Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος"


1 Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος Δρ Ζήσης Μαμούρης Καθηγητής Γενετικής Τμήμα Βιοχημείας & Βιοτεχνολογίας Πανεπιστήμιο Θεσσαλίας Μοριακή Βιολογία και Γενετική Μηχανική: Μελέτη, Ανάλυση, Τροποποίηση του DNA και του RNA Εξαγωγή Ράψιμο Έχουμε τα «εργαλεία» Αντιγραφή Κόψιμο Σήμανση Η ΒΙΟΤΕΧΝΟΛΟΓΙΑ Βιολογία Βιοτεχνολογία Βιοχημεία Βιομηχανική Χημικές διεργασίες Πληροφορική Μηχανική Χημεία Ο 6ος Μαζικός Αφανισμός Τα γεωλογικά δεδομένα υποδεικνύουν 5 μαζικούς αφανισμούς ειδών Επί του παρόντος είμαστε μάρτυρες του 6ου μαζικού αφανισμού Βασικός υπεύθυνος οι ανθρωπογενείς παρεμβάσεις: Καταστροφές ή/και κατακερματισμός φυσικού περιβάλλοντος Κυνήγι Ταξινομική ομάδα Θηλαστικά Πτηνά Ερπετά Αμφίβια Ψάρια Ασπόνδυλα Φυτά Αριθμός % των ομάδων % των ειδών αφανισμών που χάθηκαν που απειλούνται Αφανισμοί που καταχωρήθηκαν από το 1900 Ο ρυθμός των αφανισμών επιταχύνεται Θερμά σημεία Βιοποικιλότητας περιοχές με υψηλή συγκέντρωση ενδημικών ειδών, στις οποίες καταγράφεται ταχεία απώλεια ενδιαιτημάτων Μοριακή Οικολογία Η Μοριακή Οικολογία χρησιμοποιεί τεχνικές μοριακής γενετικής για να λύσει προβλήματα οικολογίας, εξέλιξης και συμπεριφοράς, κάτω από το πρίσμα και την προοπτική της διατήρησης της βιοποικιλότητας 1

2 Αναδιπλασιασμός του DNA Λάθη Μοριακοί είκτες Μικρές περιοχές του γονιδιώματος που χρησιμοποιούνται ως δείκτες γενετικής ποικιλομορφίας Είναι χρήσιμοι μόνο όταν είναι πολυμορφικοί στους πληθυσμούς 3 εκατ. πολυμορφικές θέσεις Single Nucleotide Polymorphisms (SNPs) AGTTCGATTGCTCGATAGCACGAT AGTTCAATTGCTTGATAGCACGAT AGTTCGATTGCTTGATAGCTCGAT Repeats AGTTCAATTGCTTGATAGCGCGAT AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT Deletions AGTTCAATTGATAGCGCGAT Γιατί μοριακοί δείκτες; Ενυπάρχουν στα άτομα (δεν μπορούν να χαθούν) Κληρονομήσιμοι (ταυτοποίηση απογόνων) εν καταστρέφεται το δείγμα (δεν απαιτείται θανάτωση του ζώου) Πολλοί διαφορετικοί δείκτες: Ισοένζυμα Αλληλουχίες μιτοχονδριακού (mt( mt) DNA Αλληλουχίες χλωροπλαστικού (cp) DNA Μικροδορυφορικό DNA Αλληλουχίες πυρηνικού DNA Πυρηνικό DNA Εξωπυρηνικό DNA Μικροδορυφορικό DNA Μικροδορυφόροι είναι τόποι όπου μικρές αλληλουχίες DNA επαναλαμβάνονται στη σειρά η μια αμέσως μετά την άλλη. Χρωμόσωμα Y Μικρό χρωμόσωμα cpdna που προσδιορίζει Μιτοχονδριακό Χρωμόσωμα DNA το (mtdna) φύλο ενός Υ ατόμου. Έμβρυα με Το σπέρμα δίνει μόνο χρωμόσωμα γενετικό υλικό Υ γίνονται αρσενικά. και όχι κυτταρικά οργανίδια. Έτσι, η γενετική Έτσι, πληροφορία του όλο το mtdna προέρχεται χρωμοσώματος από Υ το είναι μόνο ωάριο, το οποίο είναι πατρικής μητρικής προέλευσης. προέλευσης. mtdna Polymerase Chain Reaction (PCR) Ability to generate identical high copy number DNAs made possible in the 1970s by recombinant DNA technology (i.e., cloning). Cloning DNA is time consuming and expensive. Probing libraries can be like hunting for a needle in a haystack. PCR, discovered in 1983 by Kary Mullis, enables the amplification (or duplication) of millions of copies of any DNA sequence with known flanking sequences. Requires only simple, inexpensive ingredients and a couple hours. DNA template Primers (anneal to flanking sequences) DNA polymerase dntps Mg 2+ Buffer Can be performed by hand or in a machine called a thermal cycler. 1993: Nobel Prize for Chemistry Hot water bacteria: Thermus aquaticus Taq DNA polymerase Life at High Temperatures by Thomas D. Brock Biotechnology in Yellowstone 1994 Yellowstone Association for Natural Science 2

3 Gel Electrophoresis separates nucleic acids by size Πηκτή Θήκες Vetex Τροφοδοτικό Gel Electrophoresis separates nucleic acids by size DNA or RNA have negative charge. They migrate towards cathode, in "bands" according to mol wt "Loaded" onto gel at anode end. Smaller molecules navigate through the matrix faster Buffer Nucleic acids can be detected by general stains, or... (not sequence specific) DNA ή Γενετικοί είκτες: γενετικοί, πολυμορφικοί τόποι, με περισσότερα του ενός αλληλόμορφα, οι οποίοι είναι δυνατόν να ανιχνευτούν με μοριακή ανάλυση. AFLP: Amplified Fragments Length Polymorphism RFLP: Restriction Fragments Length Polymorphism RAPD: Randomly Amplified Polymorphic DNA SNP: Single Nucleotide Polymorphism SSCP: Single Strand Conformation Polymorphism SSR: Simple Sequence Repeat OLA: Oligonucleotide Ligation Assay VNTR: Variable Number of Tandem Repeat CAPS: Cleaved Amplified Polymorphic Sequence Μοριακοί είκτες Ισοένζυμα Χαμηλός πολυμορφισμός Πιθανή επιλογή Χαμηλή αναλυτική ικανότητα (Αρχικά σε Ανθρώπους, Harris, 1966) Heterozygote Translation Enzyme products Electrophoresis Homozygote Μέθοδος RFLP Βασίζεται στα ένζυμα περιορισμού Μιτοχονδριακό DNA Kb 37 γονίδια 13 mrna Συντηρημένη ομή Σημαντικό Μοριακό Εργαλείο Γρήγορος ρυθμός μετάλλαξης Μητρική κληρονόνιση Απουσία ανασυνδυασμού Γρήγορη διαφοροποίηση Εύκολο στη χρήση 3

4 Ανάλυση MtDNA με χρήση Τεχνική RAPD RFLP Αλληλούχισης (Sequencing) Τεχνική RAPD DNA digestion, ligation, PCR and detection Μικροδορυφόροι (SSR Simple Sequence Repeats) Οι μονάδες επανάληψης είναι συνήθως δι-, τρι-, τετρα-, πεντανουκλεοτίδια 21 Με τη χρήση διαφόρων μικροδορυφορικών τόπων, μπορεί να παραχθεί ένα μοναδικό γενοτυπικό πρότυπο για κάθε άτομο, επιτρέποντας την ατομική ταυτοποίηση SSCP (Single Strand Conformation Polymorphism) Normal Allele (N) Mutated Allele (M) C A A GT T PCR Products Denaturation CG A GC T CA A GTT CAA CGA NN NM MM GCT Polyacrilamide Gel Electrophoresis CGA GTT GCT 4

5 Γιατί ΤΟΣΟΙ ΠΟΛΛΟΙ μοριακοί δείκτες; Γονιδιώματα πολύ διαφορετικά - Συμπαγή γονιδιώματα: λιγότερο πολυαλληλομορφικοί δείκτες Ποικιλία καταστάσεων - Εξημερωμένοι και Φυσικοί πληθυσμοί διαχωρισμένοι για γενιές: μεγάλη γενετική διαφοροποίηση Ποικιλία τεχνικών για ατομική γενοτύπηση - Φτηνή/ακριβή τεχνικά εύκολη/δύσκολη Ποικιλία πληθυσμιακών καταστάσεων - Πρόσφατοι στενωποί: μικρή ενδοπληθυσμιακή ποικιλότητα ιαφορετικοί τύποι γενετικών δεικτών - Υπερέχοντες, συνυπερέχοντες, δι-, πολύ- αλληλομορφικοί Σωστή επιλογή = γνώση της βιολογίας του είδους Έχει η φαινοτυπική ποικιλότητα πάντα γενετικό υπόβαθρο; Η περίπτωση της κουτσομούρας ( (Mullus barbatus) Η μορφολογική ποικιλότητα δεν συμβαδίζει πάντα με τη γενετική διαφοροποίηση Γενετική ποικιλότητα στο πυρηνικό και το μιτοχονδριακό DNA RAPD mtdna ΜΙΚΡΟ ΟΡΥΦΟΡΙΚΟ ΑΛΛΗΛΟΥΧΙΣΗ DNA (SEQUENCING Μοριακή ταυτοποίηση: Είδη, Άτομα και Φύλο Αντιστοίχιση ατόμων σε πληθυσμούς Ταυτοποίηση υβριδίων μεταξύ ειδών Ταυτοποίηση λείας σε στομάχια θηρευτών Ταυτοποίηση φορέων ασθενειών Ιατροδικαστικές έρευνες σε φυσικούς ζωικούς πληθυσμούς Ανίχνευση Γενετικά Τροποποιημένων Οργανισμών Οικολογία Συμπεριφοράς Προσδιορισμός τύπων ζευγαρώματος Πολυγαμία / Μονογαμία ιμορφισμός και αναλογία φύλου Μοριακή ανίχνευση επιλογής συντρόφου (Π.χ. MHC) ιαμάχες μεταξύ φύλων Εκτίμηση διασποράς των ζώων 5

6 Πληθυσμιακή Γενετική και Εφαρμοσμένη Φυλογεωγραφία Εκτίμηση δομής, δραστικού μεγέθους και κατανομής πληθυσμών και μεταπληθυσμών Γονιδιακή ροή και ρυθμοί μετανάστευσης Προσδιορισμός και ταυτοποίηση μεταναστών Πληθυσμιακές στενωποί Ταξινομικές αποφάσεις Ανίχνευση του μητρικού πληθυσμού εισαγόμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών και πληθυσμών Γενετική της αποκατάστασης των ειδών Κρυο-συντήρηση γαμετών, τεχνητή γονιμοποίηση, κλωνοποίηση Χρήση Μοριακών εικτών για Προσδιορισμό των «Μονάδων ιατήρησης» σε Απειλούμενους Φυσικούς Πληθυσμούς TUATARA (Sphenodon) αρχαία σειρά ερπετών Πάνθηρας της Florida Τσίτα (Acinonyx jubatus) Γκρίζος Λύκος Θαλάσσιοι Ελέφαντες 100δες είδη πτηνών 100δες είδη εντόμων..και δυστυχώς ο κατάλογος συνεχώς μεγαλώνει Μοριακά εργαλεία για αποκάλυψη απάτης Γενετική ανάλυση κρέατος φάλαινας ραματική μείωση των πληθυσμών ιεθνείς διαμάχες για την προστασία Ταυτοποίηση είδους με mtdna ανάλυση Παράνομη διακίνηση κρέατος στις παγκόσμιες αγορές Παράνομη διακίνηση ιστών από προστατευόμενα είδη DNA Barcode: Μικρές τυποποιημένες αλληλουχίες που θα βοηθήσουν στη διάκριση των ειδών σε ένα ευρύ φάσμα ζωντανών οργανισμών εν φιλοδοξεί να περιγράψει τα είδη, αλλά να προσδιορίσει τα όριά τους Απελευθερώσεις λαγών εκτροφείου Ανεξέλεγκτες απελευθερώσεις λαγών εκτροφείου Γενετική ρύπανση Απώλεια τοπικής ποικιλομορφίας Ηλύση U A B C M mtdna-rflp ανάλυση: 3 γενετικές ομάδες A B C1 C Ένα στέλεχος του ιού EBHS, διαφορετικό από τα ελληνικά, εισαγόμενο πιθανώς από την Κ. Ευρώπη 6 6

7 ιάκριση διαφόρων φυλών χοίρων 428bp 256bp 172bp Sus scrofa X Sus scrofa domestica Ανεξέλεγκτη εκτροφή αγριόχοιρων Γενετική ρύπανση από εμπλουτισμούς ιατροφική απάτη Πέψη Μ Πέψη Μ Εκτρεφόμενοι χοίροι ΥβρίδιοΑγριόχοιροι Υβρίδιο PCR-RFLP και SSCP ανάλυση του υποδοχέα της μελανοκορτίνης (MC1R) Ταυτοποίηση Φύλου σε Γεράκια ( (Accipiter cooperii) Αρσενικό ZZ Αρσενικό ή Θηλυκό; Ενήλικος Φυλετικός ιμορφισμός Θηλυκό ZW Στα πτηνά η ταυτοποίηση φύλου είναι πολύ σημαντική για τη διατήρηση και διαχείριση των ειδών PCR-SSCP ανάλυση ενός τμήματος 400bp του γονιδίου CHD ιάκριση συγγενών ειδών του γένους Macrolophus mtdna analysis Αδυναμία μελέτης της οικολογίας των αρπακτικών (μετακινήσεις, προτιμήσεις καλλιεργειών, φυτά καταφύγια) που θα βοηθούσε στην ορθολογικότερη διαχείρισή τους. ιατήρηση του του Γκιζανιού Γκιζανιού,, ενδημικού ψαριού της Ρόδου Εξαιτίας ανθρωπογενών παρεμβάσεων θεωρείται απειλούμενο είδος υψηλής προτεραιότητας από την Ε.Ε. Ανάλυση RAPD και λειτουργικών γονιδίων (MHC): Πολύ χαμηλά επίπεδα πολυμορφισμού, αιμομικτική κατάπτωση, κίνδυνος εξαφάνισης Μελέτη της Βιολογίας και της Γενετικής των υπαρχόντων πληθυσμών και διατύπωση διαχειριστικών προτάσεων MHC Α Β Γ M RAPD Ιχνηλασιμότητα των ΓΤΟ Γιατί ο έλεγχος για ΓΤΟ; Νομοθεσία ΗΠΑ: Σήμανση τροφών GM-Free <5% ΓΤ ΕΕ: Σήμανση τροφών ΓΤ εάν >1% ΓΤ Ιαπωνία: Σήμανση τροφών ΓΤ εάν >5% Πως ελέγχουμε για ΓΤΟ PCR: Έλεγχος για παρουσία εισαγόμενου ξένου DNA Υπέρ: σταθερότητα DNA Κατά: Ακριβό, χρονοβόρο ΓΤΟ Θετικό ΓΤΟ αρνητικό ELISA: Έλεγχος παρουσίας πρωτεϊνών από τη γενετική τροποποίηση Υπέρ: Γρήγορο, φθηνό, Κατά: Εξειδίκευση για κάθε φυτό, σταθερότητα πρωτεΐνης Ανάπτυξη και Εφαρμογή Μοριακών εικτών για την Ταυτοποίηση Ειδών Κρέατος στην Αλυσίδα Εμπορίας τους ή πιο απλά: Ιχνηλασιμότητα τροφών 7

8 Ιχνηλασιμότητα τροφών Τροφή (Κονσερβοποιημένη, επεξεργασμένη, ωμή, μαγειρεμένη) Εξαγωγή και απομόνωση DNA Επεξεργασία DNA (PCR, πέψη, ηλεκτροφόρηση, ανάλυση) Η Αναγκαιότητα της Ταυτοποίησης ιατροφικές Κρίσεις (BSE,γρίπη πουλερικών). Νοθεία (ηλιέλαιου, γάλακτος, κρεατοσκευασμάτων). Τροφικές αλλεργίες δηλητηριάσεις. Γ.Τ. τρόφιμα. Αύξηση της ανησυχίας και του ενδιαφέροντος των καταναλωτών για την σύσταση & ποιότητα των τροφίμων. Απαραίτητη η ανάπτυξη αξιόπιστων μεθόδων πιστοποίησης της αυθεντικότητας των συστατικών. Προστασία της υγείας των καταναλωτών, οικονομικοί & θρησκευτικοί λόγοι. Ταυτοποίηση των ειδών που περιέχονται στο αρχικό επεξεργασμένο προϊόν Ενίσχυση επιθυμητών γονιδιακών τόπων των Cyt b,12s b rrna, COI (PCR, universal primers) PCR προϊόντα: Επεξεργασμένα προϊόντα κρέατος πουλερικών 12S rrna Cyt b Βιοπληροφορική ανάλυση GenBank,BioEdit & REBsite Πέψη με διαφορετικά ένζυμα περιορισμού Ηλεκτροφόρηση και Χρώση (Silver Staining) Καταλληλότερο Ε.Π. Πρότυπα 10 ειδών πουλερικών και 3 θηλαστικών μετά την πέψη του 12S rrna με το AciI. όμοια πρότυπα με το νωπό κρέας Μίγμα κρεάτων & ιατροφική απάτη Τα πρότυπα από τα παριζάκια γαλοπούλας είναι όμοια με αυτά των προϊόντων από κοτόπουλο και όχι με της γαλοπούλας, όπως θα έπρεπε! Λουκάνικο στρουθοκάμηλου Ανάμιξη κρέατος στρουθοκαμήλου με χοιρινό για την παρασκευή λουκάνικου στρουθοκαμήλου χοιρινό στρουθοκάμηλος Πέψη του Cyt b με HaeIII & HinfI στα δείγματα: 1) Κοτόπουλο νωπό, 2) Κοτόπουλο ψητό, 3) Μπιφτέκι κοτόπουλου, 4) Παριζάκι κοτόπουλου, 5) Γαλοπούλα νωπό, 6) Σνίτσελ γαλοπούλας, 7) Παριζάκι γαλοπούλας 1, 8) Παριζάκι γαλοπούλας 2. 8

9 Βιοτεχνολογία και Περιβάλλον Η βιοτεχνολογία μπορεί να βοηθήσει αποτελεσματικά στην επίλυση περιβαλλοντικών προβλημάτων ή στην εφαρμογή βιομηχανικών μεθόδων ή διεργασιών που περιορίζουν την ρύπανση ή μόλυνση του περιβάλλοντος 1. Βιολογική Αποκατάσταση Ηχρήση της μεταβολικής ικανότητας μικροοργανισμών με στόχο την αποκατάσταση και εξυγίανση ρυπασμένων εδαφών, υδροφόρων και λοιπών οικοσυστημάτων 2. Ανάπτυξη βιομηχανικών διεργασιών Χρήση μικροοργανισμών φιλικών προς το περιβάλλον αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα Τι περιλαμβάνει η βιολογική απορρύπανση Χρήση άγριων στελεχών ή γενετικά τροποποιημένων μικροοργανισμών με ιδιαίτερες ικανότητες διάσπασης υπολειμματικών και ιδιαίτερα τοξικών οργανικών ρύπων 1. Πολυαρωματικοί Υδρογονάνθρακες 2. Πολυχλωριωμένα ιφαινύλια 3. Πολυχλωριωμένες φαινόλες 4. Γεωργικά Φάρμακα Βακτήρια «δείκτες» ανίχνευση μόλυνσης και ρύπανσης του περιβάλλοντος μικροοργανισμοί ευαίσθητοι σε συγκεκριμένους ρυπαντές Βιοτεχνολογία στην ανάπτυξη περιβαλλοντικά φιλικών βιομηχανικών διεργασιών Βιολογική επεξεργασία Υγρών και Στερεών Αποβλήτων Παραγωγή Βιοαιθανόλης, Βιοαερίου Παραγωγή Βιοπλαστικών Βιολογική ανάκτηση μετάλλων Παραγωγή βιολογικών γεωργικών φαρμάκων Σας ευχαριστώ για την προσοχή σας Καλό Απόγευμα ΤΜΗΜΑ ΒΙΟΧΗΜΕΙΑΣ & ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Τι κοινό έχουν όλα τα παραπάνω; Χρησιμοποιούν μικροοργανισμούς ή ένζυμα τους αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα DEPARTMENT OF BIOCHEMISTRY & BIOTECHNOLOGY 9


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό

ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό Γενετική Πληθυσμών γενετική δομή ενός πληθυσμού αλληλόμορφα γενότυποι Ομάδα ατόμων του ίδιου είδους που μπορούν να διασταυρωθούν Πρότυπα

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (Μοριακή Βελτίωση) 1 Βασίζεται στη χρήση μοριακών δεικτών που είναι συνδεδεμένοι με επιθυμητές χρωμοσωμικές περιοχές. Μοριακοί δείκτες είναι τυχαία επιλεγμένα τμήματα DNA χωρίς

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Τι είναι Βιοτεχνολογία;

Τι είναι Βιοτεχνολογία; Βιοτεχνολογία Ζώων Τι είναι Βιοτεχνολογία; Γενικός ορισμός Η εφαρμογή της τεχνολογίας για την τροποποίηση ή βελτίωση ενός βιολογικού οργανισμού Περιγραφικός ορισμός Η εφαρμογή της τεχνολογίας για την τροποποίηση

Διαβάστε περισσότερα

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus 4// Bιολογική ποικιλότητα ή Bιοποικιλότητα ποικιλότητα των διαφόρων μορφών ζωής Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus Επίπεδα βιοποικιλότητας Γενετική ποικιλότητα Ποικιλότητα

Διαβάστε περισσότερα


ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

Τίτλος εργασίας: Καθορισμός του φύλου στους ζωικούς οργανισμούς

Τίτλος εργασίας: Καθορισμός του φύλου στους ζωικούς οργανισμούς Τίτλος εργασίας: Καθορισμός του φύλου στους ζωικούς οργανισμούς Ένας από τους βασικότερους βιολογικούς μηχανισμούς, ο καθορισμός του φύλου, χαρακτηρίζεται από υψηλό επίπεδο ποικιλότητας μηχανισμών και

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 17 (+ παράρτημα ε: mus musculus) Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA. Αποτύπωμα DNA. 2 ΕΙΚΟΝΑ 17.1 Παράδειγμα μεταλλαξιγένεσης ειδικής θέσης με

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα


ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενότητα 3: : Ασφάλεια Βιολογικών Τροφίμων

Ενότητα 3: : Ασφάλεια Βιολογικών Τροφίμων Ενότητα 3: : Ασφάλεια Βιολογικών Τροφίμων Διάλεξη 3.2 : Ποιοτικός έλεγχος & ασφάλεια στην αλυσίδα παραγωγής βιολογικών προϊόντων Εργαστήριο Πληροφορικής Γεωπονικό Πανεπιστήμιο Αθηνών http://infolab.aua.gr

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΓΥΜΝΑΣΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΓΥΜΝΑΣΙΟΥ 1.Να τοποθετήσετε τους παρακάτω όρους από τον πιο απλό στον πιο σύνθετο: σύστηµα οργάνων κύτταρο ιστός, οργανισµός όργανο. 2.Να φτιάξετε µια τροφική αλυσίδα µε τους παρακάτω

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΚΑΤΕΥΘΥΝΣΗ: ΤΡΟΦΙΜΑ - ΒΙΟΤΕΧΝΟΛΟΓΙΑ Σκοπός: εκπαίδευση - Βιοτεχνολογία - Επιστήµη και Τεχνολογία Τροφίµων συστατικά τροφίµων διεργασίες επεξεργασίας/συντήρησης τροφίµων ποιότητα, υγιεινή και συσκευασία

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΧΡΗΣΙΜΟΤΗΤΑ ΤΗΣ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΧΡΗΣΙΜΟΤΗΤΑ ΤΗΣ Ο σακχαρώδης διαβήτης είναι μία από τις ασθένειες που ταλαιπωρεί μεγάλο αριθμό ατόμων σε όλο τον κόσμο. Οι διαβητικοί αντιμετωπίζουν σοβαρά προβλήματα υγείας, επειδή

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί

Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί Εργασία στο μάθημα της Βιολογίας Υπεύθυνος καθηγητής : Κ.Κεραμάρης Μαθητές : Λιούμη Κυριακή, Μωραΐτης Βαγγέλης Περιεχόμενα

Διαβάστε περισσότερα


ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σήµερα οι εξελίξεις στην Επιστήµη και στην Τεχνολογία δίνουν τη

Σήµερα οι εξελίξεις στην Επιστήµη και στην Τεχνολογία δίνουν τη ΚΕΦΑΛΑΙΟ 7ο: ΑΡΧΕΣ & ΜΕΘΟ ΟΛΟΓΙΑ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Συνδυασµός ΤΕΧΝΟΛΟΓΙΑΣ & ΕΠΙΣΤΗΜΗΣ Προσφέρει τη δυνατότητα χρησιµοποίησης των ζωντανών οργανισµών για την παραγωγή χρήσιµων προϊόντων 1 Οι ζωντανοί οργανισµοί

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... ΚΕΦΑΛΑΙΟ 8 ο ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...10 1 ΚΕΦΑΛΑΙΟ 8 ο I. Εφαρµογές της βιοτεχνολογίας

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 27/5/2016 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 27/5/2016 ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 1 Α 2 Γ 3Α 4 Β 5 Α 6 Α 7 Γ Β2 Κάθε φυσιολογικό μεταφασικά χρωμόσωμα αποτελείται από δύο αδελφές χρωματίδες, οι οποίες

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΡΥΠΑΝΣΗ. Ρύποι. Αντίδραση βιολογικών συστημάτων σε παράγοντες αύξησης

ΡΥΠΑΝΣΗ. Ρύποι. Αντίδραση βιολογικών συστημάτων σε παράγοντες αύξησης ΡΥΠΑΝΣΗ 91 είναι η άμεση ή έμμεση διοχέτευση από τον άνθρωπο στο υδάτινο περιβάλλον ύλης ή ενέργειας με επιβλαβή αποτελέσματα για τους οργανισμούς ( ο ορισμός της ρύπανσης από τον ΟΗΕ ) Ρύποι Φυσικοί (εκρήξεις

Διαβάστε περισσότερα


Τάσος Λεγάκις Ζωολογικό Μουσείο Πανεπιστημίου Αθηνών ΑΞΙΟΛΟΓΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΝΟΜΟΘΕΣΙΑΣ ΓΙΑ ΤΗ ΒΙΟΠΟΙΚΙΛΟΤΗΤΑ ΣΤΗΝ ΕΛΛΑ Α Τάσος Λεγάκις Ζωολογικό Μουσείο Πανεπιστημίου Αθηνών ΑΞΙΟΛΟΓΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΝΟΜΟΘΕΣΙΑΣ ΓΙΑ ΤΗ ΒΙΟΠΟΙΚΙΛΟΤΗΤΑ ΣΤΗΝ ΕΛΛΑ Α ιεθνές Συνέδριο «ίκαιο & Προστασία της Φύσης», Αθήνα, 5-6.12.2003 Βιοποικιλότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly Department of Biochemistry and Biotechnology University of Thessaly Laboratory of Molecular Biology and Genomics ΤΡΑΝΣΚΡΙΠΤΟΜΙΚΗ ΚΑΙ ΠΡΩΤΕΟΜΙΚΗ ΑΝΑΛΥΣΗ ΤΟΥ ΣΗΜΑΝΤΙΚΟΤΕΡΟΥ ΠΑΡΑΣΙΤΟΥ ΤΗΣ ΕΛΙΑΣ, ΤΟΥ ΕΝΤΟΜΟΥ

Διαβάστε περισσότερα

Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων

Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων - Μάστερ στη Βιοτεχνολογία Φυτών - Μάστερ στη Βιοτεχνολογία Ζώων - Μάστερ στη

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΣΥΝΕΠΕΙΕΣ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΓΕΝΕΤΙΚΗ Ένας επιστημονικός κλάδος που με τα επιτεύγματά του προκάλεσε έντονες συζήσεις στο τέλος του 20 ου αιώνα και αναμένεται να απασχολήσει εξίσου έντονα, αν όχι να μονοπωλήσει το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα


ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΜΑΣΤΕΡ (MSc) ΒΙΟΤΕΧΝΟΛΟΓΙΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΦΥΣΙΚΟΙ ΠΟΡΟΙ Η ΣΧΕΣΗ ΜΑΣ ΜΕ ΤΗ ΓΗ Δ. ΑΡΖΟΥΜΑΝΙΔΟΥ ΦΥΣΙΚΟΙ ΠΟΡΟΙ Η ΣΧΕΣΗ ΜΑΣ ΜΕ ΤΗ ΓΗ Δ. ΑΡΖΟΥΜΑΝΙΔΟΥ είναι οι παραγωγικές δυνάμεις ή το αποτέλεσμα των παραγωγικών δυνάμεων που υπάρχουν και δρουν στο φυσικό περιβάλλον και που για τον σημερινό άνθρωπο μπορούν,

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα