Σύγχρονες Προσεγγίσεις στο Σχεδιασμό και Σύνθεση Αναλόγων του RGD ως Αντιθρομβωτικών και Αντικαρκινι κών Φαρμάκων

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Σύγχρονες Προσεγγίσεις στο Σχεδιασμό και Σύνθεση Αναλόγων του RGD ως Αντιθρομβωτικών και Αντικαρκινι κών Φαρμάκων"

Transcript

1 ΑΡΘΡΑ ΕΠΙΣΚΟΠΗΣΗ! ΦΑΡΜΑΚΕΥΤΙΚΗ 15,1, 211, 2002 REVIEW ARTICLES PHARMAKEFTIKI15,1, 211, 2002 Σύγχρονες Προσεγγίσεις στο Σχεδιασμό και Σύνθεση Αναλόγων του RGD ως Αντιθρομβωτικών και Αντικαρκινι κών Φαρμάκων Κ. Μπελεκοΰκιας1, Γ. Σαρηγιάννης1, Γ. Σταυρόπουλος1, Τ. Μαυρομοΰστακος2 'Τμήμα Χημείας, Πανεπιστήμιο Πατρών, , Πάτρα Ινστιτούτο Οργανικής και Φαρμακευτικής Χημείας, Εθνικό Ίδρυμα Ερευνών, Βασ. Κωνσταντίνου 48, , Αθήνα 2 Π ε ρ ί λ η ψ η D Στο δηλητήριο ορισμένων φιδιών εμπε ριέχονται πεπτιδικές ουσίες που περιέχουν την δομή RGD ή παράγωγα της που δρουν στους υποδοχείς των ιντεγκρινών. Η δράση των ουσιών αυτών οφείλεται στην παρεμπόδιση συγκόλλησης των αιμοπεταλίων. Η ιδιότητα αυτή των πεπτιδικών ουσιών χρησίμευσε στον σχεδιασμό συνθέσεως αντιθρομβωτικών φαρμάκων. Τα συντιθέμενα πεπτίδια έδειξαν ότι επιπρόσθετα παρουσιάζουν αντιαγγειογενετικές ιδιότητες και επομένως μπορούσαν να χρη σιμεύσουν για την καταπολέμηση του καρκίνου. Το άρ θρο επισκόπησης αυτό περιέχει πληροφορίες για τους βιολογικούς φορείς που εμπλέκονται στην δράση των πε πτιδικών αναλόγων του RGD. Επίσης συζητώνται οι μέ χρι στιγμής ερευνητικές δραστηριότητες καθώς και οι προοπτικές που αναπτύσσονται στο ερευνητικό αυτό πε δίο. 1. Εισαγωγή 1.1 Το τριπεπτίδιο RGD Το τριπεπτίδιο RGD (ArgGlyAsp) απαντάται σε αρκε τές πρωτεΐνες που βρίσκονται μεταξύ των κυττάρων και οι οποίες παράγονται από αυτά (εξωκυττάριες ουσίες). Μερικές από αυτές είναι το ινωδογόνο, η ινοσυνδετίνη, η λαμινίνη και η βιτρονεκτίνη (vitronectin). Αυτές με τη σει ρά τους προσδένονται σε διάφορες πρωτεΐνες με την γε νική ονομασία ιντεγκρίνες για να εξασκήσουν την βιολο γική τους δράση (Σχήμα 1). Η βιολογική σπουδαιότητα του RGD έγκειται στο ότι αλ λάζει την διαμόρφωση της ιντεγκρίνης. Εκτός από το RGD στις ιντεγκρίνες προσδένονται και πρωτεϊνικά πε πτίδια με αλληλουχίες KGD ή παρόμοιες. ΠΡΩΤΕΪΝΕΣ {ΙΝΩΔΟΓΟΝΟ ΛΑΜΙΝΙΝΗ ΚΛΠ.) Σχήμα 1. Σύνδεση κυττάρου πρωτεϊνών μέσω ιντεγκρινών 1.2 Εξωκυττάριες ουσίες Οι εξωκυττάριες ουσίες περιλαμβάνουν 3 είδη πρωτεϊ νών1: α) δομικές πρωτεΐνες, όπως το κολλαγόνο και η ελαστίνη, β) συγκολλητικές πρωτεΐνες (ή πρωτεΐνες σύνδε σμοι), όπως η ινοσυνδετίνη, η λαμινίνη, το ινοδωγόνο και η βιτρονεκτίνη, και γ) πρωτεογλυκάνες. Μία από τις ιδιότητες των εξωκυττάριων ουσιών είναι η συμπλοκοποίησή τους η οποία γίνεται στην επιφάνεια του κυττάρου μέσω των συγκολλητικών πρωτεϊνών (ινωδογό νο, ινοσυνδετίνη κ.τ.λ1'2. Η σύνδεση μεταξύ δομικών πρω τεϊνών, πρωτεογλυκανών και πρωτεϊνών συνδέσμων επι φέρει την επικοινωνία μεταξύ των κυττάρων. Αρχικά (δε καετία του 1980) ο ρόλος των εξωκυττάριων ουσιών πε ριοριζόταν στη μηχανική στήριξη του κυττάρου. Όμως στην τελευταία δεκαετία έγινε κατανοητό ότι ρυθμίζουν επιπρόσθετες λειτουργίες, όπως τη μετανάστευση των κυττάρων, την κινητικότητα τους, τη δυνατότητα προσκόλ λησης στο κύτταρο εξωκυττάριων παραγόντων, τη διαφο

2 ροποίηση κυττάρων και την εμβρυϊκή ανάπτυξη. Επίσης ερευνητικά αποτελέσματα έδειξαν ότι αυτές εμπλέκονται στην αναπαραγιογή των κυττάρων, στην απόπτωση (προ γραμματισμένος κυτταρικός θάνατος), στην αγγειογένεση και στην ρύθμιση ενζύμων, όπως οι πρωτεάσες και σχεδόν σε οποιαδήποτε κυτταρική διεργασία. ΠΙΝΑΚΑΣ 1. ΥΠΟΜΟΝΑΔΕΣ ΤΩΝ ΙΝΤΕΓΚΡΙΝΩΝ ΚΑΙ ΣΥΝΔΥΑΣΜΟΙ ΤΟΥΣ 1.3 Γντεγκρίνες Οι ιντεγκρίνες είναι γλυκοπρωτεΐνες που βρίσκονται μέ σα στο κύτταρο και οι οποίες απαρτίζονται από δύο δια φορετικές υπομονάδες: Την αυπομονάδα και μια μικρότερη βυπομονάδα οι ο ποίες προβάλλουν εκτός του κυττάρου (Σχήμα 2)1 Και οι δύο υπομονάδες είναι απαραίτητες για τον σχηματισμό δεσμού με τον υποκατάστατη τους. Κατά το σχηματισμό δεσμού στις διαθέσιμες θέσεις της υπομονάδας α πρέ πει να δεσμευτούν κατιόντα. Οι ιντεγκρίνες είναι ένα μέρος μιας μεγάλης οικογένειας πρωτεϊνών που σχετίζονται με τις αλληλεπιδράσεις κυττάρουκυττάρου και κυττάρουεξωκυττάριας ουσίας. Μέχρι σήμερα είναι γνωστές 16 α και 8 β υπομονάδες ιντε γκρινών στο ζωικό βασίλειο με τους ακόλουθους 22 συν δυασμούς (Πίνακας 1). Ο συνδυασμός των υπομονάδων αυτών καθορίζει την εκλεκτικότητα τους έναντι διαφό ρων μορίων. Το τελικό τμήμα της ιντεγκρίνης που βρίσκε ται μέσα στο κύτταρο έχει θέσεις δέσμευσης διαφόρων μορίων και δρα σαν μεταγωγέας σήματος4. Οι ιντεγκρίνες διαφέρουν από άλλους υποδοχείς που υ πάρχουν στην επιφάνεια του κυττάρου στο ότι δεσμεύουν τον υποκατάστατη τους με χαμηλή χημική συγγένεια (10''1091/mol). Επίσης είναι πολλαπλάσιες στον αριθμό (10100 φορές) σε σύγκριση με άλλους υποδοχείς. Δεσμεύουν τον υποκατάστατη τους όταν υπερβούν τοπικά έναν κρί σιμο αριθμό και δεχτούν ένα ερέθισμα το οποίο συσσω ματώνει την τυχαία κατανομή τους στο κύτταρο. Η βιολογική δράση των ιντεγκρινών οφείλεται στη χαμη λή χημική συγγένεια με τον υποκατάστατη. Αν υπήρχε ι σχυρός δεσμός μεταξύ ιντεγκρίνης και ενός υποκατάστα τη, τότε αυτός θα απέτρεπε το κύτταρο να δεσμευτεί με άλλους υποκατάστατες και θα περιοριζόταν στο να εκτε λέσει μόνο την λειτουργία που του υπαγορεύει ο συγκε κριμένος δεσμευμένος υποκατάστατης με την ιντεγκρίνη. ντ~ f ÜL hi M M M M M ili ~^ ο2 ri ; σ3 gâ,\z: gl \y OD ν_ α? 08 ÎZ Μ ζ :1: = 1 =\ z \ z 1l : : ψ _ il! _ il \j ζ ; : _ ; _ Φ M~l ; ζ Ι Ζ ο9 ν ί Ι αϋ Ι \/ Ι _ V οά αν ; ζ M\ ζ \z \ ζ j : j ζ ì ζ Γ Γ ι Ί ÌL ssb L : = z ζ Ιζ \ / 1 Ì! 1.4 Δομή των ιντεγκρινών Το τμήμα των ιντεγκρινών που βρίσκεται εκτός κυτταρι κής μεμβράνης είναι πολύ μεγαλύτερο από αυτό που βρί σκεται μέσα στο κύτταρο (Σχήμα 2). Ενδοκυτταρικά οι ιντεγκρίνες περιέχουν μέχρι 60 αμινοξέα (εξαίρεση απο τελεί η β4 υπομονάδα η οποία περιέχει περίπου α μινοξέα)3. Η δομή των α υπομονάδων είναι πολύ παρόμοια. Όλες περιέχουν 7 ομόλογες επαναλήψεις των 3040 αμινοξέων στην εξωκυττάρια δομή διακοπτόμενες από σειρές των 2030 αμινοξέων. Στον εξωκυττάριο χο5ρο υπάρχουν 3 ή 4 επαναλήψεις που περιέχουν αλληλουχίες με ικανότητα δέσμευσης κατιόντων (Σχήμα 3). Επίσης όλες οι α υπομονάδες έχουν την ίδια αλληλουχία 5 αμινοξέων (GFFKR) μέσα στο κυτταρόπλασμα ακρι βώς κάτω από την περιοχή που διαπερνούν την μεμβράνη. Ο ακριβής ρόλος τους δεν είναι αποσαφηνισμένος. Εκφράζεται η άποψη ότι πιθανά να βοηθούν στην συ γκρότηση του διμερούς της ιντεγκρίνης. Οι α υπομονάδες χωρίζονται σε δύο ομάδες βάσει ορισμένων δομικών δια φορών τους. Η πρώτη ομάδα αποτελείται από τις αϊ, αϊ, αι., α\ι και α\. Η δομική ομοιότητα τους έγκειται στην κοινή παρουσία μιας περιοχής 180 αμινοξέων (Iπεριοχή) μεταξύ της δεύ τερης και τρίτης επανάληψης αμινοξέων η οποία μάλλον εμπλέκεται στην δέσμευση του υποκατάστατη. Η δεύτερη ΘΕΣΗ ΔΕΣΜΕΥΣΗΣ RGD ΙΝΤΕΓΚΡΙΝΗ (ίίϊίι αφ,r ΚΥΤΤΑΡΟΠΛΑΣΜΑΤΙΚΗ ί } ί XI ΜΕΜΒΡΑΝΗ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΘΕΣΗ ΔΕΣΜΕΥΣΗΣ ΕΣΟΚΥΤΤΑΡΙΟΝ ΜΟΡΙΩΝ Σχήμα 2. Δομή των ιντεγκρινών 3

3 νων φιδιών δημιουργούσε ακατάσχετη αιμορραγία καθώς περιείχε πεπτιδικές ουσίες που απέτρεπαν την συγκόλλη ση των αιμοπεταλίων. Στη δεκαετία του '80 βρέθηκε ότι ο στόχος αυτών των πεπτιδίων ήταν οι υποδοχείς των αιη,β.ι ιντεγκρινών. Οι πεπτιδικές αυτές ουσίες περιείχαν την τυ A^l ' πική δομή RGD ή παράγωγα της στην θέση πρόσδεσης. Η ιδιότητα αυτή των πεπτιδίων του δηλητηρίου των φιδιών θα μπορούσε να χρησιμεύσει σε μελλοντική προοπτική συνθέσεως αντιθρομβωτικών φαρμάκων. Η σύνθεση τέ τοιων πεπτιδίων έδειξε ότι επιπρόσθετα είχαν και αντιαγγειογενετικές ιδιότητες, δηλαδή σταματούσαν τη σύνθεση των λείων μυϊκών κυττάρων απαραιτήτων για την ανάπτυξη του καρκίνου και των μεταστάσεων του (συ νεπώς θα συμβάλλουν στην καταπολέμηση του καρκί Σχήμα 3. Οι εξωκυττάριες νπομονάόες α και β των ιντεγκρινών. νου)". Με Μ* παριστάνονται οι θέσεις δέσμευσης των κατιόντων 1215nm { &Λ ομάδα αποτελείται από τις as, as, α<>, αϊ, a«, am,, av και αιππ,. Αυτές αποτελούνται από δύο αλυσίδες, μια ελαφριά που βρίσκεται μέσα στο κυτταρόπλασμα, στην μεμβράνη και λίγο στην εξωκυτταρια περιοχή (περίπου 25kD) και μια βαριά που καταλαμβάνει την υπόλοιπη εξωκυτταρια πε ριοχή (περίπου 120 kd). Συναντώνται σε πολλούς ιστούς, όπως στα ενδοθηλιακά και λεία μυϊκά κύτταρα, στα αιμο πετάλια, στα μακροφάγα, στα λευκά αιμοσφαίρια, στους οστεοκλάστες (κύτταρα υπεύθυνα για την αποδόμηση των οστών) κ.τ.λ. (Πίνακας 2). ΠΙΝΑΚΑΣ 2. ΙΣΤΟΙ ΚΑΙ ΚΥΤΤΑΡΑ ΟΠΟΥ ΒΡΙΣΚΟΝΤΑΙ ΟΙ ΙΝΤΕΓΚΡΙΝΕΣ ΚΥΤΤΑΡΑ ΑΙΜΟΠΕΤΑΛΙΑ ΜΕΜΝΩΜΑΤ05 ΜΟΝΟΚΥΤΤΑΡΑ Λ. ;, ;.^ ΜΟΚΥΤΤΑΡΑ Mir.! h ι Α?Α Γ ΕΣ,7r/F^ ΤΚΟΥΣ Κ>ττΑΡΑ ΜΝΗΜΟΝΙΚΑ ΚΑΡΔΙΑΚΟΥ! MY Ι ΤΛΕΜΦΟΚΥΤΤΑΡΑ ΜΑΚΡΟΦΑΓΑ ΗΟΣίΝΟ&ΑΆ ' 'Ρ' ΤΛΡΜΦΟ!'ΥΤΤΑΡ<«ΛΕΙΑ ΜΥΙΚΛ ΚΥΤΤΑΡΑ ΗΠΑΤίΙΜΑΤΑ 2.2 Σχεδιασμός παραγώγων RGD Το επόμενο βήμα ήταν να συντεθούν μικρά πεπτίδια που να περιέχουν την αλληλουχία αυτή και να μελετηθεί η δράση τους σε μια προσπάθεια βελτίωσης της βιοδραστικότητάς τους. Από τα συντιθέμενα πεπτίδια τα κυκλικά παράγωγα αποδείχτηκαν τα περισσότερο βιοδραστικά. Τα συντιθέμενα όμως πεπτίδια στερούνταν εκλεκτικότη τας γιατί είχαν την τάση να ενώνονται και με άλλες ιντεγκρίνες με διαφορετικούς βαθμούς δίνοντας έτσι ανεπι θύμητες πλευρικές αντιδράσεις. Δοκιμάστηκαν επίσης διάφορες αλληλουχίες με μερικώς τροποποιημένο το αρχικό RGD πεπτίδιο (π.χ., αλλαγή ε νός KGD ή δύο αμινοξέων, προσθήκη και άλλων αμινο ξέων, προσθήκη πλευρικών ή και προστατευτικών ομά δων). Με το σκεπτικό αυτό παρασκευάστηκε η Ιντεγκριλίνη (Integrum) η οποία είναι ένα επταπεπτίδιο που πε ριέχει την τριάδα των αμινοξέων KGD (Σχήμα 4). Η Ιντεγκριλίνη είναι ένα φαρμακευτικό προϊόν το οποίο έγινε αποδεκτό από τον Παγκόσμιο Οργανισμό Φαρμάκων (Federal Drug AssociationFDA) το SCHWANN ΚΥΤΤΑΡΑ ~ [ΚΑ ΚΥΤΤΑΡΑ ΚΑΡΚΙΝΙΚΑ ΚΥΤΤΑΡΑ Σ., 21ΤΕΣ 2. Σχεδιασμός RGD αναλόγων στην ανάπτυξη αντιθρομβωτικών και αντικαρκινικών φαρμάκων 2.1 Ανακάλυψη πεπτώικώχ αναλόγων RGD Για πολλά χρόνια ήταν γνωστό ότι το δηλητήριο ορισμέ Σχήμα 4. Το επταπεπτίδιο ιντεγκριλίνη

4 ΠΙΝΑΚΑΣ 3. ΜΕΡΙΚΑ ΚΥΚΛΙΚΑ ΑΝΑΛΟΓΑ TOY RGD 1, ^3 aiibi>3 ΤΤεπτίοΐο Κ»(μΜ) IC ;,O(MM) Αρχικό 6R6DSPK , /. :.: V....., S < : cyde(n(ate)&<söfv) cyclo!.. ι O.ÛODT 5 ; >10 5 c.ycio(rôn(me)dfv) cyclo(ri5dn(me}fv) cycto(r<sdf~r Me)V~) 3 0G058 OMAÄA TremxàxiîN ΔΧΛΜΟΝΩΣΗ est» ΙΝΤΕΓΚΡΙΝΗ ΔΕΣΜΕΥΣΑ!ï\/i.. 1 (ft 0.\//t tt\ (hl j > tjüb/ßi H Ιντεγκριλίνη δεν μπορεί να χορηγηθεί από το στόμα (per os) γιατί καταστρέφεται από τα γαστρικά υγρά. Έτσι η χορήγηση της γίνεται ενδοφλέβια67. «^V^V^r^*** 2.3 ΝΜεθυλίωση αμινοξέων Η Νμεθυλίωση των συνθετικών πεπτιδίων κατέστη ένα χρήσιμο εργαλείο για την κατανόηση της σχέσης δομήςδράσης. Έχει μάλιστα οδηγήσει σε ανάλογα (αγωνιστές ή ανταγωνιστές) με καλύτερη βιοδραστικότητα, αυξημένο χρόνο ημιζωής καθώς και αυξημένη σταθερότητα (Πίνα κας 3). Παρατηρείται στον πίνακα 3 ότι εκτός των κυκλικών πα ραγώγων 5 και 6 όλα τα υπόλοιπα δείχνουν αυξημένη δράση έναντι του αρχικού πεπτιδίου που είχε απομονωθεί (GRGDSPK) στην ανβ3 ιντεγκρίνη. Η σειρά μειούμενης δραστικότητας είναι 7 > 2 > 3 > 4 > 1. Ειδικά το cyclo(rgdfn(me)v) βρίσκεται σε στάδιο κλι νικών δοκιμών για την ευεργετική του δράση (φάση II) σε διάφορα είδη σαρκώματος, καρκίνου του εγκεφάλου και στατικών καρκίνων8. Αναφορικά με τα πεπτιδικά ανάλογα που έχουν μέχρι σή μερα συντεθεί μπορούν να εξαχθούν τα παρακάτω συ μπεράσματα: Τα τρία αμινοξέα που αποτελούν το τριπεπτίδιο RGD σχηματίζουν γωνία η οποία εξαρτάται από τη διαμόρφω ση τους την οποία λαμβάνουν όταν επιπρόσθετα αμινοξέα ali p Σχήμα 6. Σχέση διαμόρφωσης πεπτιδίου και ανάλογης δέσμευ σης ιντεγκρίνης σχηματίσουν ένα κυκλικό πεπτίδιο (Σχήματα 5 και 6). Στην πρωτεΐνη Decorsili (μια πρωτεΐνη βδέλλας) η οποία περιέχει το τριπεπτίδιο RGD, τα αμινοξέα Asp και Arg εμφανίζονται με τις πλευρικές αλυσίδες τους σχεδόν αντί θετες'. Τα κυκλικά πεπτίδια cyclo(rgdfv) και cyclo(rgdfn(me)v) (Σχήμα 7) παρουσιάζουν μείωση της αγγειογένεσης που προκαλεί ο καρκίνος στο μοντέλο της χοριοαλλαντοϊκής μεμβράνης εμβρύου κοτόπουλου και αυξημένη δράση αντίστοιχα (Πίνακας 3). Οι απαιτή σεις για βιοδραστικότητα σύμφωνα με τις μέχρι σήμερα μελέτες απεικονίζονται στο Σχήμα 8. Σ' αυτό δείχνεται η κατανομή υδροφοβικών επιδράσεων στο μόριο καθώς και η θέση των ιοντικών και υδρογονικών δεσμών. Στερικά Σχήμα 7. Προσομοίωση της τρισδιάστατης δομής του cyclo(rgdf N(Me)V) Σχήμα 5. Τυπική δομή του πεπτιδίου (RGDjV) 5

5 (SIANC <H>âue BTD Sgira Σχήμα 8. To γενικό μοτίβο φαινόμενα εμφανίζονται στην θέση της γλυκίνης γι' αυτό και όπως αναφέρθηκε αντικατάσταση της από άλλο αμι10 νοξύ οδηγεί σε απώλεια δράσης του μορίου. Με τη βοήθεια Υπολογιστικής Χημείας και Μοριακών Γραφικών τα κυκλικά πεπτίδια που περιέχουν RGD αλ ληλουχία έχει βρεθεί ότι έχουν την διαμόρφωση βιι/γστροφής (Σχήμα 9)8<). 2.4 Αντικατάσταση αμινοξέων Μια άλλη προσέγγιση για την κατανόηση της διαμόρφω σης των πεπτιδίων αυτών ήταν η αντικατάσταση των αμι νοξέων f, V με ορισμένα οργανικά μόρια που μιμούνται τη ßll/γ στροφή. To RGD είναι πολΰ ευαίσθητο στις αλλαγές αμινοξέων. Για παράδειγμα αντικατάσταση της Gly με DAla, όπως φαίνεται στο μόριο 6 του πίνακα 4, επιφέρει ση μαντική μείωση της δραστικότητας. Στις μελέτες αυτές χρησιμοποιήθηκαν τα μόρια του σχήματος 10 και λήφθησαν τα αποτελέσματα του πίνακα 4. Παρατηρούμε διαφο ρά στην δραστικότητα των (R) και (S)ANC καθώς επί σης και έλλειψη βιοδραστικότητας στο μόριο 4s. Σχήμα 10. Οργανικά μόρια που μιμούνται τη ßll/γ στροφή Στον πίνακα 5 παρουσιάζονται ανάλογα του RGD τα ο ποία περιέχουν μη φυσικά D και φυσικά L αμινοξέα (μικρά και κεφαλαία γράμματα αντίστοιχα) τα οποία πα ρεμποδίζουν την ιντεγκρίνη otnbßi. Παρατηρείται ότι είναι λιγότερο βιοδραστικά από το πε πτίδιο αναφοράς (GRGDSPK). Εξαίρεση αποτελεί το YRGDVNHi. Κοινό χαρακτηριστικό των πεπτιδίων τα οποία απαρτίζουν τον πίνακα 5 είναι ότι περιέχουν τα α μινοξέα Κ,Υ στο αμινοτελικό άκρο. Τα υπόλοιπα που προστίθενται είναι D ή Γ αμινοξέα. Στις παρενθέσεις παρίστανται οι τιμές ICso (μμ) για τα ίδια πεπτίδια χωρίς τα τελικά Κ και Υ αμινοξέα. Παρατηρείται ότι η παρουπινακασ 4. ΚΥΚΛΙΚΑ ΑΝΑΛΟΓΑ TOY RGD ΧΡΗΣΙΜΟΠΟΙΩΝΤΑΣ ΜΙΜΗΤΕΣ ΣΤΡΟΦΗΣ Λ I.C. 5 O(MM) I.C.SOCMM) allbp3 avf)3 GRGD5PK 1,66 0,36 c(rgdfv) 0,83 0,0022 CjO 0,04 0,0085 0, c(r60"btd") 4,8 0,28 4 c(r(5br,spiro") 5 c(r(5d"btd"v) 0,55 0,043 6 c(rad"btd"v) 2.5 Τεχνικές φιλτραρίσματος Οι τεχνικές φιλτραρίσματος υψηλών αποδόσεων στην σύνθεση των πεπτιδίων έχουν επίσης βοηθήσει στην με λέτη πολλών διαμορφώσεων διαφόρων πεπτιδίων και έ χει υπολογιστεί ότι η θέση πρόσδεσης του RGD στην ιντεγκρίνη είναι μια σχισμή βάθους τουλάχιστον IIA. c ( R t 7 D ζ>~ 1 ANC") c(rgdmr 2 Σχήμα 9. Το πρότυπο της ΒΙΙΙγ στροφής ANC")

6 ΠΙΝΑΚΑΣ 5. ΠΑΡΑΓΩΓΑ RGD ΧΡΗΣΙΜΟΠΟΙΩΝΤΑΣ ΤΕ ΧΝΙΚΕΣ Φ Ι Λ Τ Ρ Α Ρ Ί Σ Μ Α Τ Ο Σ ΠΙΝΑΚΑΣ 6. ΔΡΑΣΤΙΚΟΤΗΤΑ ΤΩΝ ΔΙΑΜΟΡΦΩΜΕΡΩΝ TOY RGDF5 Αλληλουχία 2 YRRDVNH2 y' μι,\/\κ /WRDVNH2 >,, s sk κc,.. ι '. Υ!" ΙΗ η lrpkynh2 35(125 pyioct /ΝΗ pyiqkky~nhy pylwtkynhì NH2 100 ι^π> VMr 79(125) p f i n ri y ΜΗ 2 110) r ippkyni 12 45(315) ι 1 τιη.4 ' ' h. 23 anbp3 1 s,s 0, rs.ts 24 > κ, ο ,7 >10 6 Λ Λ Συμπεράσματα: Α. Τα παράγωγα που συντέθηκαν στον πίνακα 5 αποδει κνύουν ότι η ύπαρξη του τριπεπτιδίου RGD δίνει τις πιο βιοδραστικές ουσίες (ίδε 110 ενώσεις). Β. Τα πεπτίδια 1123 περιέχουν τα μη φυσικά αμινοξέα p(f/y)l. Τα αμινοξέα αυτά αποτελούν ένα νέο τρόπο προ σέγγισης ο οποίος μιμείται τα φυσικά αμινοξέα RGD (η δομική ομοιότητα της καινοτόμου αυτής προσέγγισης μπορεί να κατανοηθεί από το Σχήμα 11). Τα πεπτίδια 1123 ποικίλουν σε βιολογική δράση (κυμαίνεται κατά 23 φο ρές). Τα επιπρόσθετα αμινοξέα εκτός της τριάδας p(f/y)l δεν έδωσαν δραστικότερα πεπτίδια συγκριτικά με το πε πτίδιο αναφοράς GRGDSPK. Γ. Το δραστικότερο από τα πεπτίδια (11) που περιέχουν μη φυσικά αμινοξέα παρουσιάζει εξειδίκευση γιατί αντί στοιχα πεπτίδια με ίδια σύνθεση αλλά αντιστρεμμένη την αλληλουχία αμινοξέων απέτυχαν να παρεμποδίσουν τη δέσμευση σε συγκεντρώσεις μέχρι ImM. 2.6 Ασύμμετρη κατάλυση Μια άλλη μέθοδος που χρησιμοποιήθηκε στη παρασκευή αναλόγων και έδωσε ενδιαφέροντα αποτελέσματα ήταν η ασύμμετρη κατάλυση. Σαν στόχος της έρευνας αυτής ή ταν η διερεύνηση της σχέσης στερεοχημικής δομής δρα στικότητας. Το πεπτίδιο που επιλέχθηκε ήταν το RGDF5 (όπου 5 = 21 avp3 ri : Ι YMHZ μ; I. I.Ç.SO(MM) σία των Κ και Υ αμινοξέων ενισχύει την αναστολή της anbß3 ιντεγκρίνης αν και τα πεπτίδια δεν περιέχουν την κλασική τριάδα RGD ή KGD. Σε αντίθεση στα πεπτίδια 1123 παρατηρείται διαφορά στις τιμές IGu (μμ) αυτών που περιέχουν RGD συγκριτικά με αυτά που δεν περιέ χουν". ; μ; 1 I.C5o(uM) 27C pfhp» / MHZ 1 0=c OH και μελετήθηκαν οι δομές (S,S), (R,R), (R,S), (S,R).

7 HÌN. NM Τ ΙΤΕΛΟ RSD ΗΝ L Ο Νίΐ Ml A, ^Κ Η ηση των κυκλικών RGD πεπτιδίων με υδατάνθρακες είχε ως αποτέλεσμα τη δημιουργία μορίων με ελαττωμένη βιο λογική δράση. Έτσι συμφωνά με τους στερεοχημικούς περιορισμούς συ ντέθηκε ένα τροποποιημένο σάκχαρο (Σχήμα 14) με σκο πό να αντικαταστήσει τα δυο αμινοξέα DPheVal στην αλληλουχία cyclo (RGDfV). Το σάκχαρο αυτό εκλέχθηκε γιατί μπορούσε να εισάγει την βπγ ΠΙΝΑΚΑΣ 7. ΔΡΑΣΤΙΚΟΤΗΤΑ ΤΩΝ ΓΛΥΚΟΖΥΛΙΩΜΕΝΩΝ ΠΕΠΤΙΔΙΩΝ G::.. 1 Ο ΤΟw ""τϊ\ ΗΝ I.C, ί MEO ΜΟΤΙΒΟ ΔΕΣΜΟΙ Η Ò Ι χ r N *H «s. ÌR6DSPÌ c(r6öf\ ύ Ν Σχήμα 11. Παράγωγα τον πίνακα 5 βασίζονται στο μοντέλο RGD (άνω) ή δομικά όμοιων καινοτόμων μορίων που δεν πε ριέχουν την αλληλουχία RGD Οι δομές (R,S), (S,R) έχουν την τυπική γστροφή στο αμινοξΰ της γλυκίνης αν και διαφέρουν ως προς τον προσα νατολισμό των πλευρικών μονάδων των αμινοξέων της Arg και Asp. Το παράγωγο (S,S) δείχνει μια επίπεδη δο μή και μια ßllστροφή, ενώ το (R,R) παράγωγο δείχνει μια βΐστροφή και το RGD παρουσιάζει καμπή στο αμινοξΰ της γλυκίνης (Σχήμα 12). Όπως φαίνεται και στον πίνακα 6 όλα τα παράγωγα έδειξαν υψηλή συγγένεια με την ανβ.ι ιντεγκρίνη. Μια άλλη παρατήρηση που αξίζει να αναφερθεί είναι ότι η στερεοχημεία των τεσσάρων διαμορφωμερών του πεπτιδίου RGDf5 καθορίζει την εκλε κτικότητα μεταξύ των ανβι και am,ß3 ιντεγκρινών12. Επίσης έχουν συντεθεί και αποτιμηθεί C και Νγλυκοζυλιωμένα RGD πεπτίδια τα οποία έχουν δείξει βιολογική δράση (Σχήμα 13). Στις πρώτες προσπάθειες η τροποποί RS if!. Hi is.hì Σχήμα 12. Ta 4 διαμορφωμερή του πεπτιδίου RGDF «17 ΑΐΠ 2; 2.7 C, Ν γλυκοξυλίωση ν< 0,8 ι 7300 στροφή στο κυκλικό πεπτίδιο. Παρατηρούμε στον πίνακα 7 ότι το πεπτίδιο 1 δείχνει με γάλη εκλεκτικότητα όσον αφορά την ιντεγκρίνη ανβ3, συ γκριτικά με το πεπτίδιο 2. Με την βοήθεια του μοριακού σχεδιασμού προσομοιώθηκαν οι δομές των δύο σακχά ρων (Σχήμα 15) και βρέθηκε ότι συμφωνούν με το γενικό σχήμα των κυκλικών πεπτιδίων. Έτσι το πεπτίδιο 1 (αsaa Sugar Amino Acid) κατατάσσεται στην ομάδα 2 (βλέπε Σχήμα 6) που με την διαμόρφωση αυτή έχει μεγα λύτερη συγγένεια για την α>.β3 ιντεγκρίνη. Το πεπτίδιο 2 (ßSAA) παρουσιάζει γραμμικότητα στην τριάδα αμινο ξέων RGD και όχι κάμψη όπως το πεπτίδιο 1 (ανήκει στην ομάδα 3). Δηλαδή έχει μια ενδιάμεση διαμόρφωση που ευνοεί και την ανβΐ και την αιιβ3 ιντεγκρίνη. Με την σύνθεση γλυκοζυλιωμένων πεπτιδίων έγινε προ σπάθεια εξειδίκευσης της δράσης των πεπτιδίων αυτών

8 Xaa; 11, = H I :! 'h r^' = H,K L H ί< = Η = Ο" 18; η = 19. > OH 21; η = 4: Χ = OH Σχήμα 13. Ta C και Ν γλνκοζυλίωμενα RGD πεπτίδια cyclo(argglyaspdtyrxaa) 1114 και cyclo (ArgGlyAspDPheXaa) 1522 αιιι,β.? που έχει εγκριθεί για χρήση είναι το ReoPro (ΑΒΚΙΞΙΜΑΒΗ). Το μειονέκτημα αυτής της προσέγγι σης είναι ότι τα μονοκλωνικά αντισώματα έχουν τα ίδια μειονεκτήματα με τα πεπτίδια και αναγκαστικά χορηγού νται ενδοφλέβια14. OBz.OB ζ OBz,. Χί NH y n^ "'V. "CT 3. Προοπτικές Σύγχρονες προσεγγίσεις UH,A<g CiL Σχήμα 14. Το σάκχαρο αμινο'ξύ σε συγκεκριμένες ιντεγκρίνες. Ένας άλλος βασικός λό γος σύνθεσης των γλυκοζυλιωμένων πεπτιδίων είναι και η βελτίωση της φαρμακοκινητικής. Όπως φαίνεται στο σχή μα 14 και στον πίνακα 6 διαφοροποιώντας την γλυκοζυτική αλυσίδα επηρεάζεται η δράση και η εκλεκτικότητα του πεπτιδίου. Όλα τα πεπτίδια έδειξαν υψηλή συγγένεια για την ανβ:, ιντεγκρίνη και υπάρχουν και πεπτίδια με κα λύτερη δράση από τα GRGDSPK και cyclo(rgdfv) ό πως το 12 και το 21 (για την ιντεγκρίνη α>β3). Αξιοσημεί ωτη επίσης είναι η εκλεκτικότητα του παραγώγου 20. Συ γκριτικά με μη γλυκοζυλιωμένα παράγωγα όσον αφορά την φαρμακοκινητικήτα παράγωγα αυτά έδειξαν μικρό τερη απορρόφηση από το ήπαρ, διπλασιασμό της αρχικής συγκέντρωσης στο αίμα και αύξηση της συγκέντρωσης στην περιοχή του καρκίνου". 2.8 Χρήση μονοκλωνικών αντισωμάτων Μια άλλη προσέγγιση, όσον αφορά την καταπολέμηση θρομβωτικών επεισοδίων, είναι τα μονοκλωνικά αντισώ ματα. Έ ν α μονοκλωνικό αντίσωμα για την ιντεγκρίνη 3.1 Μη ιτεπτιδικά ανάλογα Για τους παραπάνω λόγους η σύγχρονη έρευνα στράφηκε στη σύνθεση σταθερών οργανικών μορίων τα οποία μι μούνται την^δομή των πεπτιδίων (μη πεπτιδικούς μιμητές) χρησιμοποιώντας σύγχρονες τεχνολογίες, όπως ο μορια κός σχεδιασμός, ο Πυρηνικός Μαγνητικός Συντονισμός κ.τ.λ. Έ ν α από τα φυσικοχημικά χαρακτηριστικά του πεπτιδίου RGD (ή KGD) που έπρεπε να διατηρηθεί κατά το σχε διασμό καινοτόμων μορίων είναι ο zwitterion χαρακτήρας του. Δηλαδή θα έπρεπε να διατηρείται η απόσταση μετα ξύ θετικού φορτίου (Arg ή Lys) και αρνητικού (Asp) στα Σχήμα 15. Προσομοίωση των δομών των δυο σακχάρων

9 αποτελούν τμήματα της αλληλουχίας RGD με το σαλικυ λικό ή το ακετυλοσαλικυλικό οξύ στο Ντελικό άκρο πα ρουσιάζουν ανασταλτική δράση της συγκόλλησης των αι μοπεταλίων. Επιπρόσθετα παράγωγα με πιθανή βελτιω μένη φαρμακολογική δράση είναι υπό σύνθεση στο εργα στήριο μας. Design and Synthesis of RGD Analogs as Antithrombotic and Anticancer Agents Σχήμα 16. Το αντιθρομβωτικό Aggrastat θερή. Λαμβάνοντας όμως υπόψη ότι τα φορτισμένα φάρ μακα δεν έχουν καλή απορρόφηση από τον οργανισμό, ε πιστήμονες συνέθεσαν προφάρμακα τα οποία περιέχουν στη δομή τους πρόσθετες υδρόφοβες ομάδες συζευγμένες με τις φορτισμένες ομάδες. Αυτές έχουν την ιδιότητα να διασπώνται στον οργανισμό από ένζυμα του πεπτικού σω λήνα. Ή δ η έχει αποτιμηθεί βιολογικά πληθώρα φαρμα κευτικών μορίων χωρίς να υπάρχει πλήρης επιτυχία στις επιθυμητές ιδιότητες". Τα φαρμακευτικά αυτά μόρια προκαλούν επιπλοκές ή παράπλευρες αντιδράσεις. Επί σης δεν υπάρχει προβλεπόμενη συμπεριφορά στην δόση και στο αναμενόμενο βιολογικό αποτέλεσμα. Έ ν α φαρμακευτικό μόριο που χρησιμοποιείται ως αντι θρομβωτικό είναι το Aggrastat. Είναι ένα μη πεπτιδικής φύσης παράγωγο της Lτυροσίνης (Σχήμα 16) και χορη γείται σε ενεσιμη μορφή. Έχουν επίσης μελετηθεί δια μορφώσεις αναλόγων μορίων με τη βοήθεια ηλεκτρονι κών υπολογιστών. Τα αποτελέσματα συμφωνούν με το ό τι η γουανιδινομάδα της αργινίνης και η καρβοξυλομάδα του ασπαραγινικού παίζουν πρωταρχικό ρόλο στην δρα στικότητα των συντεθιμένων μορίων, όπως ακριβώς και στο RGD και στα κυκλικά του ανάλογα. K. Belekoukias', J. Sarigiannis1, G. Stavropoulos1, T. Mavromoustakos2 'Chemistry Department, University ofpatras, , Ρatra, Greece institute of Organic and Pharmaceutical Chemistry, National Hellenic Research Foundation, Vas. Constantinou 48, , Athens, Greece S u m m a r y D In some snake's venoms are contained peptidic substances with RGD derivatives amino acid sequence which act on receptors of integrins. The biological action of those substances is owed on their blocking of platelet aggregation. This property of peptides was used in the design and synthesis of new antithrombotic drugs. The synthetic peptides showed that these peptides have antigenetic properties and thus they could be utilized as anticancer agents. This review article contains information on the biological vectors involved in the biological action of RGD or its analogs and the research synthetic efforts for developing new antithrombotic or antigenetic drugs. New perspectives in this research field are also discussed. 3.2 Παράγωγα σαλικυλικού οξέος Μια άλλη προσέγγιση σύνθεσης αντιθρομβωτικών φαρ μακευτικών προϊόντων είναι η δημιουργία υβριδικών πε πτιδίων που περιέχουν το τριπεπτίδιο RGD και το σαλι κυλικό ή ακετυλοσαλικυλικό οξύ (ασπιρίνη)(σχήμα 17). Είναι γνωστό ότι το σαλικυλικό ή ακετυλοσαλικυλικό οξύ παρεμποδίζει στα πρώτα βήματα τη βιοσύνθεση στα αιμο πετάλια της προσταγλανδίνης G2 από αραχιδονικό οξύ με ακετυλίωση του αντίστοιχου ενζύμου κυκλοοξυγενάση. Έχει δειχτεί σε προηγούμενες μελέτες μας16"1" ότι ο συν δυασμός στο ίδιο μόριο διπεπτιδίων καιτριπεπτιδίων, που Βιβλιογραφία 1. http ://web. indstate. edu/thcme/mwking/ extracellularmatrix.html /ecm.htm 3. integrin.htm 4. Bernard Payrastre, Karine Missy, Catherine Trumel, Stephane Bodin,Monique Plantavid and Hugues Chap, The Integrin allb/ß3 in Human Platelet Signal Transduction. Biochemical Pharmacology, Vol. 60, pp , OH.CO Äff ~Xr Asp(0)fc) Nhfe x ^ χ &f % Leu X 2 : M, toi î Me X ; H, at If, HO* XJÎ NW; Σχήμα 17. Παράγωγα σαλικυλικών με πεπτίδια 10

10 5. TzongMing Wu, MingLiang Li and TzChong Chou, Inhibitory Effect of Hexapeptide (RGRHGD) on Platelet Aggregation. Thrombosis Research 97 (2000) INTEGRI1.HTM Michael A. Dechantsreiter, Eckart Planker, Barbara Matha, Elisabeth Lohof, Gunter Holzemann, Alfred Jonczyk, Simon L. Goodman, and Horst Kessler, N Methylated Cyclic RGD Peptides as Highly Active and Selective cuß3 Integrin Antagonists. /. Med. Chem. 1999, 42, Roland Haubner, Wolfgang Schmitt, Gunter Holzemann, Simon L. Goodman, Alfred Jonczyk, and Horst Kessler, Cyclic RGD Peptides Containing cx Turn Mimetics. /. Am. Chem. Soc. 1996, 118, Roland Haubner, Rainer Gratias, Beate Diefenbach, Simon L. Goodman, Alfred Jonczyk, and Horst Kessler, Structural and Functional Aspects of RGD Containing Cyclic Pentapeptides as Highly Potent and Selective Integrin avßs Antagonists. /. Am. Chem. Soc. 1996,118, David S. Thorpe, Helen Yeoman, A. W. Edith Chan,Viktor Krchnak, Michal Lebl, and Stephen Felder, Combinatorial Chemistry Reveals a New Motif That Binds the Platelet Fibrinogen Receptor, gpllbllla. Biochemical and Biophysical Research Communications 256, (1999). 12. D. Allen Annis, Olivier Helluin, and Eric N. Jacobsen, Stereochemistry as a Diversity Element: SolidPhase Synthesis of Cyclic RGD Peptide Derivatives by Asymmetric Catalysis. Angew. Chem. Int. Ed. 1998, 37, No. 13/ Elisabeth Lohof, Eckart Planker, Christian Mang, Fred Burkhart, Michael A. Dechantsreiter, Roland Haubner, HansJurger Wester, Markus Schwaiger, Günther Holzemann, Simon L. Goodman, and Horst Kessler, Carbohydrate Derivatives for Use in Drug Design: Cyclic ανselective RGD Peptides. Angew. Chem. Int. Ed. 2000, 39, No F.D. Suvire, A.M. Rodriguez, M.L. Mak, J.Gy. Papp, R.D. Enriz, Binding mechanism of RGD and its mimetics to receptor GPIIb/IIIa. A theoretical study. Journal of Molecular Structure (Theochem) 540 (2001) LiakopoulouKyriakides M. and Stavropoulos G. (1992) Biochem Int 26, Stavropoulos G., Magafa V., LiakopoulouKyriakides M., Sinakos Ζ and Aaberg A. (1997) Amino Acids 13, Stavropoulos G., Magafa V., Sarigiannis Y. and LiakopoulouKyriakides M Peptides (1998), Proceedings of 25th EPS, Sarigiannis Y., Stavropoulos G., Magafa V., LiakopoulouKyriakides M., and Garypidou G., Peptides: (Proceedings of the 26th EPS), Montpellier, France,

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΣΤΟ ΧΟΣ- Ε ΠΙ ΔΙΩ ΞΗ ΠΛΑΙ ΣΙΟ ΧΡΗ ΜΑ ΤΟ ΔΟ ΤΗ ΣΗΣ

ΣΤΟ ΧΟΣ- Ε ΠΙ ΔΙΩ ΞΗ ΠΛΑΙ ΣΙΟ ΧΡΗ ΜΑ ΤΟ ΔΟ ΤΗ ΣΗΣ ΣΤΟ ΧΟΣ- Ε ΠΙ ΔΙΩ ΞΗ Στό χος του Ο λο κλη ρω μέ νου Προ γράμ μα τος για τη βιώ σι μη α νά πτυ ξη της Πίν δου εί ναι η δια μόρ φω ση συν θη κών α ει φό ρου α νά πτυ ξης της ο ρει νής πε ριο χής, με τη δη

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

1.2.3 ιαρ θρω τι κές πο λι τι κές...35 1.2.4 Σύ στη μα έ λεγ χου της κοι νής α λιευ τι κής πο λι τι κής...37

1.2.3 ιαρ θρω τι κές πο λι τι κές...35 1.2.4 Σύ στη μα έ λεγ χου της κοι νής α λιευ τι κής πο λι τι κής...37 ΠΕΡΙΕΧΟΜΕΝΑ ΕΙΣΑΓΩΓΙΚΟ ΚΕ Φ Α Λ ΑΙΟ ΤΟ ΙΚΑΙΟ ΤΗΣ ΑΛΙΕΙΑΣ... 21 ΚΕ Φ Α Λ ΑΙΟ 1 o Η ΑΛΙΕΥΤΙΚΗ ΠΟΛΙΤΙΚΗ 1.1 Η Α λιεί α ως Οι κο νο μι κή ρα στη ριό τη τα...25 1.2 Η Κοι νο τι κή Α λιευ τι κή Πο λι τι κή...28

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΦΑΡΜΑΚΩΝ WORKSHOP ΣΧΕ ΙΑΣΜΟΥ

ΦΑΡΜΑΚΩΝ WORKSHOP ΣΧΕ ΙΑΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΣΧΕ ΙΑΣΜΟΥ ΣΧΕ ΙΑΣΜΟΥ ΦΑΡΜΑΚΩΝ ΕΘΝΙΚΟ Ι ΡΥΜΑ ΕΡΕΥΝΩΝ ΙΝΣΤΙΤΟΥΤΟ ΟΡΓΑΝΙΚΗΣ & ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΧΗΜΕΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΑΝΑΛΥΣΗΣ WORKSHOP ΣΧΕ ΙΑΣΜΟΥ ΦΑΡΜΑΚΩΝ Βασικές στρατηγικές Στο σχεδιασµό νέων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Ηεξέλιξη της πολυκυτταρικότητας

Ηεξέλιξη της πολυκυτταρικότητας ΚΥΤΤΑΡΙΚΗ ΕΠΙΚΟΙΝΩΝΙΑ Τα κύτταρα επικοινωνούν µεταξύ τους και µε το περιβάλλον προκειµένου να συντονίζουν τις λειτουργίες που απαιτούνται για την αύξηση, ανάπτυξη και λειτουργία ενός οργανισµού Η επικοινωνία

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777 ΘΕΜΑ Α Α1. α Α2. γ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΚΕΦΑΛΑΙΟ 8: ΕΝΖΥΜΑ: ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΚΙΝΗΤΙΚΗ Η ΕΝΝΟΙΑ ΤΗΣ ΚΑΤΑΛΥΣΗΣ ΣΤΗΝ ΧΗΜΕΙΑ ΚΑΙ ΤΗΝ ΒΙΟΛΟΓΙΑ Παράδειγμα: η αναγωγή του αζώτου σε αμμωνία Ν 2 + 3Η

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ Αυτό σημαίνει ότι χρησιμοποιούμε μόνο ενέσιμα φάρμακα και μόνο στο σημείο που πάσχει. ΜΕΣΟΘΕΡΑΠΕΙΑ Ξεκίνησε στη λογική του γιατί να μη χορηγήσω ένα αντιφλεγμονώδες

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΑΣΚΗΣΗ, ΨΥΧΙΚΗ ΥΓΕΙΑ ΚΑΙ ΠΟΙΟΤΗΤΑ ΖΩΗΣ

ΑΣΚΗΣΗ, ΨΥΧΙΚΗ ΥΓΕΙΑ ΚΑΙ ΠΟΙΟΤΗΤΑ ΖΩΗΣ Γιάννης Θεοδωράκης Πανεπιστήμιο Θεσσαλίας ΑΣΚΗΣΗ, ΨΥΧΙΚΗ ΥΓΕΙΑ ΚΑΙ ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΘΕΣΣΑΛΟΝΙΚΗ 2010 ΠΕΡΙΕΧΟΜΕΝΑ Πρό λο γος...6 1. Ά σκη ση και ψυ χική υ γεί α Ει σα γω γή...9 Η ψυ χο λο γί α της ά σκη σης...11

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Η ΔΙΑΣΠΑΣΗ ΤΟΥ ΠΕΠΤΙΔΙΚΟΥ ΔΕΣΜΟΥ ΚΑΙ ΚΑΤΑΛΥΤΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ ΠΡΩΤΕΑΣΩΝ Η ΔΙΑΣΠΑΣΗ ΕΥΝΟΕΙΤΑΙ ΘΕΡΜΟΔΥΝΑΜΙΚΑ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Γ ΝΕΥΡΟΔΙΑΒΙΒΑΣΤΕΣ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Γ ΝΕΥΡΟΔΙΑΒΙΒΑΣΤΕΣ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Γ ΝΕΥΡΟΔΙΑΒΙΒΑΣΤΕΣ ΝΕΥΡΟΔΙΑΒΙΒΑΣΤΕΣ Ορίζουμε ως διαβιβαστή μια ουσία που απελευθερώνεται από έναν νευρώνα σε μια σύναψη και που επηρεάζει ένα άλλο κύτταρο, είτε έναν νευρώνα είτε ένα κύτταρο

Διαβάστε περισσότερα

ΥΒΡΙΔΙΚΑ ΜΟΡΙΑ ΚΙΝΟΛΙΝΟΝΩΝ-ΦΑΙΝΟΛΙΚΩΝ ΟΞΕΩΝ ΜΕ ΣΥΝΔΥΑΣΜΕΝΗ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗ ΚΑΙ ΑΝΤΙΦΛΕΓΜΟΝΩΔΗ ΔΡΑΣΗ

ΥΒΡΙΔΙΚΑ ΜΟΡΙΑ ΚΙΝΟΛΙΝΟΝΩΝ-ΦΑΙΝΟΛΙΚΩΝ ΟΞΕΩΝ ΜΕ ΣΥΝΔΥΑΣΜΕΝΗ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗ ΚΑΙ ΑΝΤΙΦΛΕΓΜΟΝΩΔΗ ΔΡΑΣΗ ΥΒΡΙΔΙΚΑ ΜΟΡΙΑ ΚΙΝΟΛΙΝΟΝΩΝ-ΦΑΙΝΟΛΙΚΩΝ ΟΞΕΩΝ ΜΕ ΣΥΝΔΥΑΣΜΕΝΗ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗ ΚΑΙ ΑΝΤΙΦΛΕΓΜΟΝΩΔΗ ΔΡΑΣΗ Π. Γενναίου, Μ. Ρουσσάκη, Α. Δέτση Εργαστήριο Οργανικής Χημείας, Σχολή Χημικών Μηχανικών, Ε.Μ.Π., Ηρώων

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ Η νευρομυϊκή σύναψη αποτελεί ιδιαίτερη μορφή σύναψης μεταξύ του κινητικού νευρώνα και της σκελετικής μυϊκής ίνας Είναι ορατή με το οπτικό μικροσκόπιο Στην

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες Οργανική Χημεία Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες 1. Καρβονυλικές ενώσεις Καρβονυλική ομάδα C=O σημαντικότερη λειτουργική ομάδα οργανικής χημείας Καρβονυλικές ομάδες βρίσκονται

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

PΟΛΟΣ ΤΩΝ ΛΙΠΑΡΩΝ ΥΛΩΝ ΣΤΗ ΔΙΑΤΡΟΦΗ H βιολογική σημασία των λιποειδών είναι μεγάλη : Eίναι δομικές μονάδες των μεμβρανών και συμμετέχουν στις

PΟΛΟΣ ΤΩΝ ΛΙΠΑΡΩΝ ΥΛΩΝ ΣΤΗ ΔΙΑΤΡΟΦΗ H βιολογική σημασία των λιποειδών είναι μεγάλη : Eίναι δομικές μονάδες των μεμβρανών και συμμετέχουν στις PΟΛΟΣ ΤΩΝ ΛΙΠΑΡΩΝ ΥΛΩΝ ΣΤΗ ΔΙΑΤΡΟΦΗ H βιολογική σημασία των λιποειδών είναι μεγάλη : Eίναι δομικές μονάδες των μεμβρανών και συμμετέχουν στις διάφορες διεργασίες που γίνονται μέσω των μεμβρανών. Eίναι

Διαβάστε περισσότερα

Κεφάλαιο 5. Συνθετική Οργανική Χημεία

Κεφάλαιο 5. Συνθετική Οργανική Χημεία Κεφάλαιο 5 Συνθετική Οργανική Χημεία Σύνοψη Στο κεφάλαιο αυτό αναπτύσσονται θέματα σχετιζόμενα με την οργανική σύνθεση, δηλαδή την Παρασκευή, οργανικών ενώσεων μέσω αντιδράσεων. Σε ορισμένες περιπτώσεις,

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια ΧΗΜΕΙΑ ΦΥΣΙΚΩΝ ΠΡΟΪΟΝΤΩΝ-ΓΕΝΙΚΑ ΦΥΣΙΚΑ ΠΡΟΪΟΝΤΑ: Ενώσεις που αποτελούν τους ζωντανούς οργανισμούς ή παράγονται από αυτούς. Σήμερα ο όρος φυσικά προϊόντα αναφέρεται στα προϊόντα του δευτερογενούς μεταβολισμού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ της Νικολέτας Ε. 3ο Κεφάλαιο Περιληπτική Απόδοση 3.1. Ενέργεια και οργανισμοί Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται

Διαβάστε περισσότερα

Θεωρι α Γραφημα των 8η Δια λεξη

Θεωρι α Γραφημα των 8η Δια λεξη Θεωρι α Γραφημα των 8η Δια λεξη Α. Συμβω νης Ε Μ Π Σ Ε Μ Φ Ε Τ Μ Φεβρουα ριος 2015 Α. Συμβω νης (ΕΜΠ) Θεωρι α Γραφημα των 8η Δια λεξη Φεβρουα ριος 2015 168 / 182 Χρωματισμοι Γραφημα των Χρωματισμο ς Κορυφω

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ο αριθμός mol OH ΘΕΜΑ Α Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ 10 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων Περιεχόμενα ΘΕΜΑ Α.... 2 Α1.... 2 Α3.... 2 Α5.... 2 ΘΕΜΑ B.... 2 Β1.... 2 Β2....

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ Είδη ιπιδίων Ιδιότητες Λιποπρωτείνες Ταξινόμηση Σύσταση σε ιπίδια και αποπρωτείνες Μεταβοισμός Επιθυμητές τιμές οριακές τιμές Δυσιπιδαιμίες - Υπεριποπρωτεϊναιμίες

Διαβάστε περισσότερα

Εφαρμογές αρχών φαρμακολογίας

Εφαρμογές αρχών φαρμακολογίας Εφαρμογές αρχών φαρμακολογίας Χριστίνα Δάλλα Λέκτορας Φαρμακολογίας Ιατρική Σχολή, Πανεπιστήμιο Αθηνών cdalla@med.uoa.gr www.med.uoa.gr/pharmacology Ισχύς (potency) ενός φαρμάκου (συνήθως εκφράζεται σε

Διαβάστε περισσότερα

ΕΙ ΣΑ ΓΩ ΓΗ ΣΤΙΣ Ε ΠΙ ΧΕΙ ΡΗ ΣΕΙΣ

ΕΙ ΣΑ ΓΩ ΓΗ ΣΤΙΣ Ε ΠΙ ΧΕΙ ΡΗ ΣΕΙΣ ΕΙ ΣΑ ΓΩ ΓΗ ΣΤΙΣ Ε ΠΙ ΧΕΙ ΡΗ ΣΕΙΣ CIMIC CIMIC CIMIC ΚΕΙΜΕΝΟ: Υπλγος (ΜΧ) Ευ ρι πί δης Κ. Χα νιάς ΕΙΚΟΝΟΓΡΑΦΗΣΗ: Στρατιωτική Επιθεώρηση CIMIC εί ναι τα αρ χι κά των λέ ξε ων Civil Military Co-operation

Διαβάστε περισσότερα

Ανθρώπινο σώμα: 1200 gr Ca. 99% στα οστά και τα δόντια Το υπόλοιπο βρίσκεται στους ιστούς

Ανθρώπινο σώμα: 1200 gr Ca. 99% στα οστά και τα δόντια Το υπόλοιπο βρίσκεται στους ιστούς ΡΥΘΜΙΣΗ ΑΣΒΕΣΤΙΟΥ Ανθρώπινο σώμα: 1200 gr Ca 99% στα οστά και τα δόντια Το υπόλοιπο βρίσκεται στους ιστούς ΡΟΛΟΣ ΕΞΩΚΥΤΤΑΡΙΟΥ Ca ++ Μυϊκή συστολή Συναπτική διαβίβαση Συσσώρευση αιμοπεταλίων Πήξη του αίματος

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 013 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ

ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ ΜΗΧΑΝΙΣΜΟΙ ΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΦΟΡΑΣ ΚΑΙ ΔΙΑΠΕΡΑΤΟΤΗΤΑ Διάχυση Η διάχυση είναι το κύριο φαινόμενο με το οποίο γίνεται η παθητική μεταφορά διαμέσου ενός διαχωριστικού φράγματος Γενικά στη διάχυση ένα αέριο ή

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ 19-21 -10681 210 3824614 210 3847670 www.irakleitos.gr ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr EΞΕΤΑΣΤΕΑ ΥΛΗ: ΕΝΟΤΗΤΑ 8: Η ελευθέρωση της ενέργειας, σελ. 155-168 ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η κυτταρική αναπνοή είναι η διαδικασία

Διαβάστε περισσότερα

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι

Διαβάστε περισσότερα

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Τα τρόφιμα είναι σύνθετοι συνδυασμοί που προέρχονται από πολλές πηγες. Όλα τα τρόφιμα έχουν τη δυνατότητα αλλεπίδρασης (χημικής) σε διαφορετικό βαθμό.

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 2: Στοιχεία Μικροβιολογίας και Βιοχημείας των Βιομηχανικών Ζυμώσεων(1/5), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ραδιοεπισηµασµένα Πεπτίδια στην Ογκολογία

Ραδιοεπισηµασµένα Πεπτίδια στην Ογκολογία Ραδιοεπισηµασµένα Πεπτίδια στην Ογκολογία Θεοδοσία Μάϊνα Berthold ock Εργαστήριο Ραδιοφαρµάκων Ινστιτούτο Ραδιοϊσοτόπων - Ραδιοδιαγνωστικών Προϊόντων, ΕΚΕΦΕ «ηµόκριτος», Αθήνα Στόχευση µε ραδιοπεπτίδια

Διαβάστε περισσότερα

Φορέας υλοποίησης: Φ.Μ.Ε. ΑΛΦΑ

Φορέας υλοποίησης: Φ.Μ.Ε. ΑΛΦΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΤΜΗΜΑ ΜΑΘΗΜΑΤΙΚΩΝ ΗΜΕΡΙΔΑ: «ΠΡΑΚΤΙΚΗ ΑΣΚΗΣΗ, ΜΙΑ ΕΜΠΕΙΡΙΑ ΖΩΗΣ» ΣΤΡΑΤΗ ΣΤΑΜΑΤΙΑ Επιβλέπων Καθηγητής: ΚΑΡΑΧΑΛΙΟΣ ΝΙΚΟΛΑΟΣ Φορέας υλοποίησης: Φ.Μ.Ε. ΑΛΦΑ ΚΑΡΛΟΒΑΣΙ, ΜΑΪΟΣ 2012 ΣΤΟΙΧΕΙΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Πρα κτι κών µη χα νι κών Δ ηµοσίου, ΝΠΔ Δ & OΤΑ O36R11

Πρα κτι κών µη χα νι κών Δ ηµοσίου, ΝΠΔ Δ & OΤΑ O36R11 Πρα κτι κών µη χα νι κών Δ ηµοσίου, ΝΠΔ Δ & OΤΑ O36R11 ΚΩΩ Δ Ι ΚO ΠOΙ Η ΣΗ ΣYΛ ΛO ΓΙ ΚΩΩΝ ΡYΘ ΜΙ ΣΕ ΩΩΝ (ΣΣΕ & Δ Α) ΤΩΩΝ, Ν.Π.Δ.Δ. ΚΑΙ O.Τ.Α. Α. ΓΙΑ ΤΗΝ ΚΩΩ Δ Ι ΚO ΠOΙ Η ΣΗ Ε ΛΗ ΦΘΗ ΣΑΝ Υ ΠO ΨΗ 1. H 15/1981

Διαβάστε περισσότερα

ΕΝΖΥΜΑ. 3. Στο σχήμα φαίνεται η υποθετική δράση ενός ενζύμου πάνω σε ένα υπόστρωμα και ο αναστολέας του.

ΕΝΖΥΜΑ. 3. Στο σχήμα φαίνεται η υποθετική δράση ενός ενζύμου πάνω σε ένα υπόστρωμα και ο αναστολέας του. ΕΝΖΥΜΑ 1. (α) Να εξηγήσετε τι εννοούμε με τον όρο «εξειδίκευση των ενζύμων» καθώς και που οφείλεται αυτή. (β) Ποιες ουσίες μπορούν να επηρεάσουν τη δράση ενός ενζύμου και πώς; (γ) Πώς τα ένζυμα επηρεάζουν

Διαβάστε περισσότερα