Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D."

Transcript

1 Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής ΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΠΡΩΤΕΪΝΩΝ Ιωάννης Π. Τρουγκάκος, Ph.D.

2

3 ΓΕΝΙΚΑ Το επιτυχηµένο σύστηµα αποθήκευσης, κωδικοποίησης και κληρονόµησης της πρωτογενούς πληροφορίας (νουκλεϊκά οξέα), και η πιστότητα αποκωδικοποίησης της στο κυτταρικό εργοστάσιο παραγωγής του τελικού προϊόντος (πρωτεϊνοσύνθεση), δε θα προσέφεραν και πολλά στη κατεύθυνση της επιτυχηµένης επιβίωσης του κυττάρου αν δεν συνδυαζόταν µε ένα επόµενο σύστηµα αναγνώρισης, διαλογής και µεταφοράς κάθε προϊόντος (πρωτεΐνη) στη θέση που αυτό είναι λειτουργικό. Με άλλα λόγια αναφερόµαστε σε µια διαδικασία που θα µπορούσαµε να την περιγράψουµε µε τον γενικό τίτλο ΑΠΟ ΤΗΝ ΠΑΡΑΓΩΓΗ ΣΤΗΝ ΚΑΤΑΝΑΛΩΣΗ. Τόσο η πληροφορία για το πρώτο βήµα διαλογής που αφορά τη θέση (κυττοσόλιο ή µεµβράνη ενδοπλασµατικού δικτύου) του εργοστασίου παραγωγής (ριβοσώµατα) κατά την αποκωδικοποίηση της πληροφορίας, όσο και για επόµενο βήµα διαλογής που σχετίζεται µε την µετέπειτα τύχη του µορίου στο κύτταρο είναι τυπωµένες στο ίδιο το προϊόν (πεπτιδικά σινιάλα στην αµινοξική του αλληλουχία). Σε όλα τα ενδιάµεσα σηµεία αυτών των διαδροµών λαµβάνονται µια σειρά από αποφάσεις που σχετίζονται µε την δοµική αρτιότητα του προϊόντος, µε το αν θα πρέπει να παραµείνει στο διαµέρισµα που βρίσκεται ή θα πρέπει να προωθηθεί περαιτέρω και τέλος αν θα πρέπει να µαρκαριστεί δευτερογενώς (π.χ. ειδικές µετα-µεταφραστικές τροποποιήσεις) σαν µια επιπλέον διασφάλιση για την µεταφορά του στον σωστό προορισµό (π.χ. υδρολάσες λυσοσωµάτων).

4 ΓΕΝΙΚΑ Σε γενικές γραµµές οι ειδικοί συνοδοί των πρωτεϊνών (υποδοχείς) έχουν συγκεκριµένο πόστο εκκίνησης (οργανίδιο δότης), κινούνται µόνο πάνω σε µια προκαθορισµένη τροχιά (κυτταροσκελετός) και µεταφέρουν µόνο µια ειδική κατηγόρια φορτίου (π.χ. ένας υποδοχέας µεταφέρει αποκλειστικά λυσοσωµικές υδρολάσες). Αφού δε παραδώσουν το φορτίο, επιστρέφουν γρήγορα στο σηµείο διαλογής. Η στόχευση αλλά και η απόδοση του φορτίου στο σωστό οργανίδιο γίνονται µέσω ενός πολύπλοκου συστήµατος διασφάλισης πιστότητας (π.χ. αλληλεπίδραση v- SNAREs και t-snares). Η λανθασµένη απόδοση του φορτίου σύντοµα θα οδηγούσε σε κατάρρευση της κυτταρικής οµοιοστασίας λόγω κατάργησης της ιδιαιτερότητας όσον αφορά τη σύσταση κάθε οργανιδίου. Τέλος σε κάποιες ειδικές περιπτώσεις το φορτίο παρότι πακετάρεται δεν αποδίδεται στον παραλήπτη παρά µόνο αν δοθεί το κατάλληλο σύνθηµα (ρυθµιζόµενη έκκριση ουσιών)

5 ΓΕΝΙΚΑ Ενα ευκαρυωτικό κύτταρο περιέχει περίπου πρωτεϊνικά µόρια (ή περίπου διαφορετικές πρωτεϊνες). Η σύνθεση σχεδόν όλων των πρωτεϊνών αυτών ξεκινά στο κυττοσόλιο. Για να καταστεί λειτουργική µια πρωτεΐνη θα πρέπει να µεταφερθεί στο ειδικό οργανίδιο του οποίου αποτελεί δοµικό στοιχείο ή να προωθηθεί για έκκριση αν προορίζεται να δράσει στον εξωκυττάριο χώρο. Αυτό επιτυγχάνεται µέσω πολύπλοκων συστηµάτων διανοµής τα οποία µεταφέρουν τις πρωτεϊνες από το ένα οργανίδιο στο άλλο. Ο τρόπος µε τον οποίο οι πρωτεϊνες που κωδικοποιούνται από το DNA του πυρήνα βρίσκουν το δρόµο τους µετά τη σύνθεση τους είναι το κύριο θέµα του κεφαλαίου αυτού, δεδοµένου ότι προκειµένου να κατανοηθεί το ευκαρυωτικό κύτταρο είναι απαραίτητο να γνωρίζουµε τι συµβαίνει σε καθένα από τα οργανίδια αυτά, µε πιό τρόπο να µόρια κινούνται µεταξυ τους καθώς και µε πιό τρόπο τα διαµερίσµατα αυτά δηµιουργούνται και διατηρούνται. Όλα τα παρόµοια οργανίδια πραγµατοποιούν την ίδια οµάδα βασικών λειτουργιών ανεξαρτήτως του κυτταρικού τύπου αλλά ο αριθµός τους διαφέρει ανάλογα µε την ειδίκευση κάθε κυττάρου.

6 Ηπατικό Παρεγχυµατικό κύτταρο Η τοποθέτηση κάθε οργανιδίου δεν είναι τυχαία εντός του κυττάρου αφού η τοπολογία του αντανακλά και µια λειτουργική συνέχεια. Για παράδειγµα το Golgi είναι κοντά στον πυρήνα ενώ το ER είναι σε άµεση σύνδεση µε τον πυρήνα και διαχέεται σε όλο το κύτταρο.

7 ΚΥΤΤΑΡΙΚΑ ΟΡΓΑΝΙ ΙΑ

8 Εξελικτικά τα ενδοκυττάρια διαµερίσµατα των ευκαρωτικών κυττάρων µπορούν να οµαδοποιηθούν σε 5 διακριτές οικογένειες που είναι: - Ο πυρήνας και το κυτταρόπλασµα που επικοινωνούν µέσω των πυρηνικών πόρων και είναι τοπολογικά συνεχή διαµερίσµατα (αν και διακριτά όσον αφορά την λειτουργία τους, - Τα µιτοχόνδρια - Τα πλαστίδια (στα φυτά µόνο) - Τα υπεροξεισώµατα - Ολα τα οργανίδια που συµµετέχουν στο εκκριτικό και ενδοκυττικό µονοπάτι (ER, Golgi, ενδοσώµατα, λυσοσώµατα και οι διάφορες κατηγορίες των κυστιδίων µεταφοράς)

9 ΚΥΤΤΑΡΙΚΗ ΟΡΓΑΝΩΣΗ ΖΩΪΚΟΥ ΚΥΤΤΑΡΟΥ ιαµερισµατοποίηση πρωτεϊνικά µόρια διαφορετικές πρωτεϊνες) Οικογένειες ενδοκυττάριων διαµερισµάτων: - Πυρήνας / Κυττοσόλιο - Μιτοχόνδρια - Πλαστίδια (στα φυτά µόνο) - Υπεροξυσώµατα - Οργανίδια εκκριτικού µονοπατιού (Ε, Golgi, Λυσοσώµατα, κυστίδια)

10 ΚΥΤΤΟΣΟΛΙΟ ΠΥΡΗΝΑΣ ΥΠΕΡΟΞΕΙΣΩΜΑΤΑ ΜΙΤΟΧΟΝ ΡΙΑ ΠΛΑΣΤΙ ΙΑ ΕΝ ΟΠΛΑΣΜΑΤΙΚΟ ΙΚΤΥΟ GOLGI ΛΥΣΟΣΩΜΑ ΕΝ ΟΣΩΜΑ ΕΚΚΡΙΤΙΚΑ ΚΥΣΤΙ ΙΑ ΠΛΑΣΜΑΤΙΚΗ ΜΕΜΒΡΑΝΗ Οι κύριες οδοί µεταφοράς πρωτεϊνών στο κύτταρο περιλαµβάνουν τη φυλασσόµενη µεταφορά (κόκκινο βέλος) από το κυττοσόλιο στο πυρήνα (και αντίστροφα), τη διαµεµβρανικη (γκρι βέλη) και την κυστιδιακή µεταφορά (µπλε βέλη). Τα σινιάλα που κατευθύνουν τη κίνηση και το πεπρωµένο µιας πρωτεΐνης βρίσκονται στην αµινοξική της αλληλουχία, ενώ σε κάθε ενδιάµεσο σταθµό (κουτιά) θα πρέπει να παρθεί µια απόφαση αν η πρωτεΐνη πρέπει να παραµείνει ή να µετακινηθεί περαιτέρω.

11 ΤΑ ΥΟ ΒΑΣΙΚΑ ΜΟΝΟΠΑΤΙΑ ΣΤΟΧΕΥΣΗΣ ΠΡΩΤΕΪΝΩΝ Μετα-Μεταφραστική Συν-Μεταφραστική* Κυτταρόπλασµα Πυρήνας Μιτοχόνδρια Χλωροπλάστες Υπεροξεισώµατα Εκκριτικό µονοπάτι *συνήθως Τα βασικά µονοπάτια στόχευσης των νεοσυντιθέµενων πρωτεϊνών περιλαµβάνουν είτε µετα-µεταφραστικές τροποποιήσεις είτε συν- µεταφραστικές (κυστιδιακή µεταφορά)

12 Στόχευση Μοριακοί µηχανισµοί που εµπλέκονται στη µεταφορά των πρωτεϊνών στη σωστή µεµβράνη/οργανίδιο στόχο ιαλογή Μοριακοί µηχανισµοί που «ξεδιαλέγουν» τις παραγόµενες πρωτεΐνες ανάλογα µε το στόχο τους

13 λιπιδική διπλοστοιβάδα πρωτεΐνη µεµβράνης πρωτεΐνες του αυλού Ο ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ ΤΩΝ ΜΕΜΒΡΑΝΩΝ ΙΑΤΗΡΕΙΤΑΙ ΚΑΤΑ ΤΗ ΜΕΤΑΦΟΡΑ ΤΩΝ ΚΥΣΤΙ ΙΩΝ ιατήρηση της πλευρικότητας κατά την κυστιδιακή µεταφορά. Ο αρχικός προσανατολισµός τόσο των πρωτεϊνών όσο και των λιπιδίων της µεµβράνης-δότη διατηρείται και στη µεµβράνη-στόχο και οι διαλυτές πρωτεΐνες µεταφέρονται πάντα από τον αυλό κάποιου οργανιδίου στον αυλό κάποιου άλλου. εκβλάστηση σύντηξη κυστίδιο µεταφοράς ΟΡΓΑΝΙ ΙΟ ΟΤΗΣ ΟΡΓΑΝΙ ΙΟ ΣΤΟΧΟΣ

14 Ο ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ ΤΩΝ ΜΕΜΒΡΑΝΩΝ ΙΑΤΗΡΕΙΤΑΙ ΚΑΤΑ ΤΗ ΜΕΤΑΦΟΡΑ ΤΩΝ ΚΥΣΤΙ ΙΩΝ

15 ΤΥΠΙΚΑ ΣΙΝΙΑΛΑ ΙΑΛΟΓΗΣ ΠΡΩΤΕΪΝΩΝ

16 ΥΟ ΙΑΦΟΡΕΤΙΚΟΙ ΤΡΟΠΟΙ ΣΧΗΜΑΤΙΣΜΟΥ ΕΝΟΣ ΣΙΝΙΑΛΟΥ ΙΑΛΟΓΗΣ ΣΕ ΜΙΑ ΠΡΩΤΕΪΝΗ H 2 N H 2 N πεπτίδιο σινιάλο τµήµατα της επιφάνειας σινιάλο COOH COOH πεπτίδιο σινιάλο H 2 N H 2 N COOH επιφάνεια σινιάλο COOH Ένα σινιάλο διαλογής µπορεί είτε να αποτελεί συνεχή αµινοξική ακολουθία (π.χ. πεπτίδιο οδηγητής) είτε να προκύπτει σαν αποτέλεσµα του διπλώµατος της πρωτεΐνης οπότε και δηµιουργείται µια επιφάνεια επαφής (από αποµακρυσµένες ακολουθίες) που ονοµάζεται επιφάνειασινιάλο. Σε κάθε περίπτωση το σινιάλο µεταφοράς εξαρτάται από την τρισδιάστατη διαµόρφωση της πρωτεΐνης και για το λόγο αυτό είναι σχετικά δύσκολο να εντοπιστεί πάντα µε ακρίβεια.

17 Φυλασσόµενη µεταφορά πρωτεϊνών (µονοπάτι 1) και νουκλεϊκών οξέων (µονοπάτι 12) εντός και εκτός του πυρήνα. πυρηνικός πόρος 12 mrna, trna, ριβοσωµικές υποµονάδες N µεταγραφικοί παράγοντες, δοµικές πρωτεΐνες 1

18 Ο ΠΥΡΗΝΙΚΟΣ ΠΟΡΟΣ Ο πυρηνικός φάκελος ενός τυπικού ευκαρυωτικού κυττάρου περιέχει περίπου NPC και για παράδειγµα κατά τη φάση S του κυτταρικού κύκλου κάθε NPC θα πρέπει να εισάγει στον πυρήνα περίπου 100 µόρια ιστονών ανά λεπτό, ενώ αν το κύτταρο αυξάνει γοργά (έντονη πρωτεϊνοσύνθεση) θα πρέπει να εξέρχονται από τον NPC προς το κυτοσόλιο 6 νεοαυτοσυγκροτηµένες µεγάλες και µικρές ριβοσωµικές υποµονάδες ανά λεπτό. Επίσης η κίνηση µορίων από τον NPC περιλαµβάνει αµφίδροµη κίνηση είτε προς το εσωτερικό του πυρήνα (δοµικές πρωτεϊνες, DNA πολυµεράσες, µεταγραφικοί παράγοντες, ιστόνες, πρωτεϊνες µατίσµατος, hnrnps κτλ) είτε από τον πυρήνα προς το κυτταρόπλασµα (mrna, trna, rrna κτλ).

19 κυτταροπλασµικά ινίδια κεντρικό κανάλι κυτταρόπλασµα κυτταροπλασµικός δακτύλιος πυρηνικός φάκελος πυρήνας ΚΥΤΤΑΡΟΠΛΑΣΜΑ πυρηνικός φάκελος ΠΥΡΗΝΑΣ ινίδιο καλαθιού ινίδιο καλαθιού ΕΞΑΓΩΓΗ ΜΟΡΙΩΝ mrna, trna, snrna, προ-ριβοσώµατα ΠΑΘΗΤΙΚΗ ΙΑΧΥΣΗ µόρια <9 nm ή 80 kda πυρηνοπλασµικός δακτύλιος ΕΙΣΑΓΩΓΗ ΜΟΡΙΩΝ πυρηνικές πρωτεΐνες, ριβοσωµικές πρωτεϊνες, ώριµα snrnps ΠΑΘΗΤΙΚΗ ΙΑΧΥΣΗ? µόρια <9 nm ή 80 kda µεταφορέας κυτταροπλασµικά ινίδια ΚΙΝΗΣΗ ΠΡΩΤΕΪΝΩΝ ΤΗΣ ΠΥΡΗΝΙΚΗΣ ΜΕΜΒΡΑΝΗΣ όπως οι LBR, LAP2 από το RER προς τον πυρηνικό φάκελο Ο ΠΥΡΗΝΙΚΟΣ ΠΟΡΟΣ - Τρισδιάστατη αναπαράσταση του πυρηνικού πόρου όπου διακρίνεται η οργάνωση των κύριων δοµών του συµπλόκου. - Σχηµατική αναπαράσταση του NPC σε τοµή κάθετη προς την πυρηνική µεµβράνη. ιακρίνονται τα κύρια δοµικά συστατικά του συµπλόκου όπως τα κυτταροπλασµατικά ινίδια, ο µεταφορέας και τα ινίδια του πυρηνοπλασµατικού καλαθιού. Παράλληλα σηµειώνεται ο τρόπος και η κατεύθυνση (βέλη) µεταφοράς των διαφόρων µορίων που κινούνται µέσω του NPC. Μοριακό βάρος ~ kda (~ 30 φορές µεγαλύτερος από το ριβόσωµα) (Πυρηνικός φάκελος ~ ΠΠ) Αποτελείται από περισσότερες από 100 πρωτεΐνες που τοποθετούνται µε µια µάλλον οκταγωνική συµµετρία

20 ΚΙΝΗΣΗ ΜΟΡΙΩΝ ΙΑΜΕΣΟΥ ΤΟΥ ΠΥΡΗΝΙΚΟΥ ΠΟΡΟΥ Σχηµατική αναπαράσταση των διαφορετικών µονοπατιών κίνησης των µακροµορίων µέσω του πυρηνικού πόρου. Σε όλες τις περιπτώσεις το κυττοσόλιο είναι προς το πάνω µέρος του σχήµατος και το πυρηνόπλασµα προς το κάτω. (α) Μακροµόρια µικρότερα από 50 kda είναι ικανά για ελεύθερη διάχυση. (β) Η υποβοηθούµενη διάχυση αφορά κυρίως µόρια µεταφορείς κατά την πυρηνοπλασµατική κίνηση µακροµορίων τα οποία µετακινούνται µε το τρόπο αυτό προς τις δύο κατευθύνσεις απουσία φορτίου. (γ, δ) Εισαγωγή στον πυρήνα και εξαγωγή από τον πυρήνα πρωτεϊνών µε τη µεσολάβηση ειδικού σινιάλου. ιαδοχικά γεγονότα σύνδεσηςαποσύνδεσης-επανασύνδεσης µεταξύ των µεταφορέων και του πυρηνικού πόρου αλλά και κατανάλωσης ενέργειας έχουν σαν αποτέλεσµα τη µεταφορά του φορτίου προς µια κατεύθυνση. α γ µεταφορέας > 50 kda < 50 kda Ελεύθερη διάχυση πρωτεΐνη που αλληλεπιδρά µε τον πόρο πρωτεΐνη για εισαγωγή υποδοχεάς για εισαγωγή β δ πρωτεΐνη για εξαγωγή υποδοχεάς για εξαγωγή Υποβοηθούµενη διάχυση

21 Οι πρωτεϊνες που εξέρχονται από τον πυρήνα φέρουν ένα πεπτιδικό σινιάλο εξόδου (NES) ενώ τέλος οι πρωτεϊνες που κυκλοφορούν εντός και εκτός του πυρήνα περιέχουν τόσο ένα NLS όσο και ένα NES. Τα NLSs πρωτοανακαλύφθηκαν στο Τ-αντιγόνο του ιού Simian 40 (SV40) και αποτελούνται κυρίως από µια µικρή αλληλουχία που αν και µπορεί να διαφερει σε διάφορες πρωτεϊνες χαρακτηρίζεται από το ότι είναι πλούσια σε θετικά φορτισµένα αµινοκέα όπως είναι Lys Arg ενώ συνήθως περιέχει και Pro. Στην πραγµατικότητα οι πιό πολλές πυρηνικές πρωτεϊνες έχουν πάνω από ένα NLS

22 Η ΛΕΙΤΟΥΡΓΙΑ ΕΝΟΣ ΣΙΝΙΑΛΟΥ ΠΥΡΗΝΙΚΗΣ ΕΝΤΟΠΙΣΗΣ Τ-αντιγόνο α n β Αν µια πρωτεΐνη µε σινιάλο πυρηνικής εντόπισης προσδεθεί σε κόκκους χρυσούς και ενεθεί στο κυτταρόπλασµα ωοκυττάρων Xenopus, µετά από 3 ώρες (όπως φαίνεται σε Η.Μ. υψηλής ανάλυσης) οι κόκκοι χρυσού κατευθύνονται άµεσα στον πυρήνα (βέλος) µέσω των πυρηνικών πόρων. γ

23 Στόχευση και διαµεµβρανική µεταφορά πρωτεϊνών στο µιτοχόνδριο (µονοπάτι 2) και το υπεροξείσωµα (µονοπάτι 3). Απελευθέρωση διαλυτών πρωτεϊνών από τα ελεύθερα (πολυ)-ριβοσώµατα στο κυττοσόλιο (µονοπάτι 4). 3 ΥΠΕΡΟΞΕΙΣΩΜΑ R 4 ΚΥΤΤΟΣΟΛΙΟ 2 ΜΙΤΟΧΟΝ ΡΙΟ

24 µήτρα Ν Ν NH 3 + εξωτερική µεµβράνη διαµεµβρανικός χώρος εσωτερική µεµβράνη NH 3 + σινιάλο στόχευσης στη µήτρα C C ΕΙΣΑΓΩΓΗ ΠΡΩΤΕΪΝΩΝ ΣΤΑ ΜΙΤΟΧΟΝ ΡΙΑ Ένα πεπτιδικό σινιάλο για την στόχευση και εισαγωγή µιας πρωτεΐνης (αριστερά) στο µιτοχόνδριο περιλαµβάνει (συνήθως) τη δηµιουργία µιας αµφιπαθικής έλικας (δεξιά) µε βήµα 3.6 κατάλοιπα ανά στροφή. Οι αµφιπαθικές έλικες χαρακτηρίζονται από το γεγονός ότι τα θετικά φορτισµένα αµινοξέα οµαδοποιούνται στη µία πλευρά της έλικας και τα µη-πολικά στην άλλη. Εντοπισµός των πεπτιδικών σινιάλων στόχευσης στις µιτοχονδριακές πρωτεΐνες. Όλες σχεδόν έχουν ένα ειδικό σινιάλο στο Ν-άκρο (µπλε) το οποίο όµως µπορεί να διαφέρει µεταξύ διαφορετικών πρωτεϊνών. Οι πρωτεΐνες που προορίζονται για τον διαµεµβρανικό χώρο ή την εξωτερική µεµβράνη έχουν µια επιπλέον ακολουθία στόχευσης (κόκκινο, πεπτιδικό σήµα θέσης που καθορίζει τη θέση της πρωτεΐνης στο µιτοχόνδριο). σινιάλο αναστολής µεταφοράς και εντοπισµού στην εξωτερική µεµβράνη

25 Σύνδεση µιτοχονδριακών πρωτεϊνών σε ειδικούς µεταφορείς όπως οι πρωτεΐνες MSF και η κυττολική µοριακή συνοδός Hsc70 ιαγραµµατική απεικόνιση της ροής (φορά βελών) των βασικών µονοπατιών εισαγωγής και στόχευσης µιτοχονδριακών πρωτεϊνών που συντίθενται είτε σε ελεύθερα κυττοσολικά ριβοσωµατα είτε στα ριβοσώµατα του µιτοχονδρίου. Η φορά των βελών υποδεικνύει τα σύµπλοκα από τα οποία περνούν οι πρωτεΐνες ανάλογα µε τον προορισµό τους και τη προέλευση τους. Υδρόλυση ΑΤΡ Πρόσδεση της µη αυτοσυγκροτηµένης πρωτεΐνης στην µιτοχονδριακή µοριακή συνοδό Hsc70 ίπλωµα µέσω πρόσδεσης στην Hsc60

26 ΕΙΣΑΓΩΓΗ ΠΡΩΤΕΪΝΩΝ ΕΝΤΟΣ της ΜΗΤΡΑΣ ΤΩΝ ΜΙΤΟΧΟΝ ΡΙΩΝ

27 ΥΠΕΡΟΞΕΙΣΩΜΑΤA Μετά την απελευθερωση τους απο τα ριβοσώµατα οι υπεροξεισωµικές πρωτεϊνες σε αντίθεση µε αυτές των µιτοχονδρίων (και των χλωροπλαστών) αυτοσυγκρούνται-διπλώνουν στο κυττοσόλιο πριν µπούν στο οργανίδιο. Για παράδειγµα η καταλάση προσδένεται σε ένα διαλυτό υποδοχέα του κυττοσολίου που ονοµάζεται PTS1R, µόνο αφού προσδεθεί σε κάθε µονοµερές η αίµη και αυτοσυγκροτηθεί η ώριµη τετραµερής πρωτεϊνη. Το πεπτιδικό σινιάλο διαλογής για την καταλάση είναι η ακολουθία Ser- Lys-Leu (SLK ακολουθία) που βρίσκεται στο C-άκρο της πρωτεϊνης. Στο C-άκρο βρίσκεται επίσης το σινιάλο διαλογής και υπεορξεισωµικές πρωτεϊνες fatty acyl CoA oxidase και urate oxidase. Το σύµπλοκο υποδοχέας-καταλάση στη συνέχεια προσδένεται στο σύµπλοκο των πρωτεϊνών Pex της υπεροξεισωµικής µεµβράνης. Ακολούθως η καταλάση µεταφέρεται στο εσωτερικό του υπεροξεισώµατος όπου θα πρέπει να σηµειώσουµε ότι ακολυθία SLK ακολουθία δεν αποκόπτεται. Η εισαγωγή απαιτεί υδρόλυση ATP αλλά δεν υπάρχει ηλεκτροχηµική κλίση κατά µήκος της µεµβράνης. Αλλες υπεροξεισωµικές πρωτεϊνες φέρουν το πεπτιδικό σινιάλο στο Ν-άκρο όπως για παράδειγµα η θειολάση όπου η ακολουθία αυτή αποτελείται από 26 αµινοξέα. Οι πρωτεϊνες του τύπου αυτού προσδένονται σε ένα κυττοσσολικό υποδοχέα PTS2R που συνοδεύει την πρωτεϊνη στον υποδοχέα Pex της µεµβράνης. Σηµειώνουµε επίσης ότι στη περίπτωση αυτή το πεπτιδικό σινιάλο, µετά την είσοδο των πρωτεϊνών στον αυλό του υπεροξεισώµατος, αποκόπτεται. Το πεπτιδικό σινιάλο που κατευθύνει τις µεµβρανικές πρωτεϊνες των υποεροξεισωµάτων δεν είναι γνωστό και γενικά η διαδικασία πρόσληψης των πρωτεϊνών αυτών από τα υπεροξεισώµατα είναι σχετικά άγνωστη.

28 σινιάλο ΠΥΡΗΝΑΣ ολιγοµερική πρωτεϊνη mrna ΚΥΤΤΟΣΟΛΙΟ RER PMB υποδοχέας κυστίδιο ΥΠΕΡΟΞΕΙΣΩΜΑ PMF ΚΥΤΤΟΣΟΛΙΟ ΥΠΕΡΟΞΕΙΣΩΜΑ υποδοχέας σινιάλο σύµπλοκο πρωτεϊνών Pex Mονοπάτια που περιγράφουν τη διαλογή των πρωτεϊνών της µεµβράνης των υπεροξεισωµάτων. Οι πρωτεΐνες αυτές συντίθενται σε ελεύθερα ριβοσώµατα στο κυττοσόλιο. Το µοντέλο διαχωρίζει τις πρωτεΐνες που είναι απαραίτητες για τη βιογένεση του οργανιδίου (PMBs) και τις πρωτεΐνες που εµπλέκονται στην λειτουργία του οργανιδίου. (PMFs). Οι PMBs µπορεί αρχικά να µεταφερθούν στο ενδοπλασµατικό δίκτυο (ER) και τελικά µέσω κυστιδίων να µεταφερθούν στον αναπτυσσόµενο υπεροξείσωµα. Αντίθετα οι PMFs µπορεί να µεταφερθούν κατευθείαν από το ριβόσωµα στο οργανίδιο. Μοντέλο που περιγράφει τα πρώιµα στάδια για την εισαγωγή των πρωτεϊνών της µήτρας του υπεροξεισώµατος. Οι πρωτεΐνες που περιέχουν τα υπεροξεισωµικά πεπτιδικά σινιάλα αναγνωρίζονται στο κυττοσόλιο από ειδικούς υποδοχείς. Στη συνέχεια το σύµπλοκο πρωτεΐνης-υποδοχέα προσδένεται στις πρωτεΐνες Pex στην επιφάνεια της µεµβράνης του υπεροξεισώµατος. Οι ολιγοµερικές υπεροξεισωµικές πρωτεΐνες όπου µόνο κάποιες υποµονάδες περιέχουν το ειδικό πεπτιδικό σινιάλο µπορούν να εισέλθουν στη µήτρα του υπεροξείσωµατος αφού για την διαδικασία αυτή δεν επιβάλλεται αποσύνδεση των υποµονάδων ή ξεδίπλωµα των πρωτεϊνών.

29 ΑΠΕΛΕΥΘΕΡΩΣΗ ΠΡΩΤΕΪΝΩΝ ΣΤΟ ΚΥΤΤΟΣΟΛΙΟ ATP Σχηµατική αναπαράσταση της διαδικασίας αυτοσυγκρότησηςδιπλώµατος των διαλυτών πρωτεϊνών του κυττοσολίου µέσω της µοριακής χαπερόνης Hsp70 (µονοπάτι ❶) ή του συµπλόκου TciP (µονοπάτι ❷). Hsp70 ❷ ❶ µερικά διπλωµένη πρωτεΐνη ATP κανονικά διπλωµένη πρωτεΐνη TCiP/CroEL

30 κυστίδιο µεταφοράς σύµπλεγµα Golgi πυρήνας πυρηνική µεµβράνη aδρό ER Σχηµατική απεικόνιση των δύο κύριων δρόµων που ξεκινούν από το ER και αφορούν την κυστιδιακή µεταφορά (κόκκινα βέλη). λυσόσωµα Οι δρόµοι αυτοί καταλήγουν (εκτός βέβαια από τις πρωτεΐνες που είναι δοµικά στοιχεία του ER ή του Gogli) είτε στο λυσόσωµα είτε στην πλασµατική µεµβράνη. πλασµατική µεµβράνη λείο ER

31 ΗΘΕΩΡΙΑ ΤΟΥ ΣΙΝΙΑΛΟΥ Τα ριβοσώµατα που συνθέτουν πρωτεΐνες στο κυττοσόλιο είναι όµοια µε αυτά τα οποία προσδένονται στο ER και προέρχονται από ένα κοινό απόθεµα. mrna κυττοσολικής πρωτεϊνης παραµένει ελεύθερο στο κυττοσόλιο ριβοσωµικές υποµονάδες στο κυττοσόλιο µεµβράνη ER mrna πρωτεΐνης για το ER παραµένει προσδεδεµένο στη µεµβράνη ελεύθερο κυττοσολικό πολυριβόσωµα 3 πεπτιδικό σινιάλο ΕR πολυριβόσωµα προσδεδεµένο στο ER µέσω των νεο-συντιθέµενων πρωτεϊνών Το ριβόσωµα οδηγείται στη µεµβράνη του ER λόγω αναγνώρισης του σινιάλου του πεπτιδίου οδηγητή. Το µόριο του mrna µπορεί να παραµείνει µόνιµα προσδεδεµένο στο ER σαν τµήµα του πολυριβοσώµατος ενώ τα ριβοσώµατα που µετακινούνται κατά µήκος του mrna µπορεί να ανακυκλώνονται. Στο τέλος κάθε γύρου πρωτεϊνοσύνθεσης οι ριβοσωµικές υποµονάδες απελευθερώνονται και επανασυνδέονται µε το κοινό απόθεµα των ελεύθερων ριβοσωµάτων.

32 ΚΙΝΗΣΗ ΠΡΩΤΕΪΝΩΝ

33 Αναγνώριση του πεπτιδίου οδηγητή, αγκυροβόληση ριβοσωµάτων στο ER και εισαγωγή των νεοσυντιθέµενων πρωτεϊνών στον αυλό του ER (µονοπάτι 5). 5 ER

34 ΕΝ ΟΠΛΑΣΜΑΤΙΚΟ ΙΚΤΥΟ Το ER είναι ένα δίκτυο µεµβρανών που υπάρχει σε όλα τα κύτταρα. Η µεµβράνη του συνήθως αποτελεί πάνω από το µισό της συνολικής µεµβράνικής επιφάνειας του κυττάρου και οργανώνεται σαν ένα δίκτυο λαβυρινθώδες από διακλαδιζώµενους σωλήνες και επιπεδοποιηµένους σάκους που εκτείνονται σε όλο το κυττοσόλιο.

35 ΜΕΤΑΦΡΑΣΗ ΣΤΟ Α ΡΟ ΕΝ ΟΠΛΑΣΜΑΤΙΚΟ ΙΚΤΥΟ υποδοχέας SRP υποδοχέας ριβοσώµατος ή translocon πεπτιδάση σινιάλου Ακολουθία σινιάλου (ή πεπτίδιο οδηγητής) 5 ΑΥΛΟΣ ΤΟΥ ER ❹Το SPR αποδεσµεύεται κύκλος SRP ❸Το SPR αναγνωρίζει ΑΑΑ 3 την πρωτεΐνη πρόσδεσης στο ❺Επανέναρξη πρωτεϊνοσύνθεσης - RER και το πεπτίδιο η πολυπεπτιδική αλυσίδα εισέρχεται οδηγητής εισέρχεται στο RER εντός της πλασµατικής µεµβράνης ❶Το πεπτίδιο οδηγητής συντίθεται στο 5 άκρο του mrna τranslocon ανοικτό ❷Αναγνώριση από το SRP, προσωρινή αναστολή πρωτεϊνοσύνθεσης ΚΥΤΤΑΡΟΠΛΑΣΜΑ ❻Η πρωτεΐνη εντός του αυλού του RER - ανακύκλωση ριβοσώµατος και το πεπτίδιο οδηγητής αποκόπτεται Σχηµατική αναπαράσταση των διαδοχικών βηµάτων (❶-❻) κατά την αναγνώριση του νεοσυντιθέµενου πεπτιδίου οδηγητή, τη µεταφορά και την πρόσδεση του ριβοσώµατος (µέσω του SRP και του υποδοχέα του) στον µετατοπιστή (translocon) που εντοπίζεται στη µεµβράνη του ER και τελικά την απελευθέρωση της πρωτεΐνης στον αυλό του ER. Το πεπτίδιο οδηγητής αποκόπτεται εντός του αυλού από την πεπτιδάση του σινιάλου.

36 Η µετάφραση του πεπτιδίου οδηγητή από ένα ελεύθερο ριβόσωµα προκαλεί την άµεση πρόσδεση τόσο στο ριβόσωµα όσο και στο πεπτίδιο οδηγητή του σωµατίδιου αναγνώρισης του σινιάλου [signal recognition particle (SRP)]. Tο SRP είναι µια ριβονουκλεοπρωτεϊνική µηχανή (σύµπλοκο) τύπου µοριακής συνοδού που αποτελείται από 6 πρωτεϊνες και ένα µόριο RNA. Σηµειώνουµε ότι κάποιες από τις πρωτεϊνες του συµπλόκου αλληλεπιδρούν µε το ριβόσωµα, κάποιες µε το πεπτιδικό σινιάλο και κάποιες απαιτούνται για τη µετατόπιση της πρωτεϊνης αφού αυτή έχει προσδεθεί στη µεµβράνη του ER. Η άµεση πρόσδεση του SRP στο πολυπεπτιδίο αµέσως µόλις αυτό εµφανιστεί από το ριβόσωµα προκαλεί (σε αρκετές αλλά όχι όλες τις περιπτώσεις) αναστολή της πρωτείνοσύνθεσης γεγονός που επιτρέπει στο ριβόσωµα να προσδεθεί στο ER πριν η πρωτεΐνη βγει στο κυττοσόλιο. Στη συνέχεια το σύµπλεγµα SRPπεπτίδιο οδηγητής-mrna-ριβόσωµα αγκυροβολεί µέσω ενός υποδοχέα του SRP στη µεµβράνη του ΕR.

37 Το πεπτιδιo οδηγητής (πεπτιδικό σινιάλο διαλογής για το ER) ) έχει µέγεθος αµινοξέα και βρίσκεται στο N-άκρο της πρωτεϊνης. Οσον αφορά τη δοµή του µετά από ένα ή περισσότερα θετικά φορτισµένα αµινοξέα ακολουθεί ένα σχετικά µεγάλο τµήµα υδρόφοβων αµινοξέων το οποίο και είναι απαραίτητο για τη δράση του πεπτιδίου οδηγητή.

38 Ο µετατοπιστής (υδατικός πόρος πρωτεϊνικής φύσης) µοιάζει χονδρικά µε έναν πενταγωνικό κύλινδρο ύψους 5-6 nm και διαµέτρου 8.5 nm. Ο εσωτερικός πόρος (κανάλι) έχει διάµετρο ~2 nm και διαµορφώνεται κύρια από την πρωτεϊνη TRAM (πρόσφατες µελέτες δεικνύουν ότι αποτελείται από µια ετεροτριµερή πρωτεϊνη που λέγεται Sec61στα ευκαρυωτικά και SecY στα βακτήρια) Σε κανονικές συνθήκες ο πόρος συνδέεται µε το αυξανόµενο πολυπεπτίδιο και πιθανώς συµµετέχει στο τράβηγµα του πολυπεπτιδίου προς τον αυλό, ενώ θα πρέπει να σηµειωθεί ότι είναι µια δυναµική οντότητα αφού ανοίγει όταν προσδεθεί το ριβόσωµα και κλείνει όταν τελείωσει η µετάφραση και απελευθερωθεί η πολυπεπτιδική αλυσίδα. Η µετατόπιση της πρωτεϊνης µέσω του πόρου προς τον αυλό του ER απαιτεί ενέργεια που παρέχεται στα κύτταρα των θηλαστικών µέσω της υδρόλυσης του GTP σε GDP. Ανενεργός µετατοπιστής Ενεργός µετατοπιστής

39 Καθώς η πρωτεϊνη εισέρχεται στον αυλό του ER το αµινοτελικό πεπτίδιο οδηγητής τελικά αποκόπτεται µέσω µιας ειδικής πεπτιδάσης. Προκειµένου δε να προωθηθεί η αποκοπή απαιτείται µια γειτονική θέση αποκοπής που αναγνωρίζεται ειδικά από την πεπτιδάση. Η θέση αυτή δεν υπάρχει σε εσωτερικά σινιάλα και για το λόγο αυτό τα σινιάλα αυτά δεν αποκόπτονται ποτέ αλλά παραµένουν στη πολυπεπτιδική αλυσίδα και συχνά χρησιµεύουν σαν άγκυρες για την πρόσδεση της πρωτεϊνης στη µεµβράνη του ER. Το αµινοτελικό πεπτίδιο-οδηγητής µιας διαλυτής πρωτεϊνης του µονοπατιού κυστιδιακής µεταφοράς εκτός από το να κατευθύνει την πρωτεΐνη στην µεµβράνη του ER πιστεύεται ότι δρα και σαν σινιάλο έναρξης-µεταφοράς κατά µήκος του µετατοπιστή. Πιθανώς δε παραµένει προσδεδεµένο στον µηχανισµό µεταφοράς ενώ η υπόλοιπη πρωτεϊνη µεταφέρεται γλιστρώντας προς το εσωτερικό σαν λούπα. Απο τη στιγµή που το καρβόξυ της άκρο έχει φτάσει στον αυλό, το πεπτιδικό σινιάλο απελευθερώνεται από τον πόρο µετατόπισης αποκόπτεται από την πεπτιδάση του σινιάλου και γρήγορα αποδοµείται σε αµινοξέα από άλλες πρωτεϊνες του ER. Η ώριµη πρωτεϊνη ελευθερώνεται εντός του αυλού.

40 Στον αυλό του ER λαµβάνουν χώρα µια σειρά από τις πιο σηµαντικές µετα- µεταφραστικές τροποποιήσεις των πρωτεϊνών οι πιό πολλές από τις οποίες εξελίσονται παράληλα µε τη σύνθεση της πρωτεΐνης. Οι βασικές αυτές µετατροπές αφορούν: (1) τη δηµιουργία δισουλφιδικών δεσµών, (2) την προσθηκη και τροποποίηση υδατανθράκων σε κατάλοιπα Asp (3) το ενεργειακά αποδεκτό δίπλωµα της πρωτεϊνης (4) την αυτοσυγκρότηση των πολυπεπτιδικών υποµονάδων σε πολυµερικές πρωτεϊνες.

41 - Προώθηση πρωτεϊνών από το ER προς τις δεξαµενές του Golgi - Κίνηση των πρωτεϊνών εντός των δεξαµενών Golgi (εµπρόσθια κίνηση - µονοπάτι 6) - Επιστροφή των δοµικών πρωτεϊνών του ER από το Golgi (ανάστροφη κίνηση µονοπάτι 7). 6 TGN Golgi 7

42 ΤΟ ΣΥΜΠΛΕΓΜΑ GOLGI δεξαµενές Golgi trans όψη φεύγει υλικό σπό το Golgi cis όψη δέχεται υλικό σπό το ER κυστίδιο µεταφοράς από το ER σχηµατισµός κυστιδίου Τρισδιάστατη απεικόνιση του συµπλέγµατος Golgi και απεικόνιση των διακριτών δεξαµενών από τις οποίες εισέρχεται (cis όψη-είσοδος) και εξέρχεται (trans όψηέξοδος) πρωτεϊνικό υλικό µέσω κυστιδιακής µεταφοράς. Οι δεξαµενές είναι πάντα οργανωµένες σε πολικότητα cis trans. κυστίδιο µεταφοράς Κάθε στοίβα έχει µέγεθος µm και µπορεί να αποτελείται από 3-20 δεξαµενές, ενώ τα κυστίδια που παρατηρούνται στις άκρες των δεξαµενών έχουν διάµετρο ~50 nm.

43 ΤΟ ΣΥΜΠΛΕΓΜΑ GOLGI Κάθε στοίβα Golgi έχει δύο όψεις. Τη cis- (ή όψη εισόδου) και την trans- (ή όψη εξόδου) ανάµεσα στις οποίες υπάρχουν οι δεξαµενές medial. Τόσο η cis- όσο και η tans- όψη είναι στενά συνδεδεµένες µε ειδικά διαµερίσµατα που αποτελούνται από ένα δικτυο διασυνδεόµενων σωλήνων και δεξαµενικών δοµών που ονοµάζονται δίκτυο cis- [(cis-golgi Νetwork (CGN)] και δίκτυο trans- [trans-golgi Network (TGN)]. Οι πρωτεϊνες που εξέρχονται από το ER εισέρχονται διαδοχικά στις διάφορες δεξαµενές του Golgi (cis, medial, trans) και τελικα εξέρχονται από το TGN ο αυλός του οποίου είναι σε συνέχεια µε αυτόν του trans-golgi.

44 ΤΟ ΣΥΜΠΛΕΓΜΑ GOLGI Τόσο το CGN αλλά ιδιαίτερα το TGN φαίνεται ότι είναι χρήσιµα για τη διαλογή των µεταφερόµενων πρωτεϊνών.

45 ΙΣΤΟΧΗΜΙΚΗ ΑΠΟ ΕΙΞΗ ΤΗΣ ΒΙΟΧΗΜΙΚΗΣ ΙΑΜΕΡΙΣΜΑΤΟΠΟΙΗΣΗΣ ΤΩΝ ΕΞΑΜΕΝΩΝ ΤΟΥ GOLGI Αναγωγή Οσµίου Πυροφωσφατάση της Θειαµίνης Οξινη Φωσφατάση

46 ΛΕΙΤΟΥΡΓΙΚΗ ΙΑΜΕΡΙΣΜΑΤΟΠΟΙΗΣΗ ΤΟΥ ΣΥΜΠΛΕΓΜΑΤΟΣ GOLGI

47 ΕΝΖΥΜΑ ΕΞΑΜΕΝΩΝ GOLGI Η λειτουργική διαµερισµατοποίηση του συµπλέγµατος Golgi συνδέεται µε την διακριτή τοπολογική κατανοµή των διαφόρων ενζύµων και ειδικών υποδοχέων στις διαφορετικές δεξαµενές του Golgi. Η σειριακή τοποθέτηση των ενζύµων πιθανότατα σχετίζεται µε το γεγονός ότι η τροποποιήσεις που εισάγονται στην πρωτεΐνη από τα ένζυµα τα αρχικών δεξαµενών χρησιµοποιούνται (συνήθως) σαν υπόστρωµα προκειµένου να δράσουν τα ένζυµα των επόµενων δεξαµενών. Παρότι µόνο τρία διακριτά τµήµατα έχουν µέχρι σήµερα περιγραφεί (cis, medial, trans) καθένα είναι δυνατόν να αποτελείται από µια οµάδα δύο ή περισσοτέρων δεξαµενών, ενώ πιθανότατα µπορεί να υπάρχουν και άλλες υποδιαιρέσεις. glcn-acetyl-transferase-i mannosidase I 1P-Nac-glucosaminidase NADPase, mannosidase II Galactosyl transferase Υποδοχείς 6-P-µαννόζης Sialyl transferase Οξινη φωσφατάση ER cis-golgi δίκτυο (CGN) δεξαµενή cis δεξαµενή medial δεξαµενή trans trans-golgi δίκτυο (TGN) εκκριτικό κυστίδιο λυσόσωµα πλασµατική µεµβράνη H αφαίρεση των καταλοίπων µανόζης και η πρόσθεση των Ν-ακετυλογλουκοζαµινών φαίνεται να γίνεται στις δεξαµενές medial ενώ η πρόσθεση της γαλακτόζης και των καταλοίπων τους σιαλικού οξέος γίνεται στις δεξαµενές trans και στο TGN. Γενικά δεν είναι γνωστό αν υπάρχει αποκλεισµός κάθε ενζύµου από τις άλλες δεξαµενές ή αν δηµιουργείται κλίση συγκέντρωσης.

48 Τροποποίηση πρωτεϊνών και άλλων µορίων στο Golgi Τροποποιήσεις µορίων που λαµβάνουν χώρα στο Golgi αφορούν: (1) Τη γλυκοζυλίωση σακχάρων / λιπιδίων. (2) Την προσθήκη θειικών οµάδων. (3) Το πακετάρισµα λιποπρωτεϊνών όπου µετά την προσθήκη λιπιδίων που συντίθενται στο λείο ενδοπλασµατικό δίκτυο στο πρωτεϊνικό τµήµα (αποπρωτείνης) του µορίου η πρωτεϊνη προωθείται προς το Golgi όπου και τροποιείται περαιτέρω (π.χ. γλυκοζυλίωση). Με τον τρόπο αυτό γίνεται η παραγωγή και έκκριση των λιποπρωτεινών πολύ χαµηλής πυκνότητας (VLDL verγ lοw densitγ lipοprοteins) και υψηλής πυκνότητας (HDL - high density lipοprοtein) στα ηπατικά κύτταρα. Tο Golgi αποτελεί την κύρια θέση σύνθεσης υδρογονανθράκων για το κύτταρο αφού οι πιό πολλοί από τους πολυσακχαρίτες του κυττάρου συντίθενται στο Golgi συµπεριλαµβανοµένων, της πηκτίνης (pectin) και της ηµικυτταρίνης (hemicellulose) του κυτταρικού τοιχώµατος (φυτικό κύτταρο) αλλά και των πιο πολλών από τις γλυκοζαµινογλυκάνες της εξωκυττάριας ουσίας του ζωϊκού κυττάρου. Ένα µεγάλο ποσοστό των σακχάρων αυτών προσδένονται στις πρωτεϊνες και τα λιπίδια που περνούν από τις δεξαµενένες του Golgi.

49 The seven cisternae of the Golgi Complex (named C1- C7 in the cis-to-trans direction) are colored light blue (C1), pink (C2), rose (C3), green (C4), dark blue (C5), amber (C6) and red (C7). 3-D πολυπλοκότητα του Golgi και σχετική τοποθέτηση του στο κυτταρόπλασµα σε σχέση µε άλλα οργανίδια και τον κυτταροσκελετό Within the reconstructed volume, 2, 119 small (approximately 52 nm) transport vesicles are present near the Golgi stack. These vesicles appear in the model as white spheres. Most of the vesicles are tethered to each other or to a Golgi cisterna. Dense core granules, which contain insulin, are modeled in bright blue. Additional cytoplasmic components appear in the final frames of this movie. These include the endoplasmic reticulum (yellow), mitochondria (green) endocytic compartments (purple) and clathrin-bearing post-golgi compartments (red). Ribosomes are modeled in gold and microtubules are bright-green. Εκκριτικό Μονοπατι: Επανασύσταση από Τοµογραφίες ΗΜ

50 Ανάδροµη κίνηση Golgi ER Οπως ήδη έγινε κατανοητό µια σειρά από πρωτεΐνες αποτελούν δοµικά στοιχεία είτε της µεµβράνης είτε του αυλού του ER. Οι πρωτεΐνες αυτές θα πρέπει να µπορούν να επιστρέψουν πίσω στο ER να τυχόν παρασυρθούν λόγω της αυθόρµητης ροής προς το Golgi, ενώ κάποιες άλλες πρέπει να µεταφερθούν στο Golgi προκειµένου να γλυκοζυλιωθούν και στη συνέχεια να επιστρέψουν εκεί όπου είναι λειτουργικές (ER). Η διαλογή αυτή επιτυγχάνεται µέσω µιας σειράς ειδικών πεπτιδικών σινιάλων που υπάρχουν στις πρωτεϊνες που αποτελούν π.χ. µόνιµα συστατικά του αυλού του ER. Το πιο κοινό από αυτά τα σινιάλα είναι σινιάλο Lys-Asp-Glu-Leu (KDEL) που εντοπίζεται στο C-άκρο των περισσοτέρων πρωτεϊνών του αυλού του ER (όπως π.χ. της PDI ή της Hsc70) ή κάποιες άλλες παρόµοιες αλληλουχίες.

51 ΜΗΧΑΝΙΣΜΟΣ ΙΑΚΡΑΤΗΣΗΣ ΠΡΩΤΕΪΝΩΝ ΤΟΥ ER (Ο ΥΠΟ ΟΧΕΑΣ KDEL) πρωτεΐνη προς έκκριση υποδοχέας για πρωτεΐνη του ER (ειδικός για την aκολουθία KDEL) πρωτεΐνη του ER µονοπάτι εµπρόσθιας κίνησης µονοπάτι επιστροφής CGN δεξαµενές Golgi TGN Ο µηχανισµός που χρησιµοποιείται προκειµένου να επιστρέψουν οι δοµικές πρωτεΐνες του ER από το Golgi, περιλαµβάνει κυστιδιακή µεταφορά µέσω των κυστιδίων COPI και έναν ειδικό υποδoχέα (αναγνωρίζει την ακολουθία KDEL) που βρίσκεται σε µεγάλες ποσότητες στο ER και στη cis δεξαµενή του Golgi (αν και έχει βρεθεί σε µικρές ποσότητες και στις υπόλοιπες δεξαµενές του Golgi). Οι ιονικές συνθήκες στο ER αποδεσµεύουν τον υποδοχέα από το φορτίο και έτσι αυτός επιστρέφει στο cis-golgi προκειµένου να επαναχρησιµοποιηθεί.

52 Στόχευση των δοµικών πρωτεϊνών του λυσοσώµατος σαν αποτέλεσµα διαλογής στο TGN (µονοπάτι 8). Ένα επιπλέον µονοπάτι που καταλήγει στα λυσοσώµατα αφορά τη διαδικασία της ενδοκύττωσης (στικτή γραµµή). ΛΥΣΟΣΩΜΑ ΛΥΣΟΣΩΜΑ 8

53 Στόχευση και µεταφορά των δοµικών πρωτεϊνών του λυσοσώµατος Τα λυσοσώµατα είναι µεµβρανικοί σάκκοι υδρολυτικών ενζύµων που υπάρχουν σε όλα τα ευκαρυωτικά κύτταρα (όπως βρέθηκε µετά από κυτταροχηµική χρώση όξινης φωσφατάσης) και χρησιµεύουν στην ελεγχόµενη αποδόµηση µακροµορίων αν και γενικά είναι εξαιρετικά ετερογενή οργανίδια. Περιέχουν περίπου 40 διαφορετικά υδρολυτικά ένζυµα όλα από τα οποία είναι όξινες υδρολάσες και στα οποία περιλαµβάνονται πρωτεάσες, νουκλεάσες, γλυκοσιδάσες λιπάσες, φωσφολιπάσες φωσφατάσες και σουλφατάσες. Το βέλτιστο ph για την ενεργότητα των ενζύµων αυτών είναι γύρω στο 5 και διατηρείται στο λυσόσωµα µέσω µιας αντλίας Η + στη µεµβράνη του. Ετσι εκτός από τη µεµβράνη που προστατεύει το κυττοσόλιο από τα λυσοσωµικά ένζυµα, τυχόν διαφυγή ενζύµων κατά τη µεταφορά τους προς το λυσόσωµα από το TGN ή από το ίδιο το οργανίδιο δεν θα προκαλέσει µεγάλη βλάβη αφού τα ένζυµα αυτά έιναι σχετικά ανενεργά στο ph ~7.2 του κυττοσολίου. Οι πιο πολλές µεµβρανικές πρωτεϊνες του λυσοσώµατος είναι πολύ γλυκοζυλιωµένες κάτι που µάλλον χρησιµεύει σαν προστασία από τις υδρολάσσες του αυλού.

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ Ιωάννης Π. Τρουγκάκος Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας, Παν/μιο Αθηνών ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ ΚΥΤΤΟΣΟΛΙΟ ΠΥΡΗΝΑΣ ΥΠΕΡΟΞΕΙΣΩΜΑΤΑ

Διαβάστε περισσότερα

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ Ιωάννης Π. Τρουγκάκος Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας, Παν/μιο Αθηνών ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ ΟΡΓΑΝΩΣΗ ΖΩΪΚΟΥ ΚΥΤΤΑΡΟΥ

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ Σε ποιες κατηγορίες κατατάσσονται οι ορµόνες µε βάση τη χηµική τους φύση. Αναφέρετε από ένα παράδειγµα Περιγράψτε πως γίνεται η επικοινωνία των κυττάρων µε µηνυµατοφόρα

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ(

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΗ ΣΧΟΛΗ ΑΓΡΙΝΙΟΥ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΕΤΟΣ ΣΠΟΥΔΩΝ 1ο Ζωολογία Δ. Ματθόπουλος 1 ΥΠΕΥΘΥΝΟΙ Από έδρας Δ. Ματθόπουλος Ζωολογία Δ. Ματθόπουλος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

ΙV. Το ευκαρυωτικό κύτταρο. Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός

ΙV. Το ευκαρυωτικό κύτταρο. Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός ΙV. Το ευκαρυωτικό κύτταρο Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός Ευ-καρυωτικοί = εμπύρηνα κύτταρα, με υψηλή οργάνωση και διαμερισματοποίηση 1 ευκ. κύτταρο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2015 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Λέξεις-κλειδιά Κυτταρική ή πλασματική μεμβράνη... Βασικές ιδιότητες της πλασματικής μεμβράνης... Βασικές λειτουργίες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης.

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. (α) Να ονομάσετε τα

Διαβάστε περισσότερα

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά.

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Στον πεπτικό σωλήνα πραγματοποιείται ο τεμαχισμός της τροφής

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Κατιόν µαγνησίουmg 2+ εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Θρέψη Φυτών. Μπουράνης, Σ. Χωριανοπούλου 1 Επίπεδο Μg για κανονική αύξηση 0,15 0,35% ή60 140 µmol Mg gξμ -1 ΤοMgκινείταιστοΞΑΣκαιστοΗΑΣ HΑΣ100

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Λ. Χ. Μαργαρίτης, Β. Κ. Γαλανόπουλος, Κ. Ε. Κεραμάρης, Ε. Σ. Μαρίνος, Σ. Παπασιδέρη, Δ. Ι. Στραβοπόδης, Ι. Π.

ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Λ. Χ. Μαργαρίτης, Β. Κ. Γαλανόπουλος, Κ. Ε. Κεραμάρης, Ε. Σ. Μαρίνος, Σ. Παπασιδέρη, Δ. Ι. Στραβοπόδης, Ι. Π. ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Λ. Χ. Μαργαρίτης, Β. Κ. Γαλανόπουλος, Κ. Ε. Κεραμάρης, Ε. Σ. Μαρίνος, Σ. Παπασιδέρη, Δ. Ι. Στραβοπόδης, Ι. Π. Τρουγκάκος ISBN 960-372-077-1 ΠΕΡΙΕΧΟΜΕΝΑ ΚΕΦΑΛΑΙΟ 1 ΠΡΟΕΛΕΥΣΗ ΚΑΙ ΕΞΕΛΙΞΗ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ Η νευρομυϊκή σύναψη αποτελεί ιδιαίτερη μορφή σύναψης μεταξύ του κινητικού νευρώνα και της σκελετικής μυϊκής ίνας Είναι ορατή με το οπτικό μικροσκόπιο Στην

Διαβάστε περισσότερα

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος.

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος. Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ Αρχιτομία Αγενής αναπαραγωγή Παρατομία Εκβλάστηση Εγγενής αναπαραγωγή Απλοφασικός κύκλος Διπλοφασικός κύκλος Ισογαμία Ανισογαμία Ωογαμία Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Οξείδωση της γλυκόζης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Καταβολισµός ή ανοµοίωση» C 6 H 12 O+6O 2 +6H 2 O 12H 2 O+6CO 2 +686 Kcal/mol Πηγές ενέργειας κατά την

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος MOPIAKH BIOΛOΓIA ΦAPMAKEYTIKHΣ ΔIAΛEΞΕΙΣ 10-12 Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος (Πως γίνονται αντιληπτά τα μηνύματα και πως δίδονται οι απαντήσεις) Δρ. Xρήστος Παναγιωτίδης, Tµήµα Φαρµακευτικής

Διαβάστε περισσότερα

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2010 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Η κυτταρική ή πλασματική μεμβράνη αποτελεί το εξωτερικό όριο του κυττάρου από το περιβάλλον και περικλείει

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr EΞΕΤΑΣΤΕΑ ΥΛΗ: ΕΝΟΤΗΤΑ 8: Η ελευθέρωση της ενέργειας, σελ. 155-168 ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η κυτταρική αναπνοή είναι η διαδικασία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΟΡΓΑΝΙΔΙΑ ΜΕΤΑΤΡΟΠΗΣ ΚΑΙ ΑΠΟΙΚΟΔΟΜΗΣΗΣ ΒΙΟΜΟΡΙΩΝ: Υπεροξυσώματα - Λυσοσώματα

ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΟΡΓΑΝΙΔΙΑ ΜΕΤΑΤΡΟΠΗΣ ΚΑΙ ΑΠΟΙΚΟΔΟΜΗΣΗΣ ΒΙΟΜΟΡΙΩΝ: Υπεροξυσώματα - Λυσοσώματα ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΟΡΓΑΝΙΔΙΑ ΜΕΤΑΤΡΟΠΗΣ ΚΑΙ ΑΠΟΙΚΟΔΟΜΗΣΗΣ ΒΙΟΜΟΡΙΩΝ: Υπεροξυσώματα - Λυσοσώματα Μαριάννα Χ. Αντωνέλου, Ph.D. Λέκτορας Τμήματος Βιολογίας, Πανεπιστημίου Αθηνών 2014 YΠΕΡΟΞΥΣΩΜΑΤΑ Συμμετέχουν

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο;

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο; Μεταβολισμός των υδατανθράκων κατά την άσκηση Μεταβολισμός του γλυκογόνου Το γλυκογόνο είναι ο αφθονότερος υδατάνθρακας των ζώων Το γλυκογόνο αποθηκεύεται κυρίως στο ήπαρ (3-7% κατά βάρος) και στους μύες

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα