσης Επαναληπτικό Ι Θέμα 1 ο ιαγώνισμα στη Φυσική Γ Λυκείου Κατεύθυνσης Επαναληπτικό Ι Στα ερωτήματα 1 5 του πρώτου θέματος, να μεταφέρετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα της απάντησης που θεωρείτε

Διαβάστε περισσότερα

http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 28 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ 1 ο Για τις ημιτελείς

Διαβάστε περισσότερα

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΑΡΑΣΚΕΥΗ 0 ΜΑÏΟΥ 011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗ: ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΙΑΓΩΝΙΣΜΑ 1 Ηµεροµηνία: Τετάρτη 7 Ιανουαρίου 015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ A ΕΚΦΩΝΗΣΕΙΣ Στις ηµιτελείς προτάσεις Α1 Α4 να γράψετε

Διαβάστε περισσότερα

λ, όπου λ το µήκος κύµατος των κυµάτων που δηµιουργούν το στάσιµο.

λ, όπου λ το µήκος κύµατος των κυµάτων που δηµιουργούν το στάσιµο. ΑΡΧΗ ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΚΥΡΙΑΚΗ 9/04/05 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ Α Στις ερωτήσεις Α-Α4 να γράψετε στο τετράδιο σας τον αριθµό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012. Α5) α) Σωστό β) Σωστό γ) Λάθος δ) Λάθος ε) Σωστό.

ΑΠΑΝΤΗΣΕΙΣ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012. Α5) α) Σωστό β) Σωστό γ) Λάθος δ) Λάθος ε) Σωστό. ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 0 Α) γ Α) β Α)γ Α4) γ Α5) α) Σωστό β) Σωστό γ) Λάθος δ) Λάθος ε) Σωστό ΘΕΜΑ Β n a n ( ύ) a n (), ( ύ ) n

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Δύο χορδές μιας κιθάρας Χ1, Χ2

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΙΑΓΩΝΙΣΜΑ Φυσική Γ Λυκείου (Θετικής & Τεχνολογικής κατεύθυνσης)

ΕΠΑΝΑΛΗΠΤΙΚΟ ΙΑΓΩΝΙΣΜΑ Φυσική Γ Λυκείου (Θετικής & Τεχνολογικής κατεύθυνσης) Θέµα 1 ο ΕΠΑΝΑΛΗΠΤΙΚΟ ΙΑΓΩΝΙΣΜΑ Φυσική Γ Λυκείου (Θετικής & Τεχνολογικής κατεύθυνσης) 1.1 Πολλαπλής επιλογής A. Ελαστική ονοµάζεται η κρούση στην οποία: α. οι ταχύτητες των σωµάτων πριν και µετά την κρούση

Διαβάστε περισσότερα

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ ΘΕΜΑ Α Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί η σωστή απάντηση 1. Δίσκος κυλίεται χωρίς να ολισθαίνει με την επίδραση σταθερής οριζόντιας

Διαβάστε περισσότερα

Φυσική Γ Λυκείου Κατεύθυνσης. Προτεινόμενα Θέματα

Φυσική Γ Λυκείου Κατεύθυνσης. Προτεινόμενα Θέματα Φυσική Γ Λυκείου Κατεύθυνσης Προτεινόμενα Θέματα Θέμα ο Ένα σώμα εκτελεί απλή αρμονική ταλάντωση πλάτους Α. Η φάση της ταλάντωσης μεταβάλλεται με το χρόνο όπως δείχνει το παρακάτω σχήμα : φ(rad) 2π π 6

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÃÁËÁÎÉÁÓ. Ηµεροµηνία: Παρασκευή 20 Απριλίου 2012

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÃÁËÁÎÉÁÓ. Ηµεροµηνία: Παρασκευή 20 Απριλίου 2012 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΧΗΜΕΙΑ Ηµεροµηνία: Παρασκευή 20 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις Α1 έως και Α4 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και

Διαβάστε περισσότερα

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ ο ΑΡΧΗ ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ου ΓΕΛ ΠΕΤΡΟΥΠΟΛΗΣ ΔΕΥΤΕΡΑ 3 ΜΑΪΟΥ 200 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ : ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ () Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 4 ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση..

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ΘΕΜΑ 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

α. n 1 > n 2 β. n 2 > n 1. γ. n 1 = n 2 δ. n 2 = 2n 1. β. 2u cm. http://www.epil.gr

α. n 1 > n 2 β. n 2 > n 1. γ. n 1 = n 2 δ. n 2 = 2n 1. β. 2u cm. http://www.epil.gr ΘΕΜΑ 1ο ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 11 ΙΟΥΛΙΟΥ 2005 ΕΞΕTΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ) Να γράψετε στο

Διαβάστε περισσότερα

ÊÏÑÕÖÇ. 1.2 Το ph υδατικού διαλύµατος ασθενούς βάσης Β 0,01Μ είναι : Α. Μεγαλύτερο του 12 Β. 12 Γ. Μικρότερο του 2. Μικρότερο του 12 Μονάδες 5

ÊÏÑÕÖÇ. 1.2 Το ph υδατικού διαλύµατος ασθενούς βάσης Β 0,01Μ είναι : Α. Μεγαλύτερο του 12 Β. 12 Γ. Μικρότερο του 2. Μικρότερο του 12 Μονάδες 5 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1ο ΧΗΜΕΙΑ Στις ερωτήσεις 1.1 έως 1.3 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.1 Η ενέργεια ιοντισµού

Διαβάστε περισσότερα

ΘΕΜΑ Α Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση

ΘΕΜΑ Α Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση 1.

Διαβάστε περισσότερα

Μονάδες 5. Α2. Τα ηλεκτρομαγνητικά κύματα

Μονάδες 5. Α2. Τα ηλεκτρομαγνητικά κύματα ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 26 ΜΑÏΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ ΜΑΪΟΥ 03 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ)

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ ΜΑΪΟΥ 03 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ) ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 25 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ - ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 25 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ - ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 25 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ - ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2010 ΕΚΦΩΝΗΣΕΙΣ

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2010 ΕΚΦΩΝΗΣΕΙΣ ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 00 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Α. Έστω t, t,..., t ν οι παρατηρήσεις µιας ποσοτικής µεταβλητής Χ ενός δείγµατος µεγέθους ν, που έχουν µέση τιµή x. Σχηµατίζουµε

Διαβάστε περισσότερα

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ. Αρµονικό κύµα διαδίδεται σε ένα εθύγραµµο ελαστικό µέσο. Όλα τα σηµεία το µέσο διάδοσης, πο ταλαντώνονται λόγω της διέλεσης

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 03-01-11 ΘΕΡΙΝΑ ΣΕΙΡΑ Α ΘΕΜΑ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Οδηγία: Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη

Διαβάστε περισσότερα

Επαναληπτικό διαγώνισµα στα Κύµατα

Επαναληπτικό διαγώνισµα στα Κύµατα ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 Επαναληπτικό διαγώνισµα στα Κύµατα Θέµα 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 53 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΣΑΒΒΑΪΔΗ-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 26 : Τηλ.: 2107601470 ΔΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 2013 ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΗΣ ΘΕΤΙΗΣ-ΤΕΧΝΟΛΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΕΙΟΥ Θέμα ο. ύλινδρος περιστρέφεται γύρω από άξονα που διέρχεται από το κέντρο μάζας του με γωνιακή ταχύτητα ω. Αν ο συγκεκριμένος κύλινδρος περιστρεφόταν

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 3 Ε_3.Μλ3ΘΤ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 03-01-11 ΘΕΡΙΝΑ ΣΕΙΡΑ Α ΘΕΜΑ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΛΥΣΕΙΣ Οδηγία: Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ÓÕÍÅÉÑÌÏÓ ΕΚΦΩΝΗΣΕΙΣ ΟΜΑ Α ΠΡΩΤΗ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ÓÕÍÅÉÑÌÏÓ ΕΚΦΩΝΗΣΕΙΣ ΟΜΑ Α ΠΡΩΤΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΑΡΧΕΣ ΟΙΚΟΝΟΜΙΚΗΣ ΘΕΩΡΙΑΣ / ΕΠΙΛΟΓΗΣ Ηµεροµηνία: Παρασκευή 17 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΟΜΑ Α ΠΡΩΤΗ Α.1 Να χαρακτηρίσετε τις προτάσεις που ακολουθούν,

Διαβάστε περισσότερα

Διαγώνισμα εφ όλης της ύλης. Στα θέματα 1 4 να σημειώσετε στο τετράδιό σας ποιες από τις προτάσεις είναι σωστές και ποιες λανθασμένες.

Διαγώνισμα εφ όλης της ύλης. Στα θέματα 1 4 να σημειώσετε στο τετράδιό σας ποιες από τις προτάσεις είναι σωστές και ποιες λανθασμένες. Διαγώνισμα εφ όλης της ύλης Θέμα ο Στα θέματα 4 να σημειώσετε στο τετράδιό σας ποιες από τις προτάσεις είναι σωστές και ποιες λανθασμένες. ) Στο σχήμα φαίνεται το στιγμιότυπο ενός τρέχοντος αρμονικού κύματος

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΛΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ ΘΕΜΑ 1ο Να γράψετε στο

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 6-0- ΘΕΡΙΝΑ ΣΕΙΡΑ Α ΘΕΜΑ ο ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΛΥΣΕΙΣ Οδηγία: Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις -4 και δίπλα το γράµµα που αντιστοιχεί στη

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2007 ÏÅÖÅ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ

ÈÅÌÁÔÁ 2007 ÏÅÖÅ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ Επαναληπτικά Θέµατα ΟΕΦΕ 007 Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ ZHTHMA Στις ερωτήσεις έως να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 9 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 6 : Τηλ.: 076070 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΥΚΕΙΟΥ 009 ΘΕΜΑ Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ;

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ; 45 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Χρυσ Σµύρνης 3 : Τηλ.: 107601470 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 006 ΘΕΜΑ 1 1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 014 Ε_3.ΦλΓΑΘΤ(ε) ΤΑΞΗ: Β ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗ: ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ & ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ Ηµεροµηνία: Κυριακή 7 Απριλίου 014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ A ΕΚΦΩΝΗΣΕΙΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Αντικείµενο εξέτασης: Όλη η διδακτέα ύλη Χρόνος εξέτασης: 3 ώρες

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Αντικείµενο εξέτασης: Όλη η διδακτέα ύλη Χρόνος εξέτασης: 3 ώρες ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Αντικείµενο εξέτασης: Όλη η διδακτέα ύλη Χρόνος εξέτασης: 3 ώρες ΘΕΜΑ 1ο Στις ερωτήσεις 1-4 να γράψετε στο φύλλο απαντήσεών σας τον αριθµό

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 31 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6)

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 31 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 31 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1-1.4 να

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΘΕΜΑ 1o. , τότε η ένταση του ρεύµατος στο κύκλωµα γίνεται µέγιστη τη χρονική στιγµή: T t= γ. 4. T 2 Μονάδες 5

ΘΕΜΑ 1o. , τότε η ένταση του ρεύµατος στο κύκλωµα γίνεται µέγιστη τη χρονική στιγµή: T t= γ. 4. T 2 Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΛΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΠΕΜΠΤΗ 27 MAΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÓÕÍÅÉÑÌÏÓ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÓÕÍÅÉÑÌÏÓ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΧΗΜΕΙΑ Ηµεροµηνία: Μ. Τετάρτη 16 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Α.1 Ποια από τις παρακάτω τετράδες κβαντικών αριθµών αντιστοιχεί

Διαβάστε περισσότερα

, ραδιοκύματα: που του ασκούνται και για το αλγεβρικό άθροισμα των ροπών Στ ως προς οποιοδήποτε σημείο του, ισχύει: δ) F 0, 0

, ραδιοκύματα: που του ασκούνται και για το αλγεβρικό άθροισμα των ροπών Στ ως προς οποιοδήποτε σημείο του, ισχύει: δ) F 0, 0 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Δ Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 0 4 ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 0.06.04 Θέμα Α Στις ερωτήσεις Α-Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

Μονάδες 5. 1.2 Στο μόριο του CH C CH=CH 2 υπάρχουν:

Μονάδες 5. 1.2 Στο μόριο του CH C CH=CH 2 υπάρχουν: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 31 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ 1 ο Για τις ερωτήσεις 1.1-1.4

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΘΕΜΑ Στις ηµιτελείς προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑΤΑ ΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΩΝ ΕΞΕΤΑΣΕΩΝ 04 ΦΥΣΙΗ ΑΤΕΥΘΥΝΣΗΣ Θέμα Α Στις ερωτήσεις Α-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και, δίπλα, το γράμμα που αντιστοιχεί στη φράση η οποία συμπληρώνει

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΣΤΙΣ ΜΗΧΑΝΙΚΕΣ ΚΑΙ ΗΛΕΚΤΡΙΚΕΣ ΤΑΛΑΝΤΩΣΕΙΣ

ΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΣΤΙΣ ΜΗΧΑΝΙΚΕΣ ΚΑΙ ΗΛΕΚΤΡΙΚΕΣ ΤΑΛΑΝΤΩΣΕΙΣ ΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΣΤΙΣ ΜΗΧΑΝΙΚΕΣ ΚΑΙ ΗΛΕΚΤΡΙΚΕΣ ΤΑΛΑΝΤΩΣΕΙΣ Θέµα Α Στις ερωτήσεις 1-4 να βρείτε τη σωστή απάντηση. Α1. Για κάποιο χρονικό διάστηµα t, η πολικότητα του πυκνωτή και

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ. ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΨΗΣ - ΘΕΜΑ Ο Έστω η συνάρτηση f( ) =, 0 ) Να αποδείξετε ότι f ( ). f( ) =. ) Να υπολογίσετε το όριο lm f ( )+ 4. ) Να βρείτε την εξίσωση της εφαπτομένης

Διαβάστε περισσότερα

ΑΡΧΗ 1ης ΣΕΛΙΔΑΣ. B κύματος. Γνωρίζουμε ότι το σημείο Α έχει μικρότερη φάση από το x x σημείο Β. Συνεπώς το σημείο Γ του

ΑΡΧΗ 1ης ΣΕΛΙΔΑΣ. B κύματος. Γνωρίζουμε ότι το σημείο Α έχει μικρότερη φάση από το x x σημείο Β. Συνεπώς το σημείο Γ του ΑΡΧΗ ης ΣΕΛΙΔΑΣ Προτεινόμενο Τελικό Διαγώνισμα Στη Φυσική Θετικής και Τεχνολογικής Κατεύθυσης Γ Λυκείου Διάρκεια: 3ώρες ΘΕΜΑ A Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΤΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΤΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΤΗΣ Γ ΛΥΚΕΙΟΥ Θέµα ο ΚΕΦΑΛΑΙΟ 2 ο : ΚΥΜΑΤΑ Ποιες από τις παρακάτω προτάσεις είναι σωστές και ποιες λανθασµένες; α Η υπέρυθρη ακτινοβολία έχει µήκη κύµατος µεγαλύτερα από

Διαβάστε περισσότερα

r r r r r r r r r r r

r r r r r r r r r r r ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 0 ΜΑÏΟΥ 011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ) ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Γ(ε) ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 7 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε την φράση που συµπληρώνει ορθά κάθε µία

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 (ΚΥΜΑΤΑ) ΚΥΡΙΑΚΗ 27 ΙΑΝΟΥΑΡΙΟΥ 2013 ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ 5

ΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 (ΚΥΜΑΤΑ) ΚΥΡΙΑΚΗ 27 ΙΑΝΟΥΑΡΙΟΥ 2013 ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ 5 ΑΡΧΗ 1 ΗΣ ΣΕΛΙ ΑΣ ΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 (ΚΥΜΑΤΑ) ΚΥΡΙΑΚΗ 27 ΙΑΝΟΥΑΡΙΟΥ 2013 ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ 5 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 00 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΘΕΜΑ Α Α. Έστω t,t,...,t ν οι παρατηρήσεις μιας ποσοτικής μεταβλητής Χ ενός δείγματος μεγέθους ν,

Διαβάστε περισσότερα

Επαλληλία Αρµονικών Κυµάτων. Επιµέλεια: Μιχάλης Ε. Καραδηµητρίου, MSc Φυσικός. http://www.perifysikhs.com

Επαλληλία Αρµονικών Κυµάτων. Επιµέλεια: Μιχάλης Ε. Καραδηµητρίου, MSc Φυσικός. http://www.perifysikhs.com Επαλληλία Αρµονικών Κυµάτων - εκέµβρης 2014 Επιµέλεια: Μιχάλης Ε. Καραδηµητρίου, MSc Φυσικός http://www.perifysikhs.com 1. Θέµα Α - Ερωτήσεις πολλαπλής επιλογής 1.1. ύο σύγχρονες κυµατικές πηγές Α και

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 3 ο ΔΙΑΓΩΝΙΣΜΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Στις ημιτελείς προτάσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη φράση,

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις -4 και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.. Τα δύο

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2012 ΕΚΦΩΝΗΣΕΙΣ

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2012 ΕΚΦΩΝΗΣΕΙΣ ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 0 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Α. Αν οι συναρτήσεις f, g είναι παραγωγίσιµες στο, να αποδείξετε ότι (f() + g ()) f () + g (),. Μονάδες 7 Α. Σε ένα πείραµα µε ισοπίθανα

Διαβάστε περισσότερα

2 ο Επαναληπτικό διαγώνισμα στο 1 ο κεφάλαιο Φυσικής Θετικής Τεχνολογικής Κατεύθυνσης (Μηχανικές και Ηλεκτρικές ταλαντώσεις)

2 ο Επαναληπτικό διαγώνισμα στο 1 ο κεφάλαιο Φυσικής Θετικής Τεχνολογικής Κατεύθυνσης (Μηχανικές και Ηλεκτρικές ταλαντώσεις) ο Επαναληπτικό διαγώνισμα στο 1 ο κεφάλαιο Φυσικής Θετικής Τεχνολογικής Κατεύθυνσης (Μηχανικές και Ηλεκτρικές ταλαντώσεις) ΘΕΜΑ 1 ο Στις παρακάτω ερωτήσεις 1 4 επιλέξτε τη σωστή πρόταση 1. Ένα σώμα μάζας

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ΤΑΞΗ: Β ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ / ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΘΕΜΑ Α Ηµεροµηνία: Κυριακή Απριλίου 01 ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις από 1-4 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και το γράµµα

Διαβάστε περισσότερα

2o ΘΕΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΚΦΩΝΗΣΕΙΣ

2o ΘΕΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΚΦΩΝΗΣΕΙΣ 2o ΘΕΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΚΦΩΝΗΣΕΙΣ Θέμα 1 ο Α. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα

Διαβάστε περισσότερα

Ζαχαριάδου Φωτεινή Σελίδα 1 από 7. Γ Λυκείου Κατεύθυνσης Κεφάλαιο 3: Οξέα, Βάσεις, Ιοντική ισορροπία Θέµατα Σωστού / Λάθους Πανελληνίων, ΟΕΦΕ, ΠΜ Χ

Ζαχαριάδου Φωτεινή Σελίδα 1 από 7. Γ Λυκείου Κατεύθυνσης Κεφάλαιο 3: Οξέα, Βάσεις, Ιοντική ισορροπία Θέµατα Σωστού / Λάθους Πανελληνίων, ΟΕΦΕ, ΠΜ Χ Ζαχαριάδου Φωτεινή Σελίδα 1 από 7 Γ Λυκείου Κατεύθυνσης Κεφάλαιο 3: Οξέα, Βάσεις, Ιοντική ισορροπία Θέµατα Σωστού / Λάθους Πανελληνίων, ΟΕΦΕ, ΠΜ Χ ιάλυµα NaHSO 4 0,1 M έχει ph > 7 στους 25 ο C. Πανελλήνιες

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 4 (ΜΗΧΑΝΙΚΗ ΣΤΕΡΕΟΥ ΣΩΜΑΤΟΣ) ΚΥΡΙΑΚΗ 15 ΜΑΡΤΙΟΥ 2015 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ 5

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 4 (ΜΗΧΑΝΙΚΗ ΣΤΕΡΕΟΥ ΣΩΜΑΤΟΣ) ΚΥΡΙΑΚΗ 15 ΜΑΡΤΙΟΥ 2015 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ 5 ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 4 (ΜΗΧΑΝΙΚΗ ΣΤΕΡΕΟΥ ΣΩΜΑΤΟΣ) ΚΥΡΙΑΚΗ 15 ΜΑΡΤΙΟΥ 2015 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ 5 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον

Διαβάστε περισσότερα

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΧΗΜΕΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως και Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Πολυμερισμό 1,4 δίνει η ένωση:

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 Για τις προτάσεις 1.1 έως και 1.4 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στο σωστό συµπλήρωµά της.

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Στις ερωτήσεις Α-Α να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση..

Διαβάστε περισσότερα