Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου"

Transcript

1 1 Θζματα Πανελλθνίων Στθν εικόνα 1 φαίνεται ζνα μζροσ μίασ βιολογικισ διαδικαςίασ, θ οποία βρίςκεται ςε εξζλιξθ. Α. Να ονομάςετε τθ διαδικαςία, που βρίςκεται ςε εξζλιξθ, ςτθν εικόνα 1 και να εντοπίςετε τθ βάςθ που ενςωματϊκθκε κατά παράβαςθ του κανόνα τθσ ςυμπλθρωματικότθτασ. Β.Να γράψετε το τελικό δίκλωνο μόριο, το οποίο κα παραχκεί ςτο τζλοσ τθσ διαδικαςίασ που απεικονίηει θ εικόνα 1. Να ςθμειϊςετε τον προςανατολιςμό των αλυςίδων του μορίου αυτοφ. 2. Σε ζνα είδοσ εντόμου ζνα γονίδιο είναι υπεφκυνο για τθν παραγωγι του ενηφμου Α, ενϊ το αλλθλόμορφο του δεν παράγει το ζνηυμο Α. Ζνα άλλο γονίδιο κακορίηει το χαρακτιρα «ανοιχτό χρϊμα ςϊματοσ», ενϊ το αλλθλόμορφο του κακορίηει το «ςκοφρο χρϊμα ςϊματοσ». Διαςταυρϊνεται ζνα κθλυκό ζντομο που παράγει το ζνηυμο Α και ζχει ανοιχτό χρϊμα ςϊματοσ με ζνα αρςενικό ζντομο που παράγει το ζνηυμο Α και ζχει ανοιχτό χρϊμα ςϊματοσ. Από τθ διαςταφρωςθ προκφπτουν: 600 κθλυκοί απόγονοι που παράγουν το ζνηυμο Α και ζχουν ανοιχτό χρϊμα ςϊματοσ, 300 αρςενικοφ απόγονοι που παράγουν το ζνηυμο Α και ζχουν ςκοφρο χρϊμα ςϊματοσ και 300 αρςενικοφ απόγονοι που παράγουν το ζνηυμο Α και ζχουν ανοιχτό χρϊμα ςϊματοσ. Δίνονται: i. Για τον τρόπο κλθρονόμθςθσ των δφο χαρακτιρων ιςχφει ο 2οσ νόμοσ του Mendel. ii. Για τθ ςφνκεςθ του ενηφμου Α, τα άτομα που διαςταυρϊκθκαν είναι ετερόηυγα. iii. Το ζντομο είναι διπλοειδισ ευκαρυωτικόσ οργανιςμόσ και το φφλο του κακορίηεται όπωσ ςτον άνκρωπο. Α. Να γράψετε τον τρόπο με τον οποίο κλθρονομείται το γονίδιο που δεν παράγει το ζνηυμο Α. Να γράψετε τον τρόπο με τον οποίο κλθρονομείται το γονίδιο που κακορίηει το ανοιχτό χρϊμα ςϊματοσ. Β. Να αιτιολογιςετε τον τρόπο κλθρονόμθςθσ των παραπάνω χαρακτιρων, κάνοντασ τθν κατάλλθλθ διαςταφρωςθ ι τισ κατάλλθλεσ διαςταυρϊςεισ. Δεν απαιτείται θ διατφπωςθ των νόμων του Mendel. 3. Στθν εικόνα 2 δίνονται δφο μθ ομόλογα αυτοςωμικά χρωμοςϊματα ενόσ κυττάρου, το χρωμόςωμα Α και το χρωμόςωμα Β. Σε κάκε χρωμόςωμα απεικονίηεται θ αλλθλουχία του DNA που υπάρχει ςτο άκρο του. Ζςτω ότι ςε κακζνα από τα χρωμοςϊματα τθσ εικόνασ 2 ςυμβαίνει κραφςθ ςτα ςθμεία που δείχνουν τα βζλθ. Στθ ςυνζχεια πραγματοποιείται αμοιβαία μετατόπιςθ των ακραίων ςκιαςμζνων τμθμάτων ανάμεςα ςτο χρωμόςωμα Α και ςτο χρωμόςωμα Β. Α. Να γράψετε όλα τα πικανά χρωμοςϊματα που κα προκφψουν μετά τθν αμοιβαία μετατόπιςθ, με τισ αντίςτοιχεσ αλλθλουχίεσ DNA. Να ςθμειϊςετε τουσ προςανατολιςμοφσ όλων των μορίων DNA που προκφπτουν. Μία από τισ παραπάνω αμοιβαίεσ μετατοπίςεισ γίνεται ςε ηυγωτό, από το οποίο προκφπτει ζνασ ενιλικοσ άνκρωποσ με φυςιολογικό φαινότυπο. Στον άνκρωπο αυτόν ςυμβολίηουμε το χρωμόςωμα Α που ζχει τθν μετάλλαξθ ωσ χρωμόςωμα α και το χρωμόςωμα Β που ζχει τθν μετάλλαξθ ωσ χρωμόςωμα β. Β. Να γράψετε όλουσ τουσ πικανοφσ γαμζτεσ αυτοφ του ενιλικα, χρθςιμοποιϊντασ τουσ ςυμβολιςμοφσ των χρωμοςωμάτων, όπωσ ςασ ζχουν δοκεί. Γ. Κάκε γαμζτθσ που προκφπτει ςτο ερϊτθμα Β γονιμοποιείται με φυςιολογικό γαμζτθ. Να εξθγιςετε τι ποςοςτό των απογόνων κα ζχει φυςιολογικό φαινότυπο και τι ποςοςτό των απογόνων κα ζχει φυςιολογικό καρυότυπο. Δ. Να εξθγιςετε το είδοσ ι τα είδθ των δομικϊν χρωμοςωμικϊν ανωμαλιϊν, που ςίγουρα κα ζχει κάκε απόγονοσ με μθ φυςιολογικό καρυότυπο. ΘΕΜΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΠΕΡΙΝΟ 4. Στθν εικόνα 2 απεικονίηεται θ καμπφλθ ανάπτυξθσ ενόσ μικροοργανιςμοφ και του προϊόντοσ που παράγει, όταν αυτόσ καλλιεργθκεί ςε βιοαντιδραςτιρα.

2 2 Α. Ροια καμπφλθ απεικονίηει τθν ανάπτυξθ του μικροοργανιςμοφ και ποια καμπφλθ το παραγόμενο προϊόν ; Να αιτιολογιςετε τθν απάντθςι ςασ. Β. Να ονομάςετε τισ φάςεισ ανάπτυξθσ του μικροοργανιςμοφ που ςχετίηονται με τθν παραγωγι του προϊόντοσ, αναφζροντασ τα αντίςτοιχα χρονικά διαςτιματα. Γ. Ροιεσ διαδικαςίεσ κα ακολουκιςουμε για τθν παραλαβι και αξιοποίθςθ του προϊόντοσ, αν υποκζςουμε ότι αυτό εκκρίνεται από τον μικροοργανιςμό; 5. Ζνα βακτιριο περιζχει κυκλικό μόριο DNA που αποτελείται από ηεφγθ βάςεων. Το βακτιριο αυτό αναπτφςςεται ςε κρεπτικό υλικό που περιζχει αποκλειςτικά ωσ πθγι φωςφόρου ραδιενεργό 32 P, με αποτζλεςμα όλα τα νζα νουκλεοτίδια να είναι ραδιενεργά. Να υπολογίςετε τον αρικμό των ραδιενεργϊν νουκλεοτιδίων που κα περιζχονται ςτο ςφνολο των βακτθρίων μετά από δφο διαδοχικζσ διαιρζςεισ του αρχικοφ βακτθρίου. Να αιτιολογιςετε τθν απάντθςι ςασ. 6. Στον πίνακα Ι δίνονται τα αντικωδικόνια των trnas και θ ςειρά με τθν οποία χρθςιμοποιοφνται κατά τθ μετάφραςθ ενόσ μορίου mrna, που περιζχει 7 κωδικόνια. Α. Να γράψετε μία αλλθλουχία βάςεων του μορίου mrna, ςυμπεριλαμβανομζνου του 7ου κωδικονίου, για τθ μετάφραςθ του οποίου χρθςιμοποιοφνται τα trnas του πίνακα Ι. Β. Να γράψετε τθν αλλθλουχία βάςεων του γονιδίου, θ μεταγραφι του οποίου δίνει το mrna του ερωτιματοσ Α και να ορίςετε τα 5 και 3 άκρα του. Να εντοπίςετε τθν κωδικι και μθ κωδικι αλυςίδα. Να υποδείξετε τθ κζςθ του υποκινθτι ςτο παραπάνω γονίδιο, τοποκετϊντασ το γράμμα Υ ςτο κατάλλθλο άκρο του μορίου. ΘΕΜΑΣΑ ΕΠΑΝΑΛΗΠΣΙΚΩΝ Στθν εικόνα 1 απεικονίηονται διαγραμματικά 3 μόρια DNA, ςτα οποία ο υποκινθτισ ςθμειϊνεται με Υ. Α. Να μεταφζρετε ςτο τετράδιό ςασ τα τρία ςχιματα τθσ εικόνασ 1 και να ςθμειϊςετε με ζνα βζλοσ τθν κατεφκυνςθ μεταγραφισ ςε κακζνα από τα γονίδια Α, Β και Γ. Να γράψετε για το κάκε γονίδιο Α, Β και Γ ποια από τισ δφο αλυςίδεσ Ι ι ΙΙ είναι θ κωδικι. Μια γενετικι αςκζνεια οφείλεται ςε γονιδιακι μετάλλαξθ. Το φυςιολογικό γονίδιο κόβεται ςε μία κζςθ από τθν περιοριςτικι ενδονουκλεάςθ EcoRI, ενϊ το μεταλλαγμζνο αλλθλόμορφό του δεν κόβεται. Τα ςυμπτϊματα τθσ αςκζνειασ εμφανίηονται μετά τθν θλικία των 30 ετϊν. Ζνασ υγιισ άντρασ 40 ετϊν είναι παντρεμζνοσ με γυναίκα 35 ετϊν που εμφανίηει τα ςυμπτϊματα τθσ αςκζνειασ και αποκτοφν ζνα κορίτςι. Για τον εντοπιςμό του φυςιολογικοφ και του μεταλλαγμζνου γονιδίου, απομονϊκθκαν από ςωματικά κφτταρα κάκε μζλουσ τθσ οικογζνειασ τμιματα DNA μικουσ ηευγϊν βάςεων, που περιζχουν τα αλλθλόμορφα γονίδια. Στα τμιματα αυτά ζγινε επίδραςθ με τθν περιοριςτικι ενδονουκλεάςθ EcoRI. Τα αποτελζςματα τθσ επίδραςθσ τθσ EcoRI επιβεβαίωςαν τουσ φαινοτφπουσ των γονζων, ενϊ για το κορίτςι ζδειξαν ότι όλα τα τμιματα DNA που αναλφκθκαν είναι μικουσ ηευγϊν βάςεων. Β. Ροια είναι θ αλλθλουχία που αναγνωρίηει θ περιοριςτικι ενδονουκλεάςθ EcoRI; Γ. Να διερευνιςετε αν θ αςκζνεια αυτι κλθρονομείται με φυλοςφνδετο υπολειπόμενο τρόπο κλθρονομικότθτασ και αν κλθρονομείται με αυτοςωμικό υπολειπόμενο τρόπο κλθρονομικότθτασ Δ. Να γράψετε τουσ γονοτφπουσ των μελϊν τθσ οικογζνειασ. 9. Στθν εικόνα 2 απεικονίηεται ζνα αςυνεχζσ γονίδιο ανκρϊπινου θπατικοφ κυττάρου. Το γονίδιο αυτό είναι υπεφκυνο για τθν παραγωγι του ολιγοπεπτιδίου τθσ εικόνασ 3. Α. Να εντοπίςετε και να γράψετε τθν αλλθλουχία βάςεων του εςωνίου του γονιδίου τθσ εικόνασ 2. Να αιτιολογιςετε τθν απάντθςι ςασ.

3 3 Β. Να γράψετε το πρόδρομο μόριο του mrna που δθμιουργείται από τθν μεταγραφι του γονιδίου τθσ εικόνασ 2. Γ. Να γράψετε το ϊριμο mrna που προκφπτει από τθ διαδικαςία τθσ ωρίμανςθσ. Ζνασ ερευνθτισ κζλει να κλωνοποιιςει το γονίδιο τθσ εικόνασ 2 για να το μελετιςει. Επίςθσ, κζλει να κλωνοποιιςει το ίδιο γονίδιο, για τθν παραγωγι του ολιγοπεπτιδίου τθσ εικόνασ 3, από βακτθριακι καλλιζργεια ςε μεγάλθ ποςότθτα. Δ. Τι είδουσ βιβλιοκικθ κα πρζπει να καταςκευάςει ςε κακεμία περίπτωςθ; Να αιτιολογιςετε τθν απάντθςι ςασ. Ο ίδιοσ ερευνθτισ ζχει ςτθν διάκεςι του μια γονιδιωματικι βιβλιοκικθ και μία cdna βιβλιοκικθ ανκρϊπινων θπατικϊν κυττάρων και τα δφο μόρια ανιχνευτζσ Α και Β τθσ εικόνασ 4. Ε. Να διερευνιςετε τθν καταλλθλότθτα του ανιχνευτι Α και του ανιχνευτι Β να εντοπίηει ςε κάκε μια από τισ δφο βιβλιοκικεσ τον βακτθριακό κλϊνο που περιζχει το υπεφκυνο γονίδιο για τθ ςφνκεςθ του ολιγοπεπτιδίου τθσ εικόνασ 2. Σ. Να εξθγιςετε γιατί ο αρικμόσ των αμινοξζων του ολιγοπεπτιδίου τθσ εικόνασ 3 είναι διαφορετικόσ από τον αρικμό των κωδικονίων του ϊριμου mrna από το οποίο προκφπτει. Δίνονται: ΘΕΜΑΣΑ ΟΜΟΓΕΝΩΝ Στθν εικόνα-1 παρουςιάηεται το mrna που προκφπτει από τθ μεταγραφι του γονιδίου Η ενόσ βακτθρίου. Eικόνα-1 5 -GUUCAAUGUACCAGUGGCUGUAAGCAGC-3 Α.Να γραφεί θ μθ κωδικι αλυςίδα του γονιδίου Η, με τον κατάλλθλο προςανατολιςμό, αιτιολογϊντασ τθν απάντθςθ ςασ. Β.Να γράψετε τθν αλλθλουχία των αμινοξζων του ολιγοπεπτιδίου που προκφπτει από τθ μετάφραςθ του mrna τθσ εικόνασ-1. Μφα μετάλλαξθ ςτθν κωδικι αλυςίδα του γονιδίου οδθγεί ςτθν παραγωγι ενόσ διαφορετικοφ mrna (εικόνα-2) Eικόνα-2 5 -GUUCAAUGUACCAGUGΑCUGUAAGCAGC-3 Γ.Να εντοπίςετε τθν αλλαγά που ζγινε ςτθν κωδικι αλυςίδα ονομάηοντασ το είδοσ τθσ μετάλλαξθσ. Δ. Να γράψετε τθν αλλθλουχία των αμινοξζων του ολιγοπεπτιδίου που κα προκφψει από τθν μετάφραςθ του mrna τθσ εικόνασ-2. Ροια είναι θ ςυνζπεια τθσ μετάλλαξθσ ςτθν λειτουργικότθτα του ολιγοπεπτιδίου; Δφνονται αντιςτοιχίςεισ κωδικονίων- αμινοξζων: 5 -CAG-3 :Γλουταμίνθ. 5 -UAC-3 :Τυροςφνθ. 5ϋ-UGG-3ϋ:Τρυπτοφάνθ. 5ϋ-CUG-3ϋ:Λευκίνθ. 11. Ο Βαςίλθσ και θ Σοφία είναι υγιείσ και αποκτοφν ζνα γιό τον Θλία και μία κόρθ τθ Μαρία. Ο Θλίασ πάςχει μόνο από αιμορροφιλία Α ενϊ θ Μαρία μόνο από φαινυλκετονουρία. Α.Να αναφζρετε τουσ τρόπουσ κλθρονόμθςθσ των αςκενειϊν :Αιμορροφιλία Α και Φαινυλκετονουρία. Β. Να ςχεδιάςετε για κάκε μία από τισ παραπάνω αςκζνειεσ ξεχωριςτά το γενεαλογικό δζνδρο. Γ. Να γράψετε τουσ πικανοφσ γονότυπουσ των μελϊν τθσ οικογζνειασ ωσ προσ τισ δφο αςκζνειεσ. Δ. Ροια είναι θ πικανότθτα να γεννθκεί άλλθ μία κόρθ που να πάςχει από αιμορροφιλία ; 12. Μια μορφι μυϊκισ δυςτροφίασ οφείλεται ςε ζνα μεταλλαγμζνο γονίδιο που βρίςκεται ςε μιτοχονδριακό DNA. Ζνασ άνδρασ που πάςχει από μυϊκι δυςτροφία διαςταυρϊνεται με μια φυςιολογικι γυναίκα. Α. Ροια είναι θ πικανότθτα να προκφψει απόγονοσ με μυϊκι δυςτροφία; Β. Να αιτιολογιςετε τθν απάντθςισ ςασ. 13. Στισ κότεσ και τουσ πετεινοφσ το αυτοςωμικό επικρατζσ αλλθλόμορφο γονίδιο Α είναι υπεφκυνο για το φαινότυπο «πόδια με φτερά», ενϊ το υπολειπόμενο αλλθλόμορφο α είναι υπεφκυνο για το φαινότυπο «πόδια χωρίσ φτερά». Επίςθσ, το αυτοςωμικό επικρατζσ αλλθλόμορφο γονίδιο Γ είναι υπεφκυνο για το φαινότυπο «ςφνκετο λοφίο», ενϊ το υπολειπόμενο αλλθλόμορφο γ είναι υπεφκυνο για το φαινότυπο «απλό λοφίο». Τα γονίδια που ελζγχουν τουσ δφο παραπάνω φαινότυπουσ βρίςκονται ςε διαφορετικά ηεφγθ ομολόγων χρωμοςωμάτων. Ο πετεινόσ Ι και οι κότεσ ΙΙ, ΙΙΙ, ΙV ζχουν όλοι φαινότυπο: «πόδια με φτερά» και «ςφνκετο λοφίο». Β. Να γράψετε όλουσ τουσ πικανοφσ γονότυπουσ ενόσ ατόμου με φαινότυπο «πόδια με φτερά» και «ςφνκετο λοφίο». Από τθ διαςταφρωςθ του πετεινοφ Ι με τθν κότα ΙΙ προκφπτουν άτομα με φαινοτυπικι αναλογία: 9 *πόδια με φτερά και ςφνκετο λοφίο+ : 3 *πόδια με φτερά και απλό λοφίο+ : 3 *πόδια χωρίσ φτερά και ςφνκετο λοφίο+ : 1 *πόδια χωρίσ φτερά και απλό λοφίο].

4 4 Γ. Να γράψετε τουσ γονότυπουσ των ατόμων που διαςταυρϊκθκαν (πετεινόσ Ι και κότα ΙΙ). Να αιτιολογιςετε τθν απάντθςι ςασ. Δεν απαιτείται θ αναγραφι τθσ διαςταφρωςθσ. Από τθ διαςταφρωςθ του πετεινοφ Ι με τθν κότα ΙΙΙ, προκφπτουν άτομα με φαινότυπο «πόδια με φτερά» και «ςφνκετο λοφίο», κακϊσ και άτομα με φαινότυπο «πόδια με φτερά» και «απλό λοφίο». Από τθ διαςταφρωςθ του πετεινοφ Ι με τθν κότα ΙV, προκφπτουν άτομα με φαινότυπο «πόδια με φτερά» και «ςφνκετο λοφίο», κακϊσ και άτομα με φαινότυπο «πόδια χωρίσ φτερά» και «ςφνκετο λοφίο». Δ. Να προςδιορίςετε τουσ γονότυπουσ των ατόμων ΙΙΙ και ΙV. Να αιτιολογιςετε τθν απάντθςι ςασ και να κάνετε τισ κατάλλθλεσ διαςταυρϊςεισ. 14. Στθν Εικόνα 1 δίνεται τμιμα DNA, το οποίο περιζχει ζνα ςυνεχζσ γονίδιο: Γενετικόσ κϊδικασ: Σερίνθ: 5ϋ-UCA-3ϋ, Βαλίνθ: 5ϋ-GUG-3ϋ Λευκίνθ: 5ϋ-CUU-3ϋ Να γράψετε τθν αλλθλουχία του πρόδρομου mrna, του ϊριμου mrna,των εςωνίων και των εξωνίων. 16. Ζνασ υγιισ άνδρασ εργαηόμενοσ ςε κζντρο πυρθνικϊν ερευνϊν αποκτά μετά από γάμο με υγιι γυναίκα,υιό που πάςχει από αιμορροφιλία-α. Ο άνδρασ κατακζτει αγωγι ςτο κζντρο για αποηθμίωςθ για τθν γζννθςθ του υιοφ του. Θα δικαιωκεί ; 17. Μπορεί το παρακάτω γενεαλογικό δζνδρο να αναπαριςτά τον τρόπο κλθρονόμθςθσ : α. Τθσ μερικισ αχρωματοψίασ ςτο πράςινο-κόκκινο ; β. τθσ αχονδροπλαςίασ ; γ. τθσ κυςτικισ ίνωςθσ ; δ. μιτοχονδριακισ αςκζνειασ ; Α. Να προςδιορίςετε τθν κωδικι αλυςίδα του τμιματοσ DNA ςτθν Εικόνα 1, επιςθμαίνοντασ τα 5ϋ και 3ϋ άκρα των αλυςίδων του. Να αιτιολογιςετε τθν απάντθςι ςασ. Β. Να γράψετε τθν αλλθλουχία του mrna που προκφπτει από τθν μεταγραφι του γονιδίου ςτθν Εικόνα 1 (μονάδα 1) και να ορίςετε τα 5ϋ και 3ϋ άκρα του. Να αιτιολογιςετε τθν απάντθςι ςασ. Το δίκλωνο μόριο DNA ςτθν Εικόνα 1 ςπάει εξαιτίασ ενόσ μεταλλαξογόνου παράγοντα ςτα ςθμεία 1 και 2. Το τμιμα μεταξφ των ςθμείων 1 και 2 επανενϊνεται φςτερα από αναςτροφι. Γ. Να γράψετε το μεταλλαγμζνο δίκλωνο μόριο DNA που κα προκφψει μετά τθν αναςτροφι. Δ. Να διερευνιςετε εάν το μεταλλαγμζνο τμιμα DNA που προκφπτει μετά τθν αναςτροφι μπορεί να παράγει γονιδιακό προϊόν. Να αιτιολογιςετε τθν απάντθςι ςασ. Ε. Να αναφζρετε τισ πικανζσ ςυνζπειεσ ςτθ δομι και τθ λειτουργικότθτα του μεταλλαγμζνου ολιγοπεπτιδίου. ΘΕΜΑΣΑ ΟΕΦΕ Δφνεται το αςυνεχζσ γονίδιο: ACAAAGTACTGTGTGTTGGCATTCGTAGCCA TGTTTCATGACACACAACCGTAAGCATCGGT To οποίο είναι υπεφκυνο για τθ βιοςφνκεςθ του ολιγοπεπτιδίου: COOH-Σερίνθ-Βαλίνθ-Λευκίνθ-ΝΘ 2 ΘΕΜΑΣΑ ΟΕΦΕ Το παρακάτω ςχιμα απεικονίηει μία κθλιά τθσ αντιγραφισ: Α. Να βρείτε τα άκρα ςτισ κζςεισ Α, Β, Γ και Δ Β. Να βρείτε ςε ποια από τισ δφο κζςεισ Φ και Χ είχαμε τθν ςφνκεςθ του πρωταρχικοφ τμιματοσ 5ϋ-UAAGC-3ϋ Γ. Στθν παραπάνω κθλιά τθσ αντιγραφισ όλα τα πρωταρχικά τμιματα ζχουν το ίδιο μικοσ με το πρωταρχικό τμιμα του Β. Αν ςε κάκε αλυςίδα ςτο τμιμα που αντιγράφεται αςυνεχϊσ απαιτοφνται πζντε πρωταρχικά τμιματα,να υπολογιςτεί ο αρικμόσ των ριβονουκλεοτιδίων που απαιτείται για τθν αντιγραφι του παραπάνω

5 5 τμιματοσ DNA. 19. Βακτιριο E.coli αναπτφςςεται ςε κρεπτικό υλικό που ζχει ταυτόχρονα γλυκόηθ και μελάςα. Αν θ καλλιζργεια είναι κλειςτι, να ςχεδιάςετε τθν καμπφλθ ανάπτυξθσ των βακτθρίων Ε.coli ςτο κρεπτικό υλικό. 20. Θ βιοςφνκεςθ του ενηφμου Α ςτον άνκρωπο ελζγχεται από φυλοςφνδετο γονίδιο. Μετά από γονιδιακι μετάλλαξθ προζκυψε το αλλθλόμορφο του γονίδιο το οποίο δεν παράγει το ζνηυμο. Το μεταλλαγμζνο αλλθλόμορφο είναι υπολειπόμενο του φυςιολογικοφ. Το Β είναι ζνηυμο,απαραίτθτο για τθν λειτουργία των μιτοχονδρίων. Στον ανκρϊπινο πλθκυςμό εντοπίςτθκε μεταλλαγμζνο αλλθλόμορφο του φυςιολογικοφ γονιδίου που παράγει το Β, το οποίο διακζτει πρόωρο κωδικόνιο λιξθσ, με αποτζλεςμα να μθν παράγει το ζνηυμο Β. Ραρόλα αυτά οι άνκρωποι που εκφράηεται το μεταλλαγμζνο γονίδιο επιβιϊνουν και μποροφν να αναπαράγονται. Θ ςυχνότθτα εμφάνιςθσ τθσ ζλλειψθσ του ενηφμου Β είναι ίδια ςτα δφο φφλα. Γυναίκα που εμφανίηει ζλλειψθ και ςτα δφο ζνηυμα Α και Β παντρεφεται άνδρα που παράγει και τα δφο ζνηυμα Α και Β. Να βρεκοφν οι πικανοί γονότυποι και φαινότυποι τζκνου που πρόκειται να αποκτιςει το ςυγκεκριμζνο ηευγάρι. ΘΕΜΑΣΑ ΟΕΦΕ Δίνεται τμιμα DNA φυςιολογικοφ γονιδίου που κωδικοποιεί 8 αμινοξζα ενόσ φυςιολογικοφ πεπτιδίου 5ϋ-..AGCGACACCGAGCTTTGGGATCTT..-3ϋ Μια γονιδιακι μετάλλαξθ προκάλεςε τθν παρακάτω αλλαγι ςτο τμιμα DNA 5ϋ-..AGCGACACCGAGCTTGGGGATCTT..-3ϋ Ραρά τθ μετάλλαξθ που ζγινε δεν υπιρξε αλλαγι ςτθν αλλθλουχία αμινοξζων του πεπτιδίου. Ρροςδιορίςτε αν θ αλλθλουχία που ςασ δίνεται είναι τμιμα τθσ κωδικισ ι τθσ μθ κωδικισ αλυςίδασ του γονιδίου. Δίνονται οι αντιςτοιχίςεισ κωδικονίων- αμινοξζων: UGG-trp GGG-gly CCU-pro CCC-pro 22. Σασ δίνεται το παρακάτω γράφθμα που δείχνει τισ διαδοχικζσ διαςταυρϊςεισ φυτϊν μοςχομπίηελων. Να αντιςτοιχίςετε τισ γενιζσ Α, Β και Γ με τισ γενιζσ P, F1,F2 κακϊσ και να προςδιορίςετε τουσ γονότυπουσ τισ κάκε γενιάσ. 23. Σε ζνα ηευγάρι ο ςφηυγοσ είναι υγιισ ενϊ θ γυναίκα πάςχει από κλθρονομικι αςκζνεια. Αποκτοφν τρία παιδιά: δφο υγιι αγόρια και ζνα κορίτςι που πάςχει από τθν αςκζνεια. Α. Μπορεί το γονίδιο που προκαλεί τθν αςκζνεια να είναι φυλοςφνδετο υπολειπόμενο ; Αιτιολογιςτε. Β. Να ςχεδιαςτεί το γενεαλογικό δζνδρο τθσ οικογζνειασ ςυμβολίηοντασ κατάλλθλα τα άτομα που είναι 100% φορείσ του γονιδίου. Να αποκλειςτεί θ περίπτωςθ το γονίδιο που προκαλεί τθν αςκζνεια να είναι φυλοςφνδετο και επικρατζσ.

6 6 ΘΕΜΑΣΑ ΠΑΝΕΛΛΗΝΙΩΝ 2016 ΗΜΕΡΗΙΟ 24. Στθν εικόνα 1 υπάρχουν τζςςερα γενεαλογικά δζντρα (1, 2, 3, 4) ςτα οποία απεικονίηεται ο τρόποσ κλθρονόμθςθσ τεςςάρων διαφορετικϊν χαρακτιρων του ανκρϊπου. Στο γενεαλογικό δζντρο 1, ο χαρακτιρασ που μελετάται, είναι οι ομάδεσ αίματοσ (Α, Β, ΑΒ και Ο). Οι υπόλοιποι τρεισ χαρακτιρεσ που μελετϊνται, είναι: θ αςκζνεια τθσ οικογενοφσ υπερχολθςτερολαιμίασ, θ αιμορροφιλία Α και ο αλφιςμόσ. Με βάςθ τα ςτοιχεία που υπάρχουν ςτθν εικόνα 1: Α. Να γράψετε ςτο τετράδιό ςασ τον γόνοτυπο του ατόμου Ι1 που βρίςκεται ςτο γενεαλογικό δζντρο 1 και να αιτιολογιςετε τθν απάντθςι ςασ. Β. Να αντιςτοιχίςετε τουσ τρεισ υπόλοιπουσ χαρακτιρεσ που μελετϊνται (οικογενισ υπερχολθςτερολαιμία, αιμορροφιλία Α και αλφιςμόσ) με τα υπόλοιπα τρία γενεαλογικά δζντρα (2, 3 και 4), γράφοντασ, δίπλα από το κακζνα γενεαλογικό δζντρο, τον χαρακτιρα που του αντιςτοιχεί. Να αιτιολογιςετε τθν απάντθςι ςασ. 25. Μια φαρμακευτικι πρωτεΐνθ που προορίηεται για ανκρϊπινθ χριςθ, μπορεί να παραχκεί από το γάλα γενετικά τροποποιθμζνων κθλαςτικϊν, από βακτιρια και από όργανα κθλαςτικϊν που δεν είναι γενετικά τροποποιθμζνα. Να αναφζρετε τουσ λόγουσ, για τουσ οποίουσ προτιμοφμε να παράγουμε αυτι τθν πρωτεΐνθ όχι από βακτιρια ι από όργανα κθλαςτικϊν, αλλά από το γάλα γενετικά τροποποιθμζνων κθλαςτικϊν. 26. Το μόριο DNA ενόσ βακτθρίου αποτελείται από 2 x 10 5 ηεφγθ βάςεων που περιζχουν το μθ ραδιενεργό ιςότοπο του φωςφόρου. Το βακτιριο αυτό τοποκετείται και πολλαπλαςιάηεται ςε κρεπτικό υλικό που περιζχει αποκλειςτικά ωσ πθγι φωςφόρου ραδιενεργό 32 P, και υφίςταται πζντε διαδοχικζσ διαιρζςεισ. Ο αρικμόσ των νουκλεοτιδίων, που κα περιζχουν το μθ ραδιενεργό ιςότοπο του φωςφόρου ςτο τζλοσ των πζντε διαιρζςεων, κα είναι: α) 0 β) 4 x 10 5 γ) 2 x 10 5 Να γράψετε τθ ςωςτι απάντθςθ και να τθν αιτιολογιςετε. (Να θεωρήσετε ότι δεν ζχουν συμβεί μεταλλάξεις ή ανταλλαγή γενετικοφ υλικοφ) 27. Βρζκθκε ότι ςτελζχθ του βακτθρίου Escherichia coli (E. coli) δεν μποροφν να διαςπάςουν το διςακχαρίτθ λακτόηθ. Στα ςτελζχθ αυτά, εντοπίςτθκαν γονιδιακζσ μεταλλάξεισ. Να εξθγιςετε ςε ποια ι ποιεσ κζςεισ του οπερονίου τθσ λακτόηθσ, εκτόσ από τα δομικά γονίδια, ζχουν ςυμβεί αυτζσ οι μεταλλάξεισ. 28. Στθν εικόνα 2, το τμιμα του DNA περιλαμβάνει αςυνεχζσ γονίδιο ευκαρυωτικοφ κυττάρου που κωδικοποιεί μικρό πεπτίδιο. Μζςα ςτθν αγκφλθ φαίνεται θ αλλθλουχία τθσ αμετάφραςτθσ περιοχισ που ενϊνεται με το rrna τθσ μικρισ υπομονάδασ του ριβοςϊματοσ. Τα t-rnas που χρθςιμοποιικθκαν κατά ςειρά ςτθν παραγωγι του πεπτιδίου, είχαν τα αντικωδικϊνια 5ϋ CAU 3ϋ, 5ϋ CCA 3ϋ, 5ϋ AAA 3ϋ, 5ϋ AGG 3ϋ, 5ϋ CAU 3ϋ, 5ϋ CCA 3ϋ, 5ϋ AAC 3ϋ. Α. Να ςθμειϊςετε ςτο τετράδιό ςασ ποια από τισ αλυςίδεσ Α ι Β είναι θ κωδικι αλυςίδα του γονιδίου. Να αιτιολογιςετε τθν απάντθςι ςασ. Να χαρακτθρίςετε ωσ 5ϋ ι 3ϋ τα άκρα ςτα ςθμεία I, II, III,IV. Β. Να γράψετε ςτο τετράδιό ςασ τo εςϊνιο που υπάρχει ςτο παραπάνω γονίδιο. Γ. Να γράψετε τθν αλλθλουχία των βάςεων του mrna, που κα χρθςιμοποιθκεί κατά τθ μετάφραςθ τθσ πλθροφορίασ του γονιδίου τθσ εικόνασ 2. Δ. Στθν εικόνα 3, θ αλλθλουχία είναι τμιμα του γονιδίου που μεταγράφεται ςτο rrna τθσ μικρισ υπομονάδασ του ριβοςϊματοσ που χρθςιμοποιείται ςτθ μετάφραςθ του ευκαρυωτικοφ γονιδίου τθσ εικόνασ 2. Ροια είναι θ μεταγραφόμενθ αλυςίδα του γονιδίου που μεταγράφεται ςτο rrna; Να γραφεί ο προςανατολιςμόσ τθσ. Να αιτιολογιςετε τισ απαντιςεισ ςασ. Ε. Στθν εικόνα 4, υπάρχει το ίδιο τμιμα DNA με τθν εικόνα 2, και με τα υπογραμμιςμζνα γράμματα φαίνεται θ αλλθλουχία των βάςεων ςτισ οποίεσ γίνεται γονιδιακι μετάλλαξθ προςκικθσ των τριϊν παρακάτω ςυνεχόμενων ηευγϊν βάςεων: 5 AGC 3 3 TCG 5.

7 7 Ροιο κα είναι το αποτζλεςμα τθσ μετάλλαξθσ αν θ προςκικθ γίνει: i) ςτθ κζςθ 1 ii) ςτθ κζςθ 2. ΘΕΜΑΣΑ Εςπερινό Θ ανάλυςθ τθσ αλλθλουχίασ των βάςεων ενόσ μορίου DNA ζδειξε ότι αυτό αποτελείται από 4800 νουκλεοτίδια με Αδενίνθ, 4280 με Κυτοςίνθ, 4530 με Θυμίνθ και 4610 με Γουανίνθ. Να εξθγιςετε αν αυτό το μόριο DNA μπορεί να αποτελεί γενετικό υλικό. 30. Στθν εικόνα 1 απεικονίηεται θ μεταβολι του πλθκυςμοφ των μικροοργανιςμϊν, τθσ ςυγκζντρωςθσ του κρεπτικοφ υλικοφ τθσ καλλιζργειασ, κακϊσ και τθσ ςυγκζντρωςθσ ενόσ τοξικοφ παραπροϊόντοσ του μεταβολιςμοφ των μικροοργανιςμϊν. Να αντιςτοιχίςετε τισ καμπφλεσ 1, 2, 3 ςτο κρεπτικό υλικό, ςτο τοξικό παραπροϊόν του μεταβολιςμοφ και ςτον πλθκυςμό των μικροοργανιςμϊν. ΘΕΜΑΣΑ ΕΠΑΝΑΛΗΠΣΙΚΕ Το φφλο ςτα κουνζλια κακορίηεται όπωσ και ςτον άνκρωπο. Πταν ζνα φυςιολογικό ςωματικό κφτταρο κθλυκοφ κουνελιοφ βρίςκεται ςτθ μετάφαςθ, το μικοσ του DNA του πυρινα του είναι 1,6m. Με βάςθ αυτά τα δεδομζνα, το μικοσ του ςυνολικοφ DNA του κάκε φυςιολογικοφ γαμζτθ αυτοφ του κουνελιοφ είναι: α) 1,6m, β) 0,4m, γ) 0,8m, δ) λίγο μεγαλφτερο από 0,4m. Α. Να γράψετε ςτο τετράδιό ςασ τθ ςωςτι απάντθςθ και να αιτιολογιςετε τθν επιλογι ςασ. Β. Σφμφωνα με τα δεδομζνα του ερωτιματοσ Α, κα είναι ίδιο ι όχι το ςυνολικό μικοσ του DNA όλων των φυςιολογικϊν γαμετϊν ενόσ αρςενικοφ κουνελιοφ, με το μικοσ του ςυνολικοφ DNA των φυςιολογικϊν γαμετϊν ενόσ κθλυκοφ κουνελιοφ; 32. Στθν Εικόνα 1 δίνεται ζνα τμιμα δίκλωνου DNA που περιζχει δφο (2) γονίδια (χωρίσ εςϊνια) τα οποία ζχουν τθν πλθροφορία για τθ ςφνκεςθ δφο (2) μικρϊν πεπτιδίων. A. Να γράψετε τθν αλλθλουχία των βάςεων τθσ κωδικισ αλυςίδασ αυτϊν των γονιδίων οι οποίεσ αντιςτοιχοφν ςτισ 5ϋ αμετάφραςτεσ περιοχζσ των μορίων mrna τα οποία προκφπτουν από τθν μεταγραφι αυτϊν των γονιδίων. Να αιτιολογιςετε τθν απάντθςι ςασ. B. Να δθλϊςετε ςε ποια από τισ κζςεισ Γ, Δ τθσ Εικόνασ 1, κα προςδεκεί θ RNA πολυμεράςθ, με τθ βοικεια μεταγραφικϊν παραγόντων, κατά τθ μεταγραφι τθσ γενετικισ πλθροφορίασ αυτϊν των γονιδίων και να αιτιολογιςετε τισ επιλογζσ ςασ. 33. Διαςταυρϊκθκαν δφο άτομα ενόσ είδουσ εντόμου με κεραίεσ ενδιάμεςου μικουσ και προζκυψαν 161 άτομα με κεραίεσ ενδιάμεςου μικουσ και 79 άτομα με κεραίεσ κανονικοφ μικουσ. Σε μία άλλθ διαςταφρωςθ, ενόσ ατόμου του ίδιου είδουσ εντόμου που είχε κεραίεσ ενδιάμεςου μικουσ με ζνα άτομο με κεραίεσ κανονικοφ μικουσ, προζκυψαν 121 άτομα με κεραίεσ κανονικοφ μικουσ και 119 άτομα με κεραίεσ ενδιάμεςου μικουσ. Με δεδομζνο ότι δεν ζγινε κάποια μετάλλαξθ, να εξθγιςετε τα αποτελζςματα των διαςταυρϊςεων αυτϊν, γράφοντασ τισ αντίςτοιχεσ διαςταυρϊςεισ. 34. Στθν Εικόνα 2 απεικονίηεται τμιμα DNA του βακτθρίου E.coli το οποίο επιδιορκϊνεται μεταξφ των ςθμείων Χ και Υ με τθ δράςθ τριϊν ενηφμων. Το πρϊτο ζνηυμο, ζνα ειδικό ζνηυμο, κόβει τθν αλυςίδα και απομακρφνει το κατεςτραμμζνο τμιμα τθσ αλυςίδασ. Στθ ςυνζχεια, το ζνηυμο Ι ειςζρχεται ςτο άνοιγμα που προκφπτει και προςκζτει νουκλεοτίδια για να ςυνκζςει το DNA που λείπει. Τα νουκλεοτίδια τοποκετοφνται ξεκινϊντασ από τθν κζςθ Χ και πθγαίνοντασ προσ τθ κζςθ Υ, όπωσ φαίνεται ςτθν Εικόνα 2. Το ζνηυμο ΙΙ ολοκλθρϊνει τθν επιδιόρκωςθ με τθ ςφνδεςθ του τμιματοσ DNA ςτθ κζςθ Y τθσ αρχικισ αλυςίδασ

8 8 A. Ροια είναι τα ονόματα των ενηφμων Ι και ΙΙ; Να εξθγιςετε ποια είναι τα 5ϋ, 3ϋ άκρα των δφο αλυςίδων του δοκζντοσ τμιματοσ DNA. B. Το επιδιορκωμζνο τμιμα του βακτθριακοφ DNA αντιγράφεται. Στθν Εικόνα 3 απεικονίηεται θ κθλιά αντιγραφισ που δθμιουργείται ςτθ κζςθ ζναρξθσ τθσ αντιγραφισ (Θ.Ε.Α.). Κατά τθν διάρκεια τθσ αντιγραφισ δθμιουργείται το πρωταρχικό τμιμα 5ϋ GCUGUAA 3ϋ ςτο τμιμα τθσ αλυςίδασ που αντιγράφεται ςυνεχϊσ. ςυγκεκριμζνθ μετάλλαξθ να επθρεάηει τθ κζςθ πρόςδεςθσ του trna με το αμινοξφ που μεταφζρει. Να εξθγιςετε ποιο κα είναι το αποτζλεςμα ςτθν παραγωγι του προθγοφμενου πεπτιδίου των δφο (2) αμινοξζων από τθν μετάλλαξθ ςτο γονίδιο του trna ςτο ςυγκεκριμζνο βακτθριακό ςτζλεχοσ τθσ E.coli. ΘΕΜΑΣΑ ΟΜΟΓΕΝΩΝ Στθν εικόνα 1 απεικονίηεται το γενεαλογικό δζνδρο οικογζνειασ ςτο οποίο μελετάται ο τρόποσ κλθρονόμθςθσ μιασ αςκζνειασ. Τα άτομα I3, I4 και ΙII2 πάςχουν. Οι φαινότυποι των ατόμων II1 και II2 είναι άγνωςτοι. Να μεταφζρετε ςτο τετράδιό ςασ τθ κθλιά τθσ Εικόνασ 3 και να δείξετε με βζλοσ ςε ποιεσ κζςεισ μπορεί να τοποκετθκεί το πρωταρχικό τμιμα που ςασ δόκθκε, με τθν αιχμι του βζλουσ να δείχνει τθν κατεφκυνςθ ςφνκεςθσ τθσ νζασ αλυςίδασ του DNA. Να αιτιολογιςετε τθν απάντθςι ςασ. Γ. Να εξθγιςετε πόςα υδροξφλια (-OH) μποροφν να ςυμμετάςχουν ςτθ δθμιουργία φωςφοδιεςτερικοφ δεςμοφ ςτο πρωταρχικό τμιμα 5ϋ GCUGUAA 3ϋ. Δ. Τμιμα του παραπάνω επιδιορκωμζνου κομματιοφ DNA τθσ Εικόνασ 2, φζρει τθν αλλθλουχία νουκλεοτιδίων που δίνεται ςτθν Εικόνα 4. Θ αλλθλουχία αυτι περιζχει μόνο ζνα γονίδιο που κωδικοποιεί μικρό πεπτίδιο οκτϊ (8) αμινοξζων: Σε βακτθριακό ςτζλεχοσ E.coli που περιζχει τθν παραπάνω αλλθλουχία (Εικόνα 4), ζγινε μετάλλαξθ αντικατάςταςθσ βάςθσ θ οποία είχε ωσ αποτζλεςμα να παράγεται πεπτίδιο που αντί για οκτϊ (8) αμινοξζα αποτελείται μόνο από δφο (2) αμινοξζα. Να εξθγιςετε ποια ιταν αυτι θ αντικατάςταςθ βάςθσ και ςε ποιο κωδικόνιο ζγινε. Ε. Στθ ςυνζχεια, ςτο ίδιο βακτθριακό ςτζλεχοσ E.coli γίνεται μια δεφτερθ μετάλλαξθ ςτο γονίδιο το οποίο κωδικοποιεί το trna, που ζχει το αντικωδικόνιο 5ϋ GUA 3ϋ και που μεταφζρει το αμινοξφ τυροςίνθ. Θ μετάλλαξθ αυτι ζχει ωσ αποτζλεςμα τθν αλλαγι του αντικωδικονίου ςε 5ϋ CUA 3ϋ, χωρίσ θ Α. Αν ςτο γενεαλογικό δζνδρο τθσ εικόνασ 1 μελετάται ο τρόποσ κλθρονόμθςθσ τθσ φαινυλκετονουρίασ, να βρεκοφν οι γονότυποι και οι φαινότυποι των ατόμων II1 και II2. Να αιτιολογιςετε με λόγια ι με διαςταυρϊςεισ τθν απάντθςι ςασ. Β. Αν ςτο γενεαλογικό δζνδρο τθσ εικόνασ 1 μελετάται ο τρόποσ κλθρονόμθςθσ τθσ αχρωματοψίασ ςτο πράςινο και ςτο κόκκινο, να βρεκοφν οι γονότυποι και οι φαινότυποι των ατόμων II1 και II2. Να αιτιολογιςετε με λόγια ι με διαςταυρϊςεισ τθν απάντθςι ςασ. Γονιμοποιείται φυςιολογικό ωάριο του κθλυκοφ ατόμου ΙΙ1, με ςπερματοηωάριο του αρςενικοφ ατόμου ΙΙ2 που απεικονίηονται ςτθν εικόνα 1. Κατά το ςχθματιςμό του ςπερματοηωαρίου αυτοφ δεν ζγινε διαχωριςμόσ των φυλετικϊν χρωμοςωμάτων κατά τθ 2θ μειωτικι διαίρεςθ. Τα αυτοςωμικά του χρωμοςϊματα διαχωρίςτθκαν φυςιολογικά. Γ. Να βρεκοφν οι πικανζσ χρωμοςωμικζσ ανωμαλίεσ ςτθ ςφςταςθ των φυλετικϊν χρωμοςωμάτων ςτο ηυγωτό που μπορεί να δθμιουργθκεί. Να αιτιολογιςετε τθν απάντθςι ςασ. Δ. Ροιο κα είναι το φφλο του ατόμου που κα προκφψει από το ηυγωτό, ςε κακεμία από τισ πικανζσ περιπτϊςεισ του ερωτιματοσ Γ3; 36. Το τμιμα βακτθριακοφ DNA τθσ εικόνασ 2 περιζχει γονίδιο που κωδικοποιεί ολιγοπεπτίδιο. Το ίδιο τμιμα DNA τθσ εικόνασ 2 μπορεί να κοπεί με μία περιοριςτικι ενδονουκλεάςθ Α θ οποία

9 9 αναγνωρίηει τθν αλλθλουχία και κόβει μεταξφ G-G, όπωσ φαίνεται ςτθν εικόνα 3. Α. Να γράψετε το τμιμα του βακτθριακοφ DNA που κα προκφψει μετά τθ δράςθ τθσ περιοριςτικισ ενδονουκλεάςθσ Α. Να ςθμειϊςετε τα 5ϋ και 3ϋ άκρα των αλυςίδων. Β. Να εξθγιςετε ποια από τισ αλυςίδεσ I ι II είναι θ κωδικι αλυςίδα του γονιδίου. Γ. Να γράψετε τον αρικμό των t-rna που κα χρθςιμοποιθκοφν για τθ μετάφραςθ του m-rna που προκφπτει από τθ μεταγραφι του γονιδίου τθσ εικόνασ 2. Να γράψετε τα αντικωδικόνια με τα ςωςτά άκρα των δυο πρϊτων t-rna που χρθςιμοποιικθκαν. Δ. Αν ςυμβεί αντικατάςταςθ βάςθσ ςτο 3ο νουκλεοτίδιο του 2ου κωδικονίου τθσ κωδικισ αλυςίδασ και θ κυτοςίνθ (C) αντικαταςτακεί με γουανίνθ (G), ποια κα είναι θ επίπτωςθ τθσ μετάλλαξθσ αυτισ ςτο γονιδιακό προϊόν; ΘΕΜΑΣΑ ΗΜΕΡΗΙΟΤ ΠΑΝΕΛΛΗΝΙΕ Να μεταφζρετε ςτο τετράδιό ςασ τθν αντιςτοιχία κακενόσ από τουσ αρικμοφσ I, II, III, IV, V, VI, VII τθσ εικόνασ 1 με μια από τισ παρακάτω ζννοιεσ: Α. φωςφορικι ομάδα Ε. υδροξφλιο Β. mrna ΣΤ. αμινομάδα Γ. μεταγραφόμενθ αλυςίδα Η. RNA πολυμεράςθ Δ. κωδικι αλυςίδα Θ. πυρθνικι μεμβράνθ 40. Να ςυγκρίνετε μια γονιδιωματικι βιβλιοκικθ από θπατικό κφτταρο με μία γονιδιωματικι βιβλιοκικθ από μυϊκό κφτταρο του ίδιου οργανιςμοφ για τθν καταςκευι των οποίων χρθςιμοποιικθκαν θ ίδια μζκοδοσ και τα ίδια ζνηυμα. Να ςυγκρίνετε τισ αντίςτοιχεσ cdna βιβλιοκικεσ. 41. Στο μαςτικό αδζνα ενόσ προβάτου υπάρχει ςυγκεκριμζνοσ κυτταρικόσ τφποσ ςτον οποίο εκφράηεται το γονίδιο τθσ καηεΐνθσ, μιασ πρωτεΐνθσ του γάλακτοσ. Θζλουμε να πάρουμε τθν πρωτεΐνθ α1-αντικρυψίνθ από το γάλα ενόσ διαγονιδιακοφ προβάτου. Για το λόγο αυτό ειςάγουμε μζςα ςτο γονίδιο τθσ καηεΐνθσ με κατάλλθλο προςανατολιςμό το γονίδιο τθσ α1-αντικρυψίνθσ. Να εξθγιςετε γιατί κα εκφραςτεί το γονίδιο τθσ α1-αντικρυψίνθσ ςτα κφτταρα του μαςτικοφ αδζνα. 42. Το τμιμα DNA, που απεικονίηεται ςτθν εικόνα 2, ζχει προκφψει μετά από επίδραςθ με ενδονουκλεάςθ EcoRΙ. Να ςθμειϊςετε τα 5ϋ και 3ϋ άκρα του, αιτιολογϊντασ τθν απάντθςι ςασ. Να εξθγιςετε αν είναι δυνατόν το ςυγκεκριμζνο τμιμα να κλωνοποιθκεί με τθ βοικεια πλαςμιδίου χρθςιμοποιϊντασ τεχνολογία αναςυνδυαςμζνου DNA. 43. Μια γυναίκα (Γ 1 ) παντρεφτθκε δφο διαφορετικοφσ άντρεσ (Σ 1 και Σ 2 ) και ζκανε δφο παιδιά (Ρ 1 και Ρ 2 ). Με τθ χριςθ μονοκλωνικϊν αντιςωμάτων ελζγχκθκε θ παρουςία (+) των αντιγόνων Α, Β ςτα μζλθ τθσ οικογζνειασ. Με βάςθ τα δεδομζνα του παρακάτω πίνακα να εξθγιςετε ποιοσ είναι ο πατζρασ (Σ 1 ι Σ 2 ) του κάκε παιδιοφ (Ρ 1 και Ρ 2 ). Θ εικόνα 1 αντιςτοιχεί ςε προκαρυωτ ικό ι ςε ευκαρυωτικ ό κ φ τ τ α ρ ο ; Να α ι τ ι ο λ ο γ ι ς ε τ ε τ θ ν απά ντ θ ς ι ς α σ. 39. Κατά τθν ζναρξθ τθσ κφθςθσ ο οργανιςμόσ τθσ εγκυμονοφςασ παράγει μια ειδικι ορμόνθ, τθ χοριακι γοναδοτροπίνθ. Να περιγράψετε τθ διαδικαςία παραγωγισ μονοκλωνικϊν αντιςωμάτων που κα μποροφςαν να χρθςιμοποιθκοφν ςε διαγνωςτικοφσ ελζγχουσ (τεςτ) κφθςθσ. 44. Σε μία καλλιζργεια βακτθρίων E.coli προςτίκεται μετά από εξάντλθςθ τθσ πθγισ C λακτόηθ.στθν εικόνα 3 δείχνεται θ μεταβολι τθσ ποςότθτασ του mrna ςε ςυνάρτθςθ με το χρόνο.

10 10 Θ προςκικθ τθσ λακτόηθσ πραγματοποιικθκε τθ χρονικι ςτιγμι t 1. Να αιτιολογιςετε τθν αφξθςθ του mrna. 45. Στθν εικόνα 4 δίνονται τρεισ (3) νουκλεοτιδικζσ αλλθλουχίεσ, οι οποίεσ αποτελοφν τμιμα του 1ου εξωνίου τριϊν διαφορετικϊν αλλθλομόρφων τθσ β- αλυςίδασ τθσ HbA. Θ β-αλυςίδα τθσ HbA αποτελείται από 146 αμινοξζα και δίνεται ότι υφίςταται μεταμεταφραςτικι τροποποίθςθ κατά τθν οποία απομακρφνεται το πρϊτο αμινοξφ από το αμινικό άκρο. αντιγραφισ, φωςφορικι ομάδα, αλυςίδα DNA που ςυντίκεται με ςυνεχι τρόπο. Να ςθμειωκεί ότι ζνασ όροσ περιςςεφει. Σε ποιο ι ποια οργανίδια ενόσ ευκαρυωτικοφ κυττάρου πραγματοποιείται θ διαδικαςία τθσ αντιγραφισ του μορίου DNA που απεικονίηεται ςτθν Εικόνα 1; α. Ροια από τισ αλλθλουχίεσ τθσ εικόνασ 4 αντιςτοιχεί ςτο φυςιολογικό γονίδιο τθσ β-αλυςίδασ τθσ HbA και ποια ςτο γονίδιο β s τθσ δρεπανοκυτταρικισ αναιμίασ. Να αιτιολογιςετε τθν απάντθςθ ςασ. β. Θ αλλθλουχία τθσ εικόνασ 4 που απομζνει κα μποροφςε να αντιςτοιχεί ςε γονίδιο που προκαλεί β-καλαςςαιμία; Να αιτιολογιςετε τθν απάντθςθ ςασ. γ. Θ αλλθλουχία III τθσ εικόνασ 4 είναι τμιμα ενόσ μορίου DNA, που αντιγράφεται ςε μια διχάλα αντιγραφισ, ςτθν οποία ςυμμετζχουν τα εξισ πρωταρχικά τμιματα: i) 5ϋ AAAUGGU 3ϋ, ii) 5ϋ CUCCUC 3ϋ και iii) 5ϋ ACGCCA 3ϋ γ 1. Να εντοπίςετε αν θ κζςθ ζναρξθσ τθσ διχάλασ αντιγραφισ βρίςκεται ςτθ κζςθ Χ ι ςτθ κζςθ Υ. γ 2. Ροια αλυςίδα (Α ι Β) ςτθ διχάλα αντιγραφισ αντιγράφεται ςυνεχϊσ και ποια αςυνεχϊσ; γ 3. Ροιο από τα πρωταρχικά τμιματα τθσ αςυνεχοφσ αλυςίδασ ςυντίκεται πρϊτο; (Στα παραπάνω ερωτιματα δεν απαιτείται αιτιολόγθςθ.) δ. Ροιοι οι πικανοί γονότυποι των απογόνων που προκφπτουν από τθ διαςταφρωςθ φορζα β- καλαςςαιμίασ με φορζα δρεπανοκυτταρικισ αναιμίασ; Να γράψετε ςτο τετράδιό ςασ τθν κατάλλθλθ διαςταφρωςθ. ΘΕΜΑΣΑ ΕΠΑΝΑΛΗΠΣΙΚΩΝ Στθν Εικόνα 1 απεικονίηεται θ διαδικαςία τθσ αντιγραφισ ενόσ μορίου DNA. Να μεταφζρετε ςτο τετράδιο ςασ τθν αντιςτοιχία των γραμμάτων Α, Β, Γ, Δ, Ε, Η με τουσ όρουσ που ακολουκοφν: υποκινθτισ, υδροξφλιο, τμιμα αλυςίδασ DNA που ςυντίκεται με αςυνεχι τρόπο, πρωταρχικό τμιμα, κζςθ ζναρξθσ 47. Ροια από τα παρακάτω είναι δυνατόν να παρατθρθκοφν με οπτικό μικροςκόπιο και ποια μόνο με θλεκτρονικό; α) νουκλεοςϊματα β) μεταφαςικό χρωμόςωμα γ) πολφςωμα δ) κθλιά ζναρξθσ αντιγραφισ ε) δρεπανοκφτταρα. 48. Σε ζνα ςυγκεκριμζνο πλθκυςμό τρωκτικϊν παρατθρικθκαν τρεισ διαφορετικοί φαινότυποι όςον αφορά το χρϊμα του τριχϊματοσ: καςτανό, γκρι και μαφρο. Ρραγματοποιικθκαν τυχαίεσ διαςταυρϊςεισ μεταξφ των τρωκτικϊν και τα αποτελζςματα εμφανίηονται ςτον παρακάτω πίνακα: α. Ρϊσ κλθρονομείται το χρϊμα τριχϊματοσ ςτα ςυγκεκριμζνα τρωκτικά; β. Ροιοι γονότυποι αντιςτοιχοφν ςε κάκε φαινότυπο; γ. Ροιοι είναι οι φαινότυποι των γονζων από τθ διαςταφρωςθ των οποίων προζκυψαν 1 μαφροσ, 1 καςτανόσ και 1 γκρι απόγονοσ; Να ςθμειωκεί ότι: i) τα αναφερόμενα γονίδια εδράηονται ςε αυτοςωμικά χρωμοςϊματα ii) ο αρικμόσ απογόνων είναι μεγάλοσ και επιτρζπει τθ ςτατιςτικι επεξεργαςία iii) δεν λαμβάνεται υπόψθ θ περίπτωςθ μετάλλαξθσ.

11 Μερικζσ φορζσ είναι δυνατόν να ςυμβεί μθ διαχωριςμόσ χρωμοςωμάτων ςε ζναν φυςιολογικό γονζα, που κα ζχει ωσ αποτζλεςμα ζναν ανευπλοειδικό απόγονο. Συχνά ο φαινότυποσ του μθ φυςιολογικοφ απογόνου επιτρζπει ςτουσ γενετιςτζσ να προςδιορίςουν ςε ποιο γονζα και κατά τθ διάρκεια ποιασ μειωτικισ διαίρεςθσ ςυνζβθ ο μθ διαχωριςμόσ. Σε μία οικογζνεια που και οι δυο γονείσ ζχουν φυςιολογικό διπλοειδι καρυότυπο, ο άνδρασ παρουςιάηει ζλλειψθ του ενηφμου Α λόγω του ότι είναι ομόηυγοσ για το υπολειπόμενο γονίδιο που κωδικοποιεί το ζνηυμο αυτό. Το γονίδιο εντοπίηεται ςτο χρωμόςωμα 21. Θ γυναίκα του, που είναι ετερόηυγθ, παράγει 100 μονάδεσ του ενηφμου Α. Ο γιοσ τουσ ζχει ςφνδρομο Down και παράγει 200 μονάδεσ του ενηφμου Α. Σε ποιον γονζα ςυνζβθ ο μθ διαχωριςμόσ ποια μειωτικι διαίρεςθ; Να αιτιολογιςετε τθν απάντθςι ςασ. 50. Ζςτω γονίδιο Χ (αςυνεχζσ) που κωδικοποιεί μια φαρμακευτικι πρωτεΐνθ θ οποία εκφράηεται ςε ζνα ανκρϊπινο κυτταρικό τφπο. Επιδιϊκοντασ τθν κλωνοποίθςθ του γονιδίου αυτοφ, ςυνκζτουμε το δίκλωνο cdna του γονιδίου όπωσ φαίνεται ςτθν Εικόνα 2. Το δίκλωνο cdna φζρει ςτα άκρα του και εκτόσ των περιοχϊν του γονιδίου, κζςεισ που αναγνωρίηουν δυο περιοριςτικζσ ενδονουκλεάςεσ (Ε1 και Ε3), οι οποίεσ, όταν επιδράςουν ςτο δίκλωνο cdna, αφινουν τα μονόκλωνα άκρα που φαίνονται ςτθν Εικόνα 2. α. Ροιεσ είναι οι αλλθλουχίεσ των 6 ηευγϊν βάςεων που αναγνωρίηει θ κάκε μια από τισ περιοριςτικζσ ενδονουκλεάςεσ (Ε1 και Ε3) που χρθςιμοποιικθκαν; β. Ροια από τα παρακάτω δεν υπάρχουν ςτο cdna του γονιδίου Χ; 1) υποκινθτισ 2) εξϊνια 3) εςϊνια 4) 5ϋ αμετάφραςτθ περιοχι 5) 3ϋ αμετάφραςτθ περιοχι. γ. Θζλουμε να ενςωματϊςουμε το cdna του γονιδίου Χ ςτο πλαςμίδιο τθσ Εικόνασ 3. Το πλαςμίδιο περιζχει τισ κζςεισ που αναγνωρίηουν οι περιοριςτικζσ ενδονουκλεάςεσ Ε1, Ε2, Ε3 και Ε4. Στισ κζςεισ Amp και Kan του πλαςμιδίου βρίςκονται τα γονίδια ανκεκτικότθτασ ςτα αντιβιοτικά αμπικιλίνθ και καναμυκίνθ, αντίςτοιχα. Στθν Εικόνα 4 που ακολουκεί απεικονίηονται οι ειδικζσ αλλθλουχίεσ DNA που αναγνωρίηονται από τισ περιοριςτικζσ ενδονουκλεάςεσ Ε2 και Ε4 και με τα βζλθ υποδθλϊνονται οι κζςεισ που κόβονται οι αλυςίδεσ. Ροιο ι ποια ζνηυμα κα χρθςιμοποιιςουμε για να κόψουμε το πλαςμίδιο ζτςι ϊςτε να ενςωματϊςει το DNA τθσ Εικόνασ 2 και να επιτφχουμε τθν ζκφραςθ του από τον υποκινθτι του πλαςμιδίου τθσ Εικόνασ 3; (Να αιτιολογιςετε τθν απάντθςθ ςασ. ) δ. Στθ ςυνζχεια τθσ διαδικαςίασ κλωνοποίθςθσ του γονιδίου μεταςχθματίηουμε κφτταρα του βακτθρίου E. coli (Escherichia coli). Τα μιςά από αυτά τα κφτταρα καλλιεργοφνται ςε κρεπτικό υλικό που περιζχει το αντιβιοτικό αμπικιλίνθ (Εικόνα 5, καλλιζργεια Α) και τα άλλα μιςά ςε κρεπτικό υλικό που περιζχει το αντιβιοτικό καναμυκίνθ (Εικόνα 5, καλλιζργεια Β). Να εξθγιςετε τα αποτελζςματα τθσ ανάπτυξθσ των καλλιεργειϊν Α και Β όπωσ αυτά απεικονίηονται ςτθν Εικόνα 5.

12 Απομονϊςαμε το παρακάτω μόριο mrna από το κυτταρόπλαςμα ενόσ κυττάρου: α. Ρόςα διαφορετικά πεπτίδια κα ςυντεκοφν αν μεταφραςτεί το ςυγκεκριμζνο mrna; Να αιτιολογιςετε τθν απάντθςι ςασ. β. Ροιοσ είναι ο ρόλοσ των αμετάφραςτων αλλθλουχιϊν: Αμετάφρ-Χ1, Αμετάφρ-Χ2, Αμετάφρ-Χ3; γ. Να εξθγιςετε αν το μόριο αυτό του mrna απομονϊκθκε από προκαρυωτικό ι ευκαρυωτικό κφτταρο. δ. Σε κάκε μία από τισ παρακάτω εικόνεσ 1 και 2 απεικονίηεται ζνα μόριο mrna, που μεταφράηεται από ριβοςϊματα. Να εξθγιςετε αν το ςχιμα κάκε εικόνασ κα μποροφςε να αφορά ευκαρυωτικό κφτταρο ι προκαρυωτικό κφτταρο. ΘΕΜΑΣΑ ΟΕΦΕ Ο καρυότυποσ κθλυκισ δροςόφιλασ διακζτει 16 χρωματίδεσ. α. Ροιοσ είναι ο αρικμόσ των χρωμοςωμάτων ςε ςωματικό κφτταρο και ποιοσ ςε γαμζτθ ; β. Ρόςα από αυτά είναι αυτοςωμικά και πόςα φυλετικά (το φφλο κακορίηεται όπωσ ςτον άνκρωπο) ; γ.ρόςα μόρια διακζτει ζνα κφτταρο τθσ δροςόφιλασ κατά τθ μεςόφαςθ ; 53.Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι και να αιτιολογιςετε κάκε επιλογι ςασ με τθν κατάλλθλθ διαςταφρωςθ. τιλθ-ι 1.Αυτοςωμικι επικρατισ κλθρονομικότθτα 2. Αυτοςωμικι υπολειπόμενθ κλθρονομικότθτα 3.Φυλοςφνδετθ κλθρονομικότθτα τιλθ-ιι α. Ζνα παιδί ζχει 25% πικανότθτα να πάςχει από 2 υγιείσ γονείσ αλλά και φορείσ του γονιδίου β. Μία υγιισ γυναίκα και φορζασ του γονιδίου τθσ αςκζνειασ με υγιι άνδρα αποκτά αςκενζσ αγόρι. γ.2 αςκενείσ γονείσ αποκτοφν υγιζσ τζκνο 54.Ζνα υγιζσ ηευγάρι απζκτθςε τρία παιδιά : 1 ο αγόρι με κυαμιςμό, 2 ο κορίτςι υγιζσ και 3 ο αγόρι υγιζσ. Ο κυαμιςμόσ είναι μία αςκζνεια που ςχετίηεται με διαταραχι ςτο μεταβολιςμό που οφείλεται ςε μεταλλαγμζνο αλλθλόλομορφο γονίδιο του φυςιολογικοφ. Μετά από ανάλυςθ DNA με τθ χριςθ περιοριςτικισ ενδονουκλεάςθσ ςτο τμιμα DNA που εδράηουν το φυςιολογικό και το μεταλλαγμζνο αλλθλόμορφο είχαμε τα παρακάτω αποτελζςματα: Διαφορετικά τμιματα που προζκυψαν μετά τθ Άτομο τθσ οικογζνειασ χριςθ τθσ περιοριςτικισ ενδονουκλεάςθσ Ρατζρασ Τμιμα η.β. Μθτζρα Τμιμα η.β. Τμιμα η.β. Τμιμα η.β. 1 ο αγόρι Τμιμα η.β. Τμιμα η.β. κορίτςι Τμιμα η.β. 2 ο αγόρι Τμιμα η.β α. Να βρεκεί ο τρόποσ κλθρονόμθςθσ τθσ αςκζνειασ. β. Να ςχεδιαςτεί το γενεαλογικό δζνδρο τθσ οικογζνειασ. γ. Να βρείτε τουσ γονότυπουσ των μελϊν τθσ οικογζνειασ δ. Να υπολογίςετε τθν πικανότθτα ζνα 4 ο παιδί τθσ οικογζνειασ να πάςχει από κυαμιςμό. 55.Σασ δίνεται ϊριμο mrna που απομονϊκθκε από ανκρϊπινο κφτταρο με ςκοπό τθ δθμιουργία c-dna βιβλιοκικθσ. Το mrna κωδικοποιεί τθ ςφνκεςθ ενόσ πενταπεπτιδίου. 5ϋ-GAGUUCAUGGGACCCGAUGAGUGAGAGUUC-3ϋ α. Να γράψετε το δίκλωνο cdna που παράγεται με τθ βοικεια του παραπάνω ϊριμου mrna. β. Το δίκλωνο τμιμα DNA πρζπει να ενςωματωκεί ολόκλθρο ςε αναςυνδυαςμζνο πλαςμίδιο με τθ χριςθ τθσ EcoRI, το δίκλωνο τμιμα DNA δε διακζτει υποκινθτι, να προςκζςετε τα απαραίτθτα μονόκλωνα άκρα ςτο τμιμα DNA ϊςτε να ενςωματωκεί ςτο πλαςμίδιο. γ. Θ παρακάτω αλλθλουχία αποτελεί τμιμα του πλαςμιδίου όπου κα ενςωματωκεί το δίκλωνο cdna. CGTGGAATTCTAT GCACCTTAAGATA Ο υποκινθτισ είναι : CGTGG GCACC Το πλαςμίδιο κόβεται από τθν EcoRI. Να γράψετε τον προςανατολιςμό των αλυςίδων και τα άκρα του πλαςμιδίου μετά τθ δράςθ τθσ EcoRI.

13 13 δ. Το δίκλωνο cdna του ερωτιματοσ β αναμιγνφεται με τθ δράςθ τθσ DNA-δεςμάςθσ με το πλαςμίδιο του ερωτιματοσ γ. Να αναγράψετε τα δφο διαφορετικά αναςυνδυαςμζνα πλαςμίδια που κα προκφψουν, αιτιολογϊντασ ποιο από τα δφο μπορεί μζςα ςε βακτιριο να παράγει το πενταπεπτίδιο. ε. Να αναφζρεται ποια γονίδια δεν μποροφν να υπάρξουν ςε μία c-dna βιβλιοκικθ που δθμιουργικθκε από ζνα ςυγκεκριμζνο τφπο κυττάρου. 56.Με τθν αποδιάταξθ του γενετικοφ υλικοφ ςωματικοφ ανκρωπίνου κυττάρου, πόςεσ αλυςίδεσ κα προκφψουν ; 57.Δίνονται 2 πλθκυςμοί αμιγϊν ςτελεχϊν δροςόφιλασ.το ζνα ςτζλεχοσ διακζτει λευκά μάτια,ενϊ το άλλο κόκκινα μάτια. Το γονίδιο για τα κόκκινα μάτια επικρατεί του γονιδίου που είναι υπεφκυνο για τα λευκά μάτια. Να βρείτε μία διαςταφρωςθ που αποκαλφπτει από τα αποτελζςματά τθσ αν το γονίδιο είναι αυτοςωμικό ι φυλοςφνδετο. 58.Για τον εντοπιςμό των γονιδίων που είναι υπεφκυνα για τισ αςκζνειεσ μυϊκι δυςτροφία Duchenne και του Alzheimer χρθςιμοποιοφμε ειδικοφσ ανιχνευτζσ που υβριδοποιοφν τα αντίςτοιχα γονίδια ςτον καρυότυπο ενόσ ανκρϊπου. Χρθςιμοποιοφμε τον ανιχνευτι Duc και τον ανιχνευτι Alz ςτουσ παρακάτω καρυότυπουσ : Είδοσ καρυότυπου Θζςεισ υβριδιςμοφ Φυςιολογικόσ 4 Duc-4Alz Turner 2 Duc-4Alz Down 4Duc-6Alz Klinefelter 4 Duc-4Alz Σασ δίνονται παρακάτω και 2 γενεαλογικά δζνδρα τθσ ίδιασ οικογζνειασ όπου εμφανίηονται οι παρακάτω αςκζνειεσ. Τα άτομα ΙΙ-3 και ΙΙ-4 ενδζχεται να αποκτιςουν παιδί με μυϊκι δυςτροφία Duchenne (φυςιολογικόσ καρυότυποσ) α. Να εξθγιςετε αν το ηεφγοσ ΙΙ-3 ΙΙ-4 μπορεί να αποκτιςει κθλυκό άτομο με ςφνδρομο Turner και μυϊκι δυςτροφία. β. Να βρείτε τθν πικανότθτα το ηεφγοσ ΙΙ-3 ΙΙ-4 να αποκτιςει αγόρι που να πάςχει και από τισ 2 αςκζνειεσ. ΕΠΑΝΑΛΗΠΣΙΚΑ ΘΕΜΑΣΑ 59. Στθν οικογζνεια του παρακάτω γενεαλογικοφ δζνδρου εμφανίςτθκε ςτα μαυριςμζνα άτομα κλθρονομικι αςκζνεια που κλθρονομείται ωσ Μενδελικόσ μονογονιαδιακόσ χαρακτιρασ. α. Να υπολογιςκεί θ πικανότθτα απόκτθςθσ αςκενοφσ τζκνου των γονζων ΙΙ 1 ΙΙ 2. β. Να υπολογιςκεί θ πικανότθτα απόκτθςθσ αςκενοφσ τζκνου των γονζων ΙΙ 3 ΙΙ 4 γ. Να υπολογιςκεί θ πικανότθτα να ςυμβεί το ενδεχόμενο του γενεαλογικοφ δζνδρου δθλαδι δφο υγιείσ γονείσ να αποκτιςουν αρχικά υγιι υιό και ςτθ ςυνζχεια αςκενι κόρθ. 60. Σε γεννθτικό κφτταρο ενόσ ανκρϊπου από το οποίο με τθν διαδικαςία τθσ μείωςθσ προκφπτουν οι γαμζτεσ ςυνζβθ θ αμοιβαία μετατόπιςθ που δείχνεται παρακάτω : Χρωμόςωμα-1 (Φυςιολογικό) ΑΒΓΔΕΗΘΘ

14 14 Χρωμόςωμα-1ϋ(Μθ φυςιολογικό) ΑΒΓΔΕΛΜΝ Χρωμόςωμα-2(Φυςιολογικό) ΙΚΛΜΝ Χρωμόςωμα-2ϋ(Μθ φυςιολογικό) ΙΚΗΘΘ Τα χρωμοςϊματα 1ϋ και 2 προζκυψαν μετά από αμοιβαία μετατόπιςθ. Να εξθγιςετε : α. Ρωσ μπορεί ο ςυγκεκριμζνοσ άνκρωποσ με ζναν απολφτωσ φυςιολογικό ςφντροφο να αποκτιςει φυςιολογικό παιδί; β. Σε ποιεσ περιπτϊςεισ ο ςυγκεκριμζνοσ άνκρωποσ με ζναν απολφτωσ φυςιολογικό ςφντροφο να αποκτιςει μθ φυςιολογικό τζκνο και ποιο πρόβλθμα κα εμφανίηεται ςε κάκε περίπτωςθ ; 61. Σασ δίνονται 3 υποκετικά γονίδια Γονίδιο-1: TTTTTTATTTGGGCTAACCGAATTGGGCCCCATCTC AAAAAATAAACCCGATTGGCTTAACCCGGGGTAGAG Υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-gly-pro-arg-leu-lys-cooh Γονίδιο-2: AAATTTAGTATACAAGGGACTACTGAAGGGAAACAGTAGG TTTAAATCATATGTTCCCTGATGACTTCCCTTTGTCATCC Υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου: ΝΘ 2 -met-thr-asn-his-his-ile-cooh Γονίδιο-3: AATTCTATTTCTGCTCCGGAAACATGGCC TTAAGATAAAGACGAGGCCTTTGTACCGG Υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-phe-pro-glu-gln-lys-cooh α. Να βρεκεί θ κωδικι και θ μθ κωδικι αλυςίδα και των τριϊν γονιδίων. β. Να βρεκεί ποιο από τα τρία γονίδια είναι ςυνεχζσ. γ. Να βρεκοφν τα εςϊνια ςτο δίκλωνο τμιμα DNA ςτα 2 αςυνεχι γονίδια δ. Μετά από χρωμοςωμικζσ ανωμαλίεσ μεταξφ δφο γονιδίων είχαμε τθν παραγωγι των παρακάτω χιμαιρικϊν πρωτεϊνϊν : ΝΘ 2 -met-gly-pro-met-phe-pro-arg-leu-lys-cooh NH 2 -met-gly-pro-leu-phe-leu-leu-arg-leu-lys-cooh Κάνοντασ χριςθ του γενετικοφ κϊδικα του ςχολικοφ βιβλίου να βρείτε τισ χρωμοςωμικζσ ανωμαλίεσ που ςυνζβθςαν μεταξφ των γονιδίων. 62. Ι. Το μιτοχονδριακό DNA είναι : α. Μθτρικισ προζλευςθσ β. Ρατρικισ προζλευςθσ γ. Μιςό πατρικισ και μιςό μθτρικισ προζλευςθσ. Να επιλζξετε τθ ςωςτι απάντθςθ αιτιολογϊντασ τθν επιλογι ςασ. ΙΙ. Ρρόςφατα ςτθν Αγγλία γεννικθκε ζνα παιδί-α με ελαττωματικά μιτοχονδριακά γονίδια.το αποτζλεςμα είναι καχεξία, μυϊκι δυςτροφία και μθ φυςιολογικι ανάπτυξθ του εγκεφάλου. Το παιδί-α πολφ δφςκολα κα καταφζρει να επιηιςει. Θ ςοβαρι αυτι αςκζνεια κλθρονομικθκε ςτο παιδί-α..: α. Από τθ μθτζρα του αποκλειςτικά β. Από τον πατζρα του αποκλειςτικά γ. Και από τθ μθτζρα του και από τον πατζρα του. Να επιλζξετε τθ ςωςτι απάντθςθ αιτιολογϊντασ τθν επιλογι ςασ. ΙΙΙ. Ραράλλθλα τθν ίδια χρονικι περίοδο με τθ γζννθςθ του παιδιοφ ςτθν Αγγλία που αναφζρκθκε παραπάνω,ςτο Μεξικό γεννικθκε ζνα παιδί-δ με τθν διαδικαςία που περιγράφεται παρακάτω: «Από το ωάριο γυναίκασ-α που γονιμοποιικθκε φυςιολογικά από το ςπερματοηωάριο άνδρα-β, αφαιρζκθκε ο πυρινασ και τοποκετικθκε ςε απφρθνο ωάριο γυναίκασ-γ, το οποίο μεταφζρκθκε ςτθ μιτρα τθσ. Θ γυναίκα-γ κυοφόρθςε με επιτυχία το ζμβρυο με αποτζλεςμα τθ γζννθςθ του παιδιοφ-δ». Το παιδί-δ διακζτει γενετικό υλικό: α. Από τθ γυναίκα-α και τον άνδρα-β β. Από τθ γυναίκα-γ και τον άνδρα-β γ. Από τθ γυναίκα-α, τθ γυναίκα-γ και τον άνδρα-β Να επιλζξετε τθ ςωςτι απάντθςθ, αιτιολογϊντασ τθν επιλογι ςασ. IV. Είναι ςωςτόσ ο ιςχυριςμόσ ότι αν θ μζκοδοσ που εφαρμόςτθκε κατά τθ γζννθςθ του παιδιοφ-δ ςτο Μεξικό είχε εφαρμοςτεί ςτο παιδί-α ςτθν Αγγλία,το παιδί-α δεν κα είχε εμφανίςει τα ςυμπτϊματα τθσ βαριάσ κλθρονομικισ αςκζνειασ που εμφάνιςε; α. Πχι β. Ναι Να επιλζξετε τθ ςωςτι απάντθςθ αιτιολογϊντασ τθν επιλογι ςασ. 63. Δίνεται τμιμα γονιδίου που είναι υπεφκυνο για τθ βιοςφνκεςθ του trna που αποτελεί τμιμα του ςυμπλόκου ζναρξθσ τθσ πρωτεϊνοςφνκεςθσ. Το τμιμα του γονίδιου που ςασ δίδεται κωδικοποιεί τθν ειδικι κζςθ πρόςδεςθσ του trna ςτο ςφμπλοκο ζναρξθσ τθσ πρωτεϊνοςφνκεςθσ. α. Να βρείτε τθν κωδικι και τθ μθ κωδικι αλυςίδα του γονιδίου αιτιολογϊντασ τθν απάντθςθ ςασ.

15 15 β. Να βρείτε τθ κζςθ ( Ι ι ΙΙ ) που ςυνδζεται ο υποκινθτισ. γ. Να βρείτε τθν κατεφκυνςθ τθσ μεταγραφισ ( α ι β) 64. Θ 5ϋ αμετάφραςτθ περιοχι ενόσ mrna ακριβϊσ πριν το κωδικόνιο ζναρξθσ αποτελείται αποκλειςτικά από πουρίνεσ (A και G ). Σασ δίνεται τμιμα γονιδίου rrna που ςυμμετζχει ςτο ςχθματιςμό τθσ μικρισ υπομονάδασ του ριβοςϊματοσ που με τθν ςειρά τθσ είναι τμιμα του ςυμπλόκου ζναρξθσ τθσ πρωτεϊνοςφνκεςθσ που αφορά το παραπάνω mrna. Γονίδιο: Αλυςίδα-(α) GGGAGGGAGGAGGGGTGCATGTCA CCCTCCCTCCTCCCCΑCGTACAGT Αλυςίδα-(β) Aν ςτο τμιμα του γονιδίου που ςασ δίνεται κωδικοποιείται και το τμιμα του rrna που είναι υπεφκυνο για τθν πρόςδεςθ τθσ μικρισ υπομονάδασ του ριβοςϊματοσ ςτο mrna. Α. Να τοποκετιςετε τα άκρα ςτισ 2 αλυςίδεσ Β. Να βρείτε τθν κωδικι και μθ κωδικι αλυςίδα του γονιδίου Γ. Να ςθμειϊςετε με βζλοσ τθ κζςθ του υποκινθτι. Δ. Να ςθμειϊςετε με τον κατάλλθλο ςυμβολιςμό τθ κατεφκυνςθ τθσ μεταγραφισ. 65. Ζνα εςϊνιο ξεκινά από τθν αλλθλουχία 5-GU-3ϋ και τελειϊνει με τθν αλλθλουχία 5ϋ-AG-3ϋ όπου αναγνωρίηεται από το snrna με βάςθ τον κανόνα τθσ ςυμπλθρωματικότθτασ, επίςθσ ςτο 3ϋ του άκρου υπάρχει μία περιοχι που αποτελείται αποκλειςτικά από πυριμιδίνεσ ( C και U ) θ οποία ομοίωσ αναγνωρίηεται από το snrna με βάςθ τον κανόνα τθσ ςυμπλθρωματικότθτασ. Αλυςίδα-Ι -GTCCGATAGCTGAATTTCCTTCTCAG- -CAGGCTATCGACTTAAAGGAAGAGTC- Αλυςίδα-ΙΙ Α. Να τοποκετιςετε τα άκρα ςτισ 2 αλυςίδεσ. Β. Να βρείτε τθν κωδικι και μθ κωδικι αλυςίδα του γονιδίου. Γ. Να ςθμειϊςετε με βζλοσ τθ κζςθ του υποκινθτι Δ. Να ςθμειϊςετε με βζλοσ τθν κατεφκυνςθ τθσ μεταγραφισ. Ε. Να αναγράψετε το μόριο snrna που προκφπτει από τθ μεταγραφι του παραπάνω γονιδίου. 66. Σασ δίνεται παρακάτω τμιμα ενόσ γονίδιου μιτοχονδριακοφ DNA που είναι υπεφκυνο για τθ βιοςφνκεςθ ενόσ πεπτιδίου. Το ςυγκεκριμζνο τμιμα είναι υπεφκυνο για τθν προςκικθ των 4 τελευταίων αμινοξζων του πεπτιδίου που θ αλλθλουχία τουσ είναι: ΝΘ2-.-τρυπτοφάνθ-τρυπτοφάνθ-μεκειονίνθμεκειονίνθ-COOH Να αιτιολογιςετε το αποτζλεςμα με βάςθ τα κατάλλθλα χαρακτθριςτικά του γενετικοφ κϊδικα. 67. Φυςιολογικό γονίδιο που είναι υπεφκυνο για τθ βιοςφνκεςθ μίασ πολυπεπτιδικισ αλυςίδασ ςτον άνκρωπο διακζτει μεταλλαγμζνο αλλθλόμορφο γονίδιο που είναι υπεφκυνο για τθν βιοςφνκεςθ μίασ παραλλαγισ τθσ φυςιολογικισ πολυπεπτιδικισ αλυςίδασ που διαφζρει από τθ φυςιολογικι κατά ζνα αμινοξφ. 2 φυςιολογικοί γονείσ όςον αφορά τθν κλινικι τουσ εικόνα αποκτοφν τζκνο με αςκζνεια που οφείλεται ςτο γεγονόσ ότι το ςυγκεκριμζνο παιδί παράγει αποκλειςτικά τθ μθ φυςιολογικι πολυπεπτιδικι αλυςίδα. Και ςτουσ δυο γονείσ μετά από βιοχθμικό ανάλυςθ υπιρξε το κοινό αποτζλεςμα ότι και οι δυο παράγουν κατά 50% τθ φυςιολογικι πολυπεπτιδικι αλυςίδα και κατά 50% τθ μθ φυςιολογικι. Α. Να βρεκεί θ ςχζςθ των δφο αλλθλόμορφων γονιδίων. Β. Οι δφο γονείσ ςκοπεφουν να αποκτιςουν και δεφτερο παιδί. Ρροφανϊσ καταφεφγουν ςε ειδικό επιςτιμονα για γενετικι κακοδιγθςθ. Να βρεκεί το αποτζλεςμα αυτισ: α. Πςον αφορά τθ πικανότθτα και το δεφτερο παιδί να πάςχει από τθν αςκζνεια. β. Πςον αφορά τθ πικανότθτα το δεφτερο τουσ παιδί ενδεχομζνωσ να φζρει το μεταλλαγμζνο αλλθλόμορφο χωρίσ να αςκενεί. γ. Τθν πικανότθτα το πικανό εγγόνι τουσ ςε καμία περίπτωςθ να μθν κλθρονομιςει τθν αςκζνεια.

16 Σασ δίνεται μία αλυςίδα ενόσ ςυνεχοφσ γονιδίου : Αλυςίδα : CTTAAGTACAATTTAAATTTAGGGCCGCCCCGCCCGATCC TTAAG. Το γονίδιο είναι υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-leu-asn-leu-asn-pro-gly-gly-ala-gly-cooh. Κάνοντασ χριςθ του γενετικό κϊδικα του ςχολικοφ. Α. Να γράψετε το δίκλωνο τμιμα που είναι υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου κακϊσ και να ςθμειϊςετε τα άκρα ςτισ δφο αλυςίδεσ. Β. Να χαρακτθρίςετε τισ δφο αλυςίδεσ ωσ κωδικι και μθ κωδικι. Γ. Να βρείτε μία αναςτροφι ενόσ τμιματοσ του δίκλωνου τμιματοσ DNA με τον ελάχιςτο αρικμό βάςεων που είναι υπεφκυνο για τθ βιοςφνκεςθ ενόσ διπεπτιδίου Δ. Να βρείτε τθν αναςτροφι τμιματοσ του δίκλωνου τμιματοσ DNA που προκαλεί τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-leu-asn-leu-asn-pro-ala-arg-pro-ala-cooh E. Σασ δίνεται μία αλυςίδα ενόσ δίκλωνου τμιματοσ DNA-2 : 5ϋ-GAATTCGGCCGC-3ϋ Το γονίδιο και το τμιμα DNA-2 αφοφ «κοποφν» με τθν EcoRI αναμιγνφονται και με τθ δράςθ τθσ DNAδεςμάςθσ επαναςυνδζονται τα τμιματα. Να αναγράψετε τθν αλλθλουχία των τμθμάτων DNA που διακζτουν αλλθλουχίεσ βάςεων και από τα δφο διαφορετικά τμιματα DNA που αναςυνδυάςτθκαν. 69. Σασ δίνεται θ αλυςίδα ενόσ γονιδίου που είναι υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-pro-gly-arg-glu-pro-cooh Αλυςίδα: ΤΤΤΤΑΑΤCCCGAGCGCGGGCCTTAAAATCGTATTAA Α. Αφοφ γράψετε το δίκλωνο τμιμα που είναι υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου να βρείτε τθν κωδικι και μθ κωδικι αλυςίδα του γονιδίου. Β. Να ςθμειϊςετε τθν κατεφκυνςθ τθσ μεταγραφισ και τθ κζςθ του υποκινθτι. Γ. Να αναγραφεί θ αλλθλουχία του εςωνίου ςτο πρόδρομο mrna Δ. Θ προςκικθ ενόσ ηεφγουσ βάςεων ςτο ςυγκεκριμζνο τμιμα DNA προκαλεί τθν πρόωρθ λιξθ τθσ ςφνκεςθσ του πεπτιδίου. Να βρεκεί το ηεφγοσ βάςεων που προςτζκθκε, θ κζςθ προςκικθσ κακϊσ και τθ νζα αλλθλουχία του πεπτιδίου. Ε. Δφο χρωμοςωμικζσ μεταλλάξεισ ζχουν ωσ αποτζλεςμα τθ δθμιουργία ενόσ νζου τμιματοσ γονιδίου που παράγει το πεπτίδιο : ΝΘ 2 -met-pro-gly-arg-gly-leu-gly-leu-cooh Να βρείτε τισ χρωμοςωμικζσ ανωμαλίεσ Να γίνει χριςθ του γενετικοφ κϊδικα. 70. Στο 13 ο ηεφγοσ ομολόγων χρωμοςωμάτων εδράηουν μεταξφ άλλων και τα αλλθλόμορφα γονίδια Α, α,ενϊ ςτο 18 ο ηεφγοσ τα αλλθλόμορφα γονίδια Β, β. Να αναφζρετε τουσ μθχανιςμοφσ που προκφπτουν κακϊσ και τθν χρωμοςωμικι ανωμαλία που φζρουν οι απόγονοι, που προζρχονται από ετερόηυγουσ γονείσ (ΑαΒβ), με γονότυπο : Α. ΑΑAΒB Β. ΑAαBβ Γ. ΑαΒΒβ Δ. Ααβββ

17 17 ΘΕΜΑΣΑ ΠΑΝΕΛΛΗΝΙΟΤ ΜΑΘΗΣΙΚΟΤ ΔΙΑΓΩΝΙΜΟΤ ΒΙΟΛΟΓΙΑ 71. Ζνασ ερευνθτισ πρζπει να αλλάξει τθν αλλθλουχία των αμινοξζων ςτο μόριο μιασ πρωτεΐνθσ χωρίσ όμωσ θ αλλαγι αυτι να επθρεάςει τθ δραςτθριότθτά τθσ. Το μόριο τθσ πρωτεΐνθσ αποτελείται από μία πολυπεπτιδικι αλυςίδα με δφο διςουλφιδικοφσ δεςμοφσ (ΙΙ και ΙV) και ζνα ενεργό κζντρο (ΙΙΙ), όπωσ φαίνεται ςτο ςχιμα. Σε ποια κζςθ τθσ πολυπεπτιδικισ αλυςίδασ είναι πολφ πικανό να γίνει θ αλλαγι τθσ αλλθλουχίασ των αμινοξζων χωρίσ να αλλάξει θ λειτουργικότθτα τθσ πρωτεΐνθσ; 72. Στο ςχιμα φαίνονται ςτάδια κατά τθ διαδικαςία του ςχθματιςμοφ γαμετϊν. Ροιο από τα διαγράμματα που ακολουκοφν δείχνει καλφτερα τισ μεταβολζσ ςτθν ποςότθτα του DNA ςε κάκε κφτταρο κάκε ςταδίου; Α. Θ μεκειονίνθ βρίςκεται ςτο άκρο 1 Β. Το κωδικόνιο ζναρξθσ βρίςκεται πλθςιζςτερα ςτο άκρο Α. Γ. Το κωδικόνιο λιξθσ βρίςκεται κοντά ςτο άκρο Α Δ. Το τελευταίο αμινοξφ που τοποκετείται ςτθν πολυπεπτιδικι αλυςίδα βρίςκεται πλθςιζςτερα ςτο άκρο 2. Ε. Οι τζςςερισ πολυπεπτιδικζσ αλυςίδεσ, μετά τθν ολοκλιρωςθ τθσ ςφνκεςισ τουσ, είναι πανομοιότυπεσ. 74. Για τθ ςφνκεςθ τθσ α αλυςίδασ τθσ αιμοςφαιρίνθσ υπάρχουν, φυςιολογικά, ςε κακζνα από τα χρωμοςϊματά μασ του 16 ου ηεφγουσ ομολόγων χρωμοςωμάτων δφο αλλθλόμορφα γονίδια. Να επιλζξετε τθ ςωςτι απάντθςθ. Σε κάκε φυςιολογικό γαμζτθ περιζχονται: Α. Δφο από αυτά τα γονίδια, το ζνα μθτρικισ και το άλλο πατρικισ προζλευςθσ, ςε κάκε περίπτωςθ. Β. Ζνα από αυτά τα γονίδια, είτε μθτρικισ, είτε πατρικισ προζλευςθσ. Γ. Δφο από αυτά τα γονίδια, είτε και τα δφο μθτρικισ, είτε και τα δφο πατρικισ προζλευςθσ, είτε το ζνα μθτρικισ και το άλλο πατρικισ προζλευςθσ. Δ. Και τα τζςςερα αυτά γονίδια. 75. Στο παρακάτω ςχιμα τα Δ, Ε, Η και Θ είναι τζςςερα κυγατρικά κφτταρα που προκφπτουν από το κφτταρο Α με μείωςθ. 73. Με βάςθ τισ πλθροφορίεσ που ςασ παρζχει το ςτιγμιότυπο τθσ εικόνασ να τοποκετιςετε το γράμμα Σ ι Λ ςτισ προτάςεισ που κεωρείτε αντιςτοίχωσ ςωςτζσ ι λανκαςμζνεσ Με δεδομζνο ότι δεν ςυμβαίνει επιχιαςμόσ οφτε χρωμοςωμικι ανωμαλία, ποια κφτταρα μπορεί είναι γενετικά όμοια; Α. τα Β, Γ Β. τα Α, Δ Γ. τα Δ, Ε, Η, Θ Δ. τα Δ, Ε 76. Άνδρασ με φυλοςφνδετθ υπολειπόμενθ ανωμαλία παντρεφεται γυναίκα με φυςιολογικό φαινότυπο. Δεδομζνου ότι ζχουν ιδθ ζνα κορίτςι πάςχον από τθν ανωμαλία, ςε τι ποςοςτό αναμζνετε να πάςχουν τα κορίτςια απόγονοί τουσ; Α. 0 % Β. 25 % Γ. 50 % Δ. 100 %

18 Ζνασ άνδρασ και μία γυναίκα ζχουν ομάδα αίματοσ Α και Β αντίςτοιχα. Το πρϊτο τουσ παιδί ζχει ομάδα αίματοσ ΑΒ και το δεφτερο παιδί τουσ ζχει ομάδα αίματοσ Ο. Ροια είναι θ ςωςτι πρόβλεψθ για τθν ομάδα των επόμενων παιδιϊν; Α. Τα μιςά παιδιά κα ζχουν ομάδα αίματοσ ΑΒ και τα άλλα μιςά ομάδα αίματοσ Ο Β. Κάποια κα ζχουν ομάδα αίματοσ Α και κάποια ομάδα αίματοσ Β Γ. Κάκε παιδί ζχει ίςεσ πικανότθτεσ να ζχει ομάδα αίματοσ Α, Β, ΑΒ ι Ο Δ. Κάκε ομάδα είναι δυνατό να παρουςιαςτεί, άλλα οι ομάδεσ Α και Β είναι πικανότερεσ 78. Στθ φρουτόμυγα Drosophila melanogaster, το αλλθλόμορφο για τα λευκά μάτια είναι φυλοςφνδετο και υπολειπόμενο γονίδιο. Ροιο κα είναι το αποτζλεςμα διαςταφρωςθσ μεταξφ ενόσ κθλυκοφ με λευκά μάτια και ενόσ αρςενικοφ με κόκκινα μάτια; Α. Πλα τα κθλυκά κα ζχουν κόκκινα μάτια και όλα τα αρςενικά κα ζχουν λευκά μάτια. Β. Πλα τα αρςενικά κα ζχουν λευκά μάτια και τα κθλυκά κα ζχουν κόκκινα και λευκά μάτια ςε αναλογία 1:1. Γ. Κάκε ςυνδυαςμόσ φφλου και χρϊματοσ ματιϊν είναι δυνατόσ. Δ. Θ αναλογία των κθλυκϊν προσ τα αρςενικά και των κόκκινων προσ τα λευκά μάτια κα είναι 1:1 ανεξάρτθτα τθσ μιασ ιδιότθτασ από τθν άλλθ 79. Ροια από τισ αλλθλουχίεσ DNA του πίνακα ΔΕΝ μπορεί να βρεκεί ςε αλλθλουχία ςυμπλθρωματικοφ DNA (cdna); Α. I και II. Β. I και IV. Γ. II και IV. Δ. IV μόνο. 80. Ο μθ φυςιολογικόσ γαμζτθσ για τθ δθμιουργία του ανευπλοειδικοφ ατόμου ΧΥΥ προκφπτει από μθ διαχωριςμό: Α. των ομόλογων χρωμοςωμάτων ςτθν 1θ μείωςθ κατά το ςχθματιςμό του ωαρίου Β. των ομόλογων χρωμοςωμάτων ςτθν 1θ μείωςθ κατά το ςχθματιςμό του ςπερματοηωαρίου Γ. των αδελφϊν χρωματίδων ςτθ 2θ μείωςθ κατά το ςχθματιςμό του ωαρίου Δ. των αδελφϊν χρωματίδων ςτθ 2θ μείωςθ κατά το ςχθματιςμό του ςπερματοηωαρίο. 81. Θ ανάλυςθ τθσ αλλθλουχίασ του γονιδιϊματοσ των λεμφοκυττάρων ενόσ άνδρα, εντόπιςε μόνο ςε ζνα λεμφοκφτταρο ζλλειψθ 200 ςυνεχόμενων ηευγϊν βάςεων. Θ πικανότθτα να μεταβιβαςτεί θ ιδιαιτερότθτα αυτι ςτα λεμφοκφτταρα των απογόνων του άνδρα είναι: Α. 0% Β. 25% Γ. 50% Δ. 100% 82. Θ γονιδιακι ρφκμιςθ ςτα βακτιρια γίνεται κυρίωσ ςτο επίπεδο Α. τθσ μεταγραφισ Β. μετά τθ μεταγραφι Γ. τθσ μετάφραςθσ Δ. μετά τθ μετάφραςθ 83. Στθ διαςταφρωςθ Αα x Αα, ο πρϊτοσ νόμοσ του Mendel προβλζπει: Α. τθ φαινοτυπικι αναλογία 3:1 Β. τθ γονοτυπικι αναλογία 1:2:1 Γ. τθ γονοτυπικι αναλογία 3:1 Δ. τθ φαινοτυπικι αναλογία 1:2:1 84. Τα RNA που παράγονται κατά τθ μεταγραφι των δομικϊν γονιδίων του οπερονίου τθσ λακτόηθσ είναι: Α. Ζνα Β. Δφο Γ. Τρία Δ. Τζςςερα 85. Το ηευγάρι των ατόμων ΙΙ,1 και ΙΙ,2 του γενεαλογικοφ δζνδρου που ακολουκεί, ζχει αποφαςίςει να αποκτιςει μόνο ζνα παιδί. Ροια είναι θ πικανότθτα το παιδί αυτό να εκδθλϊςει το χαρακτθριςτικό, που απεικονίηεται με τα μαυριςμζνα ςφμβολα; Α. ½ Β. 1/3 Γ. ¼ Δ. 1/ Μελετϊντασ τον παρακάτω καρυότυπο, μποροφμε να ςυμπεράνουμε ότι: Α. ανικει ςε άνδρα με αιμορροφιλία. Β. ανικει ςε γυναίκα με ςφνδρομο Turner. Γ. ανικει ςε γυναίκα με ςφνδρομο Klinefelter. Δ. ανικει ςε άντρα με ςφνδρομο Down.

19 Συχνά εμφανίηεται ζνα μονογονιδιακό γνϊριςμα ςε απογόνουσ χωρίσ οι γονείσ τουσ να εμφανίηουν το γνϊριςμα αυτό. Ροιοσ ι ποιοι από τουσ παρακάτω τρόπουσ κλθρονομικότθτασ κεωρείτε ότι δεν ακολουκεί θ μεταβίβαςθ του γνωρίςματοσ αυτοφ; Α. αυτοςωμικόσ υπολειπόμενοσ Β. αυτοςωμικόσ επικρατισ Γ. φυλοςφνδετοσ υπολειπόμενοσ Δ. ατελϊσ επικρατισ 88. Ο όροσ ομόλογα χρωμοςϊματα χρθςιμοποιείται για: Α. Κακζνα από τα μορφολογικά όμοια χρωμοςϊματα που αποχωρίηονται κατά τθν πρϊτθ μειωτικι διαίρεςθ. Β. Κακζνα από τα πανομοιότυπα χρωμοςϊματα του μεταφαςικοφ κυττάρου. Γ. Κακζνα από τα χρωμοςϊματα μθτρικισ ι πατρικισ προζλευςθσ. Δ. Κακζνα από τα μορφολογικά όμοια χρωμοςϊματα που αποχωρίηονται κατά τθν δεφτερθ μειωτικι διαίρεςθ. 89. Ινίδια χρωματίνθσ διπλαςιάςτθκαν ςε περιβάλλον που περιείχε νουκλεοτίδια ιχνθκετθμζνα με 32. Το DNA των αδελφϊν χρωματίδων που προζκυψαν αποδιατάχκθκε ςε υψθλι κερμοκραςία και ςτθ ςυνζχεια θ κερμοκραςία επανιλκε ςε φυςιολογικά επίπεδα. Μετά από εφλογο χρονικό διάςτθμα κα υπάρχουν: Α. μονόκλωνεσ αλυςίδεσ DNA με 31 και άλλεσ με 32 Β. δίκλωνα μόρια DNA μόνο με 31 και άλλα μόνο με 32 Γ. δίκλωνα μόρια DNA μόνο με 31, άλλα μόνο με 32 και άλλα με 31 και 32 μαηί Δ. δίκλωνα μόρια DNA με μία αλυςίδα 31 και μία με Χρωμοςωμικζσ ανωμαλίεσ μπορεί να ςυμβοφν κατά: Α. τθν αντιγραφι του DNA Β. τισ μειωτικζσ διαιρζςεισ Γ. τθ μεςόφαςθ Δ. τθ μεταγραφι του DNA 91. Κφτταρα από διαφορετικοφσ ιςτοφσ του ανκρϊπινου οργανιςμοφ εμφανίηουν ιδιαίτερθ μορφολογία και διαφορετικζσ λειτουργίεσ λόγω: Α. Φπαρξθσ διαφορετικϊν γονιδίων ςτα κφτταρα διαφορετικϊν ιςτϊν. Β. Ζκφραςθσ διαφορετικϊν γονιδίων ςτα κφτταρα διαφορετικϊν ιςτϊν. Γ. Ζκφραςθσ όλων των γονιδίων, ςε κάκε κφτταρο, αλλά περαιτζρω τροποποίθςθ τθσ δομισ και των λειτουργιϊν των κυττάρων από παράγοντεσ του περιβάλλοντοσ του ανκρϊπου. Δ. Ζκφραςθσ όλων των γονιδίων, ςε κάκε κφτταρο, αλλά περαιτζρω τροποποίθςθ τθσ δομισ και των λειτουργιϊν των κυττάρων από παράγοντεσ του περιβάλλοντοσ των κυττάρων (μεςοκυττάριασ ουςίασ). 92. Στο παρακάτω γενεαλογικό δζνδρο το κθλυκό άτομο μπορεί να είναι ομόηυγο ωσ προσ: Α. υπολειπόμενο αυτοςωμικό γονίδιο. Β. υπολειπόμενο φυλοςφνδετο γονίδιο. Γ. επικρατζσ αυτοςωμικό γονίδιο. Δ. επικρατζσ φυλοςφνδετο γονίδιο. 93. Στο παρακάτω ςχιμα φαίνεται μία περιοχι δίκλωνου μορίου DNA. Οι παφλεσ αντιπροςωπεφουν περιοχζσ απροςδιόριςτου μικουσ Θ περιοχι του DNA που βρίςκεται μζςα ςτο πλαίςιο, αναςτρζφεται. Ροιο από τα παρακάτω ςχιματα αποδίδει ςωςτά τθν αναςτροφι; 94.Οι DNA ελικάςεσ είναι ζνηυμα που: Α. επιμθκφνουν τισ αλυςίδεσ του DNA Β. ςυνδζουν τισ ςυμπλθρωματικζσ βάςεισ του DNA Γ. ςπάηουν υδρογονικοφσ δεςμοφσ μεταξφ των δφο αλυςίδων του DNA Δ. ςυςπειρϊνουν το DNA. 95. Θ ροι τθσ γενετικισ πλθροφορίασ μπορεί να γίνει: Α. από το RNA προσ το DNA Β. από το DNA προσ το RNA Γ. από το RNA προσ τισ πρωτεΐνεσ Δ. ιςχφουν όλα τα παραπάνω 96. Κατά τθ διαςταφρωςθ μιασ μθτζρασ που είναι φορζασ για τθν αςκζνεια τθσ αιμορροφιλίασ Α με ζνα φυςιολογικό πατζρα, ποια είναι θ πικανότθτα να γεννθκεί κορίτςι που πάςχει από αιμορροφιλία Α; Α. 0% Β. 25% Γ. 50% Δ. 100% 97. Σε μια οικογζνεια ο άνδρασ ζχει ομάδα αίματοσ ΑΒ και θ γυναίκα ομάδα αίματοσ Β. Ροιο από τα

20 20 παιδιά τθσ οικογζνειασ προζρχεται από διαφορετικό πατζρα; Α. Το 1 ο παιδί με ομάδα αίματοσ Ο Β. Το 2 ο παιδί με ομάδα αίματοσ ΑΒ Γ. Το 3 ο παιδί ομάδα αίματοσ Α Δ. Το 4 ο παιδί με ομάδα αίματοσ Β 98. Μια ςιωπθλι μετάλλαξθ ςτο γονίδιο που κωδικοποιεί τθν β πολυπεπτιδικι αλυςίδα τθσ αιμοςφαιρίνθσ Α: Α. είναι αιτία τθσ εμφάνιςθσ τθσ αςκζνειασ τθσ δρεπανοκυτταρικισ αναιμίασ Β. είναι αιτία τθσ εμφάνιςθσ τθσ αςκζνειασ τθσ αιμορροφιλίασ Γ. είναι αιτία τθσ εμφάνιςθσ τθσ αςκζνειασ τθσ καλαςςαιμίασ Δ. δεν μπορεί να προκαλζςει κάποια αςκζνεια 99. Μια πρωτεΐνθ που αποτελείται από δφο όμοιεσ (ςε αρικμό και αλλθλουχία αμινοξζων) πολυπεπτιδικζσ αλυςίδεσ περιζχει ςυνολικά 200 αμινοξζα. Ο αρικμόσ των κωδικονίων του mrna που φζρει τθ πλθροφορία για τθ ςφνκεςθ τθσ πρωτεΐνθσ (δεδομζνου ότι δεν ζχει γίνει αποκοπι αμινοξζων) είναι: Α. 200 Β. 202 Γ. 100 Δ Ζνα νουκλεοτίδιο μπορεί να είναι ςυνδεδεμζνο με: Α. Ζνα νουκλεοτίδιο Β. Δφο άλλα νουκλεοτίδια Γ. Τρία άλλα νουκλεοτίδια Δ. Πλα τα παραπάνω 101. Δίνεται το παρακάτω γενεαλογικό δζνδρο. Θ πικανότθτα το φυςιολογικό παιδί II-1 να είναι κορίτςι και φορζασ τθσ αςκζνειασ είναι: Α. 1/4 Β. 2/3 Γ. 1/3 Δ. 3/ Αν θ ςφηυγοσ είναι φορζασ τθσ δρεπανοκυτταρικισ αναιμίασ και τθσ μερικισ αχρωματοψίασ και ο ςφηυγοσ είναι φορζασ τθσ δρεπανοκυτταρικισ αναιμίασ και φυςιολογικόσ ςτθν όραςθ, θ πικανότθτα να γεννθκεί αγόρι που πάςχει από τισ δφο αςκζνειεσ είναι: Α. 1/8 Β. 1/2 Γ. 1/32 Δ. 1/ Στο γενετικό υλικό ενόσ βακτθρίου υπάρχουν α ng 31 P. Το βακτιριο τοποκετείται ςε κρεπτικό υλικό, ςτο οποίο ο υπάρχει μόνο με τθ μορφι του ραδιενεργοφ ιςοτόπου του 32. Στα βακτιρια τθσ αποι- κίασ μετά από 4 γενιζσ αναμζνεται να υπάρχουν: Α. 0 ng 31 P Β. α ng 31 P Γ. 2α ng 31 P Δ. 4α ng 31 P 104. Στο παρακάτω ςχιμα απεικονίηονται οι καμπφλεσ ανάπτυξθσ τριϊν μικροοργανιςμϊν α, β, γ και θ καμπφλθ μεταβολισ τθσ ςυγκζντρωςθσ του οξυγόνου. Μπορεί να γίνει ταυτόχρονθ καλλιζργεια των μικροοργανιςμϊν: Α. α και β απουςία οξυγόνου Β. α και γ παρουςία οξυγόνου Γ. α και β παρουςία οξυγόνου Δ. β και γ απουςία οξυγόνου 105. Αν ζνα trna ζχει μικοσ 100 βάςεισ, το αντίςτοιχο γονίδιο από το οποίο προζκυψε ζχει μικοσ: Α. ακριβϊσ 100 βάςεισ Β. ακριβϊσ 100 ηεφγθ βάςεων Γ. περιςςότερα από 100 ηεφγθ βάςεων Δ. λιγότερα από 100 ηεφγθ βάςεων 106. Μια πολυνουκλεοτιδικι αλυςίδα ςχθματίηεται από: Α. Τθ ςυνζνωςθ πολλϊν βάςεων του DNA ςφμφωνα με τον κανόνα τθσ ςυμπλθρωματικότθτασ των βάςεων. Β. Τθν προςανατολιςμζνθ ςυνζνωςθ φωςφορικϊν ομάδων με το ςάκχαρο δεοξυριβόηθ, μζςω ομοιοπολικϊν δεςμϊν. Γ. Τθν προςανατολιςμζνθ ςυνζνωςθ μορίων δεοξυριβόηθσ με φωςφορικζσ ομάδεσ, μζςω ομοιοπολικϊν δεςμϊν. Δ. Τθ ςυνζνωςθ νουκλεοτιδίων με φωςφοδιεςτερικοφσ δεςμοφσ μεταξφ του υδροξυλίου του άνκρακα 3ϋ τθσ πεντόηθσ του πρϊτου νουκλεοτίδιου και τθσ φωςφορικισ ομάδασ που ςυνδζεται ςτον άνκρακα 5ϋ τθσ πεντόηθσ του επομζνου νουκλεοτιδίου Αντικωδικόνιο δεν μπορεί να είναι θ τριπλζτα: Α. 3 - UAG - 5 Β. 3 ACU 5 Γ. 3 AGU 5 Δ. 3 CAC 5ϋ

21 Ροια από τισ παρακάτω πρωτεΐνεσ δεν εντοπίηεται ςτον πυρινα φυςιολογικϊν ευκαρυωτικϊν κυττάρων; Α. Ιςτόνεσ Β. Αντίςτροφθ μεταγραφάςθ Γ. RNA πολυμεράςθ Δ. DNA δεςμάςθ 109. Το γονίδιο που δε φζρει κωδικόνιο ζναρξθσ και λιξθσ είναι αυτό που κωδικοποιεί : Α. Τθν RNA πολυμεράςθ Β. Τθν πρωτεΐνθ καταςτολζα Γ. Το trna Δ. Ζνα μεταγραφικό παράγοντα 110. Τα κφτταρα ενόσ οργανιςμοφ διαφζρουν ςτθ δομι και ςτθ λειτουργία τουσ εξαιτίασ διαφορϊν ςτο είδοσ των μορίων: Α. trna Β. mrna Γ. snrna Δ. rrna 111. Ρρόδρομο mrna μπορεί να προκφψει από τθ μεταγραφι γονιδίου: Α. ιοφ θπατίτιδασ Β. βακτθρίου Agrobacterium Γ. μιτοχονδρίου θπατικοφ κυττάρου Δ. οπερονίου E. Coli 112. Ζνα άτομο ςτο οποίο δεν παράγεται το ζνηυμο για τθ μετατροπι τθσ φαινυλαλανίνθσ ςε τυροςίνθ, κα πάςχει από: Α. αλφιςμό Β. φαινυλκετονουρία Γ. κυςτικι ίνωςθ Δ. πνευμονικό εμφφςθμα 113. Θ δυνατότθτα παραγωγισ ανκρϊπινων πρωτεϊνϊν από βακτθριακά ριβοςϊματα ςτθρίηεται: Α. ςτθ ςυμπλθρωματικότθτα των αηωτοφχων βάςεων Β. ςτθν κακολικότθτα του γενετικοφ κϊδικα Γ. ςτον αυτοδιπλαςιαςμό του DNA Δ. ςτθν αντίςτροφθ μεταγραφι 114. Να γράψετε ςτο τετράδιό ςασ τον αρικμό κακεμιάσ από τισ παρακάτω προτάςεισ και δίπλα του να χαρακτθρίςετε τθν αντίςτοιχθ πρόταςθ ωσ ςωςτι (Σ) ι λανκαςμζνθ (Λ) 1. Μετά από ζνα κφκλο αντιγραφισ, τα μιςά μόρια DNA περιζχουν το αρχικό υλικό και τα άλλα μιςά αποτελοφνται από νζο υλικό. 2. Μόνο μεταλλάξεισ που ςυμβαίνουν ςε κφτταρα τα οποία παράγουν ςπερματοηωάρια ι ωάρια μποροφν να μεταβιβαςτοφν ςτθν επόμενθ γενιά. 3. Δφο άνκρωποι με β - καλαςςαιμία ζχουν οπωςδιποτε τα ίδια αλλθλόμορφα του υπεφκυνου γονιδίου. 4. Δφο άνκρωποι με α - καλαςςαιμία ζχουν οπωςδιποτε τον ίδιο γονότυπο. 5. Στο οπερόνιο τθσ λακτόηθσ εντοπίηονται τζςςερα κωδικόνια ζναρξθσ και τζςςερα κωδικόνια λιξθσ. 6. Μια cdna βιβλιοκικθ περιζχει το ςυνολικό mrna που προκφπτει από τθ μεταγραφι των γονιδίων ενόσ ςυγκεκριμζνου κυτταρικοφ τφπου. 7. Τα πλαςμίδια είναι μόρια DNA που ςυμβάλλουν ςτισ διαδικαςίεσ εξαςφάλιςθσ τθσ γενετικισ ποικιλότθτασ των βακτθρίων 8. Υποκζτουμε ότι ζνασ άνδρασ που ζπαςχε από κυςτικι ίνωςθ δζχτθκε επιτυχι γονιδιακι. Θ πικανότθτα να αποκτιςει απογόνουσ που να εμφανίηουν τθν πάκθςθ είναι πλζον 0% 9. Τα εςϊνια εντοπίηονται μόνο ςτα γονίδια των ευκαρυωτικϊν κυττάρων 10. Γνωρίηοντασ τθν αλλθλουχία των βάςεων ενόσ μορίου m RNA που απομονϊκθκε από το κυτταρόπλαςμα ενόσ νευρικοφ κυττάρου, γνωρίηουμε και τθν αλλθλουχία των βάςεων του αντίςτοιχου γονιδίου. 11. Σε ζνα αναςυνδυαςμζνο πλαςμίδιο που προζκυψε με τθ δράςθ τθσ EcoRI και τθσ DNAδεςμάςθσ, θ ΕcoRI ζχει μια αλλθλουχία αναγνϊριςθσ 12. Τα γονίδια ςτα οποία οφείλεται θ δρεπανοκυτταρικι αναιμία και θ β καλαςςαιμία είναι αλλθλόμορφα. 13. Θ αλλθλουχία του υποκινθτι ενόσ γονιδίου μπορεί να απουςιάηει από τθ γονιδιωματικι βιβλιοκικθ που παραςκευάςτθκε από κφτταρα ςυγκεκριμζνου ιςτοφ αλλά να είναι παροφςα ςε μια cdna βιβλιοκικθ που παραςκευάςτθκε από κφτταρα του ίδιου ιςτοφ ςτον οποίο το ςχετικό γονίδιο εκφράηεται Τα φυλετικά χρωμοςϊματα εντοπίηονται: Α. μόνο ςτα γεννθτικά κφτταρα των πολυκφτταρων οργανιςμϊν. Β. και ςτα προκαρυωτικά κφτταρα. Γ. και ςτα ςωματικά κφτταρα των πολυκφτταρων οργανιςμϊν. Δ. και ςτουσ χλωροπλάςτεσ Θ τεχνικι διάγνωςθσ που κα ακολουκιςουμε για τον εντοπιςμό χρωμοςωμικισ ανωμαλίασ είναι: Α. PCR. Β. καρυότυποσ και μελζτθ χρωμοςωμάτων. Γ. βιοχθμικι δοκιμαςία. Δ. ςυνδυαςμόσ των Β και Γ Ζνασ γενετιςτισ παριγαγε τζςςερα φυτά με δρεπανοειδζσ περικάρπιο και πζντε φυτά με ίςιο περικάρπιο διαςταυρϊνοντασ δφο φυτά ενόσ είδουσ. Είναι γνωςτό ότι το ίςιο περικάρπιο ςε αυτό το είδοσ φυτϊν ελζγχεται από ζνα επικρατζσ γονίδιο. Σε ποιο ςυμπζραςμα πρζπει να καταλιξει ο γενετιςτισ ςχετικά με το γονότυπο των ατόμων τθσ πατρικισ γενιάσ; Α. και οι δφο γονείσ είναι ετερόηυγοι.

22 22 Β. ο ζνασ γονζασ είναι ομόηυγοσ για το υπολειπόμενο και ο άλλοσ ετερόηυγοσ. Γ. ο ζνασ γονζασ ιταν ομόηυγοσ για το επικρατζσ και ο άλλοσ ιταν ετερόηυγοσ. Δ. δεν μπορεί να καταλιξει ςε αςφαλι ςυμπεράςματα Στα μπιηζλια οι ιδιότθτεσ πράςινα (Ρ) και φουςκωμζνα (Φ) ςπζρματα είναι επικρατείσ ενϊ οι ιδιότθτεσ κίτρινα (π) και ςυρρικνωμζνα (φ) είναι υπολειπόμενεσ. Στο τετράγωνο του Punnet του ςχιματοσ, ο φαινότυποσ που αντιςτοιχεί ςτθ κζςθ 1 είναι: Α. πράςινα, φουςκωμζνα Β. πράςινα, ςυρρικνωμζνα Γ. κίτρινα, φουςκωμζνα Δ. κίτρινα, ςυρρικνωμζνα 119. Πλα τα πολλαπλά αλλθλόμορφα προκφπτουν Α. από δομικζσ χρωμοςωμικζσ μεταβολζσ Β. από αρικμθτικζσ χρωμοςωμικζσ ανωμαλίεσ Γ. με διαφορετικοφ τφπου μεταλλάξεισ ςτο ίδιο γονίδιο Δ. με πρόωρο τερματιςμό τθσ γαμετογζνεςθσ 120. Στο φυςιολογικό χρωμόςωμα 1 υπάρχει μεταξφ άλλων θ γονιδιακι αλλθλουχία ΑΒΓΔΕΗΘΘ, ενϊ αντίςτοιχα ςτο χρωμόςωμα 2 θ αλλθλουχία ΙΚΛ- ΜΝΞΟΡ. Σε ζνα θπατικό κφτταρο ενόσ ατόμου παρατθρικθκαν ςτο χρωμόςωμα 1 θ αλλθλουχία ΑΒΓΛΜΗΘΘ και ςτο χρωμόςωμα 2 θ αλλθλουχία ΙΚΔΕΝΞΟΡ. Ραρατθρείτε ότι: Α. ζγινε ανακατανομι γενετικοφ υλικοφ Β. θ μεταβολι κλθρονομικθκε ςτουσ απογόνουσ Γ. οι γαμζτεσ του ατόμου ζχουν διαφορετικι γονιδιακι ςφςταςθ Δ. θ μεταβολι οφείλεται ςε ανευπλοειδία 121. Διακζτουμε δυο γενετικά ςτελζχθ ενόσ πειραματόηωου. Το 1 ο ςτζλεχοσ ζχει το φαινότυπο Α και το 2 ο το φαινότυπο α (Α: επικρατζσ, α: υπολειπόμενο). Ροια διαςταφρωςθ κα κάνατε για να βρείτε αν το γονίδιο είναι αυτοςωμικό ι φυλοςφνδετο; Α. αρςενικό 1ου με κθλυκό 1ου Β. αρςενικό 2ου με κθλυκό 2ου Γ. αρςενικό 1ου με κθλυκό 2ου Δ. αρςενικό 2ου με κθλυκό 1ου Σθμείωςθ: Το γονίδιο δεν ανικει ςε καμία ειδικι κατθγορία γονιδίου (π.χ. το α δεν είναι κνθςιγόνο) Αν μια αςκζνεια ακολουκεί αυτοςωμικό επικρατι τφπο κλθρονομικότθτασ, οι γονείσ είναι υγιείσ και ζνα παιδί αςκενεί τότε: Α. θ αςκζνεια είναι πολφ ςοβαρι Β. θ αςκζνεια άλλαξε τφπο κλθρονομικότθτασ Γ. θ αςκζνεια ελζγχεται από πολλαπλά αλλθλόμορφα Δ. το παιδί αςκζνθςε λόγω γονιδιακισ μετάλλαξθσ 123. Μια ομάδα ερευνθτϊν αποφάςιςε να μελετιςει το ρόλο κάποιων πρωτεϊνϊν που παράγονται ςε κφτταρα του ανκρϊπινου οργανιςμοφ. Ροια από τισ παρακάτω πρωτεΐνεσ που μελετικθκαν ςχετίηεται άμεςα με τθν ζκφραςθ των γονιδίων; Α. Μεταγραφικόσ παράγοντασ Β. Κολλαγόνο Γ. Ινςουλίνθ Δ. Αντιςϊματα 124. Στα ποντίκια το γονίδιο Β ελζγχει το κοντό τρίχωμα και το γονίδιο β το μακρφ. Από τθ διαςταφρωςθ μακρότριχου ποντικοφ με κοντότριχο ποντικοφ παράχκθκαν 45 ποντικάκια, 33 κοντότριχα και 12 μακρότριχα. Ι.) Ροιοσ είναι ο γονότυποσ των γονζων τουσ; Α. ΒΒ Χ ββ Β. ββ Χ ββ Γ. ββ Χ Ββ Δ. ΒΒ Χ Ββ ΙΙ.) Αν ςυνεχιςτοφν διαςταυρϊςεισ του ίδιου ηευγαριοφ πολλζσ φορζσ, ϊςτε τελικά να παραχκοφν 80 ποντικάκια, ποια αποτελζςματα αντιςτοιχοφν ςτθν αναμενόμενθ φαινοτυπικι αναλογία; Α. 22 κοντότριχα : 58 μακρότριχα Β. 27 κοντότριχα : 53 μακρότριχα Γ. 65 κοντότριχα : 15 μακρότριχα Δ. 38 κοντότριχα : 42 μακρότριχα 125. Το παρακάτω τμιμα DNA περιζχει το κωδικόνιο ζναρξθσ τθσ μετάφραςθσ που χρθςιμοποιείται ςτο γονίδιο: O μεταγραφόμενοσ κλϊνοσ πρζπει να είναι: Α. ο πάνω κλϊνοσ με κατεφκυνςθ 5ϋ-3ϋ Β. ο πάνω κλϊνοσ με κατεφκυνςθ 3ϋ-5ϋ Γ. ο κάτω κλϊνοσ με κατεφκυνςθ 5ϋ- 3ϋ Δ. ο κάτω κλϊνοσ με κατεφκυνςθ 3ϋ- 5ϋ 126. Θ χριςθ του πυρινα ενιλικου ςωματικοφ κυττάρου για τθ δθμιουργία όλων των κυτταρικϊν τφπων ςε ζνα νζο οργανιςμό δείχνει ότι θ ανάπτυξθ κακορίηεται από: Α. τθν ζκφραςθ των γονιδίων Β. το ςυντονιςμό των μειωτικϊν διαιρζςεων Γ. το ςυντονιςμό των μιτωτικϊν διαιρζςεων ςτα κφτταρα του αναπτυςςόμενου οργανιςμοφ

23 23 Δ. το μεςοκυττάριο υγρό Συγκρίνοντασ το γενετικό υλικό ευκαρυωτικϊν και προκαρυωτικϊν κυττάρων, αλθκεφει πωσ και τα δφο: Α. οργανϊνονται ςε ηεφγθ ομολόγων χρωμοςωμάτων. Β. είναι γραμμικά χρωμοςϊματα. Γ. βρίςκεται ςτον πυρινα. Δ. αποτελείται από δίκλωνα μόρια DNA Σε ζνα εργαςτιριο, απομόνωςαν το DNA και το mrna δφο οργανιςμϊν. Θ ανάλυςθ των αηωτοφχων βάςεων των μορίων αυτϊν ζδωςε τα παρακάτω αποτελζςματα: Α. ο Κ1 είναι προκαρυωτικόσ και ο Κ2 ευκαρυωτικόσ Β. ο Κ1 είναι ευκαρυωτικόσ και ο Κ2 προκαρυωτικόσ Γ. οι Κ1 και Κ2 είναι προκαρυωτικοί Δ. οι Κ1 και Κ2 είναι ευκαρυωτικοί 129. Στο πείραμα Hershey-Chase, ιχνθκετθμζνοι ιοί μολφνουν βακτθριακι καλλιζργεια θ οποία αναπτφςςεται ςε μθ ραδιενεργό κρεπτικό υλικό. Οι ιοί που κα δθμιουργθκοφν ςτα βακτιρια - ξενιςτζσ κα ζχουν: Α. ραδιενεργό DNA και μθ ραδιενεργζσ πρωτεΐνεσ Β. ραδιενεργζσ πρωτεΐνεσ και μθ ραδιενεργό DNA Γ. ραδιενεργό DNA και πρωτεΐνεσ. Δ. μθ ραδιενεργό DNA και πρωτεΐνεσ Θ μερικι αχρωματοψία ςτο πράςινο και ςτο κόκκινο ακολουκεί Χ-φυλοςφνδετο υπολειπόμενο τφπο κλθρονομικότθτασ. Είναι λογικό να ιςχυριςτοφμε ότι : Α. Γυναίκα με αχρωματοψία πρζπει να ζχει πατζρα με αχρωματοψία. Β. Άντρασ με αχρωματοψία πρζπει να ζχει μθτζρα με αχρωματοψία. Γ. Άντρασ με αχρωματοψία πρζπει να ζχει παπποφ με αχρωματοψία. Δ. Γυναίκα με αχρωματοψία πρζπει να ζχει γιαγιά με αχρωματοψία Δίνεται ςτο ςχιμα τμιμα DNA που βρίςκεται ςε αντιγραφι. Θ αλλθλουχία των βάςεων του Α κλϊνου είναι 3 ϋ G C T T G A T G G C T C A A C C A T G G A C G G T G G T T G A A T T G A C C 5 ϋ Το πρωταρχικό τμιμα RNA που ςυντίκεται ςτθ ςυνεχι αλυςίδα και αποτελείται από 10 νουκλεοτίδια είναι: Α. CGAACUACCG Β. GGUCAAUUCA Γ. GCUUGAUGGC Δ. CCAGUUAAGU 132. Θ λίςτα (1) - (4) περιγράφει τα ςτάδια τθσ διαδικαςίασ αντιγραφισ του DNA ςε ζνα ευκαρυωτικό κφτταρο. (1) Συμπλθρωματικά νουκλεοτίδια προςδζνονται ςε κακεμία από τισ δφο αλυςίδεσ. (2) Φωςφοδιεςτερικοί δεςμοί ςχθματίηονται μεταξφ των νουκλεοτιδίων. (3) Τα νεοςχθματιςκζντα μόρια DNA είναι θμιςυντθρθτικά. (4) Το ξετφλιγμα τθσ διπλισ ζλικασ του DNA οδθγεί ςτο ςχθματιςμό δφο μονόκλωνων αλυςίδων. Θ ςωςτι αλλθλουχία των γεγονότων ζχει ωσ εξισ: Α. (1), (2), (3), (4) Β. (1), (4), (3), (2) Γ. (4), (2), (1), (3) Δ. (4), (1), (2), (3) 133. Το διάγραμμα που ακολουκεί δείχνει τισ κζςεισ τριϊν διαφορετικϊν περιοριςτικϊν ενδονουκλεαςϊν ςε ζνα πλαςμίδιο. Στθν περίπτωςθ που το πλαςμίδιο επωαςτεί με τθν περιοριςτικι ενδονουκλεάςθ EcoRI, ο αρικμόσ των κομματιϊν που κα προκφψουν κα είναι: Α. 2 Β. 3 Γ. 4 Δ Ροιο από τα νουκλεοτίδια του διπλανοφ ςχιματοσ παρουςιάηει τθ ςωςτι διάταξθ;

24 Το γονιδίωμα ενόσ μικροφ ιοφ απεικονίηεται παρακάτω, παρουςιάηοντασ τισ κζςεισ κοπισ για δφο περιοριςτικζσ ενδονουκλεάςεσ (P και Q). Χρθςιμοποιϊντασ τα ζνηυμα αυτά παρατθρικθκαν κραφςματα DNA, των οποίων το μικοσ φαίνεται ςτον πίνακα που ακολουκεί. Στθν περίπτωςθ που χρθςιμοποιθκοφν και οι δφο περιοριςτικζσ ενδονουκλεάςεσ ταυτόχρονα, τα προκφπτοντα κραφςματα DNA κα ζχουν μικθ: Α. 3 Kb, 8 Kb, 5 Kb, 2 Kb Β. 7 Kb, 2 Kb, 1 Kb Γ. 3 Kb, 5 Kb, 2 Kb Δ. 3 Kb, 7 Kb, 8 Kb,2Kb 136. Αναφορικά με ςφςτθμα των ομάδων αίματοσ ΑΒΟ είναι δυνατόν να προκφψουν παιδιά με τζςςερισ διαφορετικοφσ φαινοτφπουσ, εάν οι γονείσ είναι: Α. τφπου Β τφπου Β. Β. τφπου Α τφπου Β. Γ. τφπου Ο τφπου ΑΒ. Δ. τφπου ΑΒ τφπου ΑΒ Οι αμοιβαίεσ χρωμοςωμικζσ μετακζςεισ είναι ςυχνό φαινόμενο ςτα κακοικθ κφτταρα και ςε πολλζσ περιπτϊςεισ το αποτζλεςμα μπορεί να είναι ζνα λειτουργικό ςφνκετο γονίδιο (χιμαιρικό) που περιζχει εξϊνια από δυο διαφορετικά γονίδια. Ραρακάτω δίνεται ζνα παράδειγμα δυο γονίδιων που αναδιατάςςονται μετά από αμοιβαία χρωμοςωμικι μετάκεςθ. Ροιεσ πιςτεφετε ότι μπορεί να είναι οι ςυνζπειεσ ενόσ τζτοιου γεγονότοσ Α. θ ςφνκεςθ μιασ χιμαιρικισ πρωτεΐνθσ Β. θ καταςτολι τθσ ζκφραςθσ και των δυο γονίδιων Γ. ο ζλεγχοσ τθσ ζκφραςθσ του χιμαιρικοφ γονιδίου από τισ περιοχζσ Ι-Ε2 και ΙΙ-Ε2 Δ. θ ςφνκεςθ δυο χιμαιρικϊν πρωτεϊνϊν Από διαςταφρωςθ δφο ατόμων Drosophila προζκυψαν: 303 άτομα με γκρι χρϊμα και κανονικά φτερά, 99 άτομα με μαφρο χρϊμα και κανονικά φτερά, 102 άτομα με μαφρο χρϊμα και ατροφικά φτερά και 297 άτομα με γκρι χρϊμα και ατροφικά φτερά. Τα γονίδια βρίςκονται ςε διαφορετικά χρωμοςϊματα. Α. Ιςχφει ο νόμοσ του διαχωριςμοφ των αλλθλομόρφων γονιδίων. Β. Δεν ιςχφει ο νόμοσ του διαχωριςμοφ των αλλθλομόρφων γονιδίων. Γ. Για τθ μία ιδιότθτα ιςχφει ενϊ για τθν άλλθ δεν ιςχφει ο νόμοσ του διαχωριςμοφ των αλλθλομόρφων γονιδίων. Δ. Ο νόμοσ του διαχωριςμοφ των αλλθλομόρφων γονιδίων ιςχφει μόνο για τον ζνα γονζα Θ μεταβίβαςθ των χαρακτθριςτικϊν που κωδικοποιοφνται από το μιτοχονδριακό DNA: Α. γίνεται μόνο από τθν μθτζρα ςτισ κόρεσ Β. δεν ακολουκεί τουσ νόμουσ τθσ Μεντελικισ κλθρονομικότθτασ Γ. γίνεται μόνο από τθν μθτζρα ςτουσ γιουσ Δ. ακολουκεί τουσ νόμουσ τθσ Μεντελικισ κλθρονο- Μικότθτασ 140. Θ οπτικι νευροπάκεια Leber (LHON) οφείλεται ςε γονίδιο που βρίςκεται ςτο μιτοχονδριακό DNA. Από τθ διαςταφρωςθ υγιοφσ άνδρα με αςκενι γυναίκα, οι αναμενόμενοι απόγονοι είναι: Α. αγόρια και κορίτςια αςκενι Β. αγόρια και κορίτςια υγιι Γ. αγόρια υγιι και κορίτςια αςκενι Δ. αγόρια αςκενι και κορίτςια υγιι 141. Στον άνκρωπο, θ αχονδροπλαςία ςυνιςτά νόςο που ακολουκεί αυτοςωμικό επικρατι τφπο κλθρονομικότθτασ και οδθγεί ςε ζναν τφπο νανιςμοφ. Σε οριςμζνεσ περιπτϊςεισ, είναι δυνατόν να προκφψει παιδί με αχονδροπλαςία από γονείσ με φυςιολογικό φψοσ. Ο πικανότεροσ λόγοσ για να εμφανιςτεί παιδί με αχονδροπλαςία είναι ότι: Α. οι γονείσ είναι φορείσ και το παιδί ζχει κλθρονομιςει ζνα μεταλλαγμζνο αλλθλόμορφο από κάκε γονζα Β. μία μετάλλαξθ ζχει ςυμβεί ςε γεννθτικά κφτταρα του πατζρα ι τθσ μθτζρασ Γ. μία μετάλλαξθ ζχει ςυμβεί ςε ςωματικό κφτταρο ενόσ από τουσ δφο γονείσ Δ. μία μετάλλαξθ ζχει ςυμβεί ςτουσ ιςτοφσ του παιδιοφ 142. Στον διπλοειδι μφκθτα Sacharomyces cerevisae ζνα αντίγραφο γονιδιϊματοσ ζχει μικοσ 1,7 x 10 7 ηεφγθ βάςεων που είναι οργανωμζνα ςε 16

25 25 χρωμοςϊματα. Ζνα κφτταρο του μφκθτα ςτθν αρχι τθσ μεςόφαςθσ κα περιζχει ςτον πυρινα του: Α. 1,7x 10 7 ηεφγθ βάςεων οργανωμζνα ςε 16 χρωμοςϊματα Β. 1,7x 10 7 ηεφγθ βάςεων οργανωμζνα ςε 32 χρωμοςϊματα Γ. 3,4x 10 7 ηεφγθ βάςεων οργανωμζνα ςε 16 χρωμοςϊματα Δ. 3,4x 10 7 ηεφγθ βάςεων οργανωμζνα ςε 32 χρωμοςϊματα 143. Θ γονιδιακι ζκφραςθ περιλαμβάνει τισ διεργαςίεσ: Α. Αντιγραφι, μεταγραφι και μετάφραςθ τθσ γενετικισ πλθροφορίασ Β. Αντιγραφι και αντίςτροφθ μεταγραφι τθσ γενετικισ πλθροφορίασ Γ. Μεταγραφι ι μεταγραφι και μετάφραςθ τθσ γενετικισ πλθροφορίασ Δ. Μόνο τθ μετάφραςθ τθσ γενετικισ πλθροφορίασ 144. Υποδείξτε ποιο από τα ακόλουκα ηεφγθ κωδικονίων, αφορά ςυνϊνυμα κωδικόνια: Α. UΑΑ και UUC Β. AUG και AGU. Γ. AGC και UCU. Δ. UGΑ και CGU Σφμφωνα με τθ μεντελικι κεϊρθςθ το γονίδιο για το κόκκινο χρϊμα λουλουδιϊν ενόσ είδουσ φυτϊν κεωρείται ατελϊσ επικρατζσ του αλλθλομόρφου του για το λευκό χρϊμα λουλουδιϊν. Για να διαπιςτϊςουμε με αςφάλεια το γονότυπο ενόσ φυτοφ με κόκκινο χρϊμα λουλουδιϊν κα πρζπει να πραγματοποιιςουμε: Α. διαςταφρωςθ ελζγχου. Β. διαδοχικζσ διαςταυρϊςεισ αυτοφ του ατόμου με άτομο που ζχει- επίςθσ- κόκκινο χρϊμα λουλουδιϊν. Γ. αναηιτθςθ ςτο γονιδίωμα του προσ εξζταςθ φυτοφ του γονιδίου του υπεφκυνου για το λευκό χρϊμα λουλουδιϊν, με χριςθ κατάλλθλα ιχνθκετθμζνου μορίου DNA ι RNA. Δ. τίποτα από τα παραπάνω γιατί ςτο φαινότυπο «κόκκινο χρϊμα λουλουδιϊν» αντιςτοιχεί ζνασ και μοναδικόσ γονότυποσ Σε ζνα ευκαρυωτικό κφτταρο ο αρικμόσ των γονιδίων ςε ςχζςθ με τον αρικμό των διαφορετικϊν πρωτεϊνϊν που παράγονται από το κφτταρο είναι: Α. ίςοσ Β. μικρότεροσ Γ. μεγαλφτεροσ Δ. είτε μικρότεροσ είτε μεγαλφτεροσ 147. Να χαρακτθρίςετε, ςτο τετράδιό ςασ, με (Σ) τισ ςωςτζσ και με (Λ) τισ λανκαςμζνεσ από τισ παρακάτω προτάςεισ Στο πλαίςιο τθσ μεντελικισ κεϊρθςθσ: α. Ζνα κνθςιγόνο γονίδιο μπορεί να είναι ςυνεπικρατζσ με το αλλθλόμορφο του φυςιολογικό. β. Ρροκφπτουν και υπάρχουν ςτα κφτταρα ενόσ ανκρϊπου και επικρατι και υπολειπόμενα κνθςιγόνα γονίδια. γ. Μόνο υπολειπόμενα κνθςιγόνα γονίδια μποροφν να κλθρονομθκοφν ςε απογόνουσ. δ. Διαςταφρωςθ ελζγχου δεν μπορεί να πραγματοποιθκεί αν το ελεγχόμενο γνϊριςμα οφείλεται ςε φυλοςφνδετο γονίδιο. ε. Δεν υπάρχουν επικρατι φυλοςφνδετα γονίδια Το μικοσ ενόσ ανκρϊπινου γονιδίου που είναι υπεφκυνο για τθν παραγωγι ενόσ πεπτιδίου (Α), βρζκθκε ότι αποτελείται από ηεφγθ βάςεων και ότι περιζχει δφο εςϊνια μικουσ και ηευγϊν βάςεων το κάκε ζνα. Το πεπτίδιο Α μετά τθ μετάφραςθ (πρωτοταγισ δομι) βρζκθκε ότι ζχει 199 αμινοξζα, όμωσ μζςα ςτθν πρωτεΐνθ (Μ) ςτθ ςφνκεςθ τθσ οποίασ ςυμμετζχει βρζκθκε ότι αποτελείται από 180 αμινοξζα. Ι. Το μικοσ του πρόδρομου m RNA είναι Α βάςεισ Β βάςεισ Γ βάςεισ Δ βάςεισ ΙΙ. Κατά τθν τροποποίθςθ του πεπτιδίου (Α) για να γίνει βιολογικά λειτουργικό απομακρφνκθκαν Α. 20 αμινοξζα Β. 10 αμινοξζα Γ. 19 αμινοξζα Δ. κανζνα αμινοξφ ΙΙΙ. Τα κωδικόνια του ϊριμου m RNA είναι Α. 180 Β Γ. 200 Δ. 199 ΙV. Οι 5 και 3ϋαμετάφραςτεσ περιοχζσ ζχουν μικοσ Α. 400 βάςεισ Β. 800 βάςεισ Γ. 199 βάςεισ Δ. 403 βάςεισ 149. Στθν εικόνα παρουςιάηεται μια διχάλα αντιγραφισ του DNA. Να μεταφζρετε ςτο τετράδιό ςασ τουσ όρουσ του πίνακα και δίπλα ςε κάκε όρο να γράψετε τον αρικμό του ςτοιχείου που αντιςτοιχεί: DNA πολυμεράςθ πριμόςωμα πρωταρχικά τμιματα. DNA ελικάςθ.

26 26 αςυνεχζσ τμιμα ςυνεχζσ τμιμα DNA δεςμάςθ 150. Ο βιολόγοσ ερευνθτισ ςιμερα χρθςιμοποιϊντασ τθν τεχνολογία του αναςυνδυαςμζνου DNA καταςκευάηει cdna βιβλιοκικθ θ οποία περιζχει ανκρϊπινα γονίδια. Για τθν καταςκευι τθσ χρθςιμοποιεί 1 που μπορεί να είναι πλαςμίδια ι DNA φάγων και το ολικό ϊριμο mrna ανκρϊπινου κυττάρου. Το ολικό ϊριμο mrna εξζρχεται 2 και με διαδικαςία που γίνεται in vitro και τθ βοικεια ενηφμων, γίνεται τελικά δίκλωνο DNA. Τα ζνηυμα που χρθςιμοποιοφνται διαδοχικά ςε αυτι τθ διαδικαςία είναι 3. Τα δίκλωνα DNA ειςάγονται, π.χ. ςε πλαςμίδια, με τθν βοικεια τθσ DNA δεςμάςθσ οπότε παράγεται μίγμα αναςυνδυαςμζνων και μθ αναςυνδυαςμζνων πλαςμιδίων. Αυτά ειςάγονται ςε βακτιρια ξενιςτζσ, τα οποία δεν πρζπει να ζχουν πλαςμίδιο με γονίδιο ανκεκτικότθτασ ςε αντιβιοτικό και αυτό γιατί 4. Τα βακτιρια που προςζλαβαν πλαςμίδιο επιλζγονται με αντιβιοτικό, για το οποίο τα πλαςμίδια ζχουν γονίδιο ανκεκτικότθτασ, απομονϊνονται και κλωνοποιοφνται. Θ κλωνοποίθςθ γίνεται με 5. Το ςφνολο των 6 αποτελεί τθν cdna βιβλιοκικθ. Κάκε κλϊνοσ τθσ cdna βιβλιοκικθσ φζρει αναςυνδυαςμζνα πλαςμίδια που περιζχουν 7. Για τθν επιλογι ςυγκεκριμζνου κλϊνου τθσ cdna βιβλιοκικθσ, αναγκαίο είναι να γίνει ανίχνευςθ του. Για το λόγο αυτό είναι αναγκαία θ καταςκευι ανιχνευτϊν που μπορεί να είναι 8. Θ διαδικαςία ανίχνευςθσ περιλαμβάνει διαδοχικά τθν 9 των πλαςμιδίων των κλϊνων και τθν 10 με τουσ ανιχνευτζσ. Θ καταςκευι τθσ ανκρϊπινθσ cdna βιβλιοκικθσ ςυμβάλει ςτθν 11. Για να ζχουμε τα οφζλθ από τθν καταςκευι τθσ ανκρϊπινθσ cdna βιβλιοκικθσ ο κλϊνοσ που απομονϊνεται πρζπει να ειςαχκεί ςε 12. (1) Α. ξενιςτζσ Β. φορείσ κλωνοποίθςθσ Γ. αντιβιοτικά Δ. περιοριςτικζσ ενδονουκλεάςεσ (2) Α. τον πυρινα Β. ςτο κυτταρόπλαςμα Γ. τα μιτοχόνδρια Δ. το πυρθνοειδζσ (3) Α. αντίςτροφθ μεταγραφάςθ, περιοριςτικι ενδονουκλεάςθ, DNA πολυμεράςθ Β. αντίςτροφθ μεταγραφάςθ, DNA πολυμεράςθ, περιοριςτικι ενδονουκλεάςθ Γ. αντίςτροφθ μεταγραφάςθ, DNA πολυμεράςθ Δ. περιοριςτικι ενδονουκλεάςθ, αντίςτροφθ μεταγραφάςθ, DNA πολυμεράςθ (4) Α. δεν μπορεί να ζχουν περιςςότερα του ενόσ πλαςμιδίων Β. εάν είχαν πλαςμίδιο κα ιταν αδφνατθ θ κλωνοποίθςθ τουσ Γ. εξυπθρετείται το επόμενο βιμα καταςκευισ τθσ βιβλιοκικθσ, που είναι θ διαδικαςία επιλογισ ξενιςτϊν με τθν βοικεια αντιβιοτικϊν Δ. θ παρουςία τουσ κα αποτελοφςε εμπόδιο ςτθν είςοδο των αναςυνδυαςμζνων πλαςμιδίων (5) Α. PCR Β. μικροζγχυςθ ςε γονιμοποιθμζνο ωάριο Γ. καλλιζργεια ςε υγρό κρεπτικό υλικό Δ. βιομθχανικι καλλιζργεια ςε υγρό κρεπτικό υλικό (6) Α. κλϊνων Β. αναςυνδυαςμζνων πλαςμιδίων Γ. ξενιςτϊν Δ. κλϊνων που φζρουν αναςυνδυαςμζνο πλαςμίδιο (7) Α. ζνα γονίδιο Β. ζνα γονίδιο χωρίσ εςϊνια Γ. τυχαίο τμιμα DNA Δ. ζνα γονίδιο χωρίσ εςϊνια και υποκινθτι (8) Α. τυχαία τμιματα DNA ι RNA Β. γνωςτά ιχνθκετθμζνα τμιματα DNA ι RNA Γ. γνωςτά ιχνθκετθμζνα και μονόκλωνα τμιματα DNA ι RNA Δ. DNA ι RNA που προζρχεται από ανκρϊπινο κφτταρο (9) Α. αντιπαραλλθλία Β. υβριδοποίθςθ Γ. αποδιάταξθ Δ. κλωνοποίθςθ (10) Α. αντιπαραλλθλία Β. υβριδοποίθςθ Γ. αποδιάταξθ Δ. κλωνοποίθςθ (11) Α. καταςκευι φαρμακευτικϊν πρωτεϊνϊν Β. τεχνικι PCR Γ. μελζτθ των γονιδίων Δ. μελζτθ του DNA (12) Α. εργαςτθριακι καλλιζργεια με ςτερεό κρεπτικό υλικό Β. βιομθχανικι καλλιζργεια με υγρό κρεπτικό υλικό

27 27 Γ. εργαςτθριακι καλλιζργεια με υγρό κρεπτικό υλικό Δ. βιομθχανικι καλλιζργεια με ςτερεό κρεπτικό υλικό 151. Σε τμιμα DNA το οποίο αποτελεί τμιμα μεταφραηόμενθσ περιοχισ γονιδίου ςυμβαίνει θ παρακάτω αλλαγι: Είναι δυνατό θ αλλαγι αυτι να ΜΘΝ προκαλζςει αλλαγζσ ςτθ λειτουργικότθτα του μορίου που κα παραχκεί από τθν παραπάνω τροποποιθμζνθ γενετικι πλθροφορία; 152. Μια ςυμμακιτρια ςασ υποςτιριξε πωσ είναι λάκοσ θ άποψθ ότι κάκε γονίδιο ζχει το δικό του υποκινθτι. Ζνασ ςυμμακθτισ ςασ υποςτιριξε και αιτιολόγθςε τθν ίδια άποψθ, διατυπϊνοντασ: Τα γονίδια που μεταγράφονται ςε t RNA, r RNA, sn RNA δεν ζχουν υποκινθτι. Συμφωνείτε με τθν άποψθ τθσ ςυμμακιτρια ςασ και τθν αιτιολόγθςθ τθσ από τον ςυμμακθτι ςασ; 153. Σε ζνα αςυνεχζσ γονίδιο ευκαρυωτικοφ κυττάρου, τα εξϊνια: Α. είναι περιςςότερα από τα εςϊνια Β. είναι λιγότερα από τα εςϊνια Γ. είναι ίςα με τα εςϊνια Δ. εξαρτάται από τον οργανιςμό 154. Ζνασ άντρασ και μία γυναίκα και οι δφο με αχονδροπλαςία (μονογονιδιακι διαταραχι), αποκτοφν ζνα κορίτςι υγιζσ. Ροια κα είναι θ πικανότθτα το επόμενο παιδί που κα αποκτιςουν να ζχει αχονδροπλαςία; Α. 0,25 Β. 0,50 Γ. 0,75 Δ Σε ζνα εργαςτιριο Μοριακισ Βιολογίασ προςδιορίςτθκε μερικϊσ θ αμινοξικι αλλθλουχία μιασ πρωτεΐνθσ. Τα μόρια trna που χρθςιμοποιικθκαν ςτθ ςφνκεςθ ζχουν τα παρακάτω αντικωδικόνια: 3ϋUAC 5ϋ 3ϋCGA 5ϋ 3ϋGGA 5ϋ 3ϋGCU 5ϋ 3ϋUUU 5ϋ 3ϋGGA 5ϋ Σθμειϊςτε τθ νουκλεοτιδικι αλλθλουχία του DNA με τθν κωδικοποιθμζνθ πλθροφορία τθσ παραπάνω αμινοξικισ αλλθλουχίασ. Α. 5ϋATG-GCT-GGT-CGA-AAA-CCT-3ϋ Β. 5ϋATG-GCT-CCT-CGA-AAA-CCT-3ϋ Γ. 5ϋATG-GCT-GCT-CGA-AAA-GCT-3ϋ Δ. 5ϋATG-GGT-CCT-CGA-AAA-CGT-3ϋ 156. Διακζτουμε μια εργαςτθριακι καλλιζργεια από φρουτόμυγεσ. Ραρατθροφμε μεταξφ των ατόμων τθσ καλλιζργειασ μια κθλυκι φρουτόμυγα με ςκοφρο μαφρο χρϊμα ςϊματοσ. I. Διαςταυρϊνουμε τθν κθλυκι μαφρθ φρουτόμυγα με μία αρςενικι με καφζ χρϊμα ςϊματοσ και όλοι οι απόγονοι τθσ F1 γενιάσ ζχουν καφζ χρϊμα ςϊματοσ. Στθ ςυνζχεια διαςταυρϊνουμε μία κθλυκι και μία αρςενικι από τθν F1 γενιά και παράγονται 200 απόγονοι από τουσ οποίουσ οι 53 είναι αμιγείσ καφζ και οι 48 ςκοφροι μαφροι. Ρόςοι απόγονοι κα είναι φορείσ του γονιδίου για το μαφρο χρϊμα ςϊματοσ; Α. 53 Β. 50 Γ. 99 Δ. 152 II. Ραρατθροφμε ότι υπάρχουν ίςοι αρικμοί κθλυκϊν και αρςενικϊν ατόμων με καφζ και μαφρα ςϊματα. Αξιολογϊντασ όλεσ τισ πλθροφορίεσ ςυμπεραίνουμε ότι το χαρακτθριςτικό για το μαφρο χρϊμα ςϊματα είναι: A. Φυλοςφνδετο επικρατζσ B. Φυλοςφνδετο υπολειπόμενο Γ. Αυτοςωμικό υπολειπόμενο Δ. Αυτοςωμικό επικρατζσ Ζνα γονίδιο ςε ζνα είδοσ μυρμθγκιοφ ελζγχει τθν ςφνκεςθ του ενηφμου μθλικι αφυδρογονάςθ (MDH). Ο γενετικόσ τόποσ ζχει δφο αλλθλόμορφα, Μ 1 και Μ 2. Πταν αυτά τα αλλθλόμορφα ενεργοποιοφνται, το κακζνα προκαλεί τθν παραγωγι ίςων ποςοτιτων τθσ MDH. Οι φαινότυποι των τριϊν πικανϊν γονότυπων M 1 M 1, M 1 M 2, M 2 M 2, ςε ζνα πλθκυςμό αυτϊν των μυρμθγκιϊν ςε ςχζςθ με τθν παραγωγι τθσ MDH, αναπαρίςταται καλφτερα από το γράφθμα Στθ διαςταφρωςθ μεταξφ αμιγϊν κίτρινων και γκρίηων φρουτόμυγων πάρκθκαν τα παρακάτω αποτελζςματα:

28 28 πατζρασ του είναι πρϊτα ξαδζλφια. Θ ςχζςθ αίματοσ αναπαρίςταται με διπλι γραμμι. Α. Τα αλλθλόμορφα για το γκρίηο και το κίτρινο χρϊμα είναι ιςοεπικρατι. Β. Το αλλθλόμορφο για το γκρίηο χρϊμα είναι φυλοςφνδετο υπολειπόμενο. Γ. Το αλλθλόμορφο για το γκρίηο χρϊμα είναι φυλοςφνδετο επικρατζσ. Δ. Το αλλθλόμορφο για το κίτρινο χρϊμα είναι αυτοςωμικό υπολειπόμενο Μία βακτθριακι καλλιζργεια αναπτφςςεται ςε κρεπτικό υλικό που περιζχει ραδιενεργό Αδενίνθ (A*). Μετά από αρκετζσ γενιζσ, ϊςτε όλεσ οι αδενίνεσ να είναι ραδιενεργζσ, θ καλλιζργεια μεταφζρεται ςε κρεπτικό υλικό με μθ ραδιενεργό αδενίνθ. Μετά από ζνα κφκλο αντιγραφισ γίνεται ανάλυςθ του DNA. Ροιο από τα παρακάτω αντιςτοιχεί ςε αυτό το DNA; Βαςιηόμενοι ςε αυτζσ τισ πλθροφορίεσ οι γονείσ του Γιάννθ: Α. είναι και οι δφο ομόηυγοι για το γονίδιο τθσ αλκαπτονουρίασ. Β. είναι και οι δφο ετερόηυγοι για το γονίδιο τθσ αλκαπτονουρίασ. Γ. δεν φζρουν το γονίδιο τθσ αλκαπτονουρίασ. Δ. δεν είναι αρκετζσ οι πλθροφορίεσ για να δοκεί απάντθςθ Το γενεαλογικό δζντρο απεικονίηει τον τρόπο κλθρονόμθςθσ ενόσ γνωρίςματοσ που ελζγχεται από ζνα ηεφγοσ αλλθλομόρφων Το 1902, ο Archibald Garrod δθμοςίευςε το πρϊτο παράδειγμα ενόσ υπολειπόμενου ανκρϊπινου γνωρίςματοσ, τθν αλκαπτονουρία, μία ςχετικά ακίνδυνθ διαταραχι κατά τθν οποία οι άνκρωποι παράγουν ςκοφρα οφρα. I. Ραρατθρϊντασ τα παρακάτω γενεαλογικά δζντρα διαπιςτϊνουμε ότι ο Γιάννθσ ζχει αλκαπτονουρία. Αν ο πατζρασ του, τα αδζλφια του πατζρα του και θ αδελφι του πατζρα του δεν ζχουν αλκαπτονουρία, ενϊ θ μθτζρα του πατζρα του ζχει, να επιλζξετε το γενεαλογικό δζντρο που περιγράφει αυτι τθ κατάςταςθ. II. Θ γιαγιά του Γιάννθ ζχει δφο αδελφοφσ και μία αδελφι. Ζνασ από τουσ αδελφοφσ τθσ ζχει αλκαπτονουρία και θ κόρθ του είναι μθτζρα του Γιάννθ. Αυτό ςθμαίνει ότι θ μθτζρα του Γιάννθ και ο Ροιο τετράγωνο Punnet αναπαριςτά με ςωςτό τρόπο τθ διαςταφρωςθ μεταξφ των γονζων τθσ γενιάσ I; 162. Το ζνηυμο πεψίνθ παράγεται ςτα κφτταρα του ςτομάχου αλλά όχι ςτα κφτταρα του λεπτοφ εντζρου ςτα οποία παράγεται ζνα διαφορετικό ζνηυμο, θ κρυψίνθ. Ο λόγοσ για τον οποίο τα κφτταρα του ςτομάχου και του λεπτοφ εντζρου παράγουν διαφορετικά ζνηυμα είναι ότι το γονίδιο που κωδικοποιεί τθν κρυψίνθ: Α. βρίςκεται ςτα κφτταρα του λεπτοφ εντζρου αλλά απουςιάηει από τα κφτταρα του ςτομάχου

29 29 Β. εκφράηεται ςτα κφτταρα του λεπτοφ εντζρου αλλά δεν εκφράηεται ςτα κφτταρα του ςτομάχου Γ. ζχει υποςτεί μετάλλαξθ ςτα κφτταρα του ςτομάχου Δ. ζχει καταςτραφεί από τθν πεψίνθ του ςτομάχου 163. Το ςχιμα παρακάτω απεικονίηει τμιμα DNA προκαρυωτικοφ κυττάρου ςτο οποίο υπάρχουν δφο γονίδια το Α και το Β (ςυμβολίηονται με ζντονθ γραμμι) και οι κζςεισ των υποκινθτϊν τουσ (ςυμβολίηονται με διακεκομμζνθ γραμμι). Κάκε ζνα από τα γονίδια αυτά είναι υπεφκυνο για τθ ςφνκεςθ πεπτιδικισ αλυςίδασ. Ι. Μθ κωδικόσ κλϊνοσ για το γονίδιο Αείναι Α. ο κλϊνοσ 1 5ϋ CCG. TTG 3ϋ Β. ο κλϊνοσ 1 3ϋ CCG. TTG 5ϋ Γ. ο κλϊνοσ 2 5ϋ GGC. AAC 3ϋ Δ. ο κλϊνοσ 2 3ϋ GGC. AAC 5ϋ ΙΙ. Μθ κωδικόσ κλϊνοσ για το γονίδιο Α είναι Α. ο κλϊνοσ 1 5ϋ GTA. AAT 3ϋ Β. ο κλϊνοσ 1 3ϋ GTA. AAT 5ϋ Γ. ο κλϊνοσ 2 3ϋ CAT. TTA 5ϋ Δ. ο κλϊνοσ 2 5ϋ CAT. TTA 3ϋ ΙΙΙ. Θ τοποκζτθςθ του γονιδίου Α ςτο ςχιμα είναι Α. ςτον κλϊνο Χ βρίςκεται θ αλλθλουχία του κλϊνου 1 με διάταξθ 5ϋ GΤΤ GCC 3ϋ Β. ςτον κλϊνο Χ βρίςκεται θ αλλθλουχία του κλϊνου 1 με διάταξθ 5ϋ GCC GTT 3ϋ Γ. ςτον κλϊνο Η βρίςκεται θ αλλθλουχία του κλϊνου 2 με διάταξθ 3ϋ GGC AAC 5ϋ Δ. ςτον κλϊνο Η βρίςκεται θ αλλθλουχία του κλϊνου 2 με διάταξθ 3ϋ CAA CGG 5ϋ IV. Θ τοποκζτθςθ του γονιδίου B ςτο ςχιμα είναι Α. ςτον κλϊνο Χ βρίςκεται θ αλλθλουχία του κλϊνου 2 με διάταξθ 5ϋ ATT TAC 3ϋ Β. ςτον κλϊνο Χ βρίςκεται θ αλλθλουχία του κλϊνου 1 με διάταξθ 5ϋ TTA CAT 3ϋ Γ. ςτον κλϊνο Η βρίςκεται θ αλλθλουχία του κλϊνου 2 με διάταξθ 3ϋ ATT TAC 5ϋ Δ. ςτον κλϊνο Η βρίςκεται θ αλλθλουχία του κλϊνου 1 με διάταξθ 3ϋ GTA AAT 5ϋ V. Σε ζνα από τα δφο γονίδια γίνεται μετάλλαξθ και ςυγκεκριμζνα αντικατάςταςθ βάςθσ, αποτζλεςμα τθσ οποίασ είναι θ αδυναμία ςχθματιςμοφ ςυμπλόκου ζναρξθσ μετάφραςθσ και τελικά θ ςφνκεςθ πεπτιδικισ αλυςίδασ. Θ μετάλλαξθ ζγινε ςτθν Α. 7θ βάςθ του γονιδίου Α Β. 23θ βάςθ του γονιδίου Α Γ. 7θ βάςθ του γονιδίου Β Δ. 35θ βάςθ του γονιδίου Β 164. Θ γονιδιωματικι βιβλιοκικθ ενόσ θπατικοφ κυττάρου περιλαμβάνει 5000 κλϊνουσ, ενϊ θ γονιδιωματικι βιβλιοκικθ ενόσ παγκρεατικοφ κυττάρου περιλαμβάνει κλϊνουσ. Θ διαφορά αυτι οφείλεται: Α. ςτο ότι ςτα παγκρεατικά κφτταρα εκφράηονται περιςςότερα γονίδια. Β. οι δφο βιβλιοκικεσ καταςκευάςτθκαν με τθ χριςθ διαφορετικϊν περιοριςτικϊν ενηφμων. Γ. ςτθ διαφορετικι ποςότθτα DNA ςτισ δφο αυτζσ κατθγορίεσ κυττάρων. Δ. ςτθ διαφορετικι ρφκμιςθ τθσ γονιδιακισ ζκφραςθσ Τα περιςςότερα κφτταρα ςτο ςϊμα μιασ φρουτόμυγασ (Drosophila) περιζχουν οκτϊ χρωμοςϊματα. Ρόςα χρωμοςϊματα υπάρχουν ςε αυτά τα κφτταρα ςτο τζλοσ τθσ μεςόφαςθσ του κυτταρικοφ κφκλου; Α. 4 Β. 8 Γ. 16 Δ Μόρια snrna και trna ςε ζνα ευκαρυωτικό κφτταρο ςυνυπάρχουν: Α. ςτα ριβοςϊματα και ςτον πυρινα. Β. μόνο ςτο κυτταρόπλαςμα. Γ. μόνο ςτον πυρινα. Δ. ςτο κυτταρόπλαςμα και ςτα μιτοχόνδρια Σε περίπτωςθ καταςτροφισ ι αλλαγισ τμιματοσ του DNA, παράγεται θ πρωτεΐνθ p53 θ οποία αναςτζλλει τθ μιτωτικι διαίρεςθ και ενεργοποιεί μθχανιςμοφσ για τθν επιδιόρκωςθ του κατεςτραμμζνου DNA ι τθν απόπτωςθ του κυττάρου. Το γονίδιο για τθν παραγωγι τθσ p53 είναι: Α. ογκογονίδιο Β. ογκοκαταςταλτικό Γ. πρωτοογκογονίδιο Δ. καρκινικό γονίδιο 168. Στο γενετικό υλικό ενόσ βακτθρίου που δεν διακζτει πλαςμίδιο υπάρχουν Χ ng 30 P. Το βακτιριο τοποκετείται ςε κρεπτικό υλικό, ςτο οποίο ο

30 30 υπάρχει μόνο με τθ μορφι του ραδιενεργοφ ιςοτόπου του 32. I. Στα βακτιρια τθσ αποικίασ μετά από 10 διαιρζςεισ, πόςα ng 30 P αναμζνεται να υπάρχουν; (κεωροφμε ότι τα βακτιρια αναπαράγονται με ίδιο ρυκμό) Α. Χ ng 30 P Β. 512Χ ng 30 P Γ. 1024Χ ng 30 P Δ. 10Χ ng 30 P II. Στα βακτιρια τθσ αποικίασ μετά από 10 διαιρζςεισ, πόςα βακτιρια που κα ζχουν αποκλειςτικά 32 P, αναμζνεται να υπάρχουν; Α. 102 Β Γ Δ Απομονϊςαμε από ζνα θπατικό και ζνα επικθλιακό κφτταρο, του ίδιου ποντικοφ, το ςφνολο των mrna και trna τουσ. Στα μόρια αυτά γίνεται μελζτθ των αλλθλουχιϊν τουσ. Διαπιςτϊκθκε ότι τα μόρια αυτά είναι: Α. διαφορετικά και ςτα δφο κφτταρα. Β. ίδια και ςτα δφο κφτταρα. Γ. ίδια τα mrna και διαφορετικά τα trna τουσ. Δ. ίδια τα trna και διαφορετικά τα mrna τουσ Στουσ ανκρϊπουσ θ νευροϊνωμάτωςθ τφπου 1 (NF-1) είναι μια κλθρονομικι διαταραχι κατά τθν οποία δθμιουργοφνται καρκινικοί όγκοι ςτο νευρικό ιςτό. Θ ΝF-1 είναι αυτοςωμικι επικρατισ διαταραχι. Ζνασ άντρασ με NF-1 ζχει ζνα παιδί χωρίσ το γνϊριςμα. Θ μθτζρα του παιδιοφ δεν ζχει τθ διαταραχι αυτι. Θ πικανότθτα το επόμενο παιδί αυτϊν των γονζων να ζχει NF-1 είναι: Α. 0 Β. ½ Γ. ¼ Δ. ¾ 171. Μζςω των τεχνικϊν τθσ Γενετικισ Μθχανικισ οι βιολόγοι- ερευνθτζσ ειςιγαγαν ςε μιτοχόνδρια τμιμα DNA που ζχει όλεσ τισ απαραίτθτεσ και μεταφραηόμενεσ αλλθλουχίεσ, ϊςτε να ςυντεκεί μια πολυπεπτιδικι αλυςίδα ςτο μιτοχόνδριο, θ οποία φυςιολογικά ςυντίκεται ςτο κυτταρόπλαςμα και αποτελείται από 123 αμινοξζα. Αυτό το τμιμα DNA προερχόταν από τον πυρινα φυςιολογικοφ ανκρϊπινου κυττάρου. Στα μιτοχόνδρια, όμωσ, ςε όλεσ τισ περιπτϊςεισ παραγόταν μία πολυπεπτιδικι αλυςίδα 131 αμινοξζων. Αυτό μπορεί να οφείλεται ςτο ότι: Α. θ ειςαγωγι του γονιδίου ςτο μιτοχόνδριο προκαλεί τθ μετάλλαξι του. Β. προκαλείται κάποιο λάκοσ κατά τθν αντιγραφι αυτοφ του γονιδίου ςτο εςωτερικό του μιτοχονδρίου. Γ. ο μθχανιςμόσ τθσ μετάφραςθσ διαφοροποιείται μεταξφ κυτταροπλάςματοσ και μιτοχονδρίων. Δ. πραγματοποιικθκε με λανκαςμζνο τρόπο θ ωρίμανςθ Ο Ρερικλισ και θ Αςπαςία απζκτθςαν το πρϊτο ςτουσ παιδί, τον Κυριάκο, με ομάδα αίματοσ Ο και ζηουσ κετικό. Θ Αςπαςία γνωρίηει ότι ζχει αίμα ομάδασ Α και ζηουσ αρνθτικό. Ο Ρερικλισ δε γνωρίηει τθ δικι του ομάδα αίματοσ παρά μόνο ότι θ μθτζρα του και ο πατζρασ του ζχουν αίμα ομάδασ Β και ζηουσ κετικό. Ο Ρερικλισ και θ Αςπαςία δεν μποροφν να εξθγιςουν τθν ομάδα αίματοσ και τον παράγοντα ζηουσ του παιδιοφ τουσ. Ο παράγων ζηουσ είναι μονογονιδιακόσ χαρακτιρασ, κλθρονομείται με αυτοςωμικό τρόπο και θ παρουςία του οφείλεται ςε επικρατζσ γονίδιο. Ροια από τισ παρακάτω προτάςεισ είναι θ καλφτερθ εξιγθςθ; Α. Οι γονότυποι του Ρερικλι είναι I Β i Rr, τθσ Αςπαςίασ είναι I Α I Α rr και του Κυριάκου είναι ii Rr. Β. Οι γονότυποι του Ρερικλι είναι I Β i RR, τθσ Αςπαςίασ είναι I Α I Α rr και του Κυριάκου είναι ii RR. Γ. Επειδι οι γονείσ του Ρερικλι ζχουν και οι δφο αίμα ομάδασ Β, ο Ρερικλισ δεν μπορεί να είναι πατζρασ του Κυριάκου. Δ. Οι γονότυποι του Ρερικλι είναι I Β i RR, τθσ Αςπαςίασ είναι IΑi rr και του Κυριάκου είναι ii Rr Ζνασ μθ φυςιολογικόσ ηωικόσ οργανιςμόσ δθμιουργικθκε με αμφιγονικι αναπαραγωγι. Το ςχιμα δείχνει ζνα ςωματικό κφτταρο του παραπάνω οργανιςμοφ. Ζνασ από τουσ γαμζτεσ που προςζφερε γενετικό υλικό για τθ δθμιουργία του δεν είχε φυςιολογικό αρικμό χρωμοςωμάτων. Ρόςα χρωμοςϊματα περιείχε αυτόσ ο μθ φυςιολογικόσ γαμζτθσ; Α. 4 Β. 5 Γ. 6 Δ Εάν μια αμοιβάδα είχε περιςςότερο DNA από ζνα ανκρϊπινο κφτταρο, κα μποροφςαμε να υποκζςουμε: Α. Θ αμοιβάδα είναι λειτουργικά πιο πολφπλοκθ από τον άνκρωπο. Β. Θ αμοιβάδα ζχει περιςςότερα είδθ μεταγραφικϊν παραγόντων από τον άνκρωπο. Γ. Θ αμοιβάδα ζχει μεγαλφτερο αρικμό χρωμοςωμάτων από τον άνκρωπο. Δ. Θ αμοιβάδα ζχει περιςςότερο μθ λειτουργικό DNA από τον άνκρωπο Ζλλειψθ DNA δεςμάςθσ κατά τθν αντιγραφι ενόσ μορίου DNA κα οδθγοφςε ςε μόρια που κα μποροφςαν να απεικονιςτοφν ωσ εξισ:

31 Για να μπορζςει να δράςει θ DNA πολυμεράςθ απαιτοφνται: Α. πρωταρχικό τμιμα οπωςδιποτε RNA και μονόκλωνθ δεςοξυριβονουκλεοτιδικι αλυςίδα «καλοφπι». Β. 3ϋ ελεφκερο ΟΘ ολιγονουκλεοτιδίου και μονόκλωνθ δεςοξυριβονουκλεοτιδικι αλυςίδα «καλοφπι». Γ. 3ϋ ελεφκερο ΟΘ ολιγονουκλεοτιδίου και μονόκλωνθ είτε δεςοξυριβονουκλεοτιδικι είτε ριβονουκλεοτιδικι αλυςίδα «καλοφπι». Δ. πρωταρχικό τμιμα είτε RNA είτε DNA και μονόκλωνθ είτε δεςοξυριβονουκλεοτιδικι είτε ριβονουκλεοτιδικι αλυςίδα «καλοφπι» Αν μονογονιδιακό χαρακτθριςτικό ςχετίηεται με πολλαπλά αλλθλόμορφα γονίδια με ςχζςθ επικράτειασ Β>b>β, ο αρικμόσ των διαφορετικϊν γονότυπων και φαινοτφπων είναι αντίςτοιχα (δεν λαμβάνουμε υπόψθ πικανι επίδραςθ περιβάλλοντοσ): Α. 6 και 6 Β. 6 και 3 Γ. 3 και 3 Δ. 3 και Το παρακάτω ςχεδιάγραμμα αναπαριςτά τθ ςφνκεςθ του DNA ςε κθλιά αντιγραφισ όπωσ το ζχει ςχεδιάςει ζνασ μακθτισ. Με τα βζλθ δείχνεται θ ςυνεχισ ι αςυνεχισ ςφνκεςθ DNA ςτουσ νεοςυντικζμενουσ κλϊνουσ. Το διάγραμμα: 179. Ρυρινασ κυττάρου που απομονϊκθκε από φφλλο ενόσ φυτοφ, περιζχει ςτο τζλοσ τθσ μεςόφαςθσ 216 μόρια DNA. I. Ρόςα μόρια DNA κα περιζχει ζνα κφτταρο τθσ ρίηασ του φυτοφ ςτθν αρχι τθσ μεςόφαςθσ; Α. 216 Β. 108 Γ. 54 Δ. 27 II. Ρόςα ηεφγθ ομολόγων χρωμοςωμάτων κα ζχει ζνα άωρο γεννθτικό κφτταρο που βρίςκεται ςτθν πρόφαςθ Ι; Α. 216 Β. 108 Γ. 54 Δ. 27 III. Ρόςα μόρια DNA κα περιζχει ζνα κφτταρο πριν τθν ολοκλιρωςθ τθσ πρϊτθσ μειωτικισ διαίρεςθσ; Α. 216 Β. 108 Γ. 54 Δ Θ παρακάτω εικόνα απεικονίηει ςχθματικά τθ δθμιουργία κλϊνου. Να επιλζξετε το ςωςτό ςυνδυαςμό Χ και Υ τθσ εικόνασ. Α. Είναι ςωςτό Β. Είναι λάκοσ θ κζςθ των ςυνεχϊν και αςυνεχϊν τμθμάτων Γ. Είναι λάκοσ, γιατί θ ςφνκεςθ του DNA ζχει προςανατολιςμό 3ϋπροσ 5ϋ Δ. Είναι λάκοσ, γιατί θ ςφνκεςθ του DNA γίνεται ςτουσ δφο κλϊνουσ με λανκαςμζνο προςανατολιςμό 181. Σε κομμάτι δίκλωνου DNA, που ςχθματίςτθκε με τθ δράςθ τθσ EcoRI, ανιχνεφτθκαν 160 φωςφοδιεςτερικοί δεςμοί. Τα νουκλεοτίδια ςε αυτό το DNA είναι: Α. 160 Β. 158 Γ. 162 Δ Βακτθριακόσ κλϊνοσ, που καλλιεργείται ςε βιοαντιδραςτιρα, παράγει ζνα ζνηυμο Ε1 το οποίο μετατρζπει τθν ουςία Α ςτθν ουςία Β. Ο ίδιοσ βακτθριακόσ κλϊνοσ παράγει και άλλο ζνηυμο Ε2 το οποίο, αντίςτροφα, μετατρζπει τθν ουςία Β ςτθν ουςία Α. Για κάκε μόριο τθσ ουςίασ Α παράγεται ζνα μόριο τθσ ουςίασ Β και το αντίςτροφο. Οι ςχετικζσ

32 32 δραςτθριότθτεσ των ενηφμων Ε1 και Ε2 δίνονται ςτο παρακάτω διάγραμμα. Σε ποια κερμοκραςία πρζπει να γίνει θ αφξθςθ του πλθκυςμοφ των βακτθρίων ςτον βιοαντιδραςτιρα προκειμζνου να επιτευχκεί θ μζγιςτθ παραγωγι τθσ ουςίασ Β; Α. 10 Ο C Β. 20 Ο C Γ. 30 Ο C Δ. 35 Ο C 183. Οι χθμικζσ ενϊςεισ Χ, Ψ και Η εντοπίςτθκαν ςτθν ίδια μεταβολικι οδό ςτα κφτταρα του καλαμποκιοφ. Διαςταυρϊκθκαν δφο ομόηυγα φυτά καλαμποκιοφ. Το ζνα ςυνκζτει τθν ζνωςθ Χ και το άλλο τθν ζνωςθ Ψ. Τα φυτά τθσ F1 γενιάσ ςυνκζτουν τισ Χ, Ψ και Η ενϊςεισ. Τα φυτά τθσ F2 γενιάσ εμφάνιςαν τουσ παρακάτω φαινοτφπουσ με τισ αντίςτοιχεσ ςυχνότθτεσ: 9/16 ςυνκζτουν τισ Χ, Ψ και Η 3/16 ςυνκζτουν μόνο τθν Χ 3/16 ςυνκζτουν μόνο τθν Ψ 1/16 δεν ςυνκζτει καμία ζνωςθ Ροια μεταβολικι οδόσ περιγράφει καλφτερα τθν ςφνκεςθ των Χ, Ψ και Η; αςκζνεια υπάρχουν ςτα ςωματικά κφτταρα του ΙΙΙ- 2 κατά τθν διάρκεια τθν μετάφαςθσ; Α. 1 Β. 2 Γ. 3 Δ. 4 II. Ρόςα μόρια DNA υπάρχουν ςτον καρυότυπο του ΙΙΙ-2; Α. 46 Β. 45 Γ. 92 Δ Θ μελζτθ των γενεαλογικϊν δζντρων όπωσ είναι γνωςτό βοθκά ςτθν διαπίςτωςθ του τρόπου που κλθρονομείται μία αςκζνεια. Ο αποκλειςμόσ του τρόπου κλθρονομικότθτασ μιασ αςκζνειασ μπορεί να γίνει από μελζτθ ςυγκεκριμζνων διαςταυρϊςεων, οι οποίεσ είναι ικανζσ να δϊςουν τθν πλθροφορία. Ραρακάτω φαίνονται τζςςερα γενεαλογικά δζντρα όπου οι φαινότυποι των ατόμων εμφανίηουν διαφορετικι κλθρονομικι αςκζνεια. Ροιο τρόπο κλθρονομικότθτασ αποκλείει κάκε ζνα από τα τζςςερα δζντρα; Α. (1) αυτοςωμικό επικρατζσ, (2) αυτοςωμικό υπολειπόμενο, (3) φυλοςφνδετο υπολειπόμενο, (4) φυλοςφνδετο υπολειπόμενο. Β. (1) αυτοςωμικό επικρατζσ, (2) αυτοςωμικό υπολειπόμενο, (3) φυλοςφνδετο υπολειπόμενο, (4) αυτοςωμικό επικρατζσ. Γ. (1) φυλοςφνδετο υπολειπόμενο, (2) αυτοςωμικό επικρατζσ, (3) αυτοςωμικό υπολειπόμενο, (4) αυτοςωμικό υπολειπόμενο. Δ. (1) αυτοςωμικό υπολειπόμενο, (2) φυλοςφνδετο υπολειπόμενο, (3) αυτοςωμικό επικρατζσ, (4) φυλοςφνδετο υπολειπόμενο Στο διπλανό ςχιμα φαίνεται το αποτζλεςμα μιασ τεχνικισ τθσ Γενετικισ Μθχανικισ Δίνεται το παρακείμενο γενεαλογικό δζντρο ςτο οποίο τα μαυριςμζνα ςφμβολα δθλϊνουν μια ςπάνια φυλοςφνδετθ αςκζνεια. Το άτομο ΙΙΙ-2 είναι ςτείρο. I. Ρόςα αντίγραφα του γονιδίου που προκαλεί τθν I. Για τθν παραγωγι τθσ ανκρϊπινθσ προϊνςουλίνθσ απαιτείται: Α. εργαςτθριακι καλλιζργεια με ςτερεό κρεπτικό υλικό. Β. βιομθχανικι καλλιζργεια με υγρό κρεπτικό υλικό. Γ. εργαςτθριακι καλλιζργεια με υγρό κρεπτικό υλικό. Δ. βιομθχανικι καλλιζργεια με ςτερεό κρεπτικό

33 33 υλικό. II. Για τθν παραγωγι προϊνςουλίνθσ το αναςυνδυαςμζνο πλαςμίδιο πρζπει να ειςαχκεί: Α. ςε βακτθριακό κλϊνο που φζρει πλαςμίδια. Β. ςε βακτθριακό κλϊνο που δεν φζρει πλαςμίδια. Γ. ςε βακτιριο που δεν φζρει πλαςμίδια. Δ. ςε βακτιριο που φζρει πλαςμίδια. III. Ροιο χθμικό μόριο πιρε μζροσ ςτθ ςφνδεςθ του cdna του γονιδίου τθσ ινςουλίνθσ για τθν κλωνοποίθςθ του ςτο πλαςμίδιο; Α. ζνα εξειδικευμζνο ςάκχαρο Β. ζνα εξειδικευμζνο ζνηυμο Γ. μία ορμόνθ Δ. ζνα αντίςωμα IV. Για τθν ςυςκευαςία και διανομι του λειτουργικοφ ενηφμου ςτουσ τελικοφσ καταναλωτζσ απαιτείται επιπλζον θ: Α. μετα-μεταφραςτικι τροποποίθςθ αποκοπισ του καρβόξυ-τελικοφ άκρου από τθν παραγόμενθ πρωτεΐνθ. Β. ενηυμικι αποκοπι του άμινο-τελικοφ άκρου από τθν παραγόμενθ πρωτεΐνθ με τθν EcoRI. Γ. μετα-μεταφραςτικι τροποποίθςθ αποκοπισ του ενδιάμεςου πεπτιδίου από τθν παραγόμενθ πρωτεΐνθ. Δ. ενηυμικι αποκοπι του ενδιάμεςου πεπτιδίου από τθν παραγόμενθ πρωτεΐνθ με τθν EcoRI Σχετικά με τθ β-καλαςςαιμία να τοποκετιςετε τα παρακάτω γεγονότα ςτθ ςωςτι χρονικι ςειρά α. Γεννιζται θ Μαρία που κλθρονομεί μεταλλαγμζνο γονίδιο. β. Το οξυγόνο δεν επαρκεί ςτουσ ιςτοφσ. γ. Θ Κατερίνα παρουςιάηει αιματοκρίτθ 43, δείκτθ ότι παράγει φυςιολογικι ποςότθτα αιμοςφαιρίνθσ HbA. δ. Ραράγεται τροποποιθμζνθ β πολυπεπτιδικι αλυςίδα. ε. Θ Μαρία παρουςιάηει αυξθμζνθ ςφνκεςθ HbA2. ςτ. Σε άωρο γεννθτικό κφτταρο ςυμβαίνει αντικατάςταςθ ενόσ νουκλεοτιδίου με άλλο. η. Θ αιμοςφαιρίνθ παρουςιάηει μειωμζνθ ικανότθτα μεταφοράσ οξυγόνου. θ. Συντίκεται τροποποιθμζνο mrna Να τοποκετιςετε τα παρακάτω μόρια DNA κατά ςειρά αφξουςασ αποδιάταξθσ μετά από επίδραςθ ςτα μόρια μεγάλθσ ποςότθτασ κερμότθτασ Ζνασ άντρασ παρουςιάηει μία μιτοχονδριακι διαταραχι που προκαλείται από μία μιτοχονδριακι μετάλλαξθ και θ γυναίκα του είναι ζγκυοσ. Το ηευγάρι κζλει να κάνει ζνα προγεννθτικό τεςτ για να προςδιοριςτεί θ πικανότθτα να παρουςιάςει το παιδί τουσ τθν ίδια διαταραχι. Ο γενετικόσ ςφμβουλοσ λζει ςτο ηευγάρι ότι θ πικανότθτα είναι: Α. 100% Β. 50% Γ. 0% Δ. 25% 190. Το διάγραμμα περιλαμβάνει τζςςερα αναςυνδυαςμζνα πλαςμίδια. Σε κακζνα από τα πλαςμίδια αυτά ςθμειϊνεται θ κζςθ ζναρξθσ τθσ αντιγραφισ (Ori) και θ κζςθ του υποκινθτι (P) για τθν ζκφραςθ του ξζνου γονιδίου. Σε ποιο από τα τζςςερα πλαςμίδια είναι δυνατι θ ζκφραςθ του ξζνου γονιδίου; 191. Ρλαςμίδια φζρουν γονίδιο ανκεκτικότθτασ ςτο αντιβιοτικό ςτρεπτομυκίνθ και γονίδιο του οποίου το πρωτεϊνικό προϊόν είναι ζνηυμο (β -γαλακτοηιδάςθ), που μετατρζπει μία άχρωμθ ουςία (Χ-gal), που υπάρχει ςτο κρεπτικό υλικό και τθν οποία προςλαμβάνει το βακτιριο, ςε μπλε. Τα πλαςμίδια ζχουν τθν αλλθλουχία που κόβει θ EcoRI μζςα ςτο γονίδιο που παράγει το ζνηυμο. Μετά τον αναςυνδυαςμό των πλαςμιδίων με τμιματα DNA και τθν ειςαγωγι τουσ ςε βακτιρια ξενιςτζσ (μεταςχθματιςμόσ) πιραμε τρεισ πλθκυςμοφσ βακτθρίων. Ροια από τα παρακάτω βακτιρια πρζπει να επιλεγοφν με χριςθ του αντιβιοτικοφ ςτρεπτομυκίνθ για να αποτελζςουν μζροσ γονιδιωματικισ βιβλιοκικθσ.

34 34 Α. Βακτιρια μθ ανκεκτικά ςτθ ςτρεπτομυκίνθ. Β. Βακτιρια μπλε και ανκεκτικά ςτθ ςτρεπτομυκίνθ. Γ. Βακτιρια άχρωμα και ανκεκτικά ςτθ ςτρεπτομυκίνθ. Δ. κανζνα βακτιριο από τα παραπάνω δεν μπορεί να αποτελεί μζροσ τθσ γονιδιωματικισ βιβλιοκικθσ Να αξιολογιςετε ωσ ςωςτζσ (Σ), είτε λανκαςμζνεσ (Λ) τισ παρακάτω προτάςεισ: α. Το ςυνολικό γενετικό υλικό τθσ Dolly (του πρϊτου βιϊςιμου κλωνοποιθμζνου κθλαςτικοφ) ιταν πιςτό αντίγραφο του γενετικοφ υλικοφ του εξάχρονου προβάτου, από το οποίο χρθςιμοποιικθκε - για τθν κλωνοποίθςθ - πυρινασ κυττάρου του μαςτικοφ του αδζνα. β. Θ ανάλυςθ τθσ αλλθλουχίασ του γονιδιϊματοσ ενόσ ενιλικα (από κφτταρα του αίματοσ) ζδειξε ζλλειψθ 200 διαδοχικϊν ηευγϊν βάςεων. Αυτι θ μετάλλαξθ κα κλθρονομθκεί οπωςδιποτε και ςτουσ απογόνουσ του. γ. Μια cdna βιβλιοκικθ περιζχει το ςφνολο όλων των mrna, τα οποία προκφπτουν από τθν μεταγραφι των γονιδίων που εκφράηονται ςε ζνα ςυγκεκριμζνο κυτταρικό τφπο μια δεδομζνθ χρονικι ςτιγμι, υπό μορφι δίκλωνων cdna ςυνδεδεμζνων ςε φορείσ κλωνοποίθςθσ πλαςμίδια ι DNA φάγων. δ. Στο γενετικό υλικό εςϊνια εντοπίηονται μόνο ςτα ευκαρυωτικά κφτταρα. ε. Στο οπερόνιο τθσ λακτόηθσ εντοπίηονται περιοχζσ αντίςτοιχεσ με τισ 5ϋκαι 3ϋ αμετάφραςτεσ περιοχζσ των mrna που αυτό παράγει. ςτ. Θ προςκικθ εννζα διαδοχικϊν βάςεων, που δεν περιζχουν κωδικόνιο λιξθσ, ςε ζνα ςυνεχζσ γονίδιο οδθγεί πάντα ςτθ ςφνκεςθ ενόσ πεπτιδίου με τρία επιπλζον αμινοξζα. η. Για τθν παραγωγι μονοκλωνικϊν αντιςωμάτων με εφαρμογζσ ςτουσ ανκρϊπινουσ πλθκυςμοφσ χρθςιμοποιοφνται και κφτταρα ποντικοφ Θ μθ κωδικι αλυςίδα του 10ου εξωνίου του γονιδίου τθσ κυςτικισ ίνωςθσ (CFTR), που ζχει 24 εξϊνια, ζχει τθν αλλθλουχία βάςεων: GCTTACGGCACCGTTAGGACTAAACGA Πλα τα νουκλεοτίδια του εξωνίου είναι τριπλζτεσ. Ι. Θ μεταγραφόμενθ αλυςίδα είναι: Α. 5 GCTTACGGCACCGTTAGGACTAAACGA 3ϋ Β. 3 GCTTACGGCACCGTTAGGACTAAACGA 5ϋ Γ. 5 CGAATGCCGTGGCAATCCTGATTTGCT 3ϋ Δ. 3 CGAATGCCGTGGCAATCCTGATTTGCT 5ϋ ΙΙ. Να αιτιολογιςετε τθν επιλογι που κάνατε Για τθν κατευκυνόμενθ κλωνοποίθςθ του γονιδίου Χ ςε πλαςμίδιο, χρθςιμοποιοφνται δφο περιοριςτικζσ ενδονουκλεάςεσ, Ε1 και Ε2. Το πλαςμίδιο περιζχει δφο γονίδια ανκεκτικότθτασ ςτα αντιβιοτικά αμπικιλίνθ (AmpR) και καναμυκίνθ (KanR). Τα μεταςχθματιςμζνα βακτιρια αναπτφςςονται ςε τρία τρυβλία, 1, 2, και 3. Το τρυβλίο 1 περιζχει κρεπτικό υλικό και αμπικιλίνθ, το τρυβλίο 2 περιζχει κρεπτικό υλικό, αμπικιλίνθ και καναμυκίνθ, ενϊ το τρυβλίο 3 περιζχει κρεπτικό υλικό και καναμυκίνθ. Ι. Βακτθριακζσ αποικίεσ με αναςυνδυαςμζνα πλαςμίδια κα υπάρχουν: Α. μόνο ςτο τρυβλίο 1 Β. μόνο ςτο τρυβλίο 2 Γ. ςτα τρυβλία 1 και 2 Δ. ςε κανζνα από τα τρυβλία 1 και 2 ΙΙ. Στο τρυβλίο 3 περιμζνουμε να αναπτυχκοφν: Α. όλεσ οι αρχικζσ αποικίεσ Β. μόνο οι αποικίεσ με τα μεταςχθματιςμζνα βακτιρια με αναςυνδυαςμζνο πλαςμίδιο Γ. μόνο οι αποικίεσ με τα μεταςχθματιςμζνα βακτιρια με μθ αναςυνδυαςμζνο πλαςμίδιο Δ. καμία αποικία 195. Από τθν παρακάτω αλλθλουχία του μθ κωδικοφ κλϊνου ενόσ γονιδίου, παράγεται φυςιολογικό πεπτίδιο. DNA: 3ϋ..CGTACGGCATGTTATGGCGAACTCAACTTT.. 5ϋ Ζνα μεταλλαγμζνο αλλθλόμορφο του γονιδίου που φζρει μία γονιδιακι μετάλλαξθ παράγει το παρακάτω πεπτίδιο. Θ 2 Ν met pro tyr asn thr ala trp ser COOH α. Να γράψετε τθν αλλθλουχία του DNA του μεταλλαγμζνου αλλθλόμορφου. β. Nα ορίςετε τον τφπο τθσ μετάλλαξθσ Σε μερικοφσ ανκρϊπουσ, θ ζλλειψθ ςυγκεκριμζνων ενηφμων προκαλεί αςκζνειεσ. Οι επιςτιμονεσ προςπακοφν να χρθςιμοποιιςουν βακτιρια για τθν παραγωγι αυτϊν των ενηφμων για τθ κεραπεία αυτϊν των αςκενϊν. Ροια γραμμι του παρακάτω πίνακα περιγράφει καλφτερα τθ ςειρά των βθμάτων που ςυνικωσ ακολουκοφν οι επιςτιμονεσ;

35 Στο ίδιο βακτιριο ειςάγονται ταυτόχρονα δφο αναςυνδυαςμζνα πλαςμίδια: το πλαςμίδιο Α και το πλαςμίδιο Β. Στο πλαςμίδιο Α ζχει ειςαχκεί το ευκαρυωτικό γονίδιο α, μαηί με τον υποκινθτι του, ςε κζςθ που βρίςκεται μακριά από υποκινθτζσ γονιδίων του πλαςμιδίου. Το πλαςμίδιο Β φζρει το ευκαρυωτικό γονίδιο β, χωρίσ υποκινθτι, το οποίο όμωσ ζχει ειςαχκεί δίπλα ςτον υποκινθτι ενόσ γονιδίου του πλαςμιδίου. Θεωρϊντασ ότι τα γονίδια αποτελοφνται μόνο από εξϊνια, ποια από τισ προτάςεισ που ακολουκοφν είναι θ ςωςτι: Α. ςτο βακτιριο κα παραχκοφν και οι δφο πρωτεΐνεσ. Β. ςτο βακτιριο κα παραχκεί μόνο θ πρωτεΐνθ α. Γ. ςτο βακτιριο κα παραχκεί μόνο θ πρωτεΐνθ β. Δ. δεν κα παραχκεί καμία από τισ δφο πρωτεΐνεσ Ζχοντασ ςτθ διάκεςι μασ ςτο εργαςτιριο αμιγι ςτελζχθ για ζνα ςυγκεκριμζνο χαρακτθριςτικό τα αλλθλόμορφα του οποίου ζ- χουν ςχζςθ επικρατοφσ υπολειπόμενου, για να διαπιςτϊςουμε αν το υπεφκυνο γονίδιο είναι φυλοςφνδετο ι αυτοςωμικό Α. αρκεί να διαςταυρϊςουμε επικρατι αρςενικά με υπολειπόμενα κθλυκά και να παρατθριςουμε τθ φαινοτυπικι αναλογία ςτθν F1 Β. αρκεί να διαςταυρϊςουμε υπολειπόμενα αρςενικά με επικρατι κθλυκά και να παρατθριςουμε τθ φαινοτυπικι αναλογία ςτθν F1 Γ. αρκεί να διαςταυρϊςουμε υπολειπόμενα αρςενικά με υπολειπόμενα κθλυκά και να παρατθριςουμε τθ φαινοτυπικι αναλογία ςτθν F1 Δ. πρζπει να καταςκευαςτεί καρυότυποσ 199. Στο ςχιμα απεικονίηεται θ αρχι τθσ αντιγραφισ ςε μια κθλιά DNA, κακϊσ και θ αλλθλουχία των βάςεων τθσ ςκιαςμζνθσ περιοχισ (περιοχι 1) Ι.Θ αλυςίδα τθσ περιοχισ 1 που αντιςτοιχεί ςτον κλϊνο που αντιγράφεται ςυνεχϊσ είναι: Α. πάντοτε θ (α) Β. πάντοτε θ (β) Γ. εναλλάξ θ (α) ι θ (β) Δ. τυχαία θ (α) ι θ (β) ΙΙ. Ο κλϊνοσ του DNA που κα ςυντεκεί αςυνεχϊσ ςτθν περιοχι 1 είναι: Α. 5 CTGACTGACA 3 Β. 5 GACTGACTGT 3 Γ. 3 CTGACTGACA 5 Δ. 3 GACTGACTGT 5ϋ 200. Σε καρυότυπο ενόσ ανκρϊπου που ελιφκθ από άωρα γεννθτικά κφτταρά του, εντοπίηονται δφο μθ φυςιολογικά 3 και 21 που φζρουν αμοιβαία μετατόπιςθ, όπωσ φαίνεται ςτθν εικόνα. Οι γαμζτεσ που παράγει το άτομο από άωρα κφτταρα που φζρουν τθν μετατόπιςθ: Α. είναι όλοι φυςιολογικοί. Β. το 50% φζρει τθν αμοιβαία μετατόπιςθ. Γ. το 25% φζρει φυςιολογικά 3 και 21 χρωμοςϊματα. Δ. το 25% μόνο, φζρει λάκοσ γενετικι πλθροφορία H μυϊκι δυςτροφία Duchenne (DMD) προκαλείται από ζνα υπολειπόμενο γονίδιο που βρίςκεται ςτο ανκρϊπινο χρωμόςωμα Χ. Οι αςκενείσ ζχουν μυσ που γίνονται πιο αδφναμοι με τθν πάροδο του χρόνου, επειδι ζχουν μερικι ζλλειψθ ι απουςία δυςτροφίνθσ, μιασ πρωτεΐνθσ των μυϊν. Σπάνια ηουν μετά τα 20 χρόνια. Ρόςο πικανό είναι για μια γυναίκα να ζχει αυτι τθν κατάςταςθ; Α. Οι γυναίκεσ δεν μποροφν να ζχουν αυτι τθν κατάςταςθ. Β. Θ κόρθ ενόσ αςκενι άντρα με DMD εμφανίηει πάντοτε τθν αςκζνεια. Γ. Κάκε παιδί ενόσ προςβεβλθμζνου πατζρα και μιασ μθτζρασ φορζα ζχει πικανότθτα ¼ να ζχει αυτι τθν κατάςταςθ. Δ. Λιγότερο ςυχνά μια γυναίκα κα ζχει αυτι τθν αςκζνεια.

36 Ασ υποκζςουμε ότι προςπακείτε να ειςάγετε ζνα γονίδιο ςε ζνα πλαςμίδιο. Σασ δίνεται ζνα τμιμα DNA ςτο οποίο περιζχεται ζνα γονίδιο. Το τμιμα DNA ζχει κοπεί με τθν περιοριςτικι ενδονουκλεάςθ X. Το γονίδιο που κζλετε να ειςάγετε ζχει κζςεισ και ςτα δφο άκρα που μποροφν να κοποφν από τθν περιοριςτικι ενδονουκλεάςθ Υ. Ζχετε ζνα πλαςμίδιο με μία μοναδικι κζςθ για το Υ, αλλά όχι για το Χ. Θ ςτρατθγικι ςασ κα πρζπει να είναι: Α. να τοποκετιςετε τα κραφςματα που ζχουν κοπεί με τθν περιοριςτικι ενδονουκλεάςθ Χ απευκείασ ςτο πλαςμίδιο χωρίσ να κόψετε το πλαςμίδιο. Β. κόβετε το πλαςμίδιο με τθν περιοριςτικι ενδονουκλεάςθ Χ και τοποκετείτε τα κραφςματα που ζχετε κόψει με τθν περιοριςτικι ενδονουκλεάςθ Χ μζςα ςτο πλαςμίδιο. Γ. κόβετε το DNA με τθν περιοριςτικι ενδονουκλεάςθ Υ και τοποκετείτε αυτά τα κραφςματα μζςα ςτο πλαςμίδιο που ζχετε κόψει με το ίδιο ζνηυμο. Δ. κόβετε το πλαςμίδιο δφο φορζσ με τθν περιοριςτικι ενδονουκλεάςθ Υ και ςυνδζετε τα δφο κραφςματα ςτα άκρα των κραυςμάτων του DNA που ζχετε κόψει με τθν περιοριςτικι ενδονουκλεάςθ Χ Οι παρακάτω δφο πρωτεΐνεσ Α και Β διαφζρουν ωσ προσ τθν παρουςιαηόμενθ αλλθλουχία αμινοξζων. Για τα γονίδια Α και Β μπορεί να ιςχφει ότι, το ζνα είναι το φυςιολογικό και το άλλο προζκυψε με: Α. Γονιδιακι μετάλλαξθ αντικατάςταςθσ ηεφγουσ βάςεων. Β. Γονιδιακι μετάλλαξθ με προςκικθ δφο ηευγϊν βάςεων. Γ. Αναςτροφι τμιματοσ του γονιδίου. Δ. Γονιδιακι μετάλλαξθ που αλλάηει το βιμα τριπλζτασ Δίνεται θ κωδικι αλυςίδα ενόσ ανκρϊπινου γονιδίου. 5ϋAΤΤAAΤGΤGCAΤCΤCAΑΤAGGΤGΤGAGCCGACAΤΤGCΤ AAAGCCG3 Το γονίδιο εκφράςτθκε ςε βακτθριακά κφτταρα και παραςκεφαςε το πεπτίδιο: H 2 N - met - cys - ile - ser - ile - gly - val - ser - arg - his - cys - COOH Από το διαφοροποιθμζνο ανκρϊπινο κφτταρο, ςτο οποίο εκφραηόταν το παραπάνω γονίδιο, α- πομονϊκθκε το παρακάτω πεπτίδιο, που είναι προϊόν του γονιδίου. H 2 N - met - cys - ile - cys - arg - his - cys - COOH α) Να εξθγιςετε το λόγο τθσ διαφοράσ των δφο πεπτιδίων (Δίνεται ότι τα τρία κωδικόνια που κωδικοποιοφν το αμινοξφ κυςτεΐνθ είναι ίδια). β) Αν ςτο 3ϋ άκρο βρίςκεται υποκινθτισ, να γράψετε το πρόδρομο mrna που μπορεί να προκφψει και να δϊςετε τον προςανατολιςμό του Δίνεται θ παρακάτω αλλθλουχία DNA: Ι.Αν θ ςυγκεκριμζνθ αλλθλουχία επωαςτεί με τθν περιοριςτικι ενδονουκλεάςθ BamH1, που αναγνωρίηει τθν αλλθλουχία που φαίνεται ςτο πλαίςιο και κόβει όπωσ υποδθλϊνουν τα ςφμβολα, κα πάρουμε: Α. ζνα τμιμα Β. δφο τμιματα Γ. τρία τμιματα Δ. τζςςερα τμιματα ΙΙ. Από τθν ςυγκεκριμζνθ αλλθλουχία επικυμοφμε να απομονϊςουμε και να κλωνοποιιςουμε το τμιμα 5 ATGCCAGTGAAGTAG3. Μετά από επϊαςθ τθσ ςυγκεκριμζνθσ αλλθλουχίασ με EcoRI, καταλλθλότεροσ ανιχνευτισ για τθν ανίχνευςθ του τμιματοσ, το οποίο περιζχει τθ ςυγκεκριμζνθ αλλθλουχία είναι: A. 3 TTAAGAAACC5 B. 3 CTTTGGATCC 5 Γ. 3 CGGCTACTTC5 Δ. 3 AGGTAACTTA Στον διπλανό πίνακα καταγράφονται οριςμζνα χαρακτθριςτικά ενόσ ηεφγουσ διδφμων. Ροιο χαρακτθριςτικό μπορεί να μασ βοθκιςει για να προςδιορίςουμε αν θ Χαρά και θ Ξανκι είναι μονοηυγωτικά δίδυμα ι όχι; Α. το φψοσ Β. θ ομάδα αίματοσ Γ. το χρϊμα των ματιϊν Δ. ο δείκτθσ ευφυΐασ 207. Ζνα γραμμικό μόριο DNA φζρει n κζςεισ αναγνϊριςθσ από τθν EcoRI. Αν επιδράςουμε ςτο μόριο αυτό με τθν EcoRI, πόςα τμιματα DNA είναι δυνατόν να παραχκοφν που κα φζρουν δφο μονόκλωνα άκρα;

37 37 Α. n Β. n-1 Γ. n-2 Δ. 2n Στο πλαίςιο βρίςκεται ζνα τμιμα DNA ςτο οποίο ςυμβαίνει αναςτροφι του τμιματοσ με τθν ζντονθ γραφι. Το αποτζλεςμα κα είναι: 209. Αφοφ χρθςιμοποιιςετε τθν πλθροφορία που παρζχεται από το παρακάτω ςχιμα να απαντιςετε ςτισ ερωτιςεισ που ακολουκοφν. Οι αρικμοί 1 ωσ 5 αφοροφν διαφορετικζσ δομζσ ι μόρια. I. Το επόμενο κωδικόνιο που κα μεταφραςτεί είναι: Α. 5' CUA 3' Β. 5' CGC 3' Γ. 3' CUA 5' Δ. 3' CGC 5' II. Ωρίμανςθ μπορεί να ζχει γίνει: Α. ςτα μόρια 5 Β. ςτα μόρια 3 και 4 Γ. ςτα μόρια 1 και 2 Δ. ςτο μόριο 1 αλλά όχι ςτο 2 III. Τα μόρια τθσ δομισ 2 παράγονται με; Α. μεταγραφι και μετάφραςθ Β. αντιγραφι και μεταγραφι Γ. μεταγραφι και ωρίμανςθ Δ. μεταγραφι και αντίςτροφθ μεταγραφι 210. Να γράψετε ςτο τετράδιό ςασ τον αρικμό κακεμιάσ από τισ παρακάτω προτάςεισ και δίπλα του να χαρακτθρίςετε τθν αντίςτοιχθ πρόταςθ ωσ ςωςτι (Σ) ι λανκαςμζνθ (Λ) α. Σε ανάλυςθ DNA του 22ου ανκρϊπινου χρωμοςϊματοσ εντοπίςτθκε φυλοςφνδετο υπολειπόμενο γονίδιο που προκαλεί μια ςπάνια αςκζνεια. β. Ερευνθτζσ για να αντιμετωπίςουν τθν ομόηυγθ μορφι τθσ β-καλαςςαιμίασ πραγματοποίθςαν ex vivo γονιδιακι κεραπεία ϊριμα ερυκροκφτταρα. γ. Μία μετάλλαξθ που καταςτζλλει το ςχθματιςμό του snrna κα προκαλζςει αφξθςθ ςτο μζςο μικοσ των mrna. δ. Για να μπορζςουμε να δθμιουργιςουμε ζνα διαγονιδιακό ηϊο, ζχουμε χρθςιμοποιιςει τουλάχιςτον μια περιοριςτικι ενδονουκλεάςθ. ε. Φωτογραφίηοντασ το παραςκεφαςμα που προκφπτει από τα κατάλλθλα χρωματιςμζνα μεταφαςικά χρωμοςϊματα ενόσ ανκρϊπου, ζχουμε τον καρυότυπο του. η. Αν ςε ζνα διάλυμα με μονόκλωνεσ αλυςίδεσ DNA κζςουμε κατάλλθλεσ DNA πολυμεράςεσ και μονοφωςφορικά δεοξυριβονουκλεοτίδια - ςτθν κατάλλθλθ κερμοκραςία και ph κα ςχθματιςτοφν οι ςυμπλθρωματικζσ αλυςίδεσ DNA. θ. Θ φπαρξθ ςτο γονιδίωμα του ανκρϊπου ενόσ μεταλλαγμζνου αλλθλόμορφου για τθ β αλυςίδα τθσ αιμοςφαιρίνθσ, μπορεί να αποτελεί πλεονζκτθμα προςαρμοςτικότθτασ. κ. Μζςα ςε κφτταρα ξενιςτζσ, κάποιοι ιοί μποροφν να οδθγιςουν ςτθ ςφνκεςθ δίκλωνων κυκλικϊν RNA. ι. Θ μεταγραφι προχποκζτει οπωςδιποτε τθν αντιγραφι. κ. Για τθ δθμιουργία μιασ cdna βιβλιοκικθσ χρθςιμοποιείται και DNA πολυμεράςθ. λ. Οι γενετικζσ πλθροφορίεσ μεταβιβάηονται από το DNA ςε DNA ι ςε RNA, από RNA ςε DNA ι RNA και από RNA ςε πρωτεΐνεσ. μ. Τα ϊριμα ερυκροκφτταρα είναι απφρθνα κφτταρα, ςτα οποία περιζχονται οι αιμοςφαιρίνεσ. Είναι πικανό, ςτο άμεςο μζλλον, να επιτευχκεί θ αντιμετϊπιςθ των αιμοςφαιρινοπακειϊν, με τθν ειςαγωγι των ανάλογων φυςιολογικϊν γονιδίων ςτα παραπάνω κφτταρα (γονιδιακι κεραπεία). ν. Θ προςκικθ εννζα διαδοχικϊν βάςεων οπουδιποτε ςτο γονίδιο ενόσ ανκρϊπου ςυνεπάγεται, φυςιολογικά, τθ ςφνκεςθ ενόσ πεπτιδίου με τρία επιπλζον αμινοξζα άγνωςτθσ, γενικά, λειτουργικότθτασ. ξ. Θ διαςταφρωςθ ελζγχου χρθςιμοποιείται και ςτισ περιπτϊςεισ ελζγχου του γονοτφπου όταν το κλθρονομοφμενο γνϊριςμα κακορίηεται από αλλθλόμορφα που χαρακτθρίηονται ωσ ατελϊσ επικρατι ι ςυνεπικρατι μεταξφ τουσ. ο. Αν ο καρυότυποσ ενόσ ανκρϊπινου εμβρφου αποτελείται από 46 χρωμοςϊματα, το ζμβρυο κα

38 38 αναμζνεται να εξελιχκεί ςε ζνα φυςιολογικό άνκρωπο. π. Θ ανταλλαγι τμθμάτων μεταξφ δφο διαφορετικϊν πλαςμιδίων ενόσ βακτθρίου οδθγεί ςτο μεταςχθματιςμό του. ρ. Ζνα κατάλλθλα γενετικά τροποποιθμζνο βακτιριο ζχει τθν ικανότθτα ςφνκεςθσ τθσ πρωτεΐνθσ ινςουλίνθσ. ς. Το οπερόνιο τθσ λακτόηθσ διακζτει δφο αλλθλουχίεσ λιξθσ τθσ μεταγραφισ. τ. Οι γαμζτεσ μιασ γυναίκασ ζχουν, φυςιολογικά, δφο διαφορετικοφσ ςυνδυαςμοφσ χρωμοςωμάτων, μθτρικισ και πατρικισ προζλευςθσ. 211.Σασ δίνεται το παρακάτω γενεαλογικό δζνδρο που περιγράφει τον τρόπο κλθρονόμθςθσ μίασ μονογονιδιακισ αςκζνειασ. Τα μαυριςμζνα άτομα είναι τα αςκενι. Α. Να βρείτε τουσ πικανοφσ τρόπουσ κλθρονόμθςθσ τθσ αςκζνειασ. Β. Σε κάκε περίπτωςθ να βρεκοφν οι πικανοί γονότυποι των μελϊν τθσ οικογζνειασ 212.Σασ δίνονται οι αςκζνειεσ : 1. ρετινοβλάςτωμα 2. δρεπανοκυτταρικι αναιμία 3. ςφνδρομο XXX 4. τριςωμία ςφνδρομο φωνι τθσ γάτασ Να κατατάξετε τισ αςκζνειεσ με βάςθ τθν ζκταςθ τθσ αλλαγισ του γενετικοφ υλικοφ(αφξουςα ςειρά) 213.Σε κλειςτι καλλιζργεια βακτθρίων Ε.coli το κρεπτικό υλικό περιζχει γλυκόηθ και λακτόηθ. Ροια από τισ παρακάτω καμπφλεσ αναπαριςτά τον τρόπο ανάπτυξθσ των βακτθρίων Από φυςιολογικό πατζρα και μθτζρα που δεν βλζπει το πράςινο και κόκκινο χρϊμα, γεννικθκε παιδί με ςφνδρομο Klinefelter που βλζπει το πράςινο και κόκκινο χρϊμα. Να βρείτε τον μθχανιςμό γζννθςθσ του ςυγκεκριμζνου παιδιοφ Δίνονται δυο αμιγείσ πλθκυςμοί Drosophila, ο ζνασ εκ των οποίων εμφανίηει το γνϊριςμα γκρίηο ςϊμα (επικρατζσ) και ο άλλοσ το γνϊριςμα μαφρο ςϊμα (υπολειπόμενο). Να γράψετε τισ κατάλλθλεσ διαςταυρϊςεισ που πρζπει να κάνετε για να διαπιςτϊςετε αν το γνϊριςμα είναι αυτοςωμικό ι φυλοςφνδετο Στο παρακάτω τμιμα DNA υπάρχει θ αλλθλουχία των κωδικονίων που περιζχει τθν πλθροφορία για τθν ςφνκεςθ ενόσ πενταπεπτιδίου. Στθν αλλθλουχία των κωδικονίων που περιζχεται θ πλθροφορία για τθ ςφνκεςθ του πενταπεπτιδίου (ανοικτό πλαίςιο ανάγνωςθσ) δεν παρεμβάλλονται εςϊνια γιατί το κφτταρο μζςα ςτο οποίο υπάρχει αυτό το τμιμα DNA είναι προκαρυωτικό. Κατά τθν αντιγραφι του ςυγκεκριμζνου τμιματοσ και ςυγκεκριμζνα κατά τθ ςφνκεςθ τθσ κωδικισ αλυςίδασ όταν αντιγράφεται το 10ο νουκλεοτίδιο τοποκετείται κυμίνθ (T) κατά παράβαςθ τθσ αρχισ τθσ ςυμπλθρωματικότθτασ. Μετά το τζλοσ τθσ αντιγραφισ το αρχικό κφτταρο κάνει διαδοχικά δφο διαιρζςεισ οπότε παράγονται τζςςερα κφτταρα. Σε πόςα από τα τζςςερα κφτταρα δεν κα ςυντίκεται το ςυγκεκριμζνο πεπτίδιο; Αιτιολογιςτε τθν απάντθςθ ςασ. (Να κεωριςετε ςτισ επόμενεσ αντιγραφζσ αυτοφ του τμιματοσ DNA δεν παραβιάηεται ο κανόνασ τθσ ςυμπλθρωματικότθτασ) 217.Σασ δίνεται μία αλυςίδα του γονιδίου-1 : 5ϋAAAATTAGCTTTTCTTCGTGGTCGGGACCAACCGTAGA TCATCTCC3 Το οποίο είναι υπεφκυνο για τθν βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-ile-tyr-pro-asp-his-lys-ser-cooh κακϊσ και μία αλυςίδα του γονιδίου-2: 3 CTACAAATTCCGGGTCTTCCTCGTTTCCCTAATATTTTAA AA5 που είναι υπεφκυνο για τθ βιοςφνκεςθ του πεπτιδίου : ΝΘ 2 -met-phe-pro-arg-arg-ser-leu-cooh. Ανάμεςα ςτα δφο γονίδια είχαμε αμοιβαία μετατόπιςθ των ενδιάμεςων εξωνίων ϊςτε τα νζα γονίδια που προκφπτουν να παράγουν χιμαιρικζσ πρωτεΐνεσ δθλαδι πρωτεΐνεσ που διακζτουν αλλθλουχίεσ και από τισ 2 πρωτεΐνεσ που παράγουν ρα αρχικά γονίδια.

39 39 Να βρεκοφν οι πικανζσ αλλθλουχίεσ αμινοξζων των χιμαιρικϊν πρωτεϊνϊν. (Να γίνει χρήση του γενετικοφ κώδικα) 218. Σασ δίνεται το παρακάτω γενεαλογικό δζνδρο μίασ οικογζνειασ όπου εμφανίςτθκε θ αςκζνεια τθσ μυϊκισ δυςτροφίασ Duchenne (οφείλεται ςε φυλοςφνδετο υπολειπόμενο γονίδιο.) Να βρεκοφν οι πικανοί γονότυποι των ατόμων 1, 2 και 3 του δζνδρου Σε εργαςτιριο μοριακισ βιολογίασ οι ερευνθτζσ χρθςιμοποιοφν ραδιενεργό 32 και ραδιενεργό 35 S ϊςτε να ιχνθκετιςουν όλεσ τισ ουςίεσ των παρακάτω πειραμάτων : Θ 2 Ν met pro tyr gly asn ala COOH Ακολουκοφν 3 μεταλλαγμζνα αλ-λθλόμορφα : Ι. 3ϋ C G T A C G G C A T A C C A T T A C G A A G T C A A C T C G A A A T T C T 5ϋ ΙΙ. 3ϋ C G T A G G G C A T A C C A T T A C G A A C T C A A C T C G A A A T T C T 5ϋ ΙΙΙ. 3ϋ C G T A C G G C A T C C A T T A C G A A C T C A A C T C G A Α A T T C T 5ϋ Σε κάκε περίπτωςθ να προςδιορίςετε το είδοσ τθσ μετάλλαξθσ και τθν επίπτωςθ τθσ ςτθν αλλθλουχία του πεπτιδίου. Ζνα άλλο μεταλλαγμζνο αλλθλόμορφο είναι υπεφκυνο για τθν προςκικθ των αμινοξζων : Θ 2 Ν met p r o tyr gly asn ala trp ser COOH Να εντοπίςετε το είδοσ τθσ μετάλλαξθσ που είναι υπεφκυνθ για το παραπάνω αποτζλεςμα. Να γίνει χρήση του γενετικοφ κώδικα 222.Σασ δίνεται παρακάτω τμιμα του φυςιολογικοφ γονιδίου p53 όπου θ φπαρξθ ενόσ μεταλλαγμζνου αλλθλό-μορφοφ του ςυμβάλλει ςτθν εμφάνιςθ καρκίνου του μαςτοφ. Σε κάκε πείραμα να αναφζρετε τισ ουςίεσ που ιχνθκετικθκαν με 32 και ποιεσ με 35 S. 220.Α.Θ διαδικαςία που περιγράφεται ςτο παρακάτω διάγραμμα : μπορεί να είναι : α. Θ μιτωτικι διαίρεςθ ενόσ ςωματικοφ ευκαρυωτικοφ κυττάρου. β. Θ διαδικαςία τθσ μείωςθσ που οδθγεί ςτο ςχθματιςμό των γαμετϊν ενόσ διπλοειδοφσ οργανιςμοφ. Β. Αν ο γαμετθσ του παραπάνω οργανι-ςμοφ ςτον πυρινα του διακζτει ποςότθτα DNA ίςθ με α ηεφγθ βάςεων,να υπολογιςκεί θ ποςότθτα DNA ςτον πυρινα των κφτταρων Μ1, Μ2, Μ3 και Μ4. Σασ δίνεται ότι το φφλο ςτο ςυγκεκριμζνο οργανιςμό κλθρονομείται όπωσ ςτον άνκρωπο Σασ δίνεται παρακάτω μία αλυςίδα ενόσ εξωνίου : 3ϋ C G T A C G G C A T A C C A T T A C G A A C T C A A C T C G A A A T T C T 5ϋ Ππου το εξϊνιο αυτό είναι υπεφκυνο για τθν προςκικθ των αμινοξζων : Σε γυναίκα με καρκίνου του μαςτοφ λαμβάνεται δείγμα-ι DNA που περιζχει το μεταλλαγμζνο αλλθλόμορφο. Το δείγμα DNA «βάφεται» με κατάλλθλθ χρωςτικι χρϊματοσ κόκκινου. Αντίςτοιχα λαμβάνεται δείγμα ΙΙ του φυςιολογικοφ αλλθλόμορφου όπου με κατάλλθλθ χρωςτικι «βάφεται» χρϊματοσ πράςινο. Στο εργαςτιριο δθμιουργοφνται 4 δείγματα που περιζχουν τα παρακάτω μονόκλωνα τμιματα DNA που ζχουν δθμιουργθκεί τεχνθτά ςτο εργαςτιριο : Τα δείγματα αυτά τοποκετοφνται ςε κικεσ ενόσ δοχείο όπωσ φαίνεται ςτο παραπάνω τμιμα. Στθ ςυνζχεια τα δείγματα Ι και ΙΙ τοποκετοφνται ςτο δοχείο, και μετά από υβριδοποίθςθ αποπλζνουμε το δοχείο. Ραρατθροφμε ότι ςτισ κικεσ του δοχείου που τοποκετιςαμε τα μονόκλωνα τεχνθτά τμιματα υπάρχουν τα παρακάτω χρϊματα.

40 40 Να βρεκεί το είδοσ τθσ μετάλλαξθσ ςτο γονίδιο p53 ςτθ γυναίκα Σε ζνα αςυνεχζσ γονίδιο ευκαρυ-ωτικοφ κυττάρου, τα εξϊνια: α. είναι περιςςότερα από τα εςϊνια β. είναι λιγότερα από τα εςϊνια γ. είναι ίςα με τα εςϊνια δ. εξαρτάται από τον οργανιςμό 224. Σε ζνα εργαςτιριο Μοριακισ Βιολογίασ προςδιορίςτθκε μερικϊσ θ αμινοξικι αλλθλουχία μιασ πρωτεΐνθσ. Τα μόρια t RNA που χρθςιμοποιικθκαν ςτθ ςφνκεςθ ζχουν τα παρακάτω αντικωδικόνια: 3ϋUAC 5ϋ,3ϋCGA 5ϋ,3ϋGGA 5ϋ,3ϋGCU 5ϋ 3ϋUUU 5ϋ,3ϋGGA 5ϋ Να γραφεί το τμιμα τθσ κωδικισ αλυςίδασ που είναι υπεφκυνθ για τθ βιοςφνκεςθ του τμιματοσ τθσ πρωτεΐνθσ που ςασ δίνεται Θ ζλλειψθ κεράτων ςτισ αγελάδεσ οφείλεται ςτο επικρατζσ γονίδιο P. Τα ομόηυγα για το υπολειπόμενο γονίδιο p άτομα ζχουν κζρατα. Στισ αγελάδεσ αυτζσ, ο μαφροσ χρωματιςμόσ οφείλεται ςτο κυρίαρχο αλλθλόμορφο γονίδιο R, ενϊ ο κόκκινοσ ςτο υπολειπόμενο r. Σασ δίνεται μαυροσ ταφροσ χωρίσ κζρατα. Με ποια μία και μοναδικι διαςταφρωςθ κα διαπιςτϊςετε αν ταφροσ είναι ομόηυγοσ ι ετερόηυγοσ ωσ προσ τα δφο γονίδια (χωρίσ κζρατα και χρϊμα); Θεωρείςτε ότι και τα δυο γονίδια βρίςκονται ςε αυτοςωμικά χρωμοςϊματα. Αιτιολογείςτε τθν απάντθςθ ςασ Δίνεται τμιμα DNA τθσ μθ κωδικισ αλυςίδασ ενόσ γονιδίου που κωδικοποιεί τθν παραγωγι ενόσ trna. Θ τριπλζτα ςτο γκρίηο πλαίςιο αντιςτοιχεί ςτο αντικωδικόνιο του trna. Ροιο trna κωδικοποιεί θ παραπάνω γενετικι πλθροφορία; 227. Θζλετε να μελετιςετε τθ γ-κρυςταλλίνθ του ανκρϊπου, μια πρωτεΐνθ που βρίςκεται ςτο φακό του ματιοφ. Για να αποκτιςετε επαρκι ποςότθτα τθσ πρωτεΐνθσ αποφαςίηετε να κλωνοποιιςετε το γονίδιο τθσ γ-κρυςταλλίνθσ με τθν τεχνικι τθσ cdna βιβλιοκικθσ. Σχετικά με τθ διαδικαςία τθσ τεχνικισ αυτισ, να τοποκετιςετε τα παρακάτω βιματα ςτθ ςωςτι ςειρά: Α. Aναςυνδυαςμόσ ςε φορζα κλωνοποίθςθσ Β. Λφςθ των βακτθριακϊν κυττάρων και απομόνωςθ πρωτεΐνθσ Γ. Επαγωγι ζκφραςθσ τθσ πρωτεΐνθσ Δ. Απομόνωςθ του ολικοφ ϊριμου mrna από κφτταρα του φακοφ Ε. Δθμιουργία δίκλωνου DNA ΣΤ. Αντίςτροφθ μεταγραφι Η. Επιλογι του επικυμθτοφ κλϊνου Θ. Μεταςχθματιςμόσ ςε κφτταρα Escherichia coli 228. Να εξετάςετε το παρακάτω γενεαλογικό δζντρο που απεικονίηει τουσ φαινοτφπουσ των ατόμων ωσ προσ τισ ομάδεσ αίματοσ ςτουσ ανκρϊπουσ ςφμφωνα με το ςφςτθμα ΑΒΟ. Να προςδιορίςετε τουσ γονότυπουσ των ατόμων τθσ οικογζνειασ Ζνασ γενετιςτισ βρικε ότι μία ανκρϊπινθ αςκζνεια προκαλείται από μία μετάλλαξθ που κλθρονομείται ωσ υπολειπόμενοσ χαρακτιρασ. Το μεταλλαγμζνο αλλθλόμορφο περιζχει μία ζλλειψθ τθσ κυμίνθσ ςτθν κζςθ 25 από το ςθμείο ζναρξθσ τθσ μετάφραςθσ του γονιδίου. Το γονίδιο βρίςκεται ςτο Χ χρωμόςωμα. Ραρακάτω παρατίκεται θ αλλθλουχία του DNA για τθν κωδικι περιοχι του φυςιολογικοφ γονιδίου. Φυςιολογικό γονίδιο DNA: 5 - CCATGTTACGAGGTATCGAACTAGTTTGAACTCCCATAAA ATT - 3. Ροια/εσ πρόταςθ/εισ ςχετικά με τισ ςυνζπειεσ αυτισ τθσ μετάλλαξθσ είναι ΣΩΣΤΘ/ΕΣ; i. Θ μεταλλαγμζνθ πρωτεΐνθ περιζχει τρία περιςςότερα αμινοξζα από τθν φυςιολογικι πρωτεΐνθ. ii. Θ μεταλλαγμζνθ πρωτεΐνθ περιζχει ζνα λιγότερο αμινοξφ από τθν φυςιολογικι πρωτεΐνθ. iii. Τα αρςενικά είναι περιςςότερο πικανό να εμφανίςουν τθν αςκζνεια απϋ ότι τα κθλυκά Ραρακάτω απεικονίηεται θ νουκλεοτιδικι αλλθλουχία τμιματοσ τθσ μιασ αλυςίδασ ενόσ δίκλωνου μορίου DNA και τμιμα τθσ αμινοξικισ αλλθλουχίασ που θ παραπάνω νουκλεοτιδικι αλλθλουχία κωδικοποιεί. Επίςθσ απεικονίηεται τμιμα του γενετικοφ κϊδικα.

41 41 Να δείξετε με τισ ενδείξεισ Σ ι Λ αν οι παρακάτω προτάςεισ ςχετικά με τα παραπάνω δεδομζνα είναι ςωςτζσ ι λανκαςμζνεσ. (Να υποκζςετε ότι το μικοσ του DNA είναι το ίδιο με το πρόδρομο μόριο mrna) I. H αλυςίδα του DNA που απεικονίηεται είναι θ μθ κωδικι. II. Αν το περιεχόμενο G+C τθσ αλυςίδασ του DNA, τμιμα του οποίου απεικονίηεται, είναι 40%, τότε το περιεχόμενο A+T τθσ ςυμπλθρωματικισ του αλυςίδασ κα είναι 60%. III. Αν το περιεχόμενο G+C τθσ αλυςίδασ του DNA, τμιμα του οποίου που απεικονίηεται, είναι 40%, τότε το περιεχόμενο A+U του πρόδρομου μεταγράφου είναι 60%. IV. Θ νουκλεοτιδικι αλλθλουχία του mrna είναι 5'... UUU AAG UUA AGC... 3' Στθν παρακάτω εικόνα απεικονίηεται θ μεταγραφι και θ μετάφραςθ ενόσ γονιδίου ςε ζνα προκαρυωτικό κφτταρο. Να δείξετε με τισ ενδείξεισ Σ ι Λ αν οι παρακάτω προτάςεισ ςχετικά με τθν περιγραφι των παραπάνω διαδικαςιϊν είναι ςωςτζσ ι λανκαςμζνεσ. I. Θ κατεφκυνςθ τθσ μεταγραφισ είναι από το (Λ) ςτο (Κ). II. Θ κζςθ (Γ) του m RNA είναι το 5' άκρο και το πολυπεπτίδιο ςτο ριβόςωμα (Υ) ζχει περιςςότερα αμινοξζα από το πολυπεπτίδιο ςτο ριβόςωμα (Η) Ροιο από τα παρακάτω γενεαλογικά δζντρα απεικονίηει τθν κλθρονόμθςθ ενόσ επικρατοφσ φυλοςφνδετου γνωρίςματοσ; 233. Ραρακάτω παρατίκενται οι αλλθλουχίεσ αμινοξζων των πεπτιδίων Χ και Υ. Το πεπτίδιο Χ δθμιουργικθκε από τθν ζκφραςθ του γονιδίου Χ και το πεπτίδιο Υ από τθν ζκφραςθ του μεταλλαγμζνου αλλθλόμορφου του Υ. Oι αλλθλουχίεσ των αμινοξζων των πεπτιδίων παρατίκενται όπωσ προζκυψαν από τθν μετάφραςθ των mrna των γονιδίων Χ και Υ. Δίνονται τα κωδικόνια: asn = AAU, lys = AAA, pro = CCC, gly = GGG, phe = UUU, ile = AUU. Χ πεπτίδιο: Θ 2 Ν-met-asp-pro-val-ser-pro-val-asn-lyspro-met-ser-glu-his-trp-COOH Υ πεπτίδιο: Θ 2 Ν-met-asp-pro-val-ser-pro-val-gly-pheile-met-ser-glu-his-trp-COOH Να εντοπίςετε το είδοσ τθσ μετάλλαξθσ Μία ομάδα βιολόγων μεταςχθμάτιςε βακτιρια χωρίσ κάψα ςε βακτιρια με κάψα. Τα κφτταρα χωρίσ κάψα αναπτφχκθκαν ςε καλλιζργεια που περιείχε εκχφλιςμα νεκρϊν βακτθρίων με κάψα. Τα κφτταρα που μεταςχθματίςτθκαν παριγαγαν αποικίεσ βακτθρίων με κάψα. Ραρακάτω παρατίκενται τρεισ διαδικαςίεσ με τα αποτελζςματά τουσ. Διαδικασία Ι: Εκχφλιςμα από νεκρά κφτταρα με κάψα προςτζκθκαν ςτο κρεπτικό υλικό καλλιζργειασ. Στο ίδιο κρεπτικό υλικό προςτζκθκαν και κφτταρα χωρίσ κάψα. Αποτζλεςμα: Στο κρεπτικό υλικό αναπτφχκθκαν βακτιρια με κάψα και βακτιρια χωρίσ κάψα. Διαδικασία ΙΙ: Ρροςτζκθκαν ζνηυμα που διαςποφν τισ πρωτεΐνεσ ςε εκχφλιςμα νεκρϊν κυττάρων με κάψα και το προϊόν τθσ δράςθσ των ενηφμων τοποκετικθκε ςε κρεπτικό υλικό καλλιζργειασ. Βακτιρια χωρίσ κάψα τοποκετικθκαν ςτο ίδιο κρεπτικό υλικό. Αποτζλεςμα: Στο κρεπτικό υλικό αναπτφχκθκαν βακτιρια με κάψα και βακτιρια χωρίσ κάψα. Διαδικασία ΙΙΙ: Ρροςτζκθκαν ζνηυμα που καταςτρζφουν τo DNA ςε εκχφλιςμα νεκρϊν κυττάρων με κάψα και το προϊόν τθσ δράςθσ των ενηφμων τοποκετικθκε ςε κρεπτικό υλικό καλλιζργειασ. Βακτιρια χωρίσ κάψα τοποκετικθκαν ςτο ίδιο κρεπτικό υλικό.

42 42 Αποτζλεςμα: Στο κρεπτικό υλικό αναπτφχκθκαν βακτιρια χωρίσ κάψα. α.το ςυμπζραςμα των παραπάνω αποτελεςμάτων είναι ότι: A. O μθχανιςμόσ τθσ αντιγραφισ είναι θμιςυντθρθτικόσ Β. Το DNA είναι το γενετικό υλικό Γ. Το DNA ζχει τθ δομι διπλισ ζλικασ Δ. To DNA μεταλλάςςεται β. Για ποιο λόγο κατά τθ διαδικαςία ΙΙ προςτζκθκαν ςτο εκχφλιςμα νεκρϊν κυττάρων ζνηυμα που διαςποφν τισ πρωτεΐνεσ; Α. Για να δείξουν ότι ο παράγοντασ μεταςχθματιςμοφ είναι ζνα ζνηυμο. Β. Για να δείξουν ότι παράγοντασ μεταςχθματιςμοφ δεν είναι μία πρωτεΐνθ. Γ. Για να καταςτρζψουν τισ κάψεσ ςτο εκχφλιςμα. Δ. Για να δείξουν ότι το DNA είναι το γενετικό υλικό. γ. Για ποιο λόγο κατά τθ διαδικαςία ΙΙΙ προςτζκθκαν ςτο εκχφλιςμα νεκρϊν κυττάρων ζνηυμα που διαςποφν το DNA; Α. Για να μετακινιςουν τα βακτιρια χωρίσ κάψα από το εκχφλιςμα. Β. Για να δείξουν ότι δεν είναι θ πρωτεΐνθ ο παράγοντασ μεταςχθματιςμοφ. Γ. Για να δείξουν ότι χωρίσ DNA δε πραγματοποιείται ο μεταςχθματιςμόσ. Δ. Για να μθν αφιςουν τα βακτιρια να πολλαπλαςιαςτοφν Κατά τθ μεταγραφι του γονιδίου Χ τοποκετικθκε λάκοσ νουκλεοτίδιο ςε κάποια κζςθ του ςυντικζμενου RNA. Θ ςυγκεκριμζνθ μεταβολι δεν κα ζχει αρνθτικι επίδραςθ ςτο κφτταρο γιατί: Α. θ μεταβολι ιταν μετάλλαξθ ςε αμετάφραςτθ περιοχι Β. θ μεταβολι ιταν μετάλλαξθ ςτισ εςωτερικζσ αλλθλουχίεσ ενόσ εςωνίου Γ. ιταν ουδζτερθ μετάλλαξθ Δ. δεν κα είναι κάκε προϊόν του γονιδίου Χ μθ λειτουργικό Στθν παρακάτω εικόνα απεικονίηονται ςτιγμιότυπα από τθν μετάφραςθ ενόσ μορίου m RNA. Α. Να ςθμειϊςετε τα άκρα 5ϋ και 3ϋ ςτα άκρα Χ και Υ του ςχιματοσ. Β. Το αποτζλεςμα τθσ παραπάνω διαδικαςίασ είναι : α. Θ ςφνκεςθ πολλϊν διαφορετικϊν πολυπεπτιδικϊν αλυςίδων ςε ζνα αντίγραφο θ κάκε μία. β. Θ ςφνκεςθ μίασ πολυπεπτιδικισ αλυςίδασ ςε πολλά αντίγραφα θ κάκε μία. γ. Θ ςφνκεςθ τριϊν διαφορετικϊν πολυπεπτιδικϊν αλυςίδων ςε πολλά αντίγραφα θ κάκε μία. Γ. Το ςυγκεκριμζνο mrna μπορεί να υπάρχει : α. Μόνο ςτο κυτταρόπλαςμα ευκαρυωτικοφ κυττάρου. β. Μόνο ςτο κυτταρόπλαςμα προκαρυωτικοφ κυττάρου γ. Στον πυρινα ευκαρυωτικοφ κυττάρου. δ. Στο κυτταρόπλαςμα οποιουδιποτε είδουσ κυττάρου (ευκαρυωτικοφ ι προκαρυωτικοφ) Δ. Να αναφζρετε τον αρικμό των κωδικονίων ζναρξθσ και λιξθσ ςτο ςυγκεκριμζνο mrna Ελιφκθςαν δείγματα DNA από τζςςερα άτομα. Τα δείγματα πζραςαν μια ςειρά από ςτάδια (Ι και ΙΙ) και το αποτζλεςμα απεικονίηεται ςτον παρακάτω πίνακα. Στο ςυγκεκριμζνο δείγμα DNA εδράηουν 2 φυςιολογικά γονίδια το Α και το Β. Στον ανκρϊπινο πλθκυςμό υπάρχουν και τα μεταλλαγμζνα αλλθλόμορφά τουσ α και β αντίςτοιχα. Αν το άτομο του δείγματοσ-1 ζχει τα δφο φυςιολογικά γονίδια Α και Β. Α. Ροιο άτομο από τα υπόλοιπα τρία ζχει τα δφο φυςιολογικά γονίδια Α και Β; Β. Ροιο άτομο από τα υπόλοιπα τρία ζχει τα δφο μεταλλαγμζνα γονίδια α και β; Γ. Ροιο άτομο από τα υπόλοιπα τρία ζχει ζνα από τα δφο φυςιολογικά γονίδια και ζνα μεταλλαγμζνο ; 238. Σε οριςμζνα άτομα, που πάςχουν από ςφνδρομο Down, ζχει βρεκεί ότι υπάρχουν δφο διαφορετικζσ ςειρζσ κυττάρων ςτο ςϊμα τουσ: θ μία ςειρά ζχει φυςιολογικό αρικμό χρωμοςωμάτων 21, ενϊ θ άλλθ ζχει τριςωμία 21.

43 43 Το φαινόμενο αυτό, που είναι γνωςτό και ωσ μωςαϊκιςμόσ, μπορεί να οφείλεται: Α. ςε αμοιβαία μετατόπιςθ μεταξφ του χρωμοςϊματοσ 21 και κάποιου άλλου χρωμοςϊματοσ Β. ςε μθ διαχωριςμό των αδελφϊν χρωματίδων κατά τθ μείωςθ και το ςχθματιςμό των γαμετϊν Γ. ςε γονιμοποίθςθ ενόσ ωαρίου με δφο χρωμοςϊματα 21 από ζνα ςπερματοηωάριο χωρίσ χρωμόςωμα 21 Δ. ςε μθ διαχωριςμό ςτθ μίτωςθ, ςτα αρχικά ςτάδια τθσ εμβρυογζνεςθσ Δίνεται θ παρακάτω αλλθλουχία DNA: β) Αν ςτο 3ϋ άκρο βρίςκεται υποκινθτισ, να γράψετε το πρόδρομο mrna που μπορεί να προκφψει και να δϊςετε τον προςανατολιςμό του Θ γραφικι παράςταςθ απεικονίηει τα αποτελζςματα ενόσ πειράματοσ κατά το οποίο διερευνικθκε θ επίδραςθ τθσ κερμοκραςίασ ςτθν ανάπτυξθ ενόσ είδουσ βακτθρίου. Α. Αν θ ςυγκεκριμζνθ αλλθλουχία επωαςτεί με τθν περιοριςτικι ενδονουκ-λεάςθ BamH1, που αναγνωρίηει τθν αλλθλουχία που φαίνεται ςτο πλαίςιο και κόβει όπωσ υποδθλϊνουν τα ςφμβολα, κα πάρουμε: α. ζνα τμιμα β. δφο τμιματα γ. τρία τμιματα δ. τζςςερα τμιματα Β. Από τθν ςυγκεκριμζνθ αλλθλουχία επικυμοφμε να απομονϊςουμε και να κλωνοποιιςουμε το τμιμα 5 ATGCCAGTGAAGTAG3. Μετά από επϊαςθ τθσ ςυγκεκριμζνθσ αλλθλουχίασ με EcoRI, καταλλθλότεροσ ανιχνευτισ για τθν ανίχνευςθ του τμιματοσ, το οποίο περιζχει τθ ςυγκεκριμζνθ αλλθλουχία είναι: α. 3 TTAAGAAACC5 β. 3 CTTTGGATCC 5 γ. 3 CGGCTACTTC5 δ. 3 AGGTAACTTA Δίνεται θ κωδικι αλυςίδα ενόσ ανκρϊπινου γονιδίου. 5ϋAΤΤAAΤGΤGCAΤCΤCAΑΤAGGΤGΤGAGCCGACAΤΤGCΤ AAAGCCG3 Το γονίδιο εκφράςτθκε ςε βακτθριακά κφτταρα και παραςκεφαςε το πεπτίδιο: H 2 N - met - cys - ile - ser - ile - gly - val - ser - arg - his - cys - COOH Από το διαφοροποιθμζνο ανκρϊπινο κφτταρο, ςτο οποίο εκφραηόταν το παραπάνω γονίδιο, απομονϊκθκε το παρακάτω πεπτίδιο, που είναι προϊόν του γονιδίου. H 2 N - met - cys - ile - cys - arg - his - cys - COOH α) Να εξθγιςετε το λόγο τθσ διαφοράσ των δφο πεπτιδίων (Δίνεται ότι τα τρία κωδικόνια που κωδικοποιοφν το αμινοξφ κυςτεΐνθ είναι ίδια). Ροια κερμοκραςία είναι θ πιο αποδοτικι για τθν παραγωγι τθσ βιομάηασ του ςυγκεκριμζνου βακτθρίου ; 242. Οι μονοηυγωτικοί δίδυμοι προζρχονται από τθν διαίρεςθ ενόσ γονιμοποιθμζνου ωαρίου. α) Ζχουν οι δφο δίδυμοι πανομοιότυπο γενετικό υλικό; β) Αν κλωνοποιθκεί ζνασ άνκρωποσ με τον τρόπο που κλωνοποιικθκε θ Dolly, υπάρχει πανομοιότυπο γενετικό υλικό μεταξφ του δότθ του πυρινα και του ανκρϊπου που δθμιουργικθκε από τθν κλωνοποίθςθ; Να αιτιολογιςετε τισ απαντιςεισ ςασ Μία γυναίκα είναι φορζασ του γονιδίου κ που προκαλεί κυςτικι ίνωςθ και του γονιδίου X α που προκαλεί αιμορροφιλία. Εξετάςτθκαν τα ωάρια τθσ και ζνα από αυτά βρζκθκε να είναι φορζασ των γονιδίων κ, Χ Α και Χ α. Α. Να εξθγιςετε πωσ μπορεί να προιλκε το ςυγκεκριμζνο ωάριο. Β. Μετά από γονιμοποίθςθ του ςυγκεκριμζνου ωαρίου από ςπερματοηωάριο που διακζτει το φυλετικό χρωμόςωμα Υ, να βρείτε τισ πικανζσ αςκζνειεσ του απογόνου που κα προκφψει.