Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος"

Transcript

1 Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος Δρ Ζήσης Μαμούρης Καθηγητής Γενετικής Τμήμα Βιοχημείας & Βιοτεχνολογίας Πανεπιστήμιο Θεσσαλίας Μοριακή Βιολογία και Γενετική Μηχανική: Μελέτη, Ανάλυση, Τροποποίηση του DNA και του RNA Εξαγωγή Ράψιμο Έχουμε τα «εργαλεία» Αντιγραφή Κόψιμο Σήμανση Η ΒΙΟΤΕΧΝΟΛΟΓΙΑ Βιολογία Βιοτεχνολογία Βιοχημεία Βιομηχανική Χημικές διεργασίες Πληροφορική Μηχανική Χημεία Ο 6ος Μαζικός Αφανισμός Τα γεωλογικά δεδομένα υποδεικνύουν 5 μαζικούς αφανισμούς ειδών Επί του παρόντος είμαστε μάρτυρες του 6ου μαζικού αφανισμού Βασικός υπεύθυνος οι ανθρωπογενείς παρεμβάσεις: Καταστροφές ή/και κατακερματισμός φυσικού περιβάλλοντος Κυνήγι Ταξινομική ομάδα Θηλαστικά Πτηνά Ερπετά Αμφίβια Ψάρια Ασπόνδυλα Φυτά Αριθμός % των ομάδων % των ειδών αφανισμών που χάθηκαν που απειλούνται Αφανισμοί που καταχωρήθηκαν από το 1900 Ο ρυθμός των αφανισμών επιταχύνεται Θερμά σημεία Βιοποικιλότητας περιοχές με υψηλή συγκέντρωση ενδημικών ειδών, στις οποίες καταγράφεται ταχεία απώλεια ενδιαιτημάτων Μοριακή Οικολογία Η Μοριακή Οικολογία χρησιμοποιεί τεχνικές μοριακής γενετικής για να λύσει προβλήματα οικολογίας, εξέλιξης και συμπεριφοράς, κάτω από το πρίσμα και την προοπτική της διατήρησης της βιοποικιλότητας 1

2 Αναδιπλασιασμός του DNA Λάθη Μοριακοί είκτες Μικρές περιοχές του γονιδιώματος που χρησιμοποιούνται ως δείκτες γενετικής ποικιλομορφίας Είναι χρήσιμοι μόνο όταν είναι πολυμορφικοί στους πληθυσμούς 3 εκατ. πολυμορφικές θέσεις Single Nucleotide Polymorphisms (SNPs) AGTTCGATTGCTCGATAGCACGAT AGTTCAATTGCTTGATAGCACGAT AGTTCGATTGCTTGATAGCTCGAT Repeats AGTTCAATTGCTTGATAGCGCGAT AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT Deletions AGTTCAATTGATAGCGCGAT Γιατί μοριακοί δείκτες; Ενυπάρχουν στα άτομα (δεν μπορούν να χαθούν) Κληρονομήσιμοι (ταυτοποίηση απογόνων) εν καταστρέφεται το δείγμα (δεν απαιτείται θανάτωση του ζώου) Πολλοί διαφορετικοί δείκτες: Ισοένζυμα Αλληλουχίες μιτοχονδριακού (mt( mt) DNA Αλληλουχίες χλωροπλαστικού (cp) DNA Μικροδορυφορικό DNA Αλληλουχίες πυρηνικού DNA Πυρηνικό DNA Εξωπυρηνικό DNA Μικροδορυφορικό DNA Μικροδορυφόροι είναι τόποι όπου μικρές αλληλουχίες DNA επαναλαμβάνονται στη σειρά η μια αμέσως μετά την άλλη. Χρωμόσωμα Y Μικρό χρωμόσωμα cpdna που προσδιορίζει Μιτοχονδριακό Χρωμόσωμα DNA το (mtdna) φύλο ενός Υ ατόμου. Έμβρυα με Το σπέρμα δίνει μόνο χρωμόσωμα γενετικό υλικό Υ γίνονται αρσενικά. και όχι κυτταρικά οργανίδια. Έτσι, η γενετική Έτσι, πληροφορία του όλο το mtdna προέρχεται χρωμοσώματος από Υ το είναι μόνο ωάριο, το οποίο είναι πατρικής μητρικής προέλευσης. προέλευσης. mtdna Polymerase Chain Reaction (PCR) Ability to generate identical high copy number DNAs made possible in the 1970s by recombinant DNA technology (i.e., cloning). Cloning DNA is time consuming and expensive. Probing libraries can be like hunting for a needle in a haystack. PCR, discovered in 1983 by Kary Mullis, enables the amplification (or duplication) of millions of copies of any DNA sequence with known flanking sequences. Requires only simple, inexpensive ingredients and a couple hours. DNA template Primers (anneal to flanking sequences) DNA polymerase dntps Mg 2+ Buffer Can be performed by hand or in a machine called a thermal cycler. 1993: Nobel Prize for Chemistry Hot water bacteria: Thermus aquaticus Taq DNA polymerase Life at High Temperatures by Thomas D. Brock Biotechnology in Yellowstone 1994 Yellowstone Association for Natural Science 2

3 Gel Electrophoresis separates nucleic acids by size Πηκτή Θήκες Vetex Τροφοδοτικό Gel Electrophoresis separates nucleic acids by size DNA or RNA have negative charge. They migrate towards cathode, in "bands" according to mol wt "Loaded" onto gel at anode end. Smaller molecules navigate through the matrix faster Buffer Nucleic acids can be detected by general stains, or... (not sequence specific) DNA ή Γενετικοί είκτες: γενετικοί, πολυμορφικοί τόποι, με περισσότερα του ενός αλληλόμορφα, οι οποίοι είναι δυνατόν να ανιχνευτούν με μοριακή ανάλυση. AFLP: Amplified Fragments Length Polymorphism RFLP: Restriction Fragments Length Polymorphism RAPD: Randomly Amplified Polymorphic DNA SNP: Single Nucleotide Polymorphism SSCP: Single Strand Conformation Polymorphism SSR: Simple Sequence Repeat OLA: Oligonucleotide Ligation Assay VNTR: Variable Number of Tandem Repeat CAPS: Cleaved Amplified Polymorphic Sequence Μοριακοί είκτες Ισοένζυμα Χαμηλός πολυμορφισμός Πιθανή επιλογή Χαμηλή αναλυτική ικανότητα (Αρχικά σε Ανθρώπους, Harris, 1966) Heterozygote Translation Enzyme products Electrophoresis Homozygote Μέθοδος RFLP Βασίζεται στα ένζυμα περιορισμού Μιτοχονδριακό DNA Kb 37 γονίδια 13 mrna Συντηρημένη ομή Σημαντικό Μοριακό Εργαλείο Γρήγορος ρυθμός μετάλλαξης Μητρική κληρονόνιση Απουσία ανασυνδυασμού Γρήγορη διαφοροποίηση Εύκολο στη χρήση 3

4 Ανάλυση MtDNA με χρήση Τεχνική RAPD RFLP Αλληλούχισης (Sequencing) Τεχνική RAPD DNA digestion, ligation, PCR and detection Μικροδορυφόροι (SSR Simple Sequence Repeats) Οι μονάδες επανάληψης είναι συνήθως δι-, τρι-, τετρα-, πεντανουκλεοτίδια 21 Με τη χρήση διαφόρων μικροδορυφορικών τόπων, μπορεί να παραχθεί ένα μοναδικό γενοτυπικό πρότυπο για κάθε άτομο, επιτρέποντας την ατομική ταυτοποίηση SSCP (Single Strand Conformation Polymorphism) Normal Allele (N) Mutated Allele (M) C A A GT T PCR Products Denaturation CG A GC T CA A GTT CAA CGA NN NM MM GCT Polyacrilamide Gel Electrophoresis CGA GTT GCT 4

5 Γιατί ΤΟΣΟΙ ΠΟΛΛΟΙ μοριακοί δείκτες; Γονιδιώματα πολύ διαφορετικά - Συμπαγή γονιδιώματα: λιγότερο πολυαλληλομορφικοί δείκτες Ποικιλία καταστάσεων - Εξημερωμένοι και Φυσικοί πληθυσμοί διαχωρισμένοι για γενιές: μεγάλη γενετική διαφοροποίηση Ποικιλία τεχνικών για ατομική γενοτύπηση - Φτηνή/ακριβή τεχνικά εύκολη/δύσκολη Ποικιλία πληθυσμιακών καταστάσεων - Πρόσφατοι στενωποί: μικρή ενδοπληθυσμιακή ποικιλότητα ιαφορετικοί τύποι γενετικών δεικτών - Υπερέχοντες, συνυπερέχοντες, δι-, πολύ- αλληλομορφικοί Σωστή επιλογή = γνώση της βιολογίας του είδους Έχει η φαινοτυπική ποικιλότητα πάντα γενετικό υπόβαθρο; Η περίπτωση της κουτσομούρας ( (Mullus barbatus) Η μορφολογική ποικιλότητα δεν συμβαδίζει πάντα με τη γενετική διαφοροποίηση Γενετική ποικιλότητα στο πυρηνικό και το μιτοχονδριακό DNA RAPD mtdna ΜΙΚΡΟ ΟΡΥΦΟΡΙΚΟ ΑΛΛΗΛΟΥΧΙΣΗ DNA (SEQUENCING Μοριακή ταυτοποίηση: Είδη, Άτομα και Φύλο Αντιστοίχιση ατόμων σε πληθυσμούς Ταυτοποίηση υβριδίων μεταξύ ειδών Ταυτοποίηση λείας σε στομάχια θηρευτών Ταυτοποίηση φορέων ασθενειών Ιατροδικαστικές έρευνες σε φυσικούς ζωικούς πληθυσμούς Ανίχνευση Γενετικά Τροποποιημένων Οργανισμών Οικολογία Συμπεριφοράς Προσδιορισμός τύπων ζευγαρώματος Πολυγαμία / Μονογαμία ιμορφισμός και αναλογία φύλου Μοριακή ανίχνευση επιλογής συντρόφου (Π.χ. MHC) ιαμάχες μεταξύ φύλων Εκτίμηση διασποράς των ζώων 5

6 Πληθυσμιακή Γενετική και Εφαρμοσμένη Φυλογεωγραφία Εκτίμηση δομής, δραστικού μεγέθους και κατανομής πληθυσμών και μεταπληθυσμών Γονιδιακή ροή και ρυθμοί μετανάστευσης Προσδιορισμός και ταυτοποίηση μεταναστών Πληθυσμιακές στενωποί Ταξινομικές αποφάσεις Ανίχνευση του μητρικού πληθυσμού εισαγόμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών και πληθυσμών Γενετική της αποκατάστασης των ειδών Κρυο-συντήρηση γαμετών, τεχνητή γονιμοποίηση, κλωνοποίηση Χρήση Μοριακών εικτών για Προσδιορισμό των «Μονάδων ιατήρησης» σε Απειλούμενους Φυσικούς Πληθυσμούς TUATARA (Sphenodon) αρχαία σειρά ερπετών Πάνθηρας της Florida Τσίτα (Acinonyx jubatus) Γκρίζος Λύκος Θαλάσσιοι Ελέφαντες 100δες είδη πτηνών 100δες είδη εντόμων..και δυστυχώς ο κατάλογος συνεχώς μεγαλώνει Μοριακά εργαλεία για αποκάλυψη απάτης Γενετική ανάλυση κρέατος φάλαινας ραματική μείωση των πληθυσμών ιεθνείς διαμάχες για την προστασία Ταυτοποίηση είδους με mtdna ανάλυση Παράνομη διακίνηση κρέατος στις παγκόσμιες αγορές Παράνομη διακίνηση ιστών από προστατευόμενα είδη DNA Barcode: Μικρές τυποποιημένες αλληλουχίες που θα βοηθήσουν στη διάκριση των ειδών σε ένα ευρύ φάσμα ζωντανών οργανισμών εν φιλοδοξεί να περιγράψει τα είδη, αλλά να προσδιορίσει τα όριά τους Απελευθερώσεις λαγών εκτροφείου Ανεξέλεγκτες απελευθερώσεις λαγών εκτροφείου Γενετική ρύπανση Απώλεια τοπικής ποικιλομορφίας Ηλύση U A B C M mtdna-rflp ανάλυση: 3 γενετικές ομάδες A B C1 C Ένα στέλεχος του ιού EBHS, διαφορετικό από τα ελληνικά, εισαγόμενο πιθανώς από την Κ. Ευρώπη 6 6

7 ιάκριση διαφόρων φυλών χοίρων 428bp 256bp 172bp Sus scrofa X Sus scrofa domestica Ανεξέλεγκτη εκτροφή αγριόχοιρων Γενετική ρύπανση από εμπλουτισμούς ιατροφική απάτη Πέψη Μ Πέψη Μ Εκτρεφόμενοι χοίροι ΥβρίδιοΑγριόχοιροι Υβρίδιο PCR-RFLP και SSCP ανάλυση του υποδοχέα της μελανοκορτίνης (MC1R) Ταυτοποίηση Φύλου σε Γεράκια ( (Accipiter cooperii) Αρσενικό ZZ Αρσενικό ή Θηλυκό; Ενήλικος Φυλετικός ιμορφισμός Θηλυκό ZW Στα πτηνά η ταυτοποίηση φύλου είναι πολύ σημαντική για τη διατήρηση και διαχείριση των ειδών PCR-SSCP ανάλυση ενός τμήματος 400bp του γονιδίου CHD ιάκριση συγγενών ειδών του γένους Macrolophus mtdna analysis Αδυναμία μελέτης της οικολογίας των αρπακτικών (μετακινήσεις, προτιμήσεις καλλιεργειών, φυτά καταφύγια) που θα βοηθούσε στην ορθολογικότερη διαχείρισή τους. ιατήρηση του του Γκιζανιού Γκιζανιού,, ενδημικού ψαριού της Ρόδου Εξαιτίας ανθρωπογενών παρεμβάσεων θεωρείται απειλούμενο είδος υψηλής προτεραιότητας από την Ε.Ε. Ανάλυση RAPD και λειτουργικών γονιδίων (MHC): Πολύ χαμηλά επίπεδα πολυμορφισμού, αιμομικτική κατάπτωση, κίνδυνος εξαφάνισης Μελέτη της Βιολογίας και της Γενετικής των υπαρχόντων πληθυσμών και διατύπωση διαχειριστικών προτάσεων MHC Α Β Γ M RAPD Ιχνηλασιμότητα των ΓΤΟ Γιατί ο έλεγχος για ΓΤΟ; Νομοθεσία ΗΠΑ: Σήμανση τροφών GM-Free <5% ΓΤ ΕΕ: Σήμανση τροφών ΓΤ εάν >1% ΓΤ Ιαπωνία: Σήμανση τροφών ΓΤ εάν >5% Πως ελέγχουμε για ΓΤΟ PCR: Έλεγχος για παρουσία εισαγόμενου ξένου DNA Υπέρ: σταθερότητα DNA Κατά: Ακριβό, χρονοβόρο ΓΤΟ Θετικό ΓΤΟ αρνητικό ELISA: Έλεγχος παρουσίας πρωτεϊνών από τη γενετική τροποποίηση Υπέρ: Γρήγορο, φθηνό, Κατά: Εξειδίκευση για κάθε φυτό, σταθερότητα πρωτεΐνης Ανάπτυξη και Εφαρμογή Μοριακών εικτών για την Ταυτοποίηση Ειδών Κρέατος στην Αλυσίδα Εμπορίας τους ή πιο απλά: Ιχνηλασιμότητα τροφών 7

8 Ιχνηλασιμότητα τροφών Τροφή (Κονσερβοποιημένη, επεξεργασμένη, ωμή, μαγειρεμένη) Εξαγωγή και απομόνωση DNA Επεξεργασία DNA (PCR, πέψη, ηλεκτροφόρηση, ανάλυση) Η Αναγκαιότητα της Ταυτοποίησης ιατροφικές Κρίσεις (BSE,γρίπη πουλερικών). Νοθεία (ηλιέλαιου, γάλακτος, κρεατοσκευασμάτων). Τροφικές αλλεργίες δηλητηριάσεις. Γ.Τ. τρόφιμα. Αύξηση της ανησυχίας και του ενδιαφέροντος των καταναλωτών για την σύσταση & ποιότητα των τροφίμων. Απαραίτητη η ανάπτυξη αξιόπιστων μεθόδων πιστοποίησης της αυθεντικότητας των συστατικών. Προστασία της υγείας των καταναλωτών, οικονομικοί & θρησκευτικοί λόγοι. Ταυτοποίηση των ειδών που περιέχονται στο αρχικό επεξεργασμένο προϊόν Ενίσχυση επιθυμητών γονιδιακών τόπων των Cyt b,12s b rrna, COI (PCR, universal primers) PCR προϊόντα: Επεξεργασμένα προϊόντα κρέατος πουλερικών 12S rrna Cyt b Βιοπληροφορική ανάλυση GenBank,BioEdit & REBsite Πέψη με διαφορετικά ένζυμα περιορισμού Ηλεκτροφόρηση και Χρώση (Silver Staining) Καταλληλότερο Ε.Π. Πρότυπα 10 ειδών πουλερικών και 3 θηλαστικών μετά την πέψη του 12S rrna με το AciI. όμοια πρότυπα με το νωπό κρέας Μίγμα κρεάτων & ιατροφική απάτη Τα πρότυπα από τα παριζάκια γαλοπούλας είναι όμοια με αυτά των προϊόντων από κοτόπουλο και όχι με της γαλοπούλας, όπως θα έπρεπε! Λουκάνικο στρουθοκάμηλου Ανάμιξη κρέατος στρουθοκαμήλου με χοιρινό για την παρασκευή λουκάνικου στρουθοκαμήλου χοιρινό στρουθοκάμηλος Πέψη του Cyt b με HaeIII & HinfI στα δείγματα: 1) Κοτόπουλο νωπό, 2) Κοτόπουλο ψητό, 3) Μπιφτέκι κοτόπουλου, 4) Παριζάκι κοτόπουλου, 5) Γαλοπούλα νωπό, 6) Σνίτσελ γαλοπούλας, 7) Παριζάκι γαλοπούλας 1, 8) Παριζάκι γαλοπούλας 2. 8

9 Βιοτεχνολογία και Περιβάλλον Η βιοτεχνολογία μπορεί να βοηθήσει αποτελεσματικά στην επίλυση περιβαλλοντικών προβλημάτων ή στην εφαρμογή βιομηχανικών μεθόδων ή διεργασιών που περιορίζουν την ρύπανση ή μόλυνση του περιβάλλοντος 1. Βιολογική Αποκατάσταση Ηχρήση της μεταβολικής ικανότητας μικροοργανισμών με στόχο την αποκατάσταση και εξυγίανση ρυπασμένων εδαφών, υδροφόρων και λοιπών οικοσυστημάτων 2. Ανάπτυξη βιομηχανικών διεργασιών Χρήση μικροοργανισμών φιλικών προς το περιβάλλον αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα Τι περιλαμβάνει η βιολογική απορρύπανση Χρήση άγριων στελεχών ή γενετικά τροποποιημένων μικροοργανισμών με ιδιαίτερες ικανότητες διάσπασης υπολειμματικών και ιδιαίτερα τοξικών οργανικών ρύπων 1. Πολυαρωματικοί Υδρογονάνθρακες 2. Πολυχλωριωμένα ιφαινύλια 3. Πολυχλωριωμένες φαινόλες 4. Γεωργικά Φάρμακα Βακτήρια «δείκτες» ανίχνευση μόλυνσης και ρύπανσης του περιβάλλοντος μικροοργανισμοί ευαίσθητοι σε συγκεκριμένους ρυπαντές Βιοτεχνολογία στην ανάπτυξη περιβαλλοντικά φιλικών βιομηχανικών διεργασιών Βιολογική επεξεργασία Υγρών και Στερεών Αποβλήτων Παραγωγή Βιοαιθανόλης, Βιοαερίου Παραγωγή Βιοπλαστικών Βιολογική ανάκτηση μετάλλων Παραγωγή βιολογικών γεωργικών φαρμάκων Σας ευχαριστώ για την προσοχή σας Καλό Απόγευμα ΤΜΗΜΑ ΒΙΟΧΗΜΕΙΑΣ & ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Τι κοινό έχουν όλα τα παραπάνω; Χρησιμοποιούν μικροοργανισμούς ή ένζυμα τους αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα DEPARTMENT OF BIOCHEMISTRY & BIOTECHNOLOGY 9

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus 4// Bιολογική ποικιλότητα ή Bιοποικιλότητα ποικιλότητα των διαφόρων μορφών ζωής Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus Επίπεδα βιοποικιλότητας Γενετική ποικιλότητα Ποικιλότητα

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ:

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΕΝΑ ΠΕΙΡΑΜΑ ΜΕ ΑΓΝΩΣΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΤΗΝ ΥΓΕΙΑ, ΤΟ ΠΕΡΙΒΑΛΛΟΝ, ΤΗΝ ΚΟΙΝΩΝΙΑ ΝΙΚΟΛΑΣ ΠΡΙΜΗΚΥΡΙΟΣ, ΓΕΩΠΟΝΟΣ, Δρ. ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΦΥΤΩΝ ΓΕΝΕΤΙΚΑ

Διαβάστε περισσότερα

ΚΑΤΕΥΘΥΝΣΗ: ΤΡΟΦΙΜΑ - ΒΙΟΤΕΧΝΟΛΟΓΙΑ Σκοπός: εκπαίδευση - Βιοτεχνολογία - Επιστήµη και Τεχνολογία Τροφίµων συστατικά τροφίµων διεργασίες επεξεργασίας/συντήρησης τροφίµων ποιότητα, υγιεινή και συσκευασία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΚΑΛΑΒΡΥΤΩΝ ΕΥΣΕΒΙΟΣ ΚΗΠΟΥΡΓΟΣ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΤΡΟΦΙΜΑ

ΓΥΜΝΑΣΙΟ ΚΑΛΑΒΡΥΤΩΝ ΕΥΣΕΒΙΟΣ ΚΗΠΟΥΡΓΟΣ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΤΡΟΦΙΜΑ ΓΥΜΝΑΣΙΟ ΚΑΛΑΒΡΥΤΩΝ ΕΥΣΕΒΙΟΣ ΚΗΠΟΥΡΓΟΣ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΤΡΟΦΙΜΑ ΤΜΗΜΑ Γ2 ΕΠΙΜΕΛΕΙΑ: ΣΤΟΛΗ ΧΡΙΣΤΙΝΑ ΣΧΟΛΙΚΟ ΕΤΟΣ 2011-2012 ΕΙΣΑΓΩΓΗ Έχουν περάσει περίπου 15 χρόνια από τη δημιουργία γενετικά τροποποιημένων

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΡΟΣΗΜΟ ΘΑΛΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ. Α1. γ Α2. α Α3. β Α4. β Α5. δ

ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΡΟΣΗΜΟ ΘΑΛΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ. Α1. γ Α2. α Α3. β Α4. β Α5. δ ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Α1. γ Α2. α Α3. β Α4. β Α5. δ ΘΕΜΑ Β Β1. 1 Β 2 Α 3 Α 4 Β 5 Β 6 Α 7 Α 8 Β Β2. Σελ. 18 Σχολικού βιβλίου Το γενετικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΡΥΠΑΝΣΗ. Ρύποι. Αντίδραση βιολογικών συστημάτων σε παράγοντες αύξησης

ΡΥΠΑΝΣΗ. Ρύποι. Αντίδραση βιολογικών συστημάτων σε παράγοντες αύξησης ΡΥΠΑΝΣΗ 91 είναι η άμεση ή έμμεση διοχέτευση από τον άνθρωπο στο υδάτινο περιβάλλον ύλης ή ενέργειας με επιβλαβή αποτελέσματα για τους οργανισμούς ( ο ορισμός της ρύπανσης από τον ΟΗΕ ) Ρύποι Φυσικοί (εκρήξεις

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων

Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων - Μάστερ στη Βιοτεχνολογία Φυτών - Μάστερ στη Βιοτεχνολογία Ζώων - Μάστερ στη

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΜΑΣΤΕΡ (MSc) ΒΙΟΤΕΧΝΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ''

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' Από το 1950 και µετά αρχίζει η εντατικοποίηση της γεωργικής παραγωγής εστιάζοντας το ενδιαφέρον της αποκλειστικά

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΣΥΝΕΠΕΙΕΣ

ΓΕΝΕΤΙΚΗ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΣΥΝΕΠΕΙΕΣ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΓΕΝΕΤΙΚΗ Ένας επιστημονικός κλάδος που με τα επιτεύγματά του προκάλεσε έντονες συζήσεις στο τέλος του 20 ου αιώνα και αναμένεται να απασχολήσει εξίσου έντονα, αν όχι να μονοπωλήσει το

Διαβάστε περισσότερα

ΦΥΣΙΚΟΙ ΠΟΡΟΙ Η ΣΧΕΣΗ ΜΑΣ ΜΕ ΤΗ ΓΗ Δ. ΑΡΖΟΥΜΑΝΙΔΟΥ

ΦΥΣΙΚΟΙ ΠΟΡΟΙ Η ΣΧΕΣΗ ΜΑΣ ΜΕ ΤΗ ΓΗ Δ. ΑΡΖΟΥΜΑΝΙΔΟΥ ΦΥΣΙΚΟΙ ΠΟΡΟΙ Η ΣΧΕΣΗ ΜΑΣ ΜΕ ΤΗ ΓΗ Δ. ΑΡΖΟΥΜΑΝΙΔΟΥ είναι οι παραγωγικές δυνάμεις ή το αποτέλεσμα των παραγωγικών δυνάμεων που υπάρχουν και δρουν στο φυσικό περιβάλλον και που για τον σημερινό άνθρωπο μπορούν,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ:

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: Ανάλυση γονιδιακών πολυμορφισμών Σταυροπούλου Χρύσα,PhD Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας Ινστιτούτο Πυρηνικής

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 ΒΙΟΛΟΓΙΑ ΖΩΩΝ Ι - ΕΙΣΑΓΩΓΗ - ΒΑΣΙΚΕΣ ΑΡΧΕΣ - Σίνος Γκιώκας - Πανεπιστήμιο Πατρών 2015 1

Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 ΒΙΟΛΟΓΙΑ ΖΩΩΝ Ι - ΕΙΣΑΓΩΓΗ - ΒΑΣΙΚΕΣ ΑΡΧΕΣ - Σίνος Γκιώκας - Πανεπιστήμιο Πατρών 2015 1 Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 2015 1 Αντικείμενο μαθήματος: Περιεχόμενο μαθήματος: Προτεινόμενο σύγγραμμα: Διδάσκοντες: Μέθοδοι διδασκαλίας: Μέθοδοι αξιολόγησης: Τύπος μαθήματος:

Διαβάστε περισσότερα

ΙΑΤΡΙΚΟΣ ΣΥΛΛΟΓΟΣ ΘΕΣΣΑΛΟΝΙΚΗΣ

ΙΑΤΡΙΚΟΣ ΣΥΛΛΟΓΟΣ ΘΕΣΣΑΛΟΝΙΚΗΣ 1 ΙΑΤΡΙΚΟΣ ΣΥΛΛΟΓΟΣ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΤΡΟΠΗ ΓΙΑ ΤΗΝ ΕΚΤΙΜΗΣΗ ΤΩΝ ΠΙΘΑΝΩΝ ΕΠΙΠΤΩΣΕΩΝ ΤΩΝ ΓΕΝΕΤΙΚΩΣ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΟΡΓΑΝΙΣΜΩΝ ΣΤΗΝ ΥΓΕΙΑ ΤΟΥ ΑΝΘΡΩΠΟΥ Ο Ιατρικός Σύλλογος Θεσσαλονίκης µέσα στα πλαίσια της λειτουργίας

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος Προγραμματισμός Διδακτέας Ύλης Βιολογίας Α Γυμνασίου 2012-2013 Α ΤΕΤΡΑΜΗΝΟ Ενότητα Δραστηριότητες Βασικές Έννοιες Δ/κές Π/δοι Γνωριμία Εισαγωγικές σελίδες Γνωριμία με το βιβλίο μου 1 1 Ενότητα 1: Η Βιολογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

ΓΟΝΙΔΙΑ ΚΑΙ ΣΥΜΠΕΡΙΦΟΡΑ (ΚΕΦΑΛΑΙΟ 30) Διαμάντη Χριστίνα Α.Μ 3200 Κουπουρτίδου Χριστίνα Α.Μ 3216

ΓΟΝΙΔΙΑ ΚΑΙ ΣΥΜΠΕΡΙΦΟΡΑ (ΚΕΦΑΛΑΙΟ 30) Διαμάντη Χριστίνα Α.Μ 3200 Κουπουρτίδου Χριστίνα Α.Μ 3216 ΓΟΝΙΔΙΑ ΚΑΙ ΣΥΜΠΕΡΙΦΟΡΑ (ΚΕΦΑΛΑΙΟ 30) Διαμάντη Χριστίνα Α.Μ 3200 Κουπουρτίδου Χριστίνα Α.Μ 3216 Γονίδια και συμπεριφορά Αρχικά πρέπει να αναγνωρίσουμε τα στοιχεία εκείνα της συμπεριφοράς που είναι κληρονομήσιμα.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον 1 ο Επιμορφωτικό Σεμινάριο Γενετικής ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΓΕΝΕΤΙΚΗ ΑΝΑΛΥΣΗ Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον Γεωργία Κάκουρου, PhD ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Παγκόζμια Γκπαίδερζη «Σοξθή για όλξρπ Σοξθή για ζκέση»

Παγκόζμια Γκπαίδερζη «Σοξθή για όλξρπ Σοξθή για ζκέση» Παγκόζμια Γκπαίδερζη «Σοξθή για όλξρπ Σοξθή για ζκέση» Πείνα /Γενετικά Σροποποιημένα Σρόφιμα ΓΓΩΡΓΙΑΝΑ ΚΟΤΡΙΔΟΤ Γ- ΛΤΚΓΙΟΤ- ΛΤΚΓΙΟ ΑΓΙΟΤ ΙΩΑΝΝΗ ΛΓΜΓΟΤ Διαηοξθή και η ζημαζία ηηπ για ηημ ργεία 1) «Άφησε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα