ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΠΡΟΛΟΓΟΣ ΘΕΜΑ: Η ΕΚΦΡΑΣΗΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ ΚΥΚΛIΝΗΣ ΣΕ ΣΧΕΣΗ ΜΕ ΤΗΝ ΕΠΙΒΙΩΣΗ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΑΧΕΟΣ ΕΝΤΕΡΟΥ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΠΡΟΛΟΓΟΣ ΘΕΜΑ: Η ΕΚΦΡΑΣΗΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ ΚΥΚΛIΝΗΣ ΣΕ ΣΧΕΣΗ ΜΕ ΤΗΝ ΕΠΙΒΙΩΣΗ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΑΧΕΟΣ ΕΝΤΕΡΟΥ"

Transcript

1 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΘΕΜΑ: Η ΕΚΦΡΑΣΗΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ ΚΥΚΛIΝΗΣ ΣΕ ΣΧΕΣΗ ΜΕ ΤΗΝ ΕΠΙΒΙΩΣΗ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΑΧΕΟΣ ΕΝΤΕΡΟΥ ΠΑΝΑΓΙΩΤΗΣ ΒΑΜΒΑΚΑΣ ΓΕΝΙΚΟΣ ΧΕΙΡΟΥΡΓΟΣ ΠΕΡΙΕΧΟΜΕΝΑ Ευχαριστίες 3 Πρόλογος 4 ΓΕΝΙΚΟ ΜΕΡΟΣ 5 Εισαγωγή 5 Γονίδια και προιόντα 7 Κυτταρικός πολλαπλασιασμός 11 Κυτταρικός κύκλος 13 Ρύθμιση του κυτταρικού κύκλου 15 Διαφοροποίηση 28 Απόπτωση 34 Έλεγχος κυτταρικού κύκλου και καρκίνος 40 Πρωτοογκογονίδια(Ογκογονίδια)- Αντιογκογονίδια 44 Μηχανισμοί ενεργοποίησης ογκογονίδιων 45 Ογκοκατασταλτικό γονίδιο ρετινοβλαστώματος 48 Καρκινογένεση 54 ΕΙΔΙΚΟ ΜΕΡΟΣ 59 Εισαγωγή 59 Υλικό και μέθοδος 59 Ανοσοιστοχημεία 60 Στατιστική ανάλυση 61 Αποτελέσματα 67 Συζήτηση 70 Παράρτημα 72 Βιβλιογραφία 79 ΠΡΟΛΟΓΟΣ

2 ΓΕΝΙΚΟ ΜΕΡΟΣ ΕΙΣΑΓΩΓΗ Ο τρόπος που σκεφτόμαστε για την κληρονομικότητα και τον καρκίνο έχει υποβληθεί σε μια σειρά αλλαγών κατά τη διάρκεια του 20 ου αιώνα. Όταν η οικογενής αδενωματώδης πολυποδίαση (FAP) περιγράφηκε πάνω από 100 έτη πριν, (1,2) κληρονομικά σύνδρομα καρκίνου ήταν πολύ σπάνια. Εβδομήντα έτη πριν, με αφορμή μια μελέτη ελέγχου μιας περίπτωσης (case report) έκανε την παγκόσμια επιστημονική κοινότητα να αποδεχθεί μια θετική οικογενειακή συσχέτιση για τον καρκίνο του στομάχου ή του κόλου που συγκεκριμένα σήμανε έναν τριπλάσιο αυξανόμενο κίνδυνο για εκείνους τους καρκίνους στα μέλη της ίδιας οικογένειας. (3) Στη δεκαετία του '60, οι οικογενειακές μελέτες πρότειναν έναν αυτοχρωμοσωματικό κυρίαρχο τρόπο γενετικής μετάδοσης για ορισμένες ομάδες του καρκίνου του μαστού, της ωοθήκης, και του κόλου, (4) μια έννοια που εξετάστηκε σοβαρά από πολλούς και απορρίφθηκε κατηγορηματικά από μερικούς. Στη δεκαετία του '80, το γονίδιο για FAP συνδέθηκε με 5q, (5) έπειτα ταξινομήθηκε σε 5q21, (6,7) για να αναγγείλει έτσι την είσοδο μίας νέας εποχής στην έρευνα για τον καρκίνο, που χαρακτηριστικά τα μέσα μαζικής επικοινωνίας αναφέρουν ως μοριακή εποχή. Ο μετασχηματισμός ολοκληρώθηκε κατά τη διάρκεια της δεκαετίας του '90 δεδομένου ότι οι μοριακοί γενετιστές έκαναν τις υποθετικές συνδέσεις μεταξύ των μεταλλάξεων και των καρκίνων των διαφορετικών ανατομικών περιοχών. Υπάρχουν τώρα περισσότερες από 40 μεταλλάξεις που είναι γνωστές για την συσχέτισή τους στην παθογένεια του καρκίνου, και η πρόοδος της μοριακής βιολογίας είναι τέτοια που αποσαφηνίζεται η γενετική προσέγγιση σε ένα καρκινικό σύνδρομο το μήνα Αναμένεται ότι το ολόκληρο ανθρώπινο γονιδίωμα θα χαρτογραφηθεί μέχρι το έτος 2003(καθώς επίσης και του ποντικιού και άλλων οργανισμών), πράγμα που σημαίνει ότι περισσότερα γονίδια με ευαισθησία στον καρκίνο θα βρεθούν. (8) Ο πειραματισμός τώρα γίνεται σε πολλαπλάσια κλίμακα(τα γονίδια δεν μελετώνται ένα ένα αλλά κατά χιλιάδες) και απαιτείται η συνεργασία περισσότερων επιστημόνων ξεχωριστών ειδικοτήτων προκειμένου να αξιοποιήσει κανείς τον τεράστιο πλούτο πληροφορίας το οποίο παράγεται Έτσι ο νέος κόσμος της μοριακής βιολογίας πρέπει ακόμα να έχει τους νοσοκομειακούς γιατρούς του. Οι γενετησιολόγοι καρκίνου δεν θα είναι σε θέση να ταιριάξουν με ένα υποσύνολο ή περισσότερων γονιδίων με τις κληρονομικές διαταραχές χωρίς καλές, περιγραφικές οικογενειακές μελέτες. Δυστυχώς, είναι σπάνιο να παρθεί ένα ιατρικό διάγραμμα και να βρεθούν οι χρήσιμες πληροφορίες για την οικογενειακή ιστορία του καρκίνου. (9,10) Ένας νοσοκομειακός γιατρός που οπλίζεται όμως με τη γνώση για τα γενικά χαρακτηριστικά γνωρίσματα των κληρονομημένων συνδρόμων καρκίνου και με την προθυμία να ερευνήσει για την οικογενειακή ιστορία αποτελούν μια παρά πολύ αποτελεσματική προσέγγιση της ιατρικής έναντι του κληρονομικού καρκίνου. Το 1999, περίπου νέες υποθέσεις του καρκίνου εντοπίζονται στις Ηνωμένες Πολιτείες. (11) Εάν 5-10% εκείνων των περιπτώσεων έχουν μια αρχική κληρονομική αιτιολογία (μια συντηρητική εκτίμηση), κατόπιν κάτι σαν καρκίνους κάθε έτος θα αποδοθούν στους γενετικούς παράγοντες. Η μοριακή γενετική υπόσχεται την πρωτοφανή δύναμη να ελεγχθούν ή να προληφθούν εκείνοι οι καρκίνοι με τη δοκιμή - 2 -

3 των απρόσβλητων μελών των οικογενειών οι ιστορίες των οποίων προτείνουν ένα κληρονομικό σύνδρομο. Ένα άτομο που φέρνει μια καρκινογόνο μετάλλαξη μπορεί να εγγραφεί στα προγράμματα επιτήρησης και διαχείρισης που προσαρμόζονται στη φυσική ιστορία μιας ιδιαίτερης κληρονομικής διαταραχής, ενώ εκείνοι που στερούνται τη μετάλλαξη μπορούν να επανέλθουν στις οδηγίες για την διαλογή και τον έλεγχο του καρκίνου των γενικών πληθυσμών. Αυτός ο μαγικός δρόμος της γενετικής δεν είναι χωρίς τις δυσκολίες και μειονεκτήματα. Τα ηθικά διλήμματα είναι σίγουρα ότι θα προκύψουν στους ασθενείς. Εντούτοις, η μετάφραση γενετικής γνώσης στην κλινική πρακτική πρέπει να παραγάγει τη σημαντική μείωση της νοσηρότητας και της θνησιμότητας καρκίνου. Από την άλλη πλευρά η κατακλυσμιαία παροχή πληροφοριών σήμερα ξεπέρασε κατά παρασάγας κάθε δυνατότητα άμεσης αφομοίωσης τους. Έτσι παρόλο που υπάρχουν ελπίδες ότι η πληροφορική θα μπορέσει να συμμαζέψει κάπως τα δεδομένα και να βάλει κάποια τάξη είναι μάλλον δύσκολο για να μην πούμε αδύνατο να βρεθούν άμεσα κάποιες ικανοποιητικές λύσεις στο πρόβλημα της επεξεργασίας τους που επιδεινώνεται από μια διαβρωτική έλλειψη λογιοσύνης ( η ταχύτητα και η ευκολία του σύγχρονου πειραματισμού έχουν αρνητικό αντίχτυπο στην νοοτροπία ή αν θέλετε στο ήθος της εργασίας). Γιατί η πολυμάθεια δεν διδάσκει κατανόηση( πολυμαθίη νόον έχειν ου διδάσκει, Ηράκλειτος, Απόσπασμα 40). Η κατανόηση λοιπόν αυτών των πληροφοριών θα είναι αντικείμενο της βασικής βιολογικής έρευνας κατά την διάρκεια της επόμενης χιλιετίας. Ενώ λοιπόν η διαθεσιμότητα των πληροφοριών θα μπορέσει να επιταχύνει τον καθορισμό των γονιδίων που σχετίζονται με κληρονομικές ασθένειες, με προδιάθεση για υπέρταση, διαβήτη ή καρκίνο κλπ η ανάλυση των σχετικών λειτουργιών θα γίνει με έρευνα που θα εξακολουθεί να είναι επίπονη και χρονοβόρα, χωρίς αυτό να μας στερεί τις ελπίδες για μεγάλες ανακαλύψεις και πρακτικές εφαρμογές στην ιατρική στο άμεσο και ορατό μέλλον. Έτσι η διερεύνηση κυτταρικών σηματοδοτήσεων με προωθημένες τεχνικές φαίνεται εφικτή και ας μην ξεχνάμε σε αυτό το μοτίβο πλέον δουλειάς ότι ο καρκίνος είναι μία νόσος απορυθμισμένης σηματοδότησης. Το πρόβλημα του καρκίνου και το όραμα για θεραπευτικές κυτταρικές αναπληρώσεις έχει φέρει στο προσκήνιο ως έρευνα αιχμής τη μελέτη σχετικών κυττάρων, βιομορίων και γονιδίων που δυνητικά είναι υπεύθυνα για τον έλεγχο του κυτταρικού κύκλου. Αυτή είναι μία από τις πολύ λίγες προβλέψεις που μπορεί να κάνει κανείς με σιγουριά για τις άμεσες τάσεις και κατευθύνσεις σε ένα σχετικά καινούργιο πεδίο, το οποίο χωρίς αμφιβολία θα διευρύνουν οι πολλαπλές μελέτες που βρίσκονται σε εξέλιξη. Για την στιγμή που μιλάμε ο πιο διεγερτικός υπαινιγμός που έχει να προσφέρει η συγκριτική γενετική είναι η πιθανή ύπαρξη ενός μεγάλου αριθμού γονιδίων που δεν κωδικοποιούν πρωτεΐνες (12,13). Τι λειτουργία έχουν αυτά τα υποθετικά και στείρα γονίδια; εάν μη ελπήται ανέλπιστον, ουκ εξερευνήσει Ηράκλειτος, Απόσπασμα 18 Ένας καινούργιος κόσμος λοιπόν, ένας μοριακός μικρόκοσμος ανοίγεται μπροστά στα έκπληκτα μάτια της παγκόσμιας ιατρικής κοινότητας με την ανακάλυψη των ογκογονιδίων και την αναγνώριση των προϊόντων εκφράσεως τους ως βασικών ρυθμιστικών παραγόντων της κυτταρικής αυξήσεως, πολλαπλασιασμού και διαφοροποιήσεως που όταν υποστούν μετάλλαξη εμπλέκονται στην αιτιοπαθογένεια της κακοήθους εξαλλαγής και μεταστάσεως. (14) - 3 -

4 O καρκίνος λοιπόν είναι μία γενετική πάθηση. Ανωμαλίες στα γονίδια που ελέγχουν το κυτταρικό πολλαπλασιασμό οδηγούν σε μια αχαλίνωτη αύξηση που χαρακτηρίζει το νεοπλασματικό κύτταρο. Έτσι λοιπόν για να κερδίσουμε το προβάδισμα στην έρευνα και θεραπεία κατά του καρκίνου οι ερευνητές θα πρέπει να αρχίσουν να κατανοούν τη μοριακή ρίζα της ασθένειας, τα γονίδια, το μεταφορικό RNA και τις πρωτεΐνες που αυτά παράγουν. Με λίγα λόγια οι ερευνητές θα πρέπει να επικεντρώσουν στα εργαλεία της μοριακής βιολογίας Οι νέοι γενετικοί δείκτες και η καλλίτερη κατανόηση του φαινομένου της ογκογένεσης συνέβαλαν στην πλέον κατάλληλη ταξινόμηση των διαφόρων νεοπλασιών. Η γνώση της εικόνας των ενεργοποιημένων ογκογονιδίων και των διαγραμμένων ή αδρανοποιημένων αντιογκογονιδίων σε έναν τύπο καρκίνου, θα μπορούσαν να βοηθήσουν στο ακριβή καθορισμό του εξελικτικού σταδίου του όγκου και στον καθορισμό των υποομάδων των όγκων. Αναμένονται έτσι αληθινοί «γενετικοί χάρτες» των διαφόρων μορφών καρκίνου, που θα ταξινομούνται με βάση το «μοριακό αποτύπωμα» τους. ΓΟΝΙΔΙΑ ΚΑΙ ΠΡΟΪΟΝΤΑ ΕΚΦΡΑΣΗΣ ΤΟΥΣ Τα γονίδια είναι η βασική μονάδα κληρονομιάς και ο ύστατος καθοριστικός παράγοντας για όλους τους φαινότυπους. Το DNA ενός κανονικού ανθρώπινου κυττάρου περιέχει περίπου 50 έως γονίδια, αλλά μόνο ένα μικρό τμήμα από αυτά χρησιμοποιείται (ή εκφράζεται) σε οποιοδήποτε ιδιαίτερο κύτταρο οποιαδήποτε στιγμή (12,13) Για παράδειγμα τα γονίδια που είναι ειδικά για τα ερυθροκύτταρα, όπως πχ τα γονίδια που σχετίζονται με την έκφραση της αιμοσφαιρίνης δεν εκφράζονται στα κύτταρα του εγκεφάλου. Σύμφωνα με το κεντρικό δόγμα της μοριακής βιολογίας ένα γονίδιο ασκεί την αποτελεσματικότητά του έχοντας ένα αντιγραμμένο DNAσε ένα αγγελιοφόρο RNA(mRNA) το οποίο με τη σειρά του μεταφράζεται σε μια πρωτεΐνη τον τελικό αποδέκτη της γονιδιακής έκφρασης

5 Εικόνα 1. Έκφραση γονιδίων. Το DNA ενός γονιδίου μεταγράφεται σε mrna που στη συνέχεια, μεταφράζεται στην αντίστοιχη πρωτεΐνη. Τα λειτουργικά συστατικά ενός γονιδίου είναι σχηματικά εδώ. Οι περιοχές του γονιδίου που προορίζονται για να αντιπροσωπευθούν στο ώριμο mrna καλούνται εξώνια, και οι περιοχές του DNA μεταξύ των εξωνίων καλούνται εσώνια. Η μερίδα του γονιδίου που ελέγχει τη μεταγραφή, και επομένως την έκφραση, είναι το γονίδιουποκινητής. Αυτός ο έλεγχος ασκείται από τις συγκεκριμένες ακολουθίες νουκλεοτίδιων στην περιοχή γονιδίωνυποκινητών (αποκαλούμενοι " cis -ενεργοί παράγοντες) και από τις πρωτεΐνες (αποκαλούμενοι " trans -ενεργοί παράγοντες) που πρέπει να αλληλεπιδράσουν με το DNA ή/και την πολυμεράση ΙΙ γονιδίων-υποκινητών RNA για να ολοκληρωθεί η μεταγραφή. Το αρχικό αντίγραφο είναι το μόριο RNA που γίνεται από την πολυμεράση ΙΙ. Πρίν αφήσει τον πυρήνα, το αρχικό αντίγραφο τροποποιείται για να συνδέσει μαζί τα εξόνια ( αφαιρεί εσώνια στις ακολουθίες), Έτσι οι μοριακοί βιολόγοι συχνά ερευνούν την έκφραση ή την ενεργοποίηση με απλούστερα λόγια δηλαδή την πρόοδο της αντιγραφής του DNA σε RNA ή της μετάφρασης του RNA σε μια πρωτεΐνη. Η πρόοδος της αντιγραφής συνεπάγεται ένα τέλειο αντίγραφο RNA από την χρήση του DNA του γονιδίου σαν καλούπι. Η μετάφραση του mrna σε μια πρωτεΐνη είναι πιο πολύπλοκη διαδικασία μια και η δομή της πρωτεΐνης είναι κωδικοποιημένη στο mrna και αυτό το δομικό μήνυμα πρέπει να αποκωδικοποιηθεί κατά την διάρκεια της μετάφρασης. Κάθε γονίδιο αποτελείται από διάφορα λειτουργικά συστατικά, κάθε ένα που περιλαμβάνεται σε μια διαφορετική άποψη της διαδικασίας της έκφρασης γονιδίων Μιλώντας γενικά παρόλα αυτά υπάρχουν δυο κύριες λειτουργικές μονάδες η περιοχή υποστήριξης (promoter) και η περιοχή κωδικοποίησης (coding). Η περιοχή υποστήριξης ελέγχει πότε και σε τι ιστό το γονίδιο θα εκφραστεί. Για παράδειγμα η περιοχή υποστήριξης, για το γονίδιο που σαν προϊόν έκφρασης έχει την αιμοσφαιρίνη, προάγει την έκφραση του πιο πάνω γονιδίου στα ερυθροκύτταρα και όχι στα κύτταρα του εγκεφάλου. Πώς αυτή η εξειδικευμένη για συγκεκριμένους ιστούς έκφραση επιτυγχάνεται όμως; Στο DNA της περιοχής υποστήριξης του γονιδίου, υπάρχουν ειδικά δομικά στοιχεία αλληλουχίες νουκλεοτιδίων οι οποίες επιτρέπουν στο γονίδιο να εκφράζεται μόνο στο σωστό κύτταρο. Αυτές οι δομές είναι γνωστές σαν cis- ενεργά στοιχεία και εδράζονται στο ίδιο μόριο του DNA του γονιδίου. Σε μερικές περιπτώσεις σε άλλους ιστούς τα ειδικού τύπου cis- ενεργά στοιχεία ονομάζονται αυξητικά (enhancers) που εδράζονται στο ίδιο μόριο DNA αλλά σε μεγάλες αποστάσεις από την περιοχή κωδικοποίησης του γονιδίου (15,16) Στο κατάλληλο κύτταρο οι cis-ενεργές περιοχές δεσμεύουν πρωτεϊνικούς παράγοντες οι οποίοι είναι υπεύθυνοι για την αντιγραφή του γονιδίου. Αυτές λοιπόν οι πρωτεΐνες ονομάζονται trans-ενεργοί παράγοντες επειδή βρίσκονται στον κυτταρικό πυρήνα χωριστά από το μόριο του DNA που απαρτίζει το γονίδιο. Για παράδειγμα τα εγκεφαλικά κύτταρα δεν έχουν τους κατάλληλους transενεργούς παράγοντες που να συνδέονται με την περιοχής υποστήριξης της αιμοσφαιρίνης και συνεπώς τα εγκεφαλικά κύτταρα δεν μπορούν να εκφράσουν την αιμοσφαιρίνη ενώ σε αντίθεση έχουν trans-ενεργούς παράγοντες που συνδέονται με ειδικές νευρικές περιοχές υποστήριξης. Η δομή μιας γονιδιακά καθοριζόμενης πρωτεΐνης καθορίζεται από την περιοχή κωδικοποίησης του γονιδίου. Και στο παράδειγμά μας η περιοχή κωδικοποίησης περιέχει την πληροφορία κατά την οποία ένα ερυθροκύτταρο δεσμεύει τα ανάλογα δομικά υλικά για να σχηματίσει την πρωτεΐνη αιμοσφαιρίνη. Το DNA είναι ένα γραμμικό πολυμερές που αποτελείται από τέσσερις υπομονάδες που καλούνται νουκλεοτίδια. Στην περιοχή κωδικοποίησης του γονιδίου η γραμμική αλληλουχία των νουκλεοτιδίων κωδικοποιεί την αλληλουχία των αμινοξέων της πρωτεΐνης. Αυτός ο - 5 -

6 γενετικός κώδικας είναι σε μια μορφή τριάδας ώστε κάθε ομάδα από τρία νουκλεοτίδια να κωδικοποιεί ένα απλό αμινοξύ. Οι εξηντατέσσερις τριάδες που μπορεί να σχηματιστούν από τα 4 νουκλεοτίδια προάγουν τον σχηματισμό των αμινοξέων που είναι απαραίτητα για τον σχηματισμό και δημιουργία των πρωτεϊνών. Αυτό όμως κάνει τον κώδικα εκφυλισμένο και σαν επακόλουθο μερικά αμινοξέα να αντιπροσωπεύονται με περισσότερες από μία τριπλέτες (17) Τα νουκλεοτίδια αποτελούν τη βασική επαναλαμβανόμενη μονάδα από την οποία απαρτίζεται το πολυμερές του DNA. Αποτελούνται από ένα μη σημαντικό κομμάτι ένα σάκχαρο (δεοξυριβόζη), με μια φωσφορική ρίζα και το σημαντικό-πολύτιμο μέρος μια βάση. Από τις 4 βάσεις που παρουσιάζονται στα νουκλεοτίδια του DNA δύο είναι πουρίνες, η αδενίνη και η γουανίνη και δύο πυριμιδίνες, η κυτοσίνη και η θυμίνη. Έτσι σχηματίζεται το πιο σημαντικό δομικό συστατικό ενός χρωμοσώματος ένα συνεχόμενο μόριο DNA. Ένα μόριο που τη δομή του εισήγαγε στην διεθνή κοινότητα με μια μονοσέλιδη εργασία Molecular structure of nucleic acids στο έγκυρο περιοδικό Νature στις 25 Απριλίου 1953 ο James Watson και Francis Crick, η οποία έμελλε να αποτελέσει τη σημαντικότερη ίσως ανακάλυψη του αιώνα. Εικόνα 2 Το μοντέλο της διπλής έλικας των Watson & Crick στο οποίο οι δύο πολυνουκλεοτιδικές αλυσίδες σχηματίζουν μια έλικα που μοιάζει με σκάλα. Ο σκελετός του φωσφορικού οξέος και της δεοξυριβόζης από την εξωτερική πλευρά ενώ οι αζωτούχες βάσεις από την εσωτερική. Αυτή η διευθέτηση του μορίου ταιριάζει με αυτή που παίρνουμε με τη σκέδαση των ακτίνων Χ. Όσον αφορά τις βάσεις η αδενίνη ενώνεται με την θυμίνη της άλλης αλυσίδας είτε η η γουανίνη της μιας με την κυτοσίνη της άλλης. Στην πρώτη περίπτωση σχηματίζονται αμέσως 2 υδρογονικοί δεσμοί μεταξύ τους,ενώ στη δεύτερη τρείς υδρογονικοί δεσμοί. Αντίθετο με την ελικοειδή μορφή είναι το ζευγάρωμα πυριμιδίνης με πυριμιδίνη ή πουρίνης με πουρίνη, όπως και το ζεύγος A με τη C και η G με τη Τ

7 Τα νουκλεοτίδια συνδέονται μεταξύ τους με ένα είδος δεσμού (φωσφοδιεστερικός), ώστε το σάκχαρο και η φωσφορική ομάδα να αποτελούν τα παράλληλα εξωτερικά τμήματα της ελικοειδούς σκάλας που αποτελεί το μόριο του DNA. Οι βάσεις από τις απέναντι πλευρές της σκάλας ζευγαρώνουν μεταξύ τους για να σχηματίσουν τα σκαλοπάτια της. Ένα συγκεκριμένο κομμάτι της σκάλας έχει συνήθως μια μοναδική αλληλουχία βάσεων. Επειδή το γονίδιο είναι απλώς ένα κομμάτι αυτής της σκάλας, έχει και αυτό μια μοναδική αλληλουχία βάσεων. Αυτή η αλληλουχία μπορεί να χρησιμοποιηθεί για την διάκρισή του από τα άλλα γονίδια και για τον προσδιορισμό της θέσης του στο χρωμόσωμα. Στα ευκαριωτικά κύτταρα οι περιοχές κωδικοποίησης των περισσοτέρων γονιδίων δεν είναι συνεχόμενες. Αποτελούνται από περιοχές που μεταγράφονται στο mrna, τα εξώνια οι οποίες διακόπτονται από αναδιπλώσεις του DNΑ οι οποίες δεν εμφανίζονται στο ώριμο mrna, τα εσώνια. Οι λειτουργίες που αποδίδονται στα εσώνια βρίσκονται ακόμη υπό καθεστώς έρευνας. Ένας σκοπός μερικών κατηγοριών από αυτά είναι να υπαινίσσονται με την συντήρηση την ανάπτυξη. Παρόλα αυτά, η συνολική δομή τους μπορεί να είναι περισσότερο ζωτική από την εδική αλληλουχία των νουκλεοτιδίων, βλέποντας από το ότι η αλληλουχία των νουκλεοτιδίων των εσωνίων μεταβάλλεται πιο γρήγορα στην εξελικτική διαδικασία από ότι η αλληλουχία των εξωνίων. Τελικά το DNA που περιέχεται στα γονίδια αποτελεί ένα μικρό ποσοστό του συνολικού DNA. Μεταξύ των γονιδίων υπάρχει μία τεράστια έκταση από μη αντιγραφέν DNA η οποία υποστηρίζεται όμως ότι παίζει έναν πολύ βασικό δομικό ρόλο. Τέλος στον πυρήνα το DNA δεν παρατηρείται σαν γυμνό νουκλεικό οξύ αλλά σε στενή σχέση με έναν αριθμό από βοηθητικές πρωτεΐνες όπως οι ιστόνες και η καινούργια αυτή δομή καλείται χρωματίνη. (18) Πολλές από αυτές τις βοηθητικές πρωτείνες δεν φαίνεται να έχουν ιδιαίτερες λειτουργίες αλλά να σχετίζονται με τη στερεοδομή του DNAστο χώρο (19,20) ΚΥΤΤΑΡΙΚΟΣ ΠΟΛΛΑΠΛΑΣΙΑΣΜΟΣ Η βιολογία της κυτταρικής διαίρεσης, διαφοροποίησης και απόπτωσης είναι ασυνήθιστα παρά τα αναμενόμενα όμοια στα κανονικά και στα καρκινικά κύτταρα. Τα καρκινικά κύτταρα διαφέρουν από τα φυσιολογικά στο ότι παρεκτρέπεται η κυτταρική ρύθμιση. Τα καρκινικά κύτταρα περιέχουν όλα τα είδη των απαραίτητων βιομορίων που είναι απαραίτητα για την επιβίωση, τον πολλαπλασιασμό, τη διαφοροποίηση, τον κυτταρικό θάνατο, και την έκφραση πολλών ειδικών για κάθε κύτταρο εξειδικευμένων λειτουργιών. Η αποτυχία όμως της ρύθμισης αυτών των λειτουργιών κανονικά έχει σαν αποτέλεσμα την παραλλαγή του φαινοτύπου και τον καρκίνο. Τέσσερις κυτταρικές λειτουργίες οδηγούν σε μια ακατάλληλη ρύθμιση σε ένα νεόπλασμα. Αρχικά, η κανονική πίεση για τον συνήθη βιοχημικό έλεγχο πάνω στον κυτταρικό πολλαπλασιασμό είναι αναποτελεσματική. Δεύτερον, το πρόγραμμα διαφοροποίησης μπορεί να παραμορφωθεί. Τα καρκινικά κύτταρα μπορεί να μπλοκαριστούν σε ένα καθορισμένο σημείο της διαδικασίας διαφοροποίησης ή να διαφοροποιηθούν σε ακατάλληλο ή ανώμαλο κυτταρικό τύπο. Τρίτον η χρωμοσωμιακή και γενετική οργάνωση μπορεί να αποδιοργανωθεί τόσο ώστε τα παραλλαγμένα κύτταρα να γεννιούνται με αυξημένη συχνότητα. Μερικές παραλλαγές κυττάρων μπορεί να αυξήσουν την ενζυματική παραγωγή ή διαδικασίες οι οποίες - 7 -

8 επιτρέπουν την κακοήθη διήθηση ή τις μεταστάσεις. Τελικά το στεγανά ρυθμιζόμενο σύστημα της κυτταρικής απόπτωσης μπορεί να απορυθμιστεί. Βασικά ο καρκίνος είναι μια πάθηση με συσσώρευση κλωνοποιημένων κυττάρων. Ανώμαλος κυτταρικός πολλαπλασιασμός είναι απαραίτητος αν και συχνά ανεπαρκής για την καρκινογένεση. Η αύξηση του αριθμού των καρκινικών κυττάρων, το καρκινικό φορτίο δηλαδή σίγουρα είναι βασικό για τα αρνητικά και δυσμενή στοιχεία για τον ξενιστή. Στην πραγματικότητα το σημαντικότερο σημείο το οποίο αποτελεί και σημαντικό εφαλκτήριο για την πιο πρόσφατη θεραπεία κατά του καρκίνου είναι να μειωθεί ο καρκινικός κυτταρικός πληθυσμός και να προστατευτεί ο οργανισμός από περαιτέρω συσσώρευση καρκινικών κυττάρων. Για να εκπληρώσουμε καλλίτερα την προσέγγιση αυτού του σημείου μια πλήρης περιγραφή των μοναδικών χαρακτηριστικών του καρκινικού πολλαπλασιασμού είναι απαραίτητη. Αυτός ο σκοπός είναι δύσκολος από το γεγονός ότι τόσο ο καρκινικός πολλαπλασιασμός όσο και ο φυσιολογικός είναι παρόμοιοι. Από την προοπτική μιας βιολογικής ανάπτυξης είναι προφανές ότι τα κύτταρα ενός πολυκύτταρου οργανισμού όπως ο ανθρώπινος έχουν έναν ουσιαστικό πολλαπλασιαστικό δυναμικό το οποίο είναι σε τεράστια περίσσεια από αυτό που απαιτείται για να καλύψει τις ενδεχόμενες ανάγκες μιας φυσιολογικής αύξησης και ανάπτυξης. Η κυτταρική ζωή εξελίσσεται από έναν μονοκύτταρο οργανισμό που διαλέχτηκε για την ικανότητα του να πολλαπλασιάζεται σε μικρό εύρος χρόνου, χωρίς τον εξαναγκασμό που επιβάλει από την βιοχημική πρόοδο της κυτταρικής διαίρεσης (21) Τυπικά εργαστηριακά πειράματα από βακτηρίδια έδειξαν ότι μπορεί να πραγματωθεί διαίρεση του κυττάρου σε χρόνο 20 λεπτών σε ιδανικές συνθήκες. Η ανάγκη της κυτταρικής διαίρεσης που επιβάλλεται σε πολυκύτταρους οργανισμούς είναι μεγαλύτερη αφού η αντιγραφή πρέπει να αποτελέσει εκτός από την απόλυτη πιστότητα και να διατηρήσει την ακεραιότητα του οργανισμού. Τα φυσιολογικά ανθρώπινα κύτταρα μπορούν να διαιρούνται μια ή και δύο φορές τη μέρα in vivo. Ένα διαιρούμενο κύτταρο μία φορά τη μέρα θα μπορέσει να δημιουργήσει έναν αριθμό κυττάρων ίσο με το συνολικό αριθμό κυττάρων σε έναν ενήλικο ανθρώπινο οργανισμό σε λιγότερο από 2 μήνες. Ξεκάθαρα τότε τα ανθρώπινα κύτταρα έχουν ως κληρονομιά το πλεόνασμα της πολλαπλασιαστικής χωρητικότητας από τα αρχέγονα προγονικά κύτταρα. Οι πολυκύτταροι οργανισμοί πρέπει να εξελίσσουν μηχανισμούς έτσι ώστε να ανακτούν αυτή την πολλαπλασιαστική ικανότητα στο κατάλληλο χρόνο και μέρος. Το κλειδί για την κατανόηση του καρκινικού κυτταρικού πολλαπλασιασμού τότε είναι να χαρακτηρίσεις αυτούς τους μηχανισμούς και να καταλάβουμε που και πως αυτοί αποτυγχάνουν κατά τη διάρκεια της καρκινογένεσης Το ποσοστό πολλαπλασιασμού κυττάρων μέσα σε οποιοδήποτε πληθυσμό των κυττάρων εξαρτάται από τρεις παραμέτρους: (α) το ποσοστό κυτταροδιαίρεσης (Tc), (β) το μέρος των κυττάρων μέσα στον πληθυσμό που υποβάλλεται στην κυτταροδιαίρεση (μέρος αύξησης), και (γ) το ποσοστό απώλειας κυττάρων από τον πληθυσμό λόγω του τελικού θανάτου διαφοροποίησης ή κυττάρων Το TC αντιπροσωπεύει το χρόνο που παίρνει για να ολοκληρώσει έναν κύκλο κυτταροδιαίρεσης

9 Εικόνα 3. Ο κυτταρικός κύκλος. Όταν ένα κύτταρο δεν συνθέτει το DNA (φάση S) ή δεν ολοκληρώνει τη μίτωση (φάση M), καλείται συνήθως ως μια φάση G (χάσμα). Τα κανονικά κύτταρα είναι σε ένα καθεστώς μη διαίρεσης που συνηθίζεται να αποκαλείται Go. Στη συνέχεια μπορούν να αρχίσουν έναν ή περισσότερους κύκλους της κυτταροδιαίρεσης όταν υπάρχει μια ανάγκη να διατηρηθεί ή να αντικατασταθεί ο ιστός, και αυτοί σταματούν όταν η απαραίτητη αύξηση είναι πλήρης. Στη φάση G1, η σύνθεση πρωτεΐνης και RNA είναι ενεργός. Εάν οι συνθήκες είναι ευνοϊκές για την επόμενη κυτταροδιαίρεση, τα κύτταρα περνούν μέσω του σημείου R(περιορισμός) και κινούνται γρήγορα στη συνθετική περίοδο του S όπου συντίθεται το νέο DNA. Ένα άλλο χάσμα (G2) ακολουθεί οπότε τα πρόσφατα αναπαραχθέντα χρωμοσώματα συμπυκνώνουν. Στην περίοδο M, τα χρωμοσώματα διαιρούνται σε δύο σύνολα, οι μορφές κυττάρων σε δύο πυρήνες, και διαιρούνται έπειτα σε δύο θυγατρικά κύτταρα. Όταν τα κανονικά κύτταρα διαφοροποιούνται, χαρακτηριστικά έχοντας ένα κέρδος στις ιδιότητες που απαιτούνται για τις λειτουργίες οργάνων ή ιστού, χάνουν γενικά την ικανότητα να συνεχίσουν την κυτταροδιαίρεση. Ο κύκλος κυτταροδιαίρεσης μπορεί να διαιρεθεί σε δύο λειτουργικές φάσεις, φάσεις του S και M, και δύο προπαρασκευαστικές φάσεις, G1 και G2 Η φάση του S ορίζεται ως η φάση στην οποία το DNA ξεδιπλώνεται. Κάτω από τις κανονικές περιστάσεις, ο χρόνος που παίρνει ένα χαρακτηριστικό ανθρώπινο κύτταρο στην πλήρη φάση του S είναι περίπου 8 ώρες και είναι αμετάβλητος. Τα πλήρως ξεδιπλωμένα χρωμοσώματα διαχωρίζονται σε κάθε ένα από τους δύο θυγατρικούς πυρήνες με τη διαδικασία μίτωσης κατά τη διάρκεια της φάσης Μ. Το μήκος της φάσης Μ είναι περίπου 1 ώρα και είναι επίσης κανονικά αμετάβλητο. Η φάση G1 προηγείται της φάσης του S, ενώ G2 η φάση προηγείται της φάσης Μ. G1 και G2 οι φάσεις απαιτούνται για τη σύνθεση των κυτταρικών συστατικών που απαιτούνται για να υποστηρίξουν την ακόλουθη φάση και τελικά στην πλήρη κυτταροδιαίρεση. Στα μαστοφόρα κύτταρα, το μήκος G2 της φάσης είναι περίπου 2 ώρες. Το μήκος G1 της φάσης είναι ιδιαίτερα μεταβλητό και μπορεί να κυμανθεί από περίπου 6 ώρες σε αρκετές ημέρες ή περισσότερο. Το ποικίλο μήκος της φάσης G1 αποτελεί έναν απολογισμό με κύριο εκφραστή της διαφορετικότητας του κυττάρου το TC που αποτελεί κριτήριο μεταξύ των κυττάρων που αυξάνονται υπό διαφορετικούς όρους. ΚΥΤΤΑΡΙΚΟΣ ΚΥΚΛΟΣ Εκτός από λίγες εξαιρέσεις, όλα τα κύτταρα γεννιούνται ή πεθαίνουν. Η χρονική περίοδος μεταξύ του τέλους της μιας κυτταρικής διαίρεσης μέχρι το τέλος της επόμενης κυτταρικής διαίρεσης καλείται κυτταρικός κύκλος

10 Ο κυτταρικός κύκλος περιλαμβάνει την μεσόφαση και την μίτωση. Με την μίτωση το κύτταρο διαιρείται στα δύο. Τα δυο νέα κύτταρα μετά από ένα ορισμένο χρονικό διάστημα (μεσόφαση) διαιρούνται και πάλι κοκ. Στους μονοκύτταρους οργανισμούς με την κυτταρική διαίρεση επιτυγχάνεται αύξηση του ολικού αριθμού των ατόμων ενός πληθυσμού. Στους πολυκύτταρους οργανισμούς με την κυτταρική διαίρεση αυξάνεται ο αριθμός των κυττάρων του οργανισμού και αντικαθίστανται τα κατεστραμμένα κύτταρα. Η κυτταρική διαίρεση είναι εξίσου σημαντική για τους αναπτυσσόμενους οργανισμούς όσο και για τους ώριμους. Σε έναν ώριμο άνθρωπο, εκατομμύρια κύτταρα διαιρούνται σε κάθε χρονική στιγμή για να διατηρήσουν σταθερό τον αριθμό των κυττάρων. Τη δεκαετία του 50 αποδείχθηκε με τη χρήση των ραδιενεργών ισοτόπων και της αυτόραδιογραφίας ότι η σύνθεση του DNA γίνεται στο στάδιο της μεσόφασης. Τη χρονική περίοδο σύνθεσης του DNA ονόμασαν φάση S. Κατά το τέλος της φάσης S τα κύτταρα έχουν αντιγράψει όλο το γενετικό υλικό και έτσι έχουν διπλοειδείς σειρές γενετικής πληροφορίας. Η φάση S χρησιμεύει σαν σημάδι για τον καθορισμό των άλλων φάσεων της μεσόφασης. Συνήθως από την αρχική στιγμή διπλασιασμού του κυττάρου μέχρι να αρχίσει η αντιγραφή του DNA, περνά ένα χρονικό διάστημα το οποίο αντιστοιχεί στη φάση G 1. Από την στιγμή πάλι που θα γίνει η αντιγραφή του DNA μέχρι μέχρι να αρχίσει η διαίρεση του κυττάρου περνά ένα χρονικό διάστημα που καλείται φάση G 2. Με το τέλος της φάσης G 2 αρχίζει η περίοδος της κυτταρικής διαίρεσης, γνωστής ως φάσης Μ(μίτωση). Κατά τη διάρκεια της φάσης G 2 το κύτταρο έχει διπλάσιο ποσό DNA από το αρχικό διπλοειδές κύτταρο. Τα κύτταρα που δεν διαιρούνται (νευρικά κύτταρα) και αυτά που διαιρούνται σπάνια(λεμφοκύτταρα)περιέχουν DNA όσο ένα διπλοειδές κύτταρο (φάση G 1 ) ΦΑΣΗ G2 ΦΑΣΗ M ΦΑΣΗ G1 ΦΑΣΗ S Εικόνα 4 Ο κυτταρικός κύκλος Η διάρκεια των φάσεων G 1,S,G 2 και Μ διαφέρει στα διάφορα είδη κυττάρων ενώ οι διαφορές είναι ασήμαντες σε κύτταρα του ιδίου είδους. Η διάρκεια των φάσεων S και G 2 ελάχιστα επηρεάζεται από τις συνθήκες του περιβάλλοντος και μπορεί να θεωρηθεί ως σταθερό χαρακτηριστικό κάθε κυτταρικού τύπου, ακόμη δε σε διάφορα κύτταρα διαφόρων θηλαστικών βρέθηκαν περίπου οι ίδιες σε διάρκεια: S περίπου 6-10 ώρες και για την G 2 περίπου 2-5 ώρες. (22) Σε αντίθεση με τις φάσεις S και G 2, η διάρκεια της φάσης G 1 επηρεάζεται από διάφορους παράγοντες φυσικούς ή περιβαλλοντολογικούς και διαφέρει σημαντικά μεταξύ των κυτταρικών τύπων, καθώς και μέσα στον ίδιο κυτταρικό πληθυσμό

11 Γενικά ανάλογα με τις συνθήκες, η φάση G 1 διαρκεί ημέρες, μήνες ή και χρόνια. Η ρύθμιση της διάρκειας του κυτταρικού κύκλου επιτελείται σε κάποιο ειδικό σημείο προς το τέλος της φάσης G1. Αν ξεπεραστεί το σημείο αυτό (σημείο περιορισμού, restriction point), τότε το κύτταρο θα ολοκληρώσει τον κύκλο ανεξάρτητα από τις συνθήκες του περιβάλλοντος. Στα βακτηρίδια, στα πλασμίδια και στους περισσότερους DNA ιούς υπάρχει ένα σημείο έναρξης μεταγραφής DNA. Αντίθετα στα ευκαριωτικά κύτταρα υπάρχουν πολλά σημεία έναρξης της αντιγραφής του DNA. Κι αυτό γιατί αν υπήρχε ένα μόνο σημείο έναρξης, η διάρκεια της φάσης S θα ήταν υπερβολικά μεγάλη με σημαντικές επιπτώσεις για τον πολλαπλασιασμό των κυττάρων. Το γονιδίωμα του ανθρώπου έχει περίπου 2 χ ανεξάρτητα σημεία αντιγραφής. Αν είχε ένα μόνο σημείο αντιγραφής θα απαιτούνταν περίπου 800 ώρες για την πλήρη αντιγραφή ενός χρωμοσώματος. Τα σημεία έναρξης της αντιγραφής φαίνεται ότι είναι καθορισμένες αλληλουχίες DNA και η διαδικασία της αντιγραφής αυτή καθ αυτή είναι μια τυπικά ασύγχρονη διαδικασία, με τα διάφορα χρωμοσώματα και τις διάφορες μονάδες αντιγραφής του ίδιου χρωμοσώματος να συνθέτουν το δικό τους DNA σε διαφορετικά χρονικά διαστήματα της φάσης S. Η διαδικασία αντιγραφής είναι ειδική για κάθε κυτταρικό τύπο και φαίνεται να διατηρείται από γενιά σε γενιά. Με μελέτες σε κυτταροκαλλιέργειες που μετριέται ο χρόνος αντιγραφής συγκεκριμένων γονιδίων διαπιστώθηκε ότι τα γονίδια που είναι ενεργά για όλα τα κύτταρα ενός οργανισμού, αντιγράφονται στην αρχή της φάσης S. Τα γονίδια που είναι ενεργά σε ορισμένα μόνα κύτταρα, αντιγράφονται στην αρχή της φάσης S μόνο στα κύτταρα που είναι ενεργά και αργότερα στους άλλους κυτταρικούς τύπους. Στο ευκαριωτικό γονιδίωμα μια άλλη ιδιομορφία είναι ότι ο αριθμός των σημείων έναρξης της αντιγραφής και συνεπώς των μονάδων της αντιγραφής εξαρτάται από το αναπτυξιακό στάδιο του οργανισμού. Στα στάδια της αυλάκωσης κατά την εμβρυογένεση η φάση S είναι πολύ πιο γρήγορη ενώ στα σωματικά κύτταρα η φάση S διαρκεί πολύ περισσότερο. Οι διαφορές στην χρονική διάρκεια της S φάσης οφείλονται στον αριθμό των σημείων έναρξης της αντιγραφής του DNA. Τα εμβρυϊκά κύτταρα χρησιμοποιούν όλα τα σημεία έναρξης της αντιγραφής, ενώ τα ώριμα σωματικά κύτταρα περίπου το 10%. Η σύνθεση των ιστονών, η αντιγραφή του DNA και η συγκρότηση των νουκλεοσωμάτων γίνεται ταυτόχρονα στη φάση S ενώ η πλειονότητα των πρωτεϊνών και του RNA παράγεται καθ όλη τη διάρκεια της μεσόφασης (22) ΡΥΘΜΙΣΗ ΤΟΥ ΚΥΤΤΑΡΙΚΟΥ ΚΥΚΛΟΥ Μία πετυχημένη κυτταρική διαίρεση απαιτεί μία πειθαρχημένη και αμφίδρομη μετάβαση από τη μία φάση του κυτταρικού κύκλου στην άλλη. Σημαντικά γεγονότα πρέπει να ολοκληρώνονται πριν αρχίσουν κάποια άλλα. Για παράδειγμα η έναρξη της μιτωτικής διαδικασίας προ της ολοκλήρωσης της αντιγραφής του DNA θα οδηγήσει προφανώς σε βλάβη του κυττάρου. Θεωρητικά η αλληλουχία των γεγονότων του κυτταρικού πολλαπλασιασμού αποτελεί ένα βιοχημικό λειτουργικό μονοπάτι. Το προϊόν της μίας αντίδρασης χρησιμεύει ως απαραίτητο υπόβαθρο για την επόμενη. Η ρύθμιση του καθ ενός συστήματος είναι εγγενής από βιοχημικά γεγονότα που ολοκληρώνονται από μόνα τους. Η επικρατούσα άποψη είναι ότι ο χρόνος και η

12 ρύθμιση του κυτταρικού κύκλου εξαρτώνται από χωριστούς θετικούς και αρνητικούς κύκλους. Ο κύκλος της ρύθμισης περιλαμβάνει μια σειρά από σημεία ελέγχου που επιτρέπουν την προσπέλαση μόνο εφόσον πραγματοποιηθούν σημαντικά γεγονότα του κυτταρικού κύκλου. Οι δύο πλευρές του ρυθμιστικού κύκλου είναι ο εσωτερικός και ο εξωτερικός. Το εσωτερικό μονοπάτι του ρυθμιστικού κύκλου είναι υπεύθυνο για τον ακριβή έλεγχο των γεγονότων του κυτταρικού κύκλου. Εφόσον η διάρκεια της S,G2 και Μ φάσης του κύκλου στα κύτταρα είναι σχετικά αμετάβλητη οι μετατροπές μεταξύ των φάσεων ελέγχονται κυρίως από το εσωτερικό ρυθμιστικό μονοπάτι. Το εξωτερικό ρυθμιστικό μονοπάτι ενεργεί σαν απάντηση σε εξωτερικούς ή περιβαλλοντολογικούς παράγοντες ή σαν απάντηση σε αναδυόμενες ανωμαλίες του κυτταρικού κύκλου. Θα εστιάσουμε την προσοχή μας στο εξωτερικό ρυθμιστικό κύκλο όπου οι διάφορες μεταξύ φυσιολογικού και νεοπλασματικού κυττάρου είναι προφανής. Εικόνα 5 Ρύθμιση του κυτταρικού κύκλου-σημείο R Παρουσιάζονται οι φάσεις της κυτταρικής διαίρεσης. Η μετάβαση από μια φάση στην επόμενη απαιτεί τη διέλευση ενός σημείου ελέγχου, όπως το σημείο περιορισμού (R), κατά τη διάρκεια του G0/G1 στη μετάβαση φάσης του S. Τη διέλευση του σημείου ελέγχου προϋποθέτει η ενεργοποίηση των από κυκλίνης -εξαρτώμενων κινάσεων (CDKs). Παρουσιάζεται ο συγχρονισμός της ενεργοποίησης μεμονωμένου CDKs κατά τη διάρκεια του κύκλου κυττάρων Η ενεργοποίηση του cyclin D/CDK4,6 είναι συμπίπτουσα με φωσφορυλίωση της πρωτεΐνης που αποτελεί το προϊόν έκφρασης του ογκοκατασταλτικού γονιδίου (Rb) και της διέλευσης του σημείου ελέγχου R. Εικόνα 6 Ρύθμιση του κυτταρικού κύκλου-ρυθμιστικός έλεγχος του CDKs

13 Η δραστηριότητα CDKs ελέγχεται σε διάφορα επίπεδα: (1) η σύνθεση των κυκλινών εμφανίζεται στους συγκεκριμένους χρόνους κατά τη διάρκεια του κύκλου κυττάρων ή σε απάντηση σε ορισμένους παράγοντες αύξησης (2) την υποβάθμιση των κυκλινών στους συγκεκριμένους χρόνους κατά τη διάρκεια του κύκλου κυττάρων και τη μεσολάβηση από εξαρτώμενη πρωτεόλυση (3) η υπομονάδα της κυκλίνης πρέπει να συνδεθεί με την καταλυτική υπομονάδα CDK (4) το σύμπλεγμα απαιτεί φωσφορυλίωση από CAK για να φθάσει στη μέγιστη συγκεκριμένη δραστηριότητα (5το σύμπλεγμα αδρανοποιείται από φωσφορυλίωση στα συγκεκριμένα υπολείμματα στην περιοχή συνδέσεων ATP του ενζύμου (5b) και μπορεί να επανενεργοποιηθεί από αποφωσφορυλίωση αυτών των υπολειμμάτων από Cdc25 (5a) (6) CKIs μπορεί να εμποδίσει τη συνέλευση της κυκλίνης /CDK συμπλέγματος (6a) ή της ενεργοποίησης του συμπλέγματος (6b). Το πέρασμα από το σημείο ελέγχου (checkpoints) του κυτταρικού κύκλου απαιτεί την ενεργοποίηση ενδοκυτταρικών ενζύμων γνωστά ως κινάσες εξαρτώμενες από κυκλίνες (CDKs). Οι CDKs είναι ισχυρά επιλεγμένες σαν επιλογές δια μέσου της εξελικτικής διαδικασίας. CDKs υπάρχουν σε όλα τα ευκαριωτικά κύτταρα από μύκητες στα φυτά και στα θηλαστικά. Στην πραγματικότητα CDKs από ανθρώπινα κύτταρα μπορεί να αποτελέσει το υπόβαθρο για την ενεργοποίηση ενζύμων. Η δομική και λειτουργική συμμετοχή αυτών των ενζύμων διαμέσου της εξελικτικής διαδικασίας υποθέτει ότι αποτελεί η CDKs κεντρικό και βασικό ρυθμιστικό υπόβαθρο για τον κυτταρικό κύκλο σε όλα τα ευκαριωτικά κύτταρα. Οι ανάγκες για αυτά τα ένζυμα, για την μετάβαση του κυτταρικού κύκλου έχει τεκμηριωθεί και έχει αποδοθεί σε γενετικό έλεγχο (23) Έχοντας υπόψη ότι η ενεργοποίηση της CDKs αποτελεί κεντρικό γεγονός στην μετάβαση του κυτταρικού κύκλου στο επόμενο στάδιο, δε μας ξαφνιάζει το γεγονός ότι αυτή η δραστηριότητα ρυθμίζεται σε διάφορα επίπεδα (24) Το ενεργό CDKs ολοένζυμο συνθέτεται από μία καταλυτική υπομονάδα και το ρυθμιστικό σύστημα της κυκλίνης. Ένα επίπεδο ρύθμισης είναι ότι κάθε κυκλίνη συντίθεται σε συγκεκριμένο σημείο του κυτταρικού κύκλου. Για παράδειγμα η κυκλίνη D συντίθεται κατά τη διάρκεια της G1 φάσης η κυκλίνη Ε συντίθεται στο τέλος της G1 φάσης, η κυκλίνη Α συντίθεται κατά τη διάρκεια της S και G2 φάσης και η κυκλίνη Β συντίθεται στην G2 και Μ φάση. Έτσι η καταλυτική υποομάδα δεν μπορεί από μόνη της να γίνει ενεργή έως ότου συντεθεί η κατάλληλη κυκλίνη. Στη συνέχεια το σύμπλεγμα κυκλίνης κινάσης απαιτεί φωσφορυλίωση (στη θρεονίνη) από μία άλλη ρυθμιστική κινάση την CDK-ενεργοποιητή κινάση(cdk-activating kinase ή CAK). Η CAK είναι ένα σύμπλεγμα από κυκλίνη Η και CDK7 πρωτεΐνες. Από τώρα τα επίπεδα του CAK επηρεάζουν την δραστηριότητα της συγκεντρωθείσης CDKs. Ένα άλλο επίπεδο ρύθμισης είναι η απενεργοποίηση της CDK από την φωσφορυλίωση μιας δικής της δεσμευμένης θέσης ΑΤΡ από μια άλλη ρυθμιστική κινάση. Η συγκεκριμένη ενέργεια από αυτή την κινάση δεν είναι συχνή και έχει διπλή ειδικότητα τόσο για την τυροσίνη όσο και την θρεονίνη. Τώρα μία απενεργοποιημένη από φωσφορυλίωση του δικού της δεσμευμένου ΑΤΡ κινάση μπορεί να επανενεργοποιηθεί από μια διπλής ειδικότητος φωσφατάση από την Cdc25 οικογένεια. Στην πραγματικότητα αποφωσφορυλίωση από αυτές τις φωσφατάσες μπορεί να αποτελέσει το ευαίσθητο βήμα για την περαιτέρω μετάβαση στον κυτταρικό κύκλο. Άλλο επίπεδο ρύθμισης αποτελεί η παρουσία μιας διαφορετικής οικογένειας από πρωτεΐνες γνωστές ως κινάσες εξαρτώμενες από κυκλίνεςαναστολείς (CDKs-inhibitors or CKIs)που μπορούν να μπλοκάρουν την δραστηριότητα των CDKs. Δύο λοιπόν τάξεις CKIs έχουμε : η πρώτη τάξη απαγορεύει τις περισσότερες CDKs και περιλαμβάνει p21cip1,p27kip1και p57kip2. Η άλλη τάξη ειδικά αναστέλλει κυκλίνηd/cdk4 ή 6 CDKs και περιλαμβάνει p16ink4,p15ink4b,p18ink4c και p19ink4d. Η σύνθεση, υποβιβασμός και η ενεργοποίηση αυτών των CDKs ρυθμίζεται σαν απάντηση σε διττά μιτωτικά και αντιμιτωτικά σήματα. Για παράδειγμα η ρύθμιση του κυτταρικού κύκλου με την

14 επαφή κυττάρου με κύτταρο ή με TGF-b(transforming growth factor-b) γίνεται με τη μεσολάβηση του p27kip1 (25,26) Όταν ενεργοποιηθεί η CDKs οδηγεί την παρούσα φάση του κυτταρικού κύκλου στην επόμενη φάση. Για παράδειγμα η CDKs απαιτείται για την αρχή της μίτωσης επίσης αποτρέπει την έξοδο από την μίτωση για την G1 φάση. Το τελικό επίπεδο από την ρύθμιση της CDKs εμπεριέχει την ειδική υποβάθμιση σε ακριβή σειρά. Είναι τώρα γενικότερα γνωστό ότι η απανταχού παρούσα διαμεσολάβηση της πρωτεόλυσης είναι υπεύθυνη για αυτή τη ρύθμιση όσο και η ρύθμιση σε ένα ξενιστή. Έτσι η σύνθεση, η μεταφραστική τροποποίηση και η προγραμματισμένη υποβάθμιση όλα συνεισφέρουν στη ρύθμιση της CDKs (27). Από την παραπάνω συζήτηση ο χρόνος που παίρνει για την πρόοδο του κύκλου από την S, G και Μ φάση του κυτταρικού κύκλου είναι σχετικά αμετάβλητος. Το μήκος της G1 φάσης από την άλλη πλευρά είναι μεταβλητό. Επιπροσθέτως τα κύτταρα μπορούν να αποδράσουν από την διαδικασία του κυτταρικού κύκλου για μακρές περιόδους και τα μαστοκύτταρα ιδίως το πετυχαίνουν δια μέσου της G1 φάσης. Αυτά τα κύτταρα που έχουν φύγει από την διαδικασία της κυτταρικής διαίρεσης συνηθίζεται να λέγονται ότι βρίσκονται στη φάση Gο ή φάση ηρεμίας. Πολλά κύτταρα στους ενήλικες βρίσκονται σε φάση ηρεμίας. Αυτή η απουσία από τη κυτταρική διαίρεση μπορεί να είναι προσωρινή ή μόνιμη όπως στην περίπτωση καλά διαφοροποιημένων κυττάρων όπως είναι τα νευρικά κύτταρα. Τα κύτταρα στη φάση της ηρεμίας είναι πολύ λειτουργικά και με έναν άρτιο μεταβολισμό και η πολλαπλασιαστική διαδικασία μπορεί να αρχίσει με αλλαγές στην κυτταρική πυκνότητα, την παρουσία μιτογόνων ή αυξητικών παραγόντων ή την παροχή θρεπτικών συστατικών. Αυτά τα κύτταρα όταν μπουν στον κυτταρικό κύκλο, ξεκινούν μια αλληλουχία γεγονότων η οποία κορυφώνεται με την κυτταρική διαίρεση. Συνοπτικά η μετάβαση Go/G1 στην S φάση είναι καλά ρυθμιζόμενη και το αποτέλεσμα αυτής της ρύθμισης είναι σε συνάρτηση με τον απαιτούμενο χρόνο και την αναμενόμενη αύξηση σε σχέση με τον πληθυσμό αυτών των κυττάρων. Όπως και στις άλλες μεταβάσεις του κυτταρικού κύκλου από τη μια φάση στην άλλη έτσι και στη μετάβαση από τη Go στην S φάση ρυθμίζεται από δύο σημαντικά σημεία ελέγχου, την αρμοδιότητα και το περιοριστικό σημείο ελέγχου R(restriction point- R). Αυτά τα σημεία ελέγχου τοποθετούνται περίπου μεταξύ 12 και 2 ώρες πριν από την έναρξη της S φάσης αντίστοιχα. Τουλάχιστον 3 αυξητικοί παράγοντες, που παρέχονται με τον ορό του αίματος απαιτούνται διαδοχικά για την μετάβαση από αυτά τα σημεία ελέγχου ακολουθώντας την επανάληψη του πολλαπλασιασμού των ινοβλαστών: platelet-derived growth factor(pdgf),epidermal growth factor(egf) και insulin-like growth factor(igf-1). Ο εξωκυττάριος παράγων TGF-b έχει το αντίθετο αποτέλεσμα, απαγορεύει την ανάπτυξη πολλαπλών επιθηλιακών κυττάρων με την μοριακή έκφραση της CDKs. Παρακρινής παραγωγή του TGF-b μπορεί να κρατήσει τα επίπεδα πολλαπλασιασμού καρκινικών αλλά και φυσιολογικών κυττάρων σε χαμηλά επίπεδα, και πειραματικά μοντέλα υποθέτουν ότι αυτό μπορεί να παίξει έναν ρόλο στην υποτροπή του καρκίνου του μαστού σαν απάντηση σε ορμονικές ή φαρμακευτικές θεραπείες (28). Όταν το κύτταρο περάσει το σημείο ελέγχου R τότε οδηγείται σε ένα κύκλο κυτταρικής διαίρεσης. Το κύτταρο τώρα περνά στις φάσεις S,G2 και M χωρίς να χρειάζεται αυξητικούς παράγοντες ή επιπρόσθετη πρωτεϊνική σύνθεση. Εφόσον αρχίσει η κυτταρική διαίρεση δεν παραμένει ανεξέλεγκτη αλλά η αρμοδιότητα και το περιοριστικό σημείο ελέγχου πρέπει να ξαναπεραστούν με τις ανάλογες για αυτά συνθήκες σε κάθε επιπροστιθέμενη G1 φάση εφόσον δημιουργούνται οι ανάλογες συνθήκες με την ύπαρξη των αυξητικών παραγόντων. Το σημείο διακοπής της

15 πολλαπλασιαστικής δραστηριότητας και η μετάπτωση σε κατάσταση ηρεμίας ή σε συνέχιση ενός νέου κυτταρικού κύκλου και μιας νέας κυτταρικής διαίρεσης εξαρτάται από εξωκυττάριους παράγοντες και ρυθμίζεται διαφορετικά σε κανονικά και καρκινικά κύτταρα. Οι υποδοχείς των αυξητικών παραγόντων είναι συμπλέγματα από μεγάλες πρωτεΐνες που καλύπτουν την πλασματική μεμβράνη. Αυτές έχουν ένα ειδικό τμήμα που αναγνωρίζει τον αυξητικό παράγοντα στο εξωτερικό τμήμα του κυττάρου και το κυτταροπλασματικό τους μέρος έχει μια ενζυμική λειτουργία όπως αυτής της τυροσίνης κινάσης. Δέσμευση ενός αυξητικού παράγοντα ή σύνδεσή του στους κυτταρικούς υποδοχείς μπορεί να προκαλέσει μετάδοση ενός σήματος στο κυτόπλασμα δια μέσου της ενεργοποίησης μίας κινάσης. (29) Το επόμενο βήμα είναι η μετάδοση του κυττοπλασματικού σήματος στον κυτταρικό πυρήνα. Αυτό συνοδεύεται από μία ετερογενή ομάδα από μόρια γνωστά ως δευτεροταγείς αγγελιοφόροι(second messengers) και περιέχουν ποικίλες πρωτεΐνες που φωσφορυλιώνονται με τη μεσολάβηση κινασών, φωσφορικών ριζών και κυκλικού AMP και ιόντα όπως Ca ++, H +,Zn ++. Στον πυρήνα γονίδια ενεργοποιούνται σαν αποτέλεσμα στο ερέθισμα αυτών των δευτεροταγών αγγελιοφόρων. Σαν αποτέλεσμα της δέσμευσης του EGF στους εξωκυττάριους υποδοχείς αυτοφωσφορυλίωση συμβαίνει στην ενδοκυττάρια περιοχή της πρωτεΐνης. Αυτή η φωσφορυλίωση προάγει την μετατροπή του πρωτεϊνικού συμπλέγματος που περιέχει Grb2 και Sos. Αυτό το σύμπλεγμα ενεργοποιεί την Ras πρωτεΐνη με την καταλυτική διάσπαση του Ras-GDP για GDP. To παράγωγο GDP από τη διάσπαση του με το Ras ενεργοποιεί την c-raf κινάση. Αυτή η κινάση ενεργοποιεί μια μιτογονικά ενεργοποιημένη πρωτεϊνική κινάση. Αυτή η κινάση τέλος μπορεί να φωσφορυλιώσει και να ρυθμίσει μεταγραφικούς παράγοντες όπως Jun, Fos και Myc. Μια ποικιλία από πρωτεΐνες παράγονται κατά τη διάρκεια της G1 φάσης αφότου τα κύτταρα αφήσουν το καθεστώς ηρεμίας. Μερικά από τα ένζυμα αυτά ανακτούν τις μεταβολικές λειτουργίες τους που είχαν χάσει στα Go κύτταρα, όπως αυτές που προάγουν ενέργεια καθώς και πολλά ριβοσώματα για μια γρήγορη κυτταρική πρωτεϊνική σύνθεση. Άλλες δε πρωτεΐνες έχουν λειτουργίες συντήρησης που κρατούν τόσο τα κύτταρα ηρεμία όσο και τα πολλαπλασιαζόμενα κύτταρα σε μια μεταβολική ισορροπία. Μόνο μερικές από την πληθώρα των εμφανιζόμενων πρωτεϊνών εμφανίζονται να έχουν ενεργή συμμετοχή στη ρύθμιση της κυτταρικής διαίρεσης. Για παράδειγμα, ένζυμα είναι απαιτούμενα για την σύνθεση ισοπρενοιδών τα οποία είναι απαραίτητα για την ενεργοποίηση του Ras ογκογονιδίου και για την σύνθεση πολυαμινών οι οποίες έχουν πολλές λειτουργίες στις οποίες περιλαμβάνονται ιονική δέσμευση των νουκλεικών οξέων. Η πρωτεΐνη του ογκογονιδίου Ras έχει παραχθεί σαν πρόδρομος πρωτεΐνη που απαιτεί διεργασία μετά την μεταγραφή για να γίνει ενεργή και ικανή της μεταμόρφωσης των κυττάρων των θηλαστικών. Τα ένζυμα τα οποία εμφανίζονται να εμπλέκονται στην σύνθεση του DNA όπως η κινάση θιμιδίνη και η DNA-πολυμεράση συνθέτονται με προτεραιότητα στην S φάση. Αυτά τα ένζυμικά μόρια μεταφέρουν και εγκαθιστούν σε άλλο μέρος την έναρξη της σύνθεσης DNA, από το κυτόπλασμα στον πυρήνα. Μια μεγάλη ποικιλία πειραμάτων μας έδειξε ότι το DNA είναι φτιαγμένο από ένα υψηλού μοριακού βάρους πολυενζυμικό σύστημα. (30,31) Αυτό το σύστημα περιέχει πολλά ένζυμα γνωστά για την ανάμιξή τους στην διαδικασία αντιγραφής του DNA και αποτελεί αντικείμενο έρευνας σε εργαστήρια και αυτές οι μελέτες αποκαλύπτουν ότι η σύνθεση αυτών των ενζύμων που προάγουν την διαδικασία αντιγραφής του γενετικού υλικού μπορεί να περιέχουν τους τελικούς παράγοντες για την έναρξη της S φάσης (32) Αφού αρχίσει η σύνθεση του DNA ο πολλαπλασιασμός του κυττάρου αρχίζει

16 να ξεφεύγει από εξωτερικές ρυθμίσεις και ελέγχους. Τα θυγατρικά κύτταρα τώρα στη G1 φάση θα διαλέξουν αν θα περάσουν σε ένα κύκλο πολλαπλασιασμού ή θα μπουν σε συνθήκη ηρεμίας στη φάση Gο πράγμα που εξαρτάται σε κυρίως εξωτερικές συνθήκες. Εάν αυτές οι συνθήκες δεν είναι επαρκείς το κύτταρο θα κατασταλεί προτού αρχίσει μία νέα αντιγραφή DNA. Πως όμως ένα κύτταρο από μία φάση ηρεμίας Gο ξαναμπαίνει στον κυτταρικό κύκλο; όπως και στους άλλους κύκλους χρειάζεται αρχικά ενεργοποίηση της CDKs. Τα κύτταρα της φάσης Gο στερούνται από ικανοποιητική δραστηριότητα της CDKs. Με την παρουσία όμως μιτωτικών αυξητικών παραγόντων, η έκφραση των D-τύπου κυκλινών(cyclinsd1,d2,και D3) ενεργοποιείται και διαρκεί καθόλη τη διάρκεια της G1 φάσης όσο οι αυξητικοί παράγοντες είναι παρόντες (33) Οι D-τύπου κυκλίνες σχηματίζουν συμπλέγματα με τις CDK4 και CDK6 σαν καταλυτικές υπομονάδες για να αποτελέσουν ένα ολοένζυμο που καλείται CAK. Όλα τα σχετικά υποστρώματα για το σύμπλεγμα D/CDK4 και 6 δεν έχουν αριθμηθεί. Παρόλα αυτά ένα σημαντικό υπόστρωμα αποτελεί η πρωτεΐνη του ογκοκατασταλτικού γονιδίου του ρετινοβλαστώματος (Rb). Το Rb εκφράζεται ωθώντας τη πολλαπλασιαστική διαδικασία διαμέσου της G1 φάσης του κυτταρικού κύκλου. (34) Το Rb συνδέεται με πολλές κυτταρικές πρωτεΐνες μεταξύ των οποίων και ο E2F παράγοντας μεταγραφής. Όταν είναι σε σύνδεση με το E2F το Rb αναχαιτίζει τη μεταγραφική διαδικασία από τους E2F-εξαρτώμενους ενισχυτικούς παράγοντες. Μέσα από τη φωσφορυλίωση από το σύμπλεγμα D/CDK4 ή 6 (35) το ρετινοβλάστωμα χάνει την ικανότητά του να καταπνίγει τον κυτταρικό κύκλο. (36) Αυτή η απάντηση είναι πιθανώς γιατί το ρετινοβλάστωμα δεν μπορεί πλέον να σχηματίζει σύμπλεγμα με το E2F και καταπιέζει την E2F-εξαρτώμενη μεταγραφή (37) Η οικογένεια του E2F περιέχει τουλάχιστον 5 μέλη (E2F-1έως E2F-5). Οι E2F πρωτεΐνες ενεργούν σαν μεταγραφικοί ενεργοποιητές όταν βρίσκονται σε ετεροδιμερή συμπλέγματα με μία από τις συσχετιζόμενες με το E2F, τις D-τύπου κυκλίνες (cyclinsd1,d2,και D3). Το ετεροδιμερές σύμπλεγμα δεσμεύει μια ειδική αλληλουχία στο DNA και ενεργοποιεί την μεταγραφή από ενισχυτικούς παράγοντες από πολλά γονίδια σημαντικά για την S φάση περιλαμβάνοντας DNA πολυμεράση α και τη θιμιδίνη κινάση. (38) Ίσως πολύ πιο βασικά το E2F επηρεάζει την έκφραση της κυκλίνης Ε. (39) Στην πραγματικότητα σε πολλά E2F- εξαρτώμενα γονίδια η κυκλίνη Ε είναι η μοναδική για την απορύθμιση στην απώλεια του ρετινοβλαστώματος σε φυσιολογικά κύτταρα (40) Η έκφραση της κυκλίνης Ε αρχίζει αργά στη φάση G1και σχηματίζει σύμπλεγμα με CDK2. Η δραστηριότητα του συμπλέγματος κυκλίνη Ε/CDK2 είναι απαραίτητη για την έναρξη της S φάσης (41) Βιαία έκφραση της δραστηριότητας της κυκλίνης Ε/CDK2 μπορεί να πυροδοτήσει την έναρξη της S φάσης σε απουσία της φωσφορυλίωσης του Rb και απελευθέρωση των άλλων E2F-εξαρτώμενων γονιδίων, υποθέτωντας έτσι ότι η κυκλίνη Ε αποτελεί κυρίαρχο στόχο για την ρύθμιση μέσω κυκλίνης D/CDK4 ή 6, Rb, και E2F (42,43) ΒΛΑΒΗ DNA-ΕΓΚΑΤΑΣΤΑΣΗ ΣΗΜΕΙΩΝ ΕΛΕΓΧΟΥ(Checkpoints) Όταν το πυρηνικό DNA παθαίνει κάποια βλάβη, τα φυσιολογικά κύτταρα αρχίζουν μια απάντηση η οποία περιλαμβάνει είσοδο στον κυτταρικό κύκλο, απόπτωση (κυτταρικό θάνατο) και ενεργοποίηση γονιδίων που εμπλέκονται στην επιδιόρθωση του DNA. Η εγκατάσταση της απόπτωσης είναι μια σημαντική απάντηση στη βλάβη του γενετικού υλικού. Τα φυσιολογικά κύτταρα στη G1φάση πριν από το σημείο ελέγχου R θα εισέλθουν στην διαδικασία της κυτταρικής διαίρεσης με την ευκαιρία της βλάβης του γενετικού υλικού. Αυτή η είσοδος προφανώς εκτελείται για να

17 εμποδιστεί η αντιγραφή του βλαμμένου DNA. Αντιγραφή κατεστραμμένου γενετικού υλικού μπορεί να έχει σαν αποτέλεσμα τη ενσωμάτωση γενετικών μεταλλάξεων. Εάν τα κύτταρα έχουν περάσει το σημείο ελέγχου R ή είναι σε S φάση, η αντιγραφή του DNA καθυστερεί χρονικά έτσι ώστε να κερδίσει χρόνο η επιδιόρθωση του DNA. Διαφορετικές βλάβες στο DNA μπορούν να έχουν σαν αποτέλεσμα τη μίτωση, τις μεταλλάξεις ή τον κυτταρικό θάνατο. Τα ογκοκατασταλτικά-γονίδια σαν τοατμ και το p53 συνεισφέρουν ένα σημαντικό μέρος στις απαντήσεις στο κατεστραμμένο DNA. (44,45) Παραδείγματος χάριν, τα κύτταρα που περιέχουν τις μεταλλάξεις από την ακτινοβολία του p53 αποτυγχάνουν να συλλάβουν τη φάσηg1 ή να υποβληθούν στη διαδικασία της απόπτωσης αποτελεσματικά. Τα κύτταρα που περιέχουν τις μεταλλάξεις στο ΑΤΜ είναι επίσης ανεπαρκή για τη σύλληψη κύκλων κυττάρων καθώς επίσης και μερικές μορφές επισκευής DNA. Η p53 πρωτεΐνη λειτουργεί ως παράγοντας μεταγραφής με τη δέσμευση των συγκεκριμένων ακολουθιών DNA και τη ρύθμιση της μεταγραφής από τα γονίδιαυποκινητές που περιέχουν εκείνες τις ακολουθίες. Στα κανονικά κύτταρα, η ζημία του DNA προκαλεί μια αύξηση στα επίπεδα του p53 με την παρεμπόδιση του κανονικού γρήγορου κύκλου εργασιών της πρωτεΐνης. Η p53 πρωτεΐνη στοχεύει κανονικά στην πρωτεόλυση από την ένωση με τη Mdm2 πρωτεΐνη. Αυτή η ένωση εμποδίζεται από τη φωσφορυλίωση του p53 στα συγκεκριμένα αμινο-τελικά υπολείμματα που προκαλείται από τη ζημία DNA. (46) Φωσφορυλίωση σε αυτά τα αμινο τελικά υπολείμματα διευκολύνει επίσης αποφωσφορυλίωση ή την ακετυλίωση p53 των τελικών καρβοξυλικών υπολειμμάτων. Αυτές οι τροποποιήσεις αυξάνουν τη συγγένεια p53 για την περιοχή συνδέσεων DNA της από τους ευδιάκριτους μηχανισμούς (47,48) και ως εκ τούτου αυξάνουν τη δυνατότητά του να ενεργοποιήσει τη μεταγραφή. Η μεταγραφή διάφορων γονιδίων μπορεί να επηρεαστεί από την ενεργοποίηση p53. Εντούτοις, η δυνατότητα p53 για να αυξήσει άμεσα την έκφραση p21cip1 είναι πιθανώς σημαντική για την p53-εξαρτώμενη G1 σύλληψη κύκλων κυττάρων που παρατηρείται επάνω στη ζημία DNA. Όπως συζητείται ανωτέρω, p21cip1 είναι ένα CKI που μπορεί να εμποδίσει τη δραστηριότητα πολλαπλάσιου CDKs, συμπεριλαμβανομένου του cyclin D/CDK4 ή 6 καθώς επίσης και του cyclin E/CDK2. Εν περιλήψει, η ζημία DNA παράγει ένα σήμα που μπορεί να ενεργοποιήσει p53 από την μετα-μεταφραστική τροποποίηση. Αυξανόμενη p53 δραστηριότητα απορυθμίζει to p21cip1, η οποία αποτρέπει την ενεργοποίηση CDKs, που απαιτείται για G1 στη μετάβαση του S. Το ATM είναι το γονίδιο η του οποίου μετάλλαξη είναι αρμόδια για την αταξία και τηλεγγιεκτασία Η ανεπάρκεια αντισωμάτων, η προοδευτική παρεγκεφαλιδική αταξία, ραδιοευαισθησία, οι ατέλειες σημείων ελέγχου κύκλων κυττάρων, και η προδιάθεση καρκίνου χαρακτηρίζουν αυτήν την ασθένεια. Το ATM κωδικοποιεί μια πρωτεΐνη που περιέχει phosphatidyl-inositol 3-κινάση όπως την περιοχή, που την εμπλέκει στη μεταγωγή σημάτων. Όπως τα κύτταρα μεταλλάξεων για το p53, τα κύτταρα μεταλλάξεων για το ATM είναι ελαττωματικά στο G1/S σημείο ελέγχου που ενεργοποιείται μετά από την εξ ακτινοβολίας ζημία DNA. Αυτή η ατέλεια αποδίδεται στην έλλειψη p53 ενεργοποίησης, που εμφανίζεται όμως κανονικά, προτείνοντας την υπόθεση ότι το ATM μπορεί να συμμετέχει στο ίδιο μεταβολικό μονοπάτι με το p53. Την πρωτεΐνη του ATM, και η σχετική πρωτεΐνη ATR, μπορεί, στην πραγματικότητα, να τις συνδέσουμε με τη φωσφορυλίωση του p53 επί των αμινο-τελικών τόπων της. (49,50) Η από το ρ53-κατευθυνόμένη δραστηριότητα των κινάσεων της πρωτεΐνης του ATM ενεργοποιείται από τη ζημία DNA.Η πρωτεΐνη του ATM, επομένως, συμβάλλει στην ενεργοποίηση και τη σταθεροποίηση p53 με τις

18 αμινο-τελικές περιοχές κατά τη διάρκεια της ζημίας DNA. Η πρωτεΐνη του ATM μπορεί να διαδραματίσει έναν ρόλο υπό την έννοια της ζημίας DNA και την παραγωγή του σήματος ζημίας DNA. Οι περιβαλλοντικοί παράγοντες όπως η ακτινοβολία ή οι καταστρεπτικές του DNA χημικές ουσίες συνηθέστερα προκαλούν τη ζημία DNA. Σπάνια, η ζημία DNA μπορεί να παραχθεί από λάθη στην κανονική εκτέλεση του κύκλου κυττάρων. Εντούτοις, μια μορφή ζημίας DNA εμφανίζεται τελικά σε όλα τα κανονικά κύτταρα. Τα κανονικά κύτταρα έχουν μια περιορισμένη αντιγραφική διάρκεια ζωής και in vivo και in vitro ένα κύτταρο μπορεί να υποβληθεί μόνο σε έναν πεπερασμένο αριθμό κυτταροδιαιρέσεων. Αυτό το όριο επιβάλλεται πιθανά, τουλάχιστον εν μέρει, από τα επίπεδα δραστηριότητας της τελομεράσης. (51) Η τελομεράση είναι μια ενζυματική δραστηριότητα μέσα στα κύτταρα που απαιτείται για να διατηρήσει την ακεραιότητα των ακρών DNA. (52) Οι πολυμεράσεις DNA που περιλαμβάνονται στην αντιγραφή DNA συνθέτουν το DNA σε 5; σε 3; κατεύθυνση και απαιτεί έναν καλούπι και ένα πρότυπο. Η απαίτηση για ένα καλούπι εξασφαλίζει ότι κάποιες γενετικές πληροφορίες δεν θα χαθούν από τα 5; τελικά άκρα του DNA κατά τη διάρκεια κάθε κύκλου της αντιγραφής DNA. Η τελομεράση προσθέτει το DNA μιας ιδιαίτερης ακολουθίας στις άκρες του DNA χωρίς την ανάγκη για έναν χωριστό καλούπι ή ένα πρότυπο, προστατεύοντας κατά συνέπεια τα κύτταρα από την απώλεια γενετικών πληροφοριών. Το DNA υπό ενέργεια τελομεράσης προστατεύει επίσης τα χρωμοσώματα από την υποβάθμιση ή τον επανασυνδυασμό. Χωρίς DNA υπό ενέργεια τελομεράσης, τα χρωμοσώματα γίνονται ασταθή. Δεδομένου ότι τα κανονικά κύτταρα γίνονται ευαίσθητα και χάνουν τη δραστηριότητα της τελομεράσης και ο κύκλος των συνεχών κυτταροδιαίρεσεών τους καθηλώνεται. Αυτήν την καθήλωση κύκλων κυττάρων μπορεί μέσω του σημείου ελέγχου να κατευθύνει η ζημία του DNA δεδομένου ότι το μικρότερο τελομερικό DNA υπό την ενέργεια της τελομεράσης συνδέεται με τα σπασίματα σκελών DNA που μπορούν να καταλάβουν ως χαλασμένο DNA. Σύμφωνα με αυτήν την υπόθεση, ο περιορισμός του DNA υπό την ενέργεια της τελομεράσης προκαλεί μια ρ53- εξαρτώμενη καθήλωση των κυτταρικών κύκλων από τη συσσώρευση του ενιαίου προσαραγμένου DNA. (53) ΣΗΜΕΙΑ ΕΛΕΓΧΟΥ ΓΙΑ ΤΑ ΚΑΡΚΙΝΙΚΑ ΚΥΤΤΑΡΑ Για να διατηρήσει την ομοιόσταση του ιστού και για να υποστηρίξει την κανονική ανάπτυξη, κάθε όργανο διατηρεί τους αυστηρούς ελέγχους του TC, του μέρους αύξησης, και της απώλειας κυττάρων. Τα φυσιολογικά ερεθίσματα μπορούν να αλλάξουν αυτές τις παραμέτρους στους κανονικούς ιστούς, που οδηγούν στην αυξανόμενη αύξηση ιστού, αλλά αυτή η αύξηση θα πάψει όταν αποσύρεται το ερέθισμα ή ένα νέο καθεστώς επιτυγχάνεται. Σε αντίθεση με τα κανονικά κύτταρα, εντούτοις, τα κύτταρα όγκων συνεχίζουν να πολλαπλασιάζονται ακόμη και ελλείψει των πολλαπλασιαστικών σημάτων. Αν και τα κύτταρα όγκων πολλαπλασιάζονται υπό τους ακατάλληλους όρους, δεν πολλαπλασιάζονται απαραιτήτως γρηγορότερα από τα κανονικά κύτταρα. Στην πραγματικότητα, μερικοί κανονικοί ιστοί αυξάνονται γρηγορότερα από τους καρκίνους υπό κανονικές συνθήκες Τα δείγματα βιοψιών από τα κανονικά, φλεγμονώδη, και νεοπλασματικά τραύματα του πνεύμονα, του τραχήλου, του φωνητικών χορδών, ή του φάρυγγα έχουν αναλυθεί για το ποσοστό πολλαπλασιασμού κυττάρων. Αυτές οι μελέτες έδειξαν ότι οι καλοήθεις φλεγμωνώδεις βλάβες μπορούν να αυξηθούν πάνω από 20 φορές γρηγορότερα από τον καρκίνο (54,55,56) Ομοίως, ο γρήγορος πολλαπλασιασμός των ανθρώπινων λεμφο

19 κυττάρων προκαλείται από τα άνοσα ερεθίσματα, και η αύξηση αυτών των κυττάρων είναι παρόμοια με εκείνη που παρατηρείται στα αρίστης ποιότητας λεμφώματα. (57) Έτσι, δεν είναι απλά ταχεία ανάπτυξη σε έναν ενιαίο χρόνο και τόπο που διακρίνει τη νεοπλασία αλλά μάλλον η αύξηση που δεν είναι σταματημένη στους κατάλληλους χρόνους και τόπους. Γενικά θεωρείται ότι τα νεοπλασματικά κύτταρα πολλαπλασιάζονται εκθετικά κατά τη διάρκεια των πρόωρων φάσεων της αύξησης όγκων κυττάρων. Δεδομένου ότι η μάζα όγκων αυξάνεται, εντούτοις, ο ρυθμός ανάπτυξης μειώνεται. Τη μέτρηση της αύξησης όγκων κατά τη διάρκεια του χρόνου περιγράφει μια καμπύλη με μια εκθετική αύξηση στις αρχές της περιόδου, έπειτα μια εξομάλυνση από το ποσοστό αύξησης κατά τη διάρκεια του χρόνου (δηλ., καμπύλη Gompertzian). (58) Διάφοροι μηχανισμοί έχουν επιστρατευθεί για να εξηγήσουν αυτήν την αλλαγή στο ποσοστό αύξησης με τους μεγαλύτερους όγκους: (α) η μείωση στο μέρος αύξησης, (β) αύξηση στην απώλεια κυττάρων (δηλ., αποφλοίωση, νέκρωση), (γ) θρεπτική μείωση των κυττάρων των όγκων ως αποτέλεσμα της μείωσης του διαθέσιμου ανεφοδιασμού αίματος, ή (δ) αν και μακραίνει των πειραματικών προτύπων όγκων προτείνει ότι το κύκλος των κυττάρων ζώων αλλάζει μόνο ελαφρώς όταν μειώνεται η αύξηση όγκων. (59) Υπό τους δυσμενείς όρους, τα κύτταρα όγκων αφήνουν συχνά το μέρος αύξησης και μπαίνουν σε ένα καθεστώς μη αύξησης (G0 ή παρατεταμένο G1), αν και αυτά τα ίδια κύτταρα μπορούν να καταγράψουν εκ νέου τον κύκλο τμήματος όταν βελτιώνονται οι όροι ή όταν υποκινουνται από τους παράγοντες αύξησης. Επομένως, η μάζα που διπλασιάζει το χρόνο των όγκων συσχετίζεται με το μέρος αύξησης Η βιοχημεία της αύξησης εμφανίζεται να είναι πολύ παρόμοια ποιοτικά στον όγκο και στα κανονικά κύτταρα.(60 Παρά τις πολυάριθμες προσπάθειες, καθολικές διαφορές στους βιοχημικούς μηχανισμούς δεν έχουν ανακαλυφθεί ακόμα μεταξύ των κανονικών και νεοπλασματικών κυττάρων. Η θεμελιώδης διαφορά βρίσκεται πιθανώς σε μια χαλάρωση του κανονισμού της αύξησης κυττάρων. (59) Παραδείγματος χάριν, τα κανονικά κύτταρα είναι γενικά ήρεμα σε φυσιολογικά επίπεδα παραγόντων αύξησης, ενώ τα σχετικά κύτταρα όγκων είναι σε θέση να πολλαπλασιαστούν υπό αυτούς τους όρους. Σε μερικά πειραματικά πρότυπα, τα κύτταρα όγκων πολλαπλασιάζονται ελλείψει ή πολύ χαμηλών επιπέδων παραγόντων αύξησης. Τα κανονικά κύτταρα παύουν χαρακτηριστικά τον πολλαπλασιασμό όταν in vitro οι εξωτερικές συνθήκες και οι παράγοντες το επιτρέπουν, αλλά τα κύτταρα όγκων μπορούν να φθάσουν στις πολλαπλές υψηλότερες πυκνότητες αν και έχουν πάψει οι εξωτερικές συνθήκες που αρχικά είχαν δώσει το έναυσμα για τον κυτταρικό πολλαπλασιασμό. Επίσης, τα κύτταρα του κανονικού στερεού ιστού βρίσκονται σε μια εκκριμένη εξωκυτταρική μήτρα (ecm) που αποτελείται από τις διάφορες πρωτεΐνες που υποκινούν την αύξηση κυττάρων.( 61) Τα κύτταρα όγκων είναι συχνά εν μέρει ή απολύτως ανεξάρτητα από ecm για τη βέλτιστη αύξηση, και μπορούν να εκκρίνουν λίγο υλικό μητρών. (62) Ποιες μοριακές ατέλειες επιφέρουν τις χαλαρωμένες απαιτήσεις αύξησης στα νεοπλασματικά κύτταρα; Οι ατέλειες μπορούν να εμφανιστούν σε διάφορα επίπεδα. Παραδείγματος χάριν, ο περιορισμός των παραγόντων αύξησης δεν μπορεί να απαιτηθεί επειδή τα κύτταρα όγκων παράγουν πολλές φορές δικούς τους (δηλ., ένας μηχανισμός αυτοέκκρισης ). Εναλλακτικά, οι αποδέκτες μπορούν να είναι υπερβολικοί, όπως συμβαίνει για τους αποδέκτες EGF στους πολυάριθμους κλινικούς όγκους, οδηγώντας στην επαρκή υποκίνηση στις χαμηλές συγκεντρώσεις παράγοντα αύξησης που βρίσκονται in vivo. Επιπλέον, οι μεταλλάξεις που αλλάζουν τους

20 ενδοκυτταρικούς μηχανισμούς κάνοντας σήμα μπορούν να παρακάμψουν την εξάρτηση του παράγοντα αύξησης. Οι αλλοιωμένες μορφές πρωτοογκογονιδίων και αδρανοποιημένων ογκοκατασταλτικών γονιδίων μπορούν να ενεργοποιήσουν την αύξηση με αυτούς τους τρόπους. Θα εστιάσουμε εδώ στις ατέλειες που εμφανίζονται στις ρυθμιστικές πρωτεΐνες κύκλων κυττάρων που επιβάλλουν τα σημεία ελέγχου που συζητούνται ανωτέρω Όπως στα φυσιολογικά κύτταρα το πέρασμα από κάποια σημεία του κυτταρικού κύκλου απαιτεί την ενεργοποίηση της CDKs. Λόγω της πολυπλοκότητας της ρύθμισης της CDK, ελαττώματα οδηγούν σε μη κανονική ενεργοποίηση της CDKs. Που μπορεί να συμβεί σε αρκετά επίπεδα. Τα υψηλά επίπεδα μεταλλάξεων γονιδίων του ελέγχου του κυτταρικού κύκλου (όπως p53, p16, p21, SMAD4, και η cyclin D1 )βρίσκονται σε καρκίνους του παγκρέατος, και υπάρχει ανώμαλη έκφραση των αποπτωτικών γονιδίων( όπως bcl-2, bcl-xl,, και bax). Αρκετοί από αυτούς τους παράγοντες αύξησης και τους δέκτες τους έχει βρεθεί να συνδέεται με τους κακώς διαφοροποιημένους όγκους ενός προχωρημένου σταδίου και μιας μειωμένης επιβίωσης. (63) Η υπερέκκφραση της κυκλίνης D1 έχει βρεθεί σε πολλούς καρκίνους λόγω της ενίσχυσης ή χρωμοσωματικής μετατόπισης στο γονίδιο της κυκλίνης D1 (64). Το γονίδιο της κυκλίνης D1 βρίσκεται στο χρωμόσωμα 11q13. Αυτή η χρωμοσωματική περιοχή συσχετίζεται με μια πλατιά ποικιλία καρκίνων του ανθρώπου στις οποίες περιλαμβάνεται το μικροκυτταρικό καρκίνωμα του πνεύμονα(10%), πρωτοπαθείς καρκίνοι του μαστού (13%), καρκίνος της ουροδόχου κύστεως (15%), καρκίνος του οισοφάγου (34%) και καρκίνος κεφαλής και τραχήλου μεταξύ άλλων (65) Η υπερέκφραση της κυκλίνης D1 μπορεί να μπορεί να παρατηρηθεί και σε καρκίνους όπως του παχέος εντέρου, σαρκώματα και μελάνωμα χωρίς την ενίσχυση του γονιδίου. Σε μερικές περιπτώσεις η έκφραση της σχετίζεται με χρωμοσομιακή μετατόπιση. Στο παραθυρεοειδές αδένωμα Motocura and co (66) ανακάλυψαν ότι η κυκλίνη D1 όταν μετατοπίζεται στο γονίδιο της ορμόνης των παραθυρεοειδών απορυθμίζεται η έκφραση της κυκλίνης D1. Η κυκλίνη D1 είναι ένας παράγοντας ανάπτυξης ο οποίος παίζει σημαντικό ρόλο στη ρύθμιση του σημείου ελέγχου για την μετάβαση από Gο σε S φάση. Απορύθμιση της έκφρασης της κυκλίνης D1μπορεί να οδηγήσει σε μη κανονική αύξηση της δραστηριότητας του συμπλέγματος D1/CDK4 και να οδηγήσει στο πέρασμα από το σημείο ελέγχου ακόμη και σε απουσία αυξητικών μιτογόνων ερεθισμάτων. Ουσιαστική απόδειξη ότι η βεβαρημένη έκφραση της κυκλίνης D1 μπορεί να προάγει την καρκινογένεση έχει παρατηρηθεί από πειράματα σε ποντίκια στα οποία η υπερέκφραση της κυκλίνης είχε σαν στόχο το επιθήλιο του θηλαστικού. Αυτά τα ποντίκια λοιπόν παρουσίασαν σωληνώδη υπερπλασία και καρκινικές μετατροπές (67) Η ενεργοποίηση της CDK μπορεί επίσης να πραγματοποιηθεί από την απενεργοποίηση των CKIs. Γενετική μετάλλαξη του γονιδίου CKI έχει επίσης συχνά συσχετιστεί με καρκίνους του ανθρωπίνου οργανισμού. Κατά αυτή την υπόθεση η απώλεια ενός CKI μετριάζει την πίεση για ενεργοποίηση της CDKs και προωθεί ένα ερέθισμα αναπαραγωγής. Επί μέρους για το ΙΝΚ4 στη χρωμοσωμική περιοχή 9p21 είναι μία από τις πιο συχνές γενετικά μεταλλασόμενες περιοχές που σχετίζονται με καρκίνο (68) αυτή επίσης συχνά συσχετίζεται με τη μεθυλίωση και παρατηρείται σε καρκίνο της κύστης και στη λευχαιμία. Εκτεταμένη μεθυλίωση του DNA αποτρέπει ικανή μεταγραφή των γονιδίων μέσα στη μεθυλιωμένη περιοχή και σαν αποτέλεσμα σιωπηλή γονιδιακή έκφραση. Τρεις πρωτεΐνες κωδικοποιούνται από το ακριβές ΙΝΚ4 περιλαμβάνοντας το CKIs p16ink4a και p15ink4b καθώς και p19arf. Αυτό μοιάζει με το ότι p16ink4a

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Μηχανισμοί Ογκογένεσης

Μηχανισμοί Ογκογένεσης ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΓΕΝΕΤΙΚΗΣ Μηχανισμοί Ογκογένεσης Δρ. Α. ΓΑΛΑΝΗΣ agalanis@mbg.duth.gr Μηχανισμοί Ογκογένεσης Ενότητα 4. Απορρύθμιση του κυτταρικού κύκλου και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

Εργασία του μαθητή Θ. Σιδηρόπουλου :καρκίνος και μεταλλάξεις. Τμήμα Γ 2

Εργασία του μαθητή Θ. Σιδηρόπουλου :καρκίνος και μεταλλάξεις. Τμήμα Γ 2 ΚΑΡΚΙΝΟΣ: Ο Καρκίνος είναι ένα από τα σοβαρότερα προβλήματα υγείας που παρατηρούνται σήμερα στις αναπτυγμένες χώρες. Οι στατιστικές δείχνουν ότι αποτελεί τη δεύτερη πιο συχνή αιτία θανάτου μετά τις καρδιοπάθειες.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΜΟΡΙΑΚΗ ΒΑΣΗ ΓΕΝΕΤΙΚΩΝ ΑΣΘΕΝΕΙΩΝ ΘΕΜΑ: ΠΟΛΛΑΠΛΗ ΝΕΥΡΟΙΝΩΜΑΤΩΣΗ. Ομάδα ΑΡΕΑΛΗ ΑΝΤΩΝΙΑ ΜΠΑΗ ΙΩΑΝΝΑ ΠΑΤΕΡΑΚΗ ΕΛΕΝΗ

ΜΟΡΙΑΚΗ ΒΑΣΗ ΓΕΝΕΤΙΚΩΝ ΑΣΘΕΝΕΙΩΝ ΘΕΜΑ: ΠΟΛΛΑΠΛΗ ΝΕΥΡΟΙΝΩΜΑΤΩΣΗ. Ομάδα ΑΡΕΑΛΗ ΑΝΤΩΝΙΑ ΜΠΑΗ ΙΩΑΝΝΑ ΠΑΤΕΡΑΚΗ ΕΛΕΝΗ ΜΟΡΙΑΚΗ ΒΑΣΗ ΓΕΝΕΤΙΚΩΝ ΑΣΘΕΝΕΙΩΝ ΘΕΜΑ: ΠΟΛΛΑΠΛΗ ΝΕΥΡΟΙΝΩΜΑΤΩΣΗ Ομάδα ΑΡΕΑΛΗ ΑΝΤΩΝΙΑ ΜΠΑΗ ΙΩΑΝΝΑ ΠΑΤΕΡΑΚΗ ΕΛΕΝΗ ΑΠΡΙΛΙΟΣ 2015 ΣΚΟΠΟΣ Σκοπός της εργασίας αυτής είναι η παρουσίαση των χαρακτηριστικών της

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Απαραίτητη η ύπαρξη αυξητικών παραγόντων στην G1. Αν όμως απουσιάζουν τότε το κύτταρο μπαίνει σε μία φάση γνωστή ως G 0.

Απαραίτητη η ύπαρξη αυξητικών παραγόντων στην G1. Αν όμως απουσιάζουν τότε το κύτταρο μπαίνει σε μία φάση γνωστή ως G 0. Ο κυτταρικός κύκλος είναι τυπικά διαιρεμένος σε τέσσερις φάσεις Είναι το κύτταρο αρκετά μεγάλο; Σημείο ελέγχου Σημείο ελέγχου ατράκτου Μήπως η άτρακτος είναι κατεστραμμένη ; Απαραίτητη η ύπαρξη αυξητικών

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα