Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος"

Transcript

1 Η Συμβολή της Βιοτεχνολογίας και της Μοριακής Βιολογίας στην Προστασία και ιαχείριση του Περιβάλλοντος Δρ Ζήσης Μαμούρης Καθηγητής Γενετικής Τμήμα Βιοχημείας & Βιοτεχνολογίας Πανεπιστήμιο Θεσσαλίας Μοριακή Βιολογία και Γενετική Μηχανική: Μελέτη, Ανάλυση, Τροποποίηση του DNA και του RNA Εξαγωγή Ράψιμο Έχουμε τα «εργαλεία» Αντιγραφή Κόψιμο Σήμανση Η ΒΙΟΤΕΧΝΟΛΟΓΙΑ Βιολογία Βιοτεχνολογία Βιοχημεία Βιομηχανική Χημικές διεργασίες Πληροφορική Μηχανική Χημεία Ο 6ος Μαζικός Αφανισμός Τα γεωλογικά δεδομένα υποδεικνύουν 5 μαζικούς αφανισμούς ειδών Επί του παρόντος είμαστε μάρτυρες του 6ου μαζικού αφανισμού Βασικός υπεύθυνος οι ανθρωπογενείς παρεμβάσεις: Καταστροφές ή/και κατακερματισμός φυσικού περιβάλλοντος Κυνήγι Ταξινομική ομάδα Θηλαστικά Πτηνά Ερπετά Αμφίβια Ψάρια Ασπόνδυλα Φυτά Αριθμός % των ομάδων % των ειδών αφανισμών που χάθηκαν που απειλούνται Αφανισμοί που καταχωρήθηκαν από το 1900 Ο ρυθμός των αφανισμών επιταχύνεται Θερμά σημεία Βιοποικιλότητας περιοχές με υψηλή συγκέντρωση ενδημικών ειδών, στις οποίες καταγράφεται ταχεία απώλεια ενδιαιτημάτων Μοριακή Οικολογία Η Μοριακή Οικολογία χρησιμοποιεί τεχνικές μοριακής γενετικής για να λύσει προβλήματα οικολογίας, εξέλιξης και συμπεριφοράς, κάτω από το πρίσμα και την προοπτική της διατήρησης της βιοποικιλότητας 1

2 Αναδιπλασιασμός του DNA Λάθη Μοριακοί είκτες Μικρές περιοχές του γονιδιώματος που χρησιμοποιούνται ως δείκτες γενετικής ποικιλομορφίας Είναι χρήσιμοι μόνο όταν είναι πολυμορφικοί στους πληθυσμούς 3 εκατ. πολυμορφικές θέσεις Single Nucleotide Polymorphisms (SNPs) AGTTCGATTGCTCGATAGCACGAT AGTTCAATTGCTTGATAGCACGAT AGTTCGATTGCTTGATAGCTCGAT Repeats AGTTCAATTGCTTGATAGCGCGAT AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT Deletions AGTTCAATTGATAGCGCGAT Γιατί μοριακοί δείκτες; Ενυπάρχουν στα άτομα (δεν μπορούν να χαθούν) Κληρονομήσιμοι (ταυτοποίηση απογόνων) εν καταστρέφεται το δείγμα (δεν απαιτείται θανάτωση του ζώου) Πολλοί διαφορετικοί δείκτες: Ισοένζυμα Αλληλουχίες μιτοχονδριακού (mt( mt) DNA Αλληλουχίες χλωροπλαστικού (cp) DNA Μικροδορυφορικό DNA Αλληλουχίες πυρηνικού DNA Πυρηνικό DNA Εξωπυρηνικό DNA Μικροδορυφορικό DNA Μικροδορυφόροι είναι τόποι όπου μικρές αλληλουχίες DNA επαναλαμβάνονται στη σειρά η μια αμέσως μετά την άλλη. Χρωμόσωμα Y Μικρό χρωμόσωμα cpdna που προσδιορίζει Μιτοχονδριακό Χρωμόσωμα DNA το (mtdna) φύλο ενός Υ ατόμου. Έμβρυα με Το σπέρμα δίνει μόνο χρωμόσωμα γενετικό υλικό Υ γίνονται αρσενικά. και όχι κυτταρικά οργανίδια. Έτσι, η γενετική Έτσι, πληροφορία του όλο το mtdna προέρχεται χρωμοσώματος από Υ το είναι μόνο ωάριο, το οποίο είναι πατρικής μητρικής προέλευσης. προέλευσης. mtdna Polymerase Chain Reaction (PCR) Ability to generate identical high copy number DNAs made possible in the 1970s by recombinant DNA technology (i.e., cloning). Cloning DNA is time consuming and expensive. Probing libraries can be like hunting for a needle in a haystack. PCR, discovered in 1983 by Kary Mullis, enables the amplification (or duplication) of millions of copies of any DNA sequence with known flanking sequences. Requires only simple, inexpensive ingredients and a couple hours. DNA template Primers (anneal to flanking sequences) DNA polymerase dntps Mg 2+ Buffer Can be performed by hand or in a machine called a thermal cycler. 1993: Nobel Prize for Chemistry Hot water bacteria: Thermus aquaticus Taq DNA polymerase Life at High Temperatures by Thomas D. Brock Biotechnology in Yellowstone 1994 Yellowstone Association for Natural Science 2

3 Gel Electrophoresis separates nucleic acids by size Πηκτή Θήκες Vetex Τροφοδοτικό Gel Electrophoresis separates nucleic acids by size DNA or RNA have negative charge. They migrate towards cathode, in "bands" according to mol wt "Loaded" onto gel at anode end. Smaller molecules navigate through the matrix faster Buffer Nucleic acids can be detected by general stains, or... (not sequence specific) DNA ή Γενετικοί είκτες: γενετικοί, πολυμορφικοί τόποι, με περισσότερα του ενός αλληλόμορφα, οι οποίοι είναι δυνατόν να ανιχνευτούν με μοριακή ανάλυση. AFLP: Amplified Fragments Length Polymorphism RFLP: Restriction Fragments Length Polymorphism RAPD: Randomly Amplified Polymorphic DNA SNP: Single Nucleotide Polymorphism SSCP: Single Strand Conformation Polymorphism SSR: Simple Sequence Repeat OLA: Oligonucleotide Ligation Assay VNTR: Variable Number of Tandem Repeat CAPS: Cleaved Amplified Polymorphic Sequence Μοριακοί είκτες Ισοένζυμα Χαμηλός πολυμορφισμός Πιθανή επιλογή Χαμηλή αναλυτική ικανότητα (Αρχικά σε Ανθρώπους, Harris, 1966) Heterozygote Translation Enzyme products Electrophoresis Homozygote Μέθοδος RFLP Βασίζεται στα ένζυμα περιορισμού Μιτοχονδριακό DNA Kb 37 γονίδια 13 mrna Συντηρημένη ομή Σημαντικό Μοριακό Εργαλείο Γρήγορος ρυθμός μετάλλαξης Μητρική κληρονόνιση Απουσία ανασυνδυασμού Γρήγορη διαφοροποίηση Εύκολο στη χρήση 3

4 Ανάλυση MtDNA με χρήση Τεχνική RAPD RFLP Αλληλούχισης (Sequencing) Τεχνική RAPD DNA digestion, ligation, PCR and detection Μικροδορυφόροι (SSR Simple Sequence Repeats) Οι μονάδες επανάληψης είναι συνήθως δι-, τρι-, τετρα-, πεντανουκλεοτίδια 21 Με τη χρήση διαφόρων μικροδορυφορικών τόπων, μπορεί να παραχθεί ένα μοναδικό γενοτυπικό πρότυπο για κάθε άτομο, επιτρέποντας την ατομική ταυτοποίηση SSCP (Single Strand Conformation Polymorphism) Normal Allele (N) Mutated Allele (M) C A A GT T PCR Products Denaturation CG A GC T CA A GTT CAA CGA NN NM MM GCT Polyacrilamide Gel Electrophoresis CGA GTT GCT 4

5 Γιατί ΤΟΣΟΙ ΠΟΛΛΟΙ μοριακοί δείκτες; Γονιδιώματα πολύ διαφορετικά - Συμπαγή γονιδιώματα: λιγότερο πολυαλληλομορφικοί δείκτες Ποικιλία καταστάσεων - Εξημερωμένοι και Φυσικοί πληθυσμοί διαχωρισμένοι για γενιές: μεγάλη γενετική διαφοροποίηση Ποικιλία τεχνικών για ατομική γενοτύπηση - Φτηνή/ακριβή τεχνικά εύκολη/δύσκολη Ποικιλία πληθυσμιακών καταστάσεων - Πρόσφατοι στενωποί: μικρή ενδοπληθυσμιακή ποικιλότητα ιαφορετικοί τύποι γενετικών δεικτών - Υπερέχοντες, συνυπερέχοντες, δι-, πολύ- αλληλομορφικοί Σωστή επιλογή = γνώση της βιολογίας του είδους Έχει η φαινοτυπική ποικιλότητα πάντα γενετικό υπόβαθρο; Η περίπτωση της κουτσομούρας ( (Mullus barbatus) Η μορφολογική ποικιλότητα δεν συμβαδίζει πάντα με τη γενετική διαφοροποίηση Γενετική ποικιλότητα στο πυρηνικό και το μιτοχονδριακό DNA RAPD mtdna ΜΙΚΡΟ ΟΡΥΦΟΡΙΚΟ ΑΛΛΗΛΟΥΧΙΣΗ DNA (SEQUENCING Μοριακή ταυτοποίηση: Είδη, Άτομα και Φύλο Αντιστοίχιση ατόμων σε πληθυσμούς Ταυτοποίηση υβριδίων μεταξύ ειδών Ταυτοποίηση λείας σε στομάχια θηρευτών Ταυτοποίηση φορέων ασθενειών Ιατροδικαστικές έρευνες σε φυσικούς ζωικούς πληθυσμούς Ανίχνευση Γενετικά Τροποποιημένων Οργανισμών Οικολογία Συμπεριφοράς Προσδιορισμός τύπων ζευγαρώματος Πολυγαμία / Μονογαμία ιμορφισμός και αναλογία φύλου Μοριακή ανίχνευση επιλογής συντρόφου (Π.χ. MHC) ιαμάχες μεταξύ φύλων Εκτίμηση διασποράς των ζώων 5

6 Πληθυσμιακή Γενετική και Εφαρμοσμένη Φυλογεωγραφία Εκτίμηση δομής, δραστικού μεγέθους και κατανομής πληθυσμών και μεταπληθυσμών Γονιδιακή ροή και ρυθμοί μετανάστευσης Προσδιορισμός και ταυτοποίηση μεταναστών Πληθυσμιακές στενωποί Ταξινομικές αποφάσεις Ανίχνευση του μητρικού πληθυσμού εισαγόμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών και πληθυσμών Γενετική της αποκατάστασης των ειδών Κρυο-συντήρηση γαμετών, τεχνητή γονιμοποίηση, κλωνοποίηση Χρήση Μοριακών εικτών για Προσδιορισμό των «Μονάδων ιατήρησης» σε Απειλούμενους Φυσικούς Πληθυσμούς TUATARA (Sphenodon) αρχαία σειρά ερπετών Πάνθηρας της Florida Τσίτα (Acinonyx jubatus) Γκρίζος Λύκος Θαλάσσιοι Ελέφαντες 100δες είδη πτηνών 100δες είδη εντόμων..και δυστυχώς ο κατάλογος συνεχώς μεγαλώνει Μοριακά εργαλεία για αποκάλυψη απάτης Γενετική ανάλυση κρέατος φάλαινας ραματική μείωση των πληθυσμών ιεθνείς διαμάχες για την προστασία Ταυτοποίηση είδους με mtdna ανάλυση Παράνομη διακίνηση κρέατος στις παγκόσμιες αγορές Παράνομη διακίνηση ιστών από προστατευόμενα είδη DNA Barcode: Μικρές τυποποιημένες αλληλουχίες που θα βοηθήσουν στη διάκριση των ειδών σε ένα ευρύ φάσμα ζωντανών οργανισμών εν φιλοδοξεί να περιγράψει τα είδη, αλλά να προσδιορίσει τα όριά τους Απελευθερώσεις λαγών εκτροφείου Ανεξέλεγκτες απελευθερώσεις λαγών εκτροφείου Γενετική ρύπανση Απώλεια τοπικής ποικιλομορφίας Ηλύση U A B C M mtdna-rflp ανάλυση: 3 γενετικές ομάδες A B C1 C Ένα στέλεχος του ιού EBHS, διαφορετικό από τα ελληνικά, εισαγόμενο πιθανώς από την Κ. Ευρώπη 6 6

7 ιάκριση διαφόρων φυλών χοίρων 428bp 256bp 172bp Sus scrofa X Sus scrofa domestica Ανεξέλεγκτη εκτροφή αγριόχοιρων Γενετική ρύπανση από εμπλουτισμούς ιατροφική απάτη Πέψη Μ Πέψη Μ Εκτρεφόμενοι χοίροι ΥβρίδιοΑγριόχοιροι Υβρίδιο PCR-RFLP και SSCP ανάλυση του υποδοχέα της μελανοκορτίνης (MC1R) Ταυτοποίηση Φύλου σε Γεράκια ( (Accipiter cooperii) Αρσενικό ZZ Αρσενικό ή Θηλυκό; Ενήλικος Φυλετικός ιμορφισμός Θηλυκό ZW Στα πτηνά η ταυτοποίηση φύλου είναι πολύ σημαντική για τη διατήρηση και διαχείριση των ειδών PCR-SSCP ανάλυση ενός τμήματος 400bp του γονιδίου CHD ιάκριση συγγενών ειδών του γένους Macrolophus mtdna analysis Αδυναμία μελέτης της οικολογίας των αρπακτικών (μετακινήσεις, προτιμήσεις καλλιεργειών, φυτά καταφύγια) που θα βοηθούσε στην ορθολογικότερη διαχείρισή τους. ιατήρηση του του Γκιζανιού Γκιζανιού,, ενδημικού ψαριού της Ρόδου Εξαιτίας ανθρωπογενών παρεμβάσεων θεωρείται απειλούμενο είδος υψηλής προτεραιότητας από την Ε.Ε. Ανάλυση RAPD και λειτουργικών γονιδίων (MHC): Πολύ χαμηλά επίπεδα πολυμορφισμού, αιμομικτική κατάπτωση, κίνδυνος εξαφάνισης Μελέτη της Βιολογίας και της Γενετικής των υπαρχόντων πληθυσμών και διατύπωση διαχειριστικών προτάσεων MHC Α Β Γ M RAPD Ιχνηλασιμότητα των ΓΤΟ Γιατί ο έλεγχος για ΓΤΟ; Νομοθεσία ΗΠΑ: Σήμανση τροφών GM-Free <5% ΓΤ ΕΕ: Σήμανση τροφών ΓΤ εάν >1% ΓΤ Ιαπωνία: Σήμανση τροφών ΓΤ εάν >5% Πως ελέγχουμε για ΓΤΟ PCR: Έλεγχος για παρουσία εισαγόμενου ξένου DNA Υπέρ: σταθερότητα DNA Κατά: Ακριβό, χρονοβόρο ΓΤΟ Θετικό ΓΤΟ αρνητικό ELISA: Έλεγχος παρουσίας πρωτεϊνών από τη γενετική τροποποίηση Υπέρ: Γρήγορο, φθηνό, Κατά: Εξειδίκευση για κάθε φυτό, σταθερότητα πρωτεΐνης Ανάπτυξη και Εφαρμογή Μοριακών εικτών για την Ταυτοποίηση Ειδών Κρέατος στην Αλυσίδα Εμπορίας τους ή πιο απλά: Ιχνηλασιμότητα τροφών 7

8 Ιχνηλασιμότητα τροφών Τροφή (Κονσερβοποιημένη, επεξεργασμένη, ωμή, μαγειρεμένη) Εξαγωγή και απομόνωση DNA Επεξεργασία DNA (PCR, πέψη, ηλεκτροφόρηση, ανάλυση) Η Αναγκαιότητα της Ταυτοποίησης ιατροφικές Κρίσεις (BSE,γρίπη πουλερικών). Νοθεία (ηλιέλαιου, γάλακτος, κρεατοσκευασμάτων). Τροφικές αλλεργίες δηλητηριάσεις. Γ.Τ. τρόφιμα. Αύξηση της ανησυχίας και του ενδιαφέροντος των καταναλωτών για την σύσταση & ποιότητα των τροφίμων. Απαραίτητη η ανάπτυξη αξιόπιστων μεθόδων πιστοποίησης της αυθεντικότητας των συστατικών. Προστασία της υγείας των καταναλωτών, οικονομικοί & θρησκευτικοί λόγοι. Ταυτοποίηση των ειδών που περιέχονται στο αρχικό επεξεργασμένο προϊόν Ενίσχυση επιθυμητών γονιδιακών τόπων των Cyt b,12s b rrna, COI (PCR, universal primers) PCR προϊόντα: Επεξεργασμένα προϊόντα κρέατος πουλερικών 12S rrna Cyt b Βιοπληροφορική ανάλυση GenBank,BioEdit & REBsite Πέψη με διαφορετικά ένζυμα περιορισμού Ηλεκτροφόρηση και Χρώση (Silver Staining) Καταλληλότερο Ε.Π. Πρότυπα 10 ειδών πουλερικών και 3 θηλαστικών μετά την πέψη του 12S rrna με το AciI. όμοια πρότυπα με το νωπό κρέας Μίγμα κρεάτων & ιατροφική απάτη Τα πρότυπα από τα παριζάκια γαλοπούλας είναι όμοια με αυτά των προϊόντων από κοτόπουλο και όχι με της γαλοπούλας, όπως θα έπρεπε! Λουκάνικο στρουθοκάμηλου Ανάμιξη κρέατος στρουθοκαμήλου με χοιρινό για την παρασκευή λουκάνικου στρουθοκαμήλου χοιρινό στρουθοκάμηλος Πέψη του Cyt b με HaeIII & HinfI στα δείγματα: 1) Κοτόπουλο νωπό, 2) Κοτόπουλο ψητό, 3) Μπιφτέκι κοτόπουλου, 4) Παριζάκι κοτόπουλου, 5) Γαλοπούλα νωπό, 6) Σνίτσελ γαλοπούλας, 7) Παριζάκι γαλοπούλας 1, 8) Παριζάκι γαλοπούλας 2. 8

9 Βιοτεχνολογία και Περιβάλλον Η βιοτεχνολογία μπορεί να βοηθήσει αποτελεσματικά στην επίλυση περιβαλλοντικών προβλημάτων ή στην εφαρμογή βιομηχανικών μεθόδων ή διεργασιών που περιορίζουν την ρύπανση ή μόλυνση του περιβάλλοντος 1. Βιολογική Αποκατάσταση Ηχρήση της μεταβολικής ικανότητας μικροοργανισμών με στόχο την αποκατάσταση και εξυγίανση ρυπασμένων εδαφών, υδροφόρων και λοιπών οικοσυστημάτων 2. Ανάπτυξη βιομηχανικών διεργασιών Χρήση μικροοργανισμών φιλικών προς το περιβάλλον αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα Τι περιλαμβάνει η βιολογική απορρύπανση Χρήση άγριων στελεχών ή γενετικά τροποποιημένων μικροοργανισμών με ιδιαίτερες ικανότητες διάσπασης υπολειμματικών και ιδιαίτερα τοξικών οργανικών ρύπων 1. Πολυαρωματικοί Υδρογονάνθρακες 2. Πολυχλωριωμένα ιφαινύλια 3. Πολυχλωριωμένες φαινόλες 4. Γεωργικά Φάρμακα Βακτήρια «δείκτες» ανίχνευση μόλυνσης και ρύπανσης του περιβάλλοντος μικροοργανισμοί ευαίσθητοι σε συγκεκριμένους ρυπαντές Βιοτεχνολογία στην ανάπτυξη περιβαλλοντικά φιλικών βιομηχανικών διεργασιών Βιολογική επεξεργασία Υγρών και Στερεών Αποβλήτων Παραγωγή Βιοαιθανόλης, Βιοαερίου Παραγωγή Βιοπλαστικών Βιολογική ανάκτηση μετάλλων Παραγωγή βιολογικών γεωργικών φαρμάκων Σας ευχαριστώ για την προσοχή σας Καλό Απόγευμα ΤΜΗΜΑ ΒΙΟΧΗΜΕΙΑΣ & ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Τι κοινό έχουν όλα τα παραπάνω; Χρησιμοποιούν μικροοργανισμούς ή ένζυμα τους αντί τοξικών χημικών και γενικά προϊόντων που δημιουργούν περιβαλλοντικά προβλήματα DEPARTMENT OF BIOCHEMISTRY & BIOTECHNOLOGY 9

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus

14/11/2011. Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus 4// Bιολογική ποικιλότητα ή Bιοποικιλότητα ποικιλότητα των διαφόρων μορφών ζωής Οικογένεια Felidae Υποοικογένεια Acinonychidea Acinonyx jubatus Επίπεδα βιοποικιλότητας Γενετική ποικιλότητα Ποικιλότητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ:

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΕΝΑ ΠΕΙΡΑΜΑ ΜΕ ΑΓΝΩΣΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΤΗΝ ΥΓΕΙΑ, ΤΟ ΠΕΡΙΒΑΛΛΟΝ, ΤΗΝ ΚΟΙΝΩΝΙΑ ΝΙΚΟΛΑΣ ΠΡΙΜΗΚΥΡΙΟΣ, ΓΕΩΠΟΝΟΣ, Δρ. ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΦΥΤΩΝ ΓΕΝΕΤΙΚΑ

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΜΑΣΤΕΡ (MSc) ΒΙΟΤΕΧΝΟΛΟΓΙΑ

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος Προγραμματισμός Διδακτέας Ύλης Βιολογίας Α Γυμνασίου 2012-2013 Α ΤΕΤΡΑΜΗΝΟ Ενότητα Δραστηριότητες Βασικές Έννοιες Δ/κές Π/δοι Γνωριμία Εισαγωγικές σελίδες Γνωριμία με το βιβλίο μου 1 1 Ενότητα 1: Η Βιολογία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ''

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' Από το 1950 και µετά αρχίζει η εντατικοποίηση της γεωργικής παραγωγής εστιάζοντας το ενδιαφέρον της αποκλειστικά

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

1. Πρόγραμμα Σπουδών Κατεύθυνση: Υγιεινή και ασφάλεια των τροφίμων ζωικής προέλευσης και προστασία της Δημόσιας Υγείας

1. Πρόγραμμα Σπουδών Κατεύθυνση: Υγιεινή και ασφάλεια των τροφίμων ζωικής προέλευσης και προστασία της Δημόσιας Υγείας Β. Κτηνιατρικός Κύκλος Ο Κτηνιατρικός κύκλος σπουδών περιλαμβάνει 3 κατευθύνσεις: 1. Υγιεινή και ασφάλεια των τροφίμων ζωικής προέλευσης και προστασία της Δημόσιας Υγείας. 2. Διαχείριση της υγείας των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD

Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD Ανάλυση αυθεντικότητας προϊόντων κρέατος με μεθόδους DNA: Η περίπτωση νοθείας με κρέας αλόγου Στέλιος Σπανιόλας Τεχνολόγος Τροφίμων, MSc PhD 1. ΕΙΣΑΓΩΓΗ Η σημασία της νοθείας των τροφίμων, τόσο από την

Διαβάστε περισσότερα

ΛΟΙΜΩΔΗΣ ΒΡΟΓΧΙΤΙΔΑ (INFECTIOUS BRONCHITIS)

ΛΟΙΜΩΔΗΣ ΒΡΟΓΧΙΤΙΔΑ (INFECTIOUS BRONCHITIS) econteplusproject Organic.Edunet ΛΟΙΜΩΔΗΣ ΒΡΟΓΧΙΤΙΔΑ (INFECTIOUS BRONCHITIS) Δρ. Ευτυχία Ξυλούρη Φραγκιαδάκη Κτηνίατρος Υγιεινολόγος, Αναπλ. Καθηγήτρια Υγιεινής Αγρ. Ζώων, Τμήμα Επιστήμης Ζωικής Παραγωγής

Διαβάστε περισσότερα

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου Επάγγελμα: Γενετιστής - Μοριακός Βιολόγος Σταδιοδρομία 2014 Κωνσταντίνος Βοσκαρίδης Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου 30-11-2014 20 Νοεμβρίου, 2010 ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

ΠΡΑΚΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΠΡΟΓΡΑΜΜΑΤΩΝ HACCP

ΠΡΑΚΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΠΡΟΓΡΑΜΜΑΤΩΝ HACCP ΠΡΑΚΤΙΚΕΣ ΕΦΑΡΜΟΓΕΣ ΠΡΟΓΡΑΜΜΑΤΩΝ HACCP 1 1. Είδη κρέατος 2. Σκόνη γάλακτος 3. Προτηγανισµένες και µη πατάτες 4. Ψάρια και θαλασσινά 2 1. Εφαρµογή προγράµµατος HACCP στην παραγωγή κρέατος Η χρήση HACCP

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας

εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας Κλασσικές και νέες μέθοδοι στον εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας Π.Γ.Ν.Λάρισας ΝΕΡΑ Περιορισμοί στον προσδιορισμό της μικροβιολογικής

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Εύθραυστο Χ, Κυστική Ίνωση, Μυΐκη υστροφία Duchenne, Οικογενής Καρκίνος Μαστού-Ωοθηκών Λάµπρος Μαυρόγιαννης Οπως η Συµβατική Εργαστηριακή

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης. Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης

Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης. Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης Πιστοποίηση βιολογικών προϊόντων Αρχή Εποπτείας: Υπουργείο Αγροτικής Ανάπτυξης & Τροφίμων

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr OΙΚΟΛΟΓΙΑ 1. Όσο το ποσό της ενέργειας: α) μειώνεται προς τα ανώτερα

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Παράρτημα 11. Παρουσία γενετικά τροποποιημένων οργανισμών σε τρόφιμα και συστατικά. τροφίμων

Παράρτημα 11. Παρουσία γενετικά τροποποιημένων οργανισμών σε τρόφιμα και συστατικά. τροφίμων Παράρτημα 11 Παρουσία γενετικά τροποποιημένων οργανισμών σε τρόφιμα και συστατικά τροφίμων 1. Αντικείμενο της συνεργασίας Αντικείμενο της συνεργασίας είναι ο έλεγχος παρουσίας γενετικά τροποποιημένων οργανισμών

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Προστατευόμενεςπεριοχέςως εργαλεία διατήρησης και διαχείρισης του θαλάσσιου περιβάλλοντος

Προστατευόμενεςπεριοχέςως εργαλεία διατήρησης και διαχείρισης του θαλάσσιου περιβάλλοντος Προστατευόμενεςπεριοχέςως εργαλεία διατήρησης και διαχείρισης του θαλάσσιου περιβάλλοντος Σωτήρης Ορφανίδης Δρ. Βιολόγος-Αναπληρωτής Ερευνητής Εθνικό Ίδρυμα Αγροτικής Έρευνας (ΕΘΙΑΓΕ) Ινστιτούτο Αλιευτικής

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

EΠΙΛΕΓΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝ.ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

EΠΙΛΕΓΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝ.ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ EΠΙΛΕΓΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝ.ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 1. Ένας άνθρωπος μολύνθηκε από ένα παθογόνο βακτήριο και δεν εμφάνισε συμπτώματα ασθένειας. Πιθανολογείστε τους λόγους που μπορεί να οφείλεται αυτό. 2.

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 20/5/2015 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Χρυσούλα Πιτσούλη, Ph.D. Τμήμα Βιολογικών Επιστημών Πανεπιστήμιο Κύπρου (pitsouli@ucy.ac.cy) Η Βιολογία μελετά τη ζωή Η Βιοϊατρική αποτελεί εφαρμογή

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας γενικής παιδείας 2015

Απαντήσεις στα θέματα βιολογίας γενικής παιδείας 2015 Απαντήσεις στα θέματα βιολογίας γενικής παιδείας 2015 Θέμα Α Α1. γ Α2. α Α3. β Α4. β Α5. δ Θέμα Β Β1. Β2. 1. Β 2. Α 3. Α 4. Β 5. Β 6. Α 7. Α 8. Β Το γενετικό υλικό ενός ιού διαθέτει πληροφορίες : α) Για

Διαβάστε περισσότερα

1.1 Τι είναι η Χημεία και γιατί τη μελετάμε:

1.1 Τι είναι η Χημεία και γιατί τη μελετάμε: 1 Η θεωρία του μαθήματος με ερωτήσεις. 1.1 Τι είναι η Χημεία και γιατί τη μελετάμε: 1. Τι ονομάζεται περιβάλλον; Οτιδήποτε μας περιβάλλει ονομάζεται περιβάλλον. Για παράδειγμα στο περιβάλλον ανήκουν τα

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΕΛΕΓΧΩΝ ΤΩΝ ΤΡΟΦΙΜΩΝ ΕΤΟΥΣ 2014. Αρμόδιες Αρχές Ελέγχου 1 ΠΔΑ ΠΔΘ

ΠΡΟΓΡΑΜΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΕΛΕΓΧΩΝ ΤΩΝ ΤΡΟΦΙΜΩΝ ΕΤΟΥΣ 2014. Αρμόδιες Αρχές Ελέγχου 1 ΠΔΑ ΠΔΘ ΠΡΟΓΡΑΜΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΕΛΕΓΧΩΝ ΤΩΝ ΤΡΟΦΙΜΩΝ ΕΤΟΥΣ 2014 α/α 1 2 3 4 Ανίχνευση Salmonella spp σε προϊόντα ζωικής προέλευσης Ανίχνευση Listeria monocytogenes σε τυριά και αλιεύματα Ανίχνευση εντεροτοξίνης

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 5: Χρώση Gram Δοκιμή Καταλάσης και Οξειδάσης, 1.5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα Τρυφινοπούλου

Διαβάστε περισσότερα

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013)

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013) KENTΡΟ ΤΟΞΙΚΟΛΟΓΙΑΣ Α.Ε. Επιστημονικό και Τεχνολογικό Πάρκο Κρήτης Step C, N. Πλαστήρα 100, Βασιλικά Βουτών, Τ.Κ. 700 13 Ηράκλειο, Κρήτη www.toxplus.gr ToxPlus Spin-off εταιρία του Εργαστηρίου Τοξικολογίας

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.1 Έκθεση ερευνητικού έργου Υπεύθυνος φορέας: Πανεπιστήμιο Λάρισα,

Διαβάστε περισσότερα

ΧΗΜΙΚΟΣ ΜΗΧΑΝΙΚΟΣ: ΑΝΤΙΚΕΙΜΕΝΟ ΤΟΥ ΧΗΜΙΚΟΥ ΜΗΧΑΝΙΚΟΥ, ΣΠΟΥΔΕΣ, ΠΡΟΟΠΤΙΚΕΣ ΕΞΕΛΙΞΗΣ, ΑΠΑΣΧΟΛΗΣΗ. Θεσσαλονίκη, 2015. sep4u.gr

ΧΗΜΙΚΟΣ ΜΗΧΑΝΙΚΟΣ: ΑΝΤΙΚΕΙΜΕΝΟ ΤΟΥ ΧΗΜΙΚΟΥ ΜΗΧΑΝΙΚΟΥ, ΣΠΟΥΔΕΣ, ΠΡΟΟΠΤΙΚΕΣ ΕΞΕΛΙΞΗΣ, ΑΠΑΣΧΟΛΗΣΗ. Θεσσαλονίκη, 2015. sep4u.gr ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΧΗΜΙΚΟΣ ΜΗΧΑΝΙΚΟΣ: ΑΝΤΙΚΕΙΜΕΝΟ ΤΟΥ ΧΗΜΙΚΟΥ ΜΗΧΑΝΙΚΟΥ, ΣΠΟΥΔΕΣ, ΠΡΟΟΠΤΙΚΕΣ ΕΞΕΛΙΞΗΣ, ΑΠΑΣΧΟΛΗΣΗ ΤΜΗΜΑ Χ Η Μ Ι Κ Ω Ν ΜΗΧΑΝΙΚΩΝ Θεσσαλονίκη, 2015 Η συνεισφορά της Χημικής

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015. Υγιεινή και Ασφάλεια Τροφίμων Γ ΕΠΑ.Λ ΟΜΑΔΑ Α & Β

Γενικές εξετάσεις 2015. Υγιεινή και Ασφάλεια Τροφίμων Γ ΕΠΑ.Λ ΟΜΑΔΑ Α & Β Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Γενικές εξετάσεις 2015 Υγιεινή και Ασφάλεια Τροφίμων Γ ΕΠΑ.Λ ΟΜΑΔΑ Α & Β Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μπουρδούνη Κ. ΘΕΜΑ

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑΣ

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑΣ ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΚΥΠΡΟΥ ΥΠΗΡΕΣΙΑ ΑΝΑΠΤΥΞΗΣ ΠΡΟΓΡΑΜΜΑTΩΝ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑΣ ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΚΑΤΑΡΤΙΣΗΣ ΕΞ ΑΠΟΣΤΑΣΕΩΣ

ΠΡΟΓΡΑΜΜΑ ΚΑΤΑΡΤΙΣΗΣ ΕΞ ΑΠΟΣΤΑΣΕΩΣ May 2014 Watermicro-eclass 2610969874 Τεύχος 2 ΠΡΟΓΡΑΜΜΑ ΚΑΤΑΡΤΙΣΗΣ ΕΞ ΑΠΟΣΤΑΣΕΩΣ Lab-on-a-chip: οι τεχνικές του μέλλοντος στην ανίχνευση μικροοργανισμών Στον τομέα της μικροβιολογικής διάγνωσης υπάρχει

Διαβάστε περισσότερα

15/01/2015 Αναλυτικό Πρόγραµµα Σπουδών 09:07:38

15/01/2015 Αναλυτικό Πρόγραµµα Σπουδών 09:07:38 Εξάµηνο : 1 2790 ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Εργ.:ΕΝΖΥΜΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ 160 ΓΕΝ. ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ Εργ.:ΓΕΝΙΚΗΣ ΧΗΜΕΙΑΣ 3310 ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΕΠΙΣΤΗΜΗ ΤΡΟΦΙΜΩΝ ΚΑΙ ΣΤΗ ΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ Μονάδες Θεωρίας : 3 Μονάδες

Διαβάστε περισσότερα

ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014

ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014 9η Συνεδρίαση της Κοσμητείας της Σχολής (αρ. 9/06-05-14) σελ. 1 ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014 Η Κοσμητεία της Σχολής Τροφίμων Βιοτεχνολογίας και Ανάπτυξης, μετά από πρόσκληση

Διαβάστε περισσότερα

ΜΕΘΟ ΟΛΟΓΙΑ ΟΙΚΟΤΟΞΙΚΟΛΟΓΙΚΩΝ ΕΡΕΥΝΩΝ

ΜΕΘΟ ΟΛΟΓΙΑ ΟΙΚΟΤΟΞΙΚΟΛΟΓΙΚΩΝ ΕΡΕΥΝΩΝ ΜΕΘΟ ΟΛΟΓΙΑ ΟΙΚΟΤΟΞΙΚΟΛΟΓΙΚΩΝ ΕΡΕΥΝΩΝ Ε. Μπακέας, 2013 Πηγή: Α. Βαλαβανίδης «Οικοτοξικολογία και Περιβαλλοντική Τοξικολογία», Τµήµα Χηµείας, ΕΚΠΑ, Αθήνα 2007, Κεφ.11. Οι κυριότεροι τοµείς οικοτοξικολογικών

Διαβάστε περισσότερα

ΔΙΑΝΕΛΛΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2009 2010 ΓΡΑΠΤΕΣ ΑΝΕΞΕΤΑΣΕΙΣ ΣΕΠΤΕΜΒΡΙΟΥ 2009

ΔΙΑΝΕΛΛΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2009 2010 ΓΡΑΠΤΕΣ ΑΝΕΞΕΤΑΣΕΙΣ ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΔΙΑΝΕΛΛΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2009 2010 ΓΡΑΠΤΕΣ ΑΝΕΞΕΤΑΣΕΙΣ ΣΕΠΤΕΜΒΡΙΟΥ 2009 Τάξη : Γ Γυμνασίου Βαθμός : Μάθημα : Βιολογία Ημερομηνία : 4 / 09/ 2009 Υπογραφή καθηγητή :... Διάρκεια : ΟΝΟΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα