Διερεύνηςη γενετικήσ ποικιλότητασ, ταυτοποίηςη και εφαρμογή λειτουργικών δεικτών ςτην κεραςιά (Prunus avium L.)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Διερεύνηςη γενετικήσ ποικιλότητασ, ταυτοποίηςη και εφαρμογή λειτουργικών δεικτών ςτην κεραςιά (Prunus avium L.)"

Transcript

1 Διερεύνηςη γενετικήσ ποικιλότητασ, ταυτοποίηςη και εφαρμογή λειτουργικών δεικτών ςτην κεραςιά (Prunus avium L.) Γανόπουλοσ Ιωάννθσ Διδακτορικι Διατριβι Θεσσαλονίκη,

2 ΑΡΗΣΟΣΔΛΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΓΔΩΠΟΝΗΑ, ΓΑΟΛΟΓΗΑ ΚΑΗ ΦΤΗΚΟΤ ΠΔΡΗΒΑΛΛΟΝΣΟ Δπηβιέπσλ Καζεγεηήο Σζαπηάξεο Αζαλάζηνο Καζεγεηήο Μέιε πκβνπιεπηηθήο Δπηηξνπήο Αξαβαλφπνπινο Φίιηππνο Καζεγεηήο Σζηξάθνγινπ Βαζίιεηνο Δπίθνπξνο Καζεγεηήο H παξνχζα έξεπλα έρεη ζπγρξεκαηνδνηεζεί απφ ηελ Δπξσπατθή Έλσζε (Δπξσπατθφ Κνηλσληθφ Σακείν - ΔΚΣ) θαη απφ εζληθνχο πφξνπο κέζσ ηνπ Δπηρεηξεζηαθνχ Πξνγξάκκαηνο «Δθπαίδεπζε θαη Γηα Βίνπ Μάζεζε» ηνπ Δζληθνχ ηξαηεγηθνχ Πιαηζίνπ Αλαθνξάο (ΔΠΑ) Δξεπλεηηθφ Υξεκαηνδνηνχκελν Έξγν: Ηξάθιεηηνο ΙΙ. Δπέλδπζε ζηελ θνηλσλία ηεο γλψζεο κέζσ ηνπ Δπξσπατθνχ Κνηλσληθνχ Σακείνπ. 2

3 ΑΡΗΣΟΣΔΛΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΓΔΩΠΟΝΗΑ, ΓΑΟΛΟΓΗΑ ΚΑΗ ΦΤΗΚΟΤ ΠΔΡΗΒΑΛΛΟΝΣΟ ΔΠΣΑΜΔΛΖ ΔΞΔΣΑΣΗΚΖ ΔΠΗΣΡΟΠΖ Δπηθνπξνο Καζεγεηήο Πνιύδσξνο Αιέμηνο (αληηθαηέζηεζε ζηηο 31/05/13 ηνλ θαζ. Σζαπηάξε Αζαλάζην) Καζεγεηήο Αξαβαλόπνπινο Φίιηππνο Δπηθνπξνο Καζεγεηήο Σζηξάθνγινπ Βαζίιεηνο Καζεγήηξηα Κνύηζηθα-σηεξίνπ Μεηαμία Δπίθνπξνο Καζεγήηξηα Νηάληνπ-Οκπετληάη Δηξήλε Δξεπλεηήο Β βαζκίδαο Αξγπξίνπ Αλαγλώζηεο Δξεπλεηήο Γ βαζκίδαο Μαδέζεο Παλαγηώηεο 3

4 Ισάλλεο Γαλφπνπινο Α.Π.Θ. ΓΗΔΡΔΤΝΖΖ ΓΔΝΔΣΗΚΖ ΠΟΗΚΗΛΟΣΖΣΑ, ΣΑΤΣΟΠΟΗΖΖ ΚΑΗ ΔΦΑΡΜΟΓΖ ΛΔΗΣΟΤΡΓΗΚΩΝ ΓΔΗΚΣΩΝ ΣΖΝ ΚΔΡΑΗΑ (PRUNUS AVIUM L.) ISBN Ηκεξνκελία πξνθνξηθήο εμέηαζεο 29 Οθησβξίνπ 2013 «Η έγθξηζε ηεο παξνύζαο δηδαθηνξηθήο δηαηξηβήο από ηε Σρνιή Γεσπνλίαο, Γαζνινγίαο θαη Φπζηθνύ Πεξηβάιινληνο ηνπ Αξηζηνηειείνπ Παλεπηζηεκίνπ Θεζζαινλίθεο δελ ππνδειώλεη απνδνρή ησλ γλσκώλ ηνπ ζπγγξαθέσο» (Ν. 5343/1932 άξζξν 202, παξ. 2) 4

5 .Αθηεξσκέλν ζηνπο γνλείο κνπ Βαζίιε θαη Θενδψξα θαη ζηε κνλάθξηβε αδεξθή κνπ Μαξία... 5

6 Δπραξηζηίεο Θα ήζεια λα επραξηζηήζσ ηνλ επηβιέπνληα θαζεγεηή κνπ θ. Αζαλάζην Σζαπηάξε γηα ηελ αλάζεζε ηνπ ζέκαηνο, ηηο ππνδείμεηο θαη ηε βνήζεηα πνπ κνπ πξφζθεξε θαηά ηε δηάξθεηα ησλ δηδαθηνξηθψλ κνπ ζπνπδψλ θαζψο θαη γηα ηελ επθαηξία πνπ κνπ έδσζε λα εξγαζηψ σο ππνςήθηνο Γηδάθηνξαο ζην Δξγαζηήξην Γελεηηθήο θαη Βειηίσζεο ησλ Φπηψλ θαη ζην Ιλζηηηνχην Δθαξκνζκέλσλ Βηνεπηζηεκψλ (ΙΝΔΒ) ηνπ Δζληθνχ Κέληξνπ Έξεπλαο θαη Σερλνινγηθήο Αλάπηπμεο (ΔΚΔΣΑ). Δπίζεο ζα ήζεια λα επραξηζηήζσ ηδηαίηεξα ηνπο επηβιέπνληεο θαζεγεηέο κνπ θ. Φίιηππν Αξαβαλφπνπιν θαη θ. Αιέμε Πνιχδσξα γηα ηελ πνιχηηκε θαζνδήγεζε ηνπο ζε φιε ηελ δηάξθεηα ησλ δηδαθηνξηθψλ κνπ ζπνπδψλ. Δπηπιένλ επραξηζηψ ζεξκά ηα κέιε ηεο επηακεινχο επηηξνπήο γηα ηελ θξηηηθή αλάγλσζε θαη ηηο δηνξζψζεηο ηνπ θεηκέλνπ. Ιδηαηηέξσο ζα ήζεια λα επραξηζηήζσ ηνλ θ. Παλαγηψηε Μαδέζε, εξεπλεηή ηνπ ΙΝΔΒ, ηνλ θ. Κσλζηαληίλν Παζέληζε, ηερληθφ επηζηήκνλα ηνπ INΔΒ θαη ηνλ εξεπλεηή ηνπ ΔΘΙΑΓΔ Απφζηνιν Καιχβα γηα ηελ πνιχηηκε βνήζεηά ηνπο ζηα ζέκαηα κνξηαθήο βηνινγίαο θαηά ηε δηάξθεηα ηεο δηδαθηνξηθήο εξγαζίαο. Δπίζεο ζα ήζεια λα επραξηζηήζσ φια ηα κέιε ηνπ INΔΒ γηα ηελ πνιχ θαιή ζπλεξγαζία θαη ηε βνήζεηά ηνπο ζε θάζε δπζθνιία. Δπίζεο ζα ήζεια λα επραξηζηήζσ ην Ιλζηηηνχην Φπιινβφισλ Γέλδξσλ (ΔΘΙΑΓΔ) θαη ηδηαηηέξσο ηνλ θ. Καδάληδε Κσλζηαληίλν γηα ηελ πνιχηηκε ζπλεξγαζία ηνπο θαη ηε βνήζεηά ηνπο. Αθφκε ζα ήζεια λα επραξηζηήζσ ζεξκά ηελ ζχληξνθν κνπ Αιίθε Ξαλζνπνχινπ θαη ηνλ αδεξθηθφ κνπ θίιν Αξηζηείδε Ισαλλίδε γηα ηελ εζηθή ππνζηήξημε ζε φιε ηε δηάξθεηα ηεο δηδαθηνξηθήο δηαηξηβήο. Σέινο επραξηζηψ ηελ νηθνγέλεηά κνπ γηα ηελ νηθνλνκηθή θαη ηελ εζηθή ππνζηήξημή πνπ κνπ πξφζθεξαλ θαζ φιε ηε δηάξθεηα ηεο εθπφλεζεο ηεο Γηδαθηνξηθήο κνπ Γηαηξηβήο. H παξνχζα έξεπλα έρεη ζπγρξεκαηνδνηεζεί απφ ηελ Δπξσπατθή Έλσζε (Δπξσπατθφ Κνηλσληθφ Σακείν - ΔΚΣ) θαη απφ εζληθνχο πφξνπο κέζσ ηνπ Δπηρεηξεζηαθνχ Πξνγξάκκαηνο «Δθπαίδεπζε θαη Γηα Βίνπ Μάζεζε» ηνπ Δζληθνχ ηξαηεγηθνχ Πιαηζίνπ Αλαθνξάο (ΔΠΑ) Δξεπλεηηθφ Υξεκαηνδνηνχκελν Έξγν: Ηξάθιεηηνο ΙΙ. Δπέλδπζε ζηελ θνηλσλία ηεο γλψζεο κέζσ ηνπ Δπξσπατθνχ Κνηλσληθνχ Σακείνπ. 6

7 Πεξηερόκελα Δπραξηζηίεο... 6 Απόδνζε αγγιηθήο νξνινγίαο Σπληκήζεηο Πεξίιεςε Abstract Κεθάιαην 1: Γεληθή Δηζαγσγή Σθνπόο Βηβιηνγξαθηθή αλαζθόπεζε Καηαγσγή ηεο θεξαζηάο Κεξαζηά (Prunus avium L.) - Βνηαληθή ηαμηλόκεζε Βνηαληθνί ραξαθηήξεο ηνπ είδνπο P. avium Τύπνη δεηθηώλ Μνξθνινγηθνί δείθηεο Βηνρεκηθνί Γείθηεο Μνξηαθνί δείθηεο Δθαξκνγέο ησλ κνξηαθώλ δεηθηώλ Πνιπκνξθηζκόο Μεγέζνπο Πεξηνξηζηηθώλ Σκεκάησλ DNA (RFLP) Σπραίν Δληζρπκέλν Πνιπκνξθηθό DNA (RAPD) Πνιπκνξθηζκόο Μήθνπο εληζρπκέλσλ Σκεκάησλ (AFLP) Μηθξνδνξπθόξνη ή Απιέο Δπαλαιακβαλόκελεο Αιιεινπρίεο (SSR) Πνιπκνξθηζκνί Μεηαμύ Δπαλαιακβαλόκελσλ Αιιεινπρηώλ (ISSR) Λεηηνπξγηθνί ή εληνπηζκέλνη ζε γνλίδηα κνξηαθνί δείθηεο Κισλνπνηεκέλεο Αιιεινπρίεο σο Μνξηαθνί δείθηεο (STS, EST, SSCP, SNP) SNPs Λεηηνπξγηθή πνηθηιόηεηα ύγθξηζε ιεηηνπξγηθώλ (GMMs) θαη νπδέηεξσλ (RDMs) κνξηαθώλ δεηθηώλ ύγθξηζε θακππιώλ ηήμεο ζε πςειή αλάιπζε (HRM) Πνιπκνξθηζκνί αιιεινκόξθσλ γακεηνθπηηθνύ απηναζπκβίβαζηνπ Πνηθηιόηεηα S-αιιεινκόξθσλ Βηβιηνγξαθία Κεθάιαην 2: Υιηθά θαη Μέζνδνη

8 2.1 Φπηηθό γελεηηθό πιηθό Αλάιπζε ησλ θπζηνινγηθώλ θαη κνξθνινγηθώλ ραξαθηεξηζηηθώλ Δθρύιηζε θαη απνκόλσζε DNA Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο (PCR) γηα ηελ αλάιπζε κε ηνπο SSR θαη ISSR κνξηαθνύο δείθηεο Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο (PCR) γηα ηελ αλάιπζε κε ηνπο ιεηηνπξγηθνύο κνξηαθνύο δείθηεο ηνπ γνληδίνπ ηεο SRNάζεο Αλάιπζε HRM ησλ κνξηαθώλ δεηθηώλ SSR θαη SNP Μνξηαθή ζηαηηζηηθή αλάιπζε Βηβιηνγξαθία Κεθάιαην 3: Μνξηαθή κειέηε ηεο γελεηηθήο πνηθηιόηεηαο ηεο αγξηνθεξαζηάο ζηα λόηηα όξηα εμάπισζεο ηνπο κε κηθξνδνξπθνξηθνύο δείθηεο Δηζαγσγή Δπηκέξνπο Υιηθά θαη Μέζνδνη Απνηειέζκαηα Δλδνπιεζπζκηαθή γελεηηθή πνηθηιόηεηα Γελεηηθή πνηθηιόηεηα κεηαμύ ησλ πιεζπζκώλ Σπδήηεζε Δλδνπιεζπζκηαθή γελεηηθή πνηθηιόηεηα Γελεηηθή πνηθηιόηεηα κεηαμύ ησλ πιεζπζκώλ Γξαζηηθό κέγεζνο πιεζπζκνύ, γελεηηθή εθηξνπή, γνληδηαθή ξνή θαη δηεξεύλεζε πιεζπζκώλ ππό γελεηηθή ζηελσπό Γεληθή ζπδήηεζε θαη ζπκπεξάζκαηα Βηβιηνγξαθία Κεθάιαην 4: Γνληδησκαηηθή πνηθηιόηεηα ησλ S-αιιεινκόξθσλ ζηελ αγξηνθεξαζηά (Prunus avium L.) Δηζαγσγή Δπηκέξνπο Υιηθά θαη Μέζνδνη Απνηειέζκαηα θαη ζπδήηεζε Ζ θαηαλνκή ζπρλνηήησλ ησλ S-αιιεινκόξθσλ ζε άγξηνπο πιεζπζκνύο θεξαζηάο Ζ γελεηηθή πνηθηιόηεηα θαη ε νπδεηεξόηεηα ησλ δεηθηώλ Ζ γελεηηθή δνκή θαη ε ξνή ησλ γνληδίσλ Σπκπεξάζκαηα Βηβιηνγξαθία

9 Κεθάιαην 5: Γελεηηθή πνηθηιόηεηα θαη κνξηαθόο ραξαθηεξηζκόο ησλ Διιεληθώλ πνηθηιηώλ θαιιηεξγνύκελεο θεξαζηάο Δηζαγσγή Δπηκέξνπο Υιηθά θαη Μέζνδνη Μνξηαθόο ραξαθηεξηζκόο θαη αμηνιόγεζε ηεο γελεηηθήο πνηθηινκνξθίαο κε δείθηεο βαζηζκέλνπο ζε κηθξνδνξπθόξνπο (SSR/ISSR) Φπινγελεηηθέο ζπγθξίζεηο ησλ SSR θαη ISSR δεηθηώλ Γελεηηθή δνκή ηεο ζπιινγήο Τξάπεδαο Γελεηηθνύ Υιηθνύ κε SSR θαη ISSR δείθηεο Σπκπεξάζκαηα Βηβιηνγξαθία Κεθάιαην 6: Πξνζδηνξηζκόο ησλ απηναζπκβίβαζησλ γελνηύπσλ ζε 21 θαιιηεξγνύκελεο πνηθηιίεο θεξαζηάο ζηελ Διιάδα θαη νη επηπηώζεηο ζηελ θαιιηέξγεηα ηνπ θεξαζεώλα Δηζαγσγή Απνηειέζκαηα θαη ζπδήηεζε Καηαλνκή ησλ S-RNase αιιεινκόξθσλ κεηαμύ ησλ ειιεληθώλ παξαδνζηαθώλ θαιιηεξγνύκελσλ πνηθηιηώλ θεξαζηάο S-γελνηύπεζε ησλ ειιεληθώλ παξαδνζηαθώλ πνηθηιηώλ θεξαζηάο Σπκβαηόηεηα κεηαμύ ησλ πνηθηιηώλ ζηελ ίδηα πεξίνδν αλζνθνξίαο Βηβιηνγξαθία Κεθάιαην 7: Μνξηαθή αλάιπζε ηεο άγξηαο θεξαζηάο θαη ε ζύγθξηζε ηεο κε ηελ θαιιηεξγνύκελε: άγξηα από ηε θύζε ηεο ή πνηθηιίεο πνπ δηέθπγαλ από θεξαζεώλεο; Δηζαγσγή Δπηκέξνπο Υιηθά θαη Μέζνδνη Απνηειέζκαηα Σπδήηεζε Βηβιηνγξαθία Κεθάιαην 8: HRM αλάιπζε γηα ηελ ηαπηνπνίεζε ησλ θαιιηεξγνύκελσλ πνηθηιηώλ θεξαζηάο κε εληνπηζκέλνπο ζε γνλίδηα κνξηαθνύο δείθηεο SNP Δπηκέξνπο Τιηθά θαη Μέζνδνη Απνηειέζκαηα θαη ζπδήηεζε πκπεξάζκαηα Βηβιηνγξαθία Κεθάιαην 9: Μνξηαθή ηαπηνπνίεζε ππνθεηκέλσλ ηεο θαιιηεξγνύκελεο θεξαζηάο κε HRM αλάιπζε κηθξνδνξπθνξηθώλ ζέζεσλ (SSR-HRM) Δηζαγσγή

10 9.2 Απνηειέζκαηα Σπδήηεζε Βηβιηνγξαθία Κεθάιαην 10: Σπζρεηίζεηο κε ραξαθηεξηζηηθά ηνπ θαξπνύ ηεο θαιιηεξγνύκελεο θεξαζηάο ρξεζηκνπνηώληαο κνξηαθνύο θαη κνξθν-θπζηνινγηθνύο δείθηεο Δηζαγσγή Δπηκέξνπο Υιηθά θαη Μέζνδνη Σπζρεηίζεηο πνζνηηθώλ ραξαθηεξηζηηθώλ θαη κνξηαθώλ δεηθηώλ Απνηειέζκαηα θαη ζπδήηεζε Αλάιπζε ησλ κνξθν-θπζηνινγηθώλ ραξαθηεξηζηηθώλ SSR θαη ISSR δείθηεο πνπ ζρεηίδνληαη κε ηα ραξαθηεξηζηηθά ηνπ θαξπνύ κέζσ ηεο MRA αλάιπζεο Σπκπεξάζκαηα Βηβιηνγξαθία Κεθάιαην 11: Έιεγρνο απζεληηθόηεηαο ηεο Πξνζηαηεπόκελεο Ολνκαζίαο Πξνέιεπζεο (ΠΟΠ) πνηθηιίαο θεξαζηάο Τξαγαλά Δδέζζεο κε SSR-HRM αλάιπζε Δηζαγσγή Απνηειέζκαηα θαη ζπδήηεζε SSR αλάιπζε κε ειεθηξνθόξεζε κε ηξηρνεηδή (SSR-CE) SSR-HRM αλάιπζε Βηβιηνγξαθία Κεθάιαην 12: Τειηθά Σπκπεξάζκαηα Γεκνζηεύζεηο από ηε Γηδαθηνξηθή Γηαηξηβή Καηάινγνο ινγηζκηθώλ πνπ ρξεζηκνπνηήζεθαλ Παξάξηεκα I

11 Απόδνζε αγγιηθήο νξνινγίαο χκθσλα κε ηα ιεμηθά ηεο Διιεληθήο Δπηζηεκνληθήο Δηαηξίαο Γελεηηθήο Βειηίσζεο Σσλ Φπηψλ (Γαιαλνπνχινπ θ.ά. 1994), Λεμηθφ Βηνινγηθψλ Καη Ιαηξηθψλ ξσλ (Παηαξγηάο θ.ά. 1992) θαη Elsevier s Dictionary of Medicine and Biology (Konstantinidis 2005). Accession Number = Αξηζκφο Καηαρψξεζεο Bottleneck = γελεηηθή ζηελσπφο Genetic drift = γελεηηθή εθηξνπή Gene bank = γελεηηθή ηξάπεδα δεδνκέλσλ Loci = γνληδηαθέο ζέζεηο Microsatellites = κηθξνδνξπθφξνη Southern blot hybridization = Τβξηδηζκφο ηχπνπ Southern πληκήζεηο ABA = Abscisic acid = Ακπζηζηθφ νμχ AFLPs = Amplified fragment length polymorphisms = Πνιιαπιαζηαζκφο Πνιπκνξθηθψλ Σκεκάησλ DNA εθ Πεξηνξηζκνχ ASOH = Allele-specific oligonucleotide hybridization BLAST = Basic Local Alignment Statistical Tool = Δξγαιείν Έξεπλαο Βαζηθήο Σνπηθήο Δπζπγξάκκηζεο BSA = Bulked Segregant Analysis = Αλάιπζε Γηαρσξηζκνχ Μεγέζνπο CAPS = Cleaved Amplified Polymorphic Sequencs = Πέςε Δληζρπφκελσλ Πνιπκνξθηθψλ Αιιεινπρηψλ CCM = Chemical Cleavage of Mismatches = Υεκηθή πέςε ιάζνο δεπγαξσκάησλ C.I. = Confidence Interval = ξηα εκπηζηνζχλεο cdna = Complementary DNA = ζπκπιεξσκαηηθφ DNA 11

12 COSs = Conserved Homologues Sequences = πληεξεκέλεο Οξζφινγεο Αιιεινπρίεο CTAB = Cetyl Trimethyl Ammonium Bromide = βξσκηνχρν αθεηπινηξηκεζπιακκψλην DFMs = Direct Functional Markers = Άκεζνη ιεηηνπξγηθνί δείθηεο dntps = deoxynucleotide triphosphates = Σξηθσζθνξηθά δενμπλνπθιενηίδηα EMC = Enzyme Mismatch Cleavage = Δλδπκηθή πέςε ιάζνο δεπγαξψκαηνο EST= Expressed Sequence Tag = Αλαγλσξηζηηθή εθθξαζκέλε αθνινπζία FMs = Functional markers = Λεηηνπξγηθνί δείθηεο gdna= genomic DNA = γνληδησκαηηθφ DNA HRM analysis = High Resolution Melting analysis = χγθξηζε θακππιψλ ηήμεο ζε πςειή αλάιπζε GMMs = Genic Molecular Markers = Γνληδηαθνί κνξηαθνί δείθηεο GTMs = Gene Targeted Markers = Γείθηεο γνληδηαθήο ζηφρεπζεο IAM model = Infinite Allele Model = Πξφηππν απείξσλ αιιεινκφξθσλ IFMs = Indirect Functional Markers = Έκκεζνη ιεηηνπξγηθνί δείθηεο ISSRs = Inter-Simple Sequence Repeats = Μεηαμχ-Απιψλ Δπαλαιακβαλφκελσλ Αιιεινπρηψλ ITDs = Internal Tandem Duplications = Γηαδνρηθνί εζσηεξηθνί δηπιαζηαζκνί LD = Linkage Disequilibrium = αληζνξξνπία ζχλδεζεο MAS = Marker Assistant Selection = επηινγή βνεζνχκελε απφ κνξηαθνχο δείθηεο mirna = Micro RNA NFDS= Negative Frequency-Dependent Selection=αξλεηηθή επηινγή εμαξηψκελε απφ ηε ζπρλφηεηα NILs = Near Isogenic Lines = θαζαξέο ηζνγνληθέο ζεηξέο NJ= Neighbor-Joining QTL = Quantitative trait locus = γνληδηαθέο ζέζεηο πνζνηηθψλ ραξαθηήξσλ PCA = Principal Component Analysis = Αλάιπζε θπξίσλ ζπληζησζψλ PCOORDA or PCoA = Principal Coordinate analysis = Αλάιπζε θπξίσλ ζπληεηαγκέλσλ PCR = Polymerase Chain Reaction = Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο PFam = Protein Families = Οηθνγέλεηεο Πξσηετλψλ 12

13 PIC = Polymorphism Information Content = πεξηερφκελε πιεξνθνξία πνιπκνξθηζκνχ RAPD = Random Amplified Polymorphic DNA = Σπραίν εληζρπκέλν πνιπκνξθηθφ DNA RDMs= Random DNA Markers = Σπραίνη δείθηεο DNA RIL = recombinant inbreed lines = Αλαζπλδπαζκέλεο θαζαξέο ζεηξέο RLFP = Restriction Fragment Length Polymorphism = Πνιπκνξθηζκφο Μήθνπο Θξαπζκάησλ εθ Πεξηνξηζκνχ RKN = Root-knot nematodes = Κνκβνλεκαηψδεο ηεο ξίδαο RNA = Ribonucleic Acid = Ρηβνλνπθιετθφ νμχ RT-PCR = Reverse Transcription PCR = Αληίζηξνθεο Μεηαγξαθήο Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο SCAR = Sequence Characterized Amplified Region = Υαξαθηεξηζκέλεο αιιεινπρίεο Δληζρπφκελσλ Πεξηνρψλ SMM model: stepwise-mutational model = πξφηππν ζηαδηαθψλ-κεηαιιάμεσλ SNP = Single Nucleotide Polymorphism = Μνλνλνπθιενηηδηθφο πνιπκνξθηζκφο SRAP= Sequence-Related Amplified Polymorphism = εληζρπκέλε πνιπκνξθηζκνί ζρεηηθψλ αιιεινπρηψλ SSCP = Single-Stranded Conformation Polymorphism = Πνιπκνξθηζκφο κνλφθισλεο Γηακφξθσζεο SSRs = Simple Sequence Repeats = Απιέο Δπαλαιακβαλφκελεο Αιιεινπρίεο STRs = Short Tandem Repeats = χληνκεο δηαδνρηθέο επαλαιήςεηο STS = Sequence Tagged Site = Θέζεηο επηζεκαζκέλεο αιιεινχρηζεο TPM model = two-phase model = Γηθαζηθφ πξφηππν UPGMA = Unweighted Pair Group Method with Arithmetic Mean 13

14 14

15 Πεξίιεςε Η αγξηνθεξαζηά (Prunus avium L.) είλαη έλα επξέσο δηαδεδνκέλν, επγελέο πιαηχθπιιν επξσπατθφ είδνο πνπ ραξαθηεξίδεηαη απφ ηελ δηάζπαξηε θαηαλνκή, ην κηθξφ κέγεζνο πιεζπζκνχ θαη ηελ αλζξσπνγελή εθκεηάιιεπζε γηα ηελ πνιχηηκε θαη αλζεθηηθή μπιεία ηνπ. Απηά ηα ραξαθηεξηζηηθά, εηδηθά ζηα λφηηα φξηα ηεο θπζηθήο εμάπισζεο ηνπ είδνπο, φπνπ κπνξεί λα πθίζηαληαη πνηθίιεο πξφζζεηεο πεξηβαιινληηθέο πηέζεηο, θαζηζηνχλ ηνπο πιεζπζκνχο ηνπ P. avium επηξξεπείο ζε πηζαλά ζηνραζηηθά, γελεηηθά θαη δεκνγξαθηθά γεγνλφηα. ηελ παξνχζα κειέηε, ρξεζηκνπνηήζεθαλ θπξίαξρνη ISSR θαη ζπγθπξίαξρνη SSR δείθηεο γηα λα δηεξεπλεζεί ε γελεηηθή δνκή ηνπ P. avium. Πέληε πιεζπζκνί απφ ηε βφξεηα Διιάδα αμηνινγήζεθαλ κε βάζε 46 ISSR θαη 11 SSR γνληδηαθέο ζέζεηο. Σν απηναζπκβίβαζην, έλα θνηλφ ραξαθηεξηζηηθφ ηεο αλάπηπμεο ησλ θπηψλ, είλαη έλα θιαζζηθφ παξάδεηγκα ηεο εμηζνξξνπεηηθήο επηινγήο ζε θπζηθνχο πιεζπζκνχο, ηδηαίηεξα ηεο αξλεηηθήο επηινγήο ηεο εμαξηψκελεο απφ ηελ ζπρλφηεηα. χκθσλα κε ηελ εμαξηψκελε απφ ηε γνληδηαθή ζπρλφηεηα αξλεηηθή επηινγή, ε γελεηηθή ζεσξία πξνβιέπεη φηη ε S-γνληδηαθή ζέζε, πνπ ειέγρεη ην απηναζπκβίβαζην εκπεξηέρεη πνιιά αιιειφκνξθα ζε ηζνκεξείο ζπρλφηεηεο πνπ απνδεηθλχνπλ έλα επξχ θάζκα αιιεινκφξθσλ. Δπηπιένλ, παξφιν πνπ νη θπζηθνί πιεζπζκνί εκθαλίδνπλ πςειφηεξε εληφο ηνπ πιεζπζκνχ γελεηηθή πνηθηιφηεηα, αλακέλεηαη κείσζε ζηελ δηαθνξνπνίεζε ηνπ πιεζπζκνχ θαη αχμεζε ηνπ δξαζηηθνχ ξπζκνχ κεηαλάζηεπζεο. Δξεπλήζεθαλ νη ζπρλφηεηεο ησλ αιιεινκφξθσλ φζνλ αθνξά ηε θαηαλνκή ηνπο θαη ηελ γελεηηθή δνκή ηνπο, ζηελ γνληδηαθή ζέζε πνπ ειέγρεη ην γακεηνθπηηθφ απηναζπκβίβαζην, ζε πέληε πιεζπζκνχο αγξηνθεξαζηάο (Prunus avium L.). Δπίζεο, έγηλαλ ζπγθξίζεηο κεηαμχ ηεο δηαθνξνπνίεζεο ηεο S-γελεηηθήο ζέζεο θαη ησλ SSR γνληδηαθψλ ζέζεσλ. Γεθαελληά ειιεληθέο παξαδνζηαθέο πνηθηιίεο θαιιηεξγνχκελεο θεξαζηάο θαζψο θαη δχν δηεζλείο πνηθηιίεο πνπ ρξεζηκνπνηήζεθαλ σο κάξηπξεο ραξαθηεξίζηεθαλ ρξεζηκνπνηψληαο δεθαπέληε SSR θαη δέθα ISSR κνξηαθνχο δείθηεο. Δπηπιένλ, πξνζδηνξίζηεθαλ νη γελφηππνη ησλ S-αιιεινκφξθσλ απφ 21 πνηθηιίεο θεξαζηάο ζπκπεξηιακβαλνκέλσλ θαη 19 πνπ δελ έρνπλ γελνηππεζεί αιιά θαιιηεξγνχληαη επξέσο ζηελ Διιάδα, κε βάζε ηα S-RNase γνληδηαθά πξντφληα ηνπο θαζψο θαη ηε ρξήζε ηεο PCR αλάιπζεο. Δπίζεο δηαθξίζεθαλ νθηψ δηαθνξεηηθά S-αιιειφκνξθα ζε δέθα ζπλδπαζκνχο. Σέζζεξα αιιειφκνξθα, ηα S 1, S 3, S 4, θαη S 9 ήηαλ επξέσο δηαδεδνκέλα θαη ζπκκεηείραλ ζην 85% ησλ S-απιφηππσλ. πλεπψο, πνιινί απφ ηνπο ζπλδπαζκνχο πνηθηιηψλ ήηαλ εκη- 15

16 ζπκβαηνί. ηελ Διιάδα, ε εκη-ζπκβαηφηεηα θάλεθε λα ζπζρεηίδεηαη κε ρακειέο απνδφζεηο. Ωζηφζν, ε δηαζηαχξσζε ηνπ πβξηδίνπ Σξαγάλα Δδέζζεο κε άγλσζηε πνηθηιία (S 3 S 13 ) θαη ε πνηθηιία Καςηψηηθα (S 2 S 5 ) πεξηέρνπλ ζπάληνπο S-απιφηππνπο θαη σο εθ ηνχηνπ είλαη πιήξσο ζπκβαηέο κε ηηο πεξηζζφηεξεο απφ ηηο πνηθηιίεο πνπ αλαιχζεθαλ. Υξεζηκνπνηήζεθαλ 9 γνληδηαθέο ζέζεηο SSR γηα ηελ αλάιπζε ηεο γελεηηθήο πνηθηιφηεηαο ζε 93 άηνκα άγξηαο θαη 21 άηνκα θαιιηεξγνχκελεο θεξαζηάο πνπ αληηπξνζσπεχνπλ ην ηνπηθφ γελεηηθφ πιηθφ. Σα απνηειέζκαηα έδεημαλ ζεκαληηθή κείσζε ησλ γελεηηθψλ παξακέηξσλ ζην θαιιηεξγνχκελν γελεηηθφ πιηθφ ζε ζχγθξηζε κε ηνπο θπζηθνχο πιεζπζκνχο. Οη ηξείο δηαθνξεηηθέο βην-ζηαηηζηηθέο πξνζεγγίζεηο (αλάιπζε θαηά Bayes, αλάιπζε κε βάζε ηε ζπρλφηεηα αιιεινκφξθσλ θαη MCMC) ησλ δεδνκέλσλ ηεο κνξηαθήο γελεηηθήο αλάιπζεο έδεημαλ φηη ε νκάδα ησλ αηφκσλ ηεο αγξηνθεξαζηάο είλαη γελεηηθά δηαθνξνπνηεκέλε απφ ηελ νκάδα ησλ θαιιηεξγνχκελσλ πνηθηιηψλ θάηη πνπ ζπλεπάγεηαη φηη ε ξνή γνληδίσλ κεηαμχ ησλ δχν ηχπσλ πιεζπζκψλ είλαη αζήκαληε. Πεξηγξάθεθε ε εθαξκνγή ηεο χγθξηζεο Κακππιψλ Σήμεο ζε Τςειή αλάιπζε (HRM), πνπ είλαη κηα πξφζθαηε ελίζρπζε ζηελ παξαδνζηαθή αλάιπζε ηήμεο DNA κε ζθνπφ ηνλ ραξαθηεξηζκφ ησλ πξντφλησλ ηεο Aιπζηδσηήο Aληίδξαζεο Πνιπκεξάζεο (PCR) θαη ηνλ εληνπηζκφ ελλέα εληνπηζκέλσλ ζε γνλίδηα κνξηαθψλ δεηθηψλ SNP γηα ηε δηάθξηζε ησλ θπξηφηεξσλ ειιεληθψλ πνηθηιηψλ θαιιηεξγνχκελεο θεξαζηάο. Η ηθαλφηεηα ηεο HRM λα δηαθξίλεη κε αθξίβεηα δηαθνξέο λνπθιενηηδίσλ ζε κηα αιιεινπρία DNA ηελ θαζηζηά κηα πην απνηειεζκαηηθή, ελαιιαθηηθή ιχζε σο πξνο ην θφζηνο θαη ηνλ ρξφλν ζε ζρέζε κε ηελ παξαδνζηαθή αλάιπζε αιιεινχρεζεο γηα ηελ αλίρλεπζε SNPs πνπ πεξηέρνληαη ζε γνλίδηα. Πξαγκαηνπνηήζεθε ε κνξηαθή ηαπηνπνίεζε ησλ πεξηζζφηεξν δηαδεδνκέλσλ ππνθεηκέλσλ θαιιηεξγνχκελεο θεξαζηάο ηνπ ειιαδηθνχ ρψξνπ κε HRM αλάιπζε πέληε κηθξνδνξπθνξηθψλ ζέζεσλ (SSR-HRM). Οη πέληε γελεηηθέο ζέζεηο πνπ ρξεζηκνπνηήζεθαλ είραλ ζεκαληηθή πιεξνθνξηνδνηηθή ηθαλφηεηα θαη δεκηνπξγήζεθε έλα κνλαδηθφ πξνθίι θακππιψλ ηήμεο γηα θάζε απφ ηα έμη ππνθείκελα. πγθεθξηκέλα, θάλνληαο ρξήζε ελφο κφλν κνξηαθνχ δείθηε (BPPCT002) θαηέζηε δπλαηφο ν δηαρσξηζκφο θαη ησλ έμη ππφ κειέηε ππνθεηκέλσλ θεξαζηάο, αλαδεηθλχνληαο ηελ ελδερφκελε ρξήζε ηνπ ζηελ αλαγλψξηζε ησλ ππνθεηκέλσλ. Γεκηνπξγήζεθε κηα κέζνδνο κε βάζε ηνπο κηθξνδνξπθνξηθνχο δείθηεο γηα λα δηαθξίλεη ηηο πνηθηιίεο θεξαζηάο ψζηε λα πηζηνπνηεζεί ε πξνζηαηεπφκελε νλνκαζία πξνέιεπζεο (ΠΟΠ) Σξαγαλά Δδέζζεο ζην επίπεδν ηεο πνηθηιίαο, αιιά θαη ζηα κεηαπνηεκέλα πξντφληα ζηελ θεξαζηά. Γνθηκάζηεθαλ δεθαηξείο κηθξνδνξπθνξηθνί δείθηεο θαη ν ζπλδπαζκφο ησλ, πνπ ραξαθηεξίδεηαη απφ πςειφ 16

17 πνιπκνξθηζκφ θαη απιά ειεθηξνθνξεηηθά πξφηππα, επέηξεςε ηελ δηάθξηζε θαη ηνλ πξνζδηνξηζκφ κηαο ΠΟΠ πνηθηιίαο θεξαζηάο ε νπνία ρξεζηκνπνηείηαη γηα παξαγσγή πξντφλησλ. Abstract Wild cherry (Prunus avium L.) is a widespread, partially asexual, noble hardwood European species characterized by a scattered distribution, small population sizes and human exploitation for its valuable wood. These characteristics, especially at the southern limits of the species natural distribution where additional varying stresses may occur render P. avium populations prone to potential stochastic, genetic and demographic events. In this study, we used dominant inter simple sequence repeats (ISSR) and co-dominant simple sequence repeats (SSR) markers to infer the genetic structure of P. avium. Five populations from northern Greece were evaluated based on 46 ISSR and 11 SSR loci. Allelic frequencies were investigated in terms of distribution and genetic structure at the gametophytic self-incompatibility locus in five wild cherry (Prunus avium L.) populations. Comparisons were also made between the differentiation at the S-locus and at the SSR loci. Theoretical expectations under balancing selection were congruent to the results observed. Nineteen Greek traditional sweet cherry cultivars and two international cultivars, which were used as controls, were grown in Greece and characterized for seventeen morphophysiological traits, fifteen Simple Sequence Repeat (SSR) loci and ten Inter Simple Sequence Repeat (ISSR) markers. The S allele genotypes of 21 sweet cherry cultivars widely grown in Greece, including 19 not previously genotyped, were determined based on their S-RNase gene products and using PCR analysis. Eight different S alleles in ten combinations, were distinguished and two new incompatibility groups were documented. Comparison of wild cherry populations and sweet cherry cultivars showed a significant reduction of genetic diversity parameters in the cultivated germplasm compared to natural populations. Bayesian, frequency-based and MCMC analyses have revealed that the wild and cultivar groups are genetically divergent and that realized between-group gene flow is almost completely absent. The application of High-Resolution-Melting (HRM) described a recent enhancement to traditional DNA melting analysis for the characterization of polymerase chain reaction products and the identification of nine gene based SNPs for distinguishing the main Greek sweet cherry cultivars. Sweet cherries can be grafted on a 17

18 wide range of rootstocks belonging to genus Prunus. High Resolution Melting (HRM) analysis, coupled with five SSR markers in order to facilitate the identification of the most popular sweet cherry rootstocks in Greece. The five SSR loci used were highly informative and generated a unique melting curve profile of microsatellites for each of the six rootstocks tested. In particular, one marker, BPPCT002, with six HRM profiles was sufficient to discriminate all sweet cherry rootstocks studied. Finally, thirteen microsatellites were tested and the combination of the amplification profiles of six of them, characterised by high polymorphism and simple electrophoretic patterns, enabled to distinguish and identify a PDO sweet cherry cultivar used for sweet cherry products. 18

19 Κεθάιαην 1: Γεληθή Δηζαγσγή Ο φξνο γελεηηθή πνηθηιόηεηα αλαθέξεηαη ζηε δηαθνξνπνίεζε ηνπ γελεηηθνχ πιηθνχ κεηαμχ ησλ αηφκσλ ηνπ ίδηνπ είδνπο θαη θαιχπηεη ηε γνληδηαθή πνηθηιία (δηαθνξνπνίεζε ζηα πνζνζηά ησλ γνληδηαθψλ αιιεινκφξθσλ) κεηαμχ ησλ πιεζπζκψλ ηνπ ίδηνπ είδνπο ή/θαη ηε γνληδηαθή πνηθηιία (πνηθηιία γνληδηαθψλ αιιεινκφξθσλ) κεηαμχ ησλ αηφκσλ ηνπ ίδηνπ πιεζπζκνχ (Δηθφλα 1.1). Η γελεηηθή πνηθηιφηεηα εθθξάδεη ην εχξνο ησλ θιεξνλνκηθψλ θαηαβνιψλ ελφο ζπγθεθξηκέλνπ είδνπο. ζν κεγαιχηεξν είλαη ην εχξνο απηφ, ηφζν κεγαιχηεξε είλαη ε ηθαλφηεηα επηβίσζεο ηνπ είδνπο απέλαληη ζε εμσηεξηθέο πηέζεηο φπσο επηδεκίεο, θιηκαηηθέο αληημνφηεηεο θ.ιπ. Δίλαη απηνλφεην φηη νη θπζηθνί πιεζπζκνί έρνπλ πνιχ κεγαιχηεξν εχξνο θιεξνλνκηθψλ θαηαβνιψλ θαη ζπλεπψο πνιχ κεγαιχηεξε αληνρή θαη ηθαλφηεηα επηβίσζεο απφ ηηο "ηερλεηά" ή γελεηηθά βειηησκέλεο πνηθηιίεο (Νηάθεο θ.ά. 1997). Η εθηίκεζε ηεο γελεηηθήο πνηθηιφηεηαο απνηειεί ζεκαληηθή παξάκεηξν ζηηο γελεηηθέο κειέηεο, ζηε κειέηε ηεο βηνπνηθηιφηεηαο, ζηνλ ραξαθηεξηζκφ ηνπ γελεηηθνχ πιηθνχ θαη ζηε δεκηνπξγία γελεηηθήο πνηθηιφηεηαο κε ζθνπφ ηε βειηίσζε ησλ θπηψλ. Δπηπιένλ, ε εθηίκεζε ηεο γελεηηθήο πνηθηιφηεηαο είλαη ζεκαληηθή θαη γηα ηελ επηινγή ησλ επηζπκεηψλ γελνηχπσλ. Σν γεγνλφο φηη πςειά πνζά γελεηηθήο πνηθηιφηεηαο δελ εθθξάδνληαη ζην θαηλφηππν θαζηζηά πξνθαλέο φηη λέεο κέζνδνη ζα πξέπεη λα αλαπηπρζνχλ γηα λα εθηηκεζεί ζσζηά θαη λα ρξεζηκνπνηεζεί απηή ε γλψζε ππέξ ελφο πξνγξάκκαηνο βειηίσζεο. Πξφζθαηα, ιφγσ ηεο κεγάιεο πξνφδνπ πνπ έρεη ζεκεησζεί ζηε κνξηαθή γελεηηθή, ε γελεηηθή πνηθηιφηεηα κπνξεί λα κεηξεζεί ζε επίπεδν DNA κε ηελ αλάπηπμε δηάθνξσλ κνξηαθψλ δεηθηψλ (Madesis θ.ά. 2013). Δμαηηίαο ηεο γεσγξαθηθήο ζέζεο θαη ηεο ζπλχπαξμεο ρισξηδηθψλ πεξηνρψλ φπσο είλαη ε Μεζνγεηαθή, ε Δπξσπατθή (Δπξαζηαηηθή) θαη ε Ιξαλνθαζπηθή (πνληηθή), ε βηνπνηθηιφηεηα ηεο Διιάδαο είλαη, αλαινγηθά κε ηελ έθηαζή ηεο, απφ ηηο πινπζηφηεξεο ηεο Δπξψπεο κε πεξηζζφηεξα απφ είδε θαη ππνείδε (πεξίπνπ taxa) θαλεξφγακσλ θπηψλ. Η νξενγξαθηθή δηακφξθσζε θαη ε ηνπνγξαθηθή εηεξνγέλεηα, ζε ζπλδπαζκφ κε ηελ πεξηπεηεηψδε γεσινγηθή ηεο ηζηνξία θαη ηελ παξάιιειε δεκηνπξγία πιήζνπο βηνηφπσλ, 19

20 έρνπλ ζπληειέζεη ζην κεγάιν ρισξηδηθφ πινχην θαη ζην πςειφ πνζνζηφ ελδεκηζκνχ ησλ θπηηθψλ εηδψλ ηεο Διιάδαο. Σέινο, ζα πξέπεη λα αλαθεξζεί φηη απφ απηά ηα θπηηθέο ηαμηλνκηθέο νκάδεο, ηα 263 ζεσξνχληαη σο ζπάληα θαη απεηινχκελα, ζχκθσλα κε ην δεκνζηεπκέλν Κφθθηλν Βηβιίν ησλ ζπάλησλ θαη απεηινχκελσλ εηδψλ θπηψλ. Δηθόλα 1.1: Παξάδεηγκα γελεηηθήο πνηθηιόηεηαο κηαο γεσγξαθηθήο ηνπνζεζίαο κεηά από αλάιπζε κε κνξηαθνύο δείθηεο. Η Διιάδα ινηπφλ πέξαλ ηνπ φηη απνηειεί έλα απφ ηα πην ζεκαληηθά θέληξα βηνπνηθηιφηεηαο ζηελ Δπξψπε, ηαπηφρξνλα απνηειεί ην ζεκαληηθφηεξν θέληξν ελδεκηζκνχ ζηελ Δπξψπε θαη ηε Μεζφγεην. Η δηαηήξεζε θαη ε ρξήζε ησλ θπηηθψλ γελεηηθψλ πφξσλ είλαη απαξαίηεηεο γηα ηελ ζπλερή ζπληήξεζε θαη βειηίσζε ηεο αγξνηηθήο παξαγσγήο θαη επηπιένλ ζηελ αεηθφξν αλάπηπμε πνπ κπνξεί λα νδεγήζεη θαη ζηελ άκβιπλζε ηεο θηψρεηαο. Σν θπζηθφ πεξηβάιινλ έραζε πνιχ γξήγνξα κεγάιν θνκκάηη ηεο βηνπνηθηιφηεηάο ηνπο. Δηδηθά ζηε γεσξγία, ην κεγαιχηεξν κέξνο ηνπ ηνπηθνχ γελεηηθνχ πιηθνχ εθηνπίζζεθε ηαρχηαηα απφ ηελ παξαγσγηθή δηαδηθαζία σο ιηγφηεξν αληαγσληζηηθφ θαη ζχληνκα ράζεθε νξηζηηθά. Μηθξφ κφλν κέξνο ηνπ δηαζψδεηαη αθφκε ζήκεξα ζε νξηαθέο νξεηλέο θνηλφηεηεο απφ κηθξφ αξηζκφ ππεξειίθσλ γεσξγψλ πνπ αθφκε θαιιηεξγνχλ ηηο κε αληαγσληζηηθέο ηνπηθέο πνηθηιίεο ζε πείζκα ησλ θαηξψλ, ζεσξψληαο ηεο θνκκάηη ηεο γεσξγηθήο παξάδνζεο θαη ηνπ γεσξγηθνχ πνιηηηζκνχ ηνπ ηφπνπ ηνπο θαη πξφζθαηα απφ νκάδα βηνθαιιηεξγεηψλ πνπ νξγαλψλνπλ εηήζηεο ζπλάμεηο αληαιιαγήο ληφπησλ (θάηη πνπ γίλεηαη φκσο αλεμέιεγθηα) πνηθηιηψλ εηήζησλ θχξηα θπηψλ. ήκεξα φκσο ν θίλδπλνο απψιεηαο ηνπ ληφπηνπ γελεηηθνχ πιηθνχ γίλεηαη αληηιεπηφο, φρη κφλν απφ ηελ επηζηεκνληθή θνηλφηεηα, αιιά θαη απφ ηνλ απιφ πνιίηε. Οη θπηνγελεηηθνί πφξνη θαη ε 20

21 γεσξγηθή βηνπνηθηιφηεηα γεληθφηεξα, παξακειεκέλε θαη απεηινχκελε κε εμαθάληζε ζην πξφζθαην παξειζφλ, απνθηά ζηηο κέξεο καο φιν θαη κεγαιχηεξε ζηξαηεγηθή αμία. Απνηειεί ην ζεκέιην γηα ηε δηαζθάιηζε ηεο δηαηξνθήο ησλ αλζξψπσλ θαη ησλ δψσλ θαη ηελ πξψηε χιε γηα ηε δεκηνπξγία ησλ ζχγρξνλσλ πνηθηιηψλ ηεο αληαγσληζηηθήο γεσξγίαο ηνπ κέιινληνο, κε δεδνκέλεο ηηο επαλαζηαηηθέο δπλαηφηεηεο πνπ δίλεη ε θαιπάδνπζα ζήκεξα γελεηηθή επηζηήκε. Η ειιεληθή γεσξγία δηέξρεηαη κηα θξίζηκε θακπή, ε νπνία έρεη επεξεαζζεί πνιχ ζνβαξά απφ ην δηεζλέο θαη ην επξσπατθφ πεξηβάιινλ. ην δηεζλέο επίπεδν νη ζπλζήθεο ηνπ Παγθφζκηνπ Οξγαληζκνχ Δκπνξίνπ (ΠΟΔ) θαη ζην επξσπατθφ ε αλακνξθσκέλε Κνηλή Αγξνηηθή Πνιηηηθή (ΚΑΠ) δεκηνχξγεζαλ πξνβιήκαηα ζηελ αληαγσληζηηθφηεηα ησλ αγξνηηθψλ πξντφλησλ. Δπίζεο, νη θαηαλαισηηθέο νξγαλψζεηο απαίηεζαλ θαη νδήγεζαλ ζηελ βειηίσζε ησλ κεζφδσλ παξαγσγήο γηα παξαγσγή αζθαιψλ, πγηεηλψλ θαη πςειήο πνηφηεηαο πξντφλησλ, πνπ παξάγνληαη θάησ απφ ζπλζήθεο πξνζηαζίαο ηνπ πεξηβάιινληνο. Η αγξνηηθή παξαγσγή απαηηεί, ζήκεξα, ρξήζε θαηλνηφκσλ ηερλνινγηψλ θαη ηερληθψλ θαιιηέξγεηαο θαζψο θαη πηνζέηεζε ελαιιαθηηθψλ θαιιηεξγεηψλ πξνθεηκέλνπ λα θαηαζηεί αληαγσληζηηθή ζην δηεζλέο πεξηβάιινλ θαζψο κεξηθέο παξαδνζηαθέο θαιιηέξγεηεο πνπ επεθηάζεθαλ ηηο ηειεπηαίεο δεθαεηίεο (θπξίσο ιφγσ θνηλνηηθψλ επηδνηήζεσλ) δελ είλαη πιένλ νηθνλνκηθά βηψζηκεο. ηνλ θιάδν ησλ νπσξνθεπεπηηθψλ, λέεο, μεληθέο ζηε ζπληξηπηηθή ηνπο πιεηνςεθία πνηθηιίεο (πβξίδηα), επεθηείλνληαη σο ελαιιαθηηθέο θαιιηέξγεηεο ρσξίο, σζηφζν, λα έρεη κειεηεζεί ε πξνζαξκνζηηθφηεηα απηψλ ζην ηνπηθφ κηθξνθιίκα ηεο ρψξαο καο, ελψ ε αληαγσληζηηθφηεηά ηνπο είλαη κηθξή θαζψο ππάξρνπλ νκνεηδή πξντφληα ζε φιν ηνλ θφζκν. Σέηνηεο θαιιηέξγεηεο πξνβάιινληαη σο λέν κνληέιν αγξνηηθήο παξαγσγήο κε ιακπξφ κέιινλ γηα πξντφληα πςειήο δηαηξνθηθήο αμίαο πνπ ζα απνθέξνπλ εηζφδεκα ζηνλ Έιιελα παξαγσγφ πνπ δηαζέηεη κηθξέο εθηάζεηο φπσο ζπκβαίλεη ζηε ρψξα καο ζε εκηνξεηλέο θαη νξεηλέο πεξηνρέο. Η αληαγσληζηηθφηεηα κηαο πεξηνρήο βαζίδεηαη ζηελ θαηλνηνκία θαη θαιή ζπλεξγαζία ησλ ηθαλψλ γηα παξαγσγή γλψζεο θνξέσλ. Η ζχλδεζε παξαδνζηαθψλ ηερληθψλ ή πξντφλησλ κε ηελ θαηλνηνκία κπνξνχλ λα δεκηνπξγήζνπλ εκπνξηθά δηαθνξνπνηεκέλα πξντφληα θαη ηηο θαηάιιειεο βάζεηο γηα ηελ νηθνλνκηθή αλάπηπμε κηαο πεξηνρήο. Ιδηαίηεξα ζηηο νξεηλέο-εκηνξεηλέο πεξηνρέο νη δπλαηφηεηεο είλαη πεξηνξηζκέλεο θαη φπνηα παξέκβαζε κπνξεί λα βειηηψζεη ηελ νηθνλνκία ηεο πεξηνρήο θαη επνκέλσο ην επίπεδν δηαβίσζεο ησλ θαηνίθσλ ηεο είλαη πςειήο ζεκαζίαο γηα ηε ρψξα. 21

22 Ο κνξηαθφο ραξαθηεξηζκφο εκβνιίσλ θαη ππνθεηκέλσλ ησλ νπνξσθφξσλ δέληξσλ είλαη απαξαίηεηνο γηα ηνπο βειηησηέο νπνξσθφξσλ, γηα ηηο ηξάπεδεο γελεηηθνχ πιηθνχ θαη γηα εκπνξηθνχο ηνκείο π.ρ θπηψξηα. Δπεηδή ηα πεξηζζφηεξα νπνξσθφξα δέληξα αλαπαξάγνληαη βιαζηηθά, ε ηαπηνπνίεζε ησλ γελνηχπσλ επηηξέπεη ηελ αλάπηπμε ελφο πξνηχπνπ αλαθνξάο έηζη ψζηε λα είλαη δπλαηή ε ηαπηνπνίεζε νπνηαζδήπνηε πνηθηιίαο θαη ηνλ έιεγρν ηεο αλαπαξαγσγήο ηνπο, αλεμαξηήησο απφ νπνηνπζδήπνηε παξάγνληεο πνπ κπνξνχλ λα πεξηνξίζνπλ ή λα επεξεάζνπλ ηνλ θαηλφηππν, φπσο ην πεξηβάιινλ, ε επνρή ή ειηθία ηνπ δέληξνπ. Δπηπιένλ, ε δπλαηφηεηα κειέηεο ηεο γελεηηθήο παξαιιαθηηθφηεηαο κεηαμχ δηαθνξεηηθψλ πνηθηιηψλ θαη πιεζπζκψλ, ζα σθειήζεη ηα πξνγξάκκαηα βειηίσζεο ησλ δέλδξσλ βνεζψληαο ηνπο βειηησηέο λα πάξνπλ απνθάζεηο γηα ηνπο πξνγνληθνχο γελνηχπνπο ησλ δηαζηαπξψζεσλ θαη ηε δηαρείξηζε ηνπ γελεηηθνχ πιηθνχ γηα ηε κεγηζηνπνίεζε ηεο ππάξρνπζαο παξαιιαθηηθφηεηαο. Σν γεγνλφο απηφ είλαη επίζεο ζεκαληηθφ γηα ηε δηαηήξεζε ηεο ππάξρνπζαο πνηθηιφηεηαο ζηα άγξηα είδε ηεο ίδηαο πεξηνρήο πνπ είλαη δηαζθνξπηζκέλα ζε φιε ηελ έθηαζε ησλ πεξηζζφηεξσλ Δπξσπατθψλ θαη νξηζκέλσλ Αζηαηηθψλ ρσξψλ, εηδηθά εμαηηίαο ηεο πξννδεπηηθήο ζπξξίθλσζεο ηεο γελεηηθήο βάζεο. θνπόο Ο ζθνπόο ηεο παξνχζαο δηδαθηνξηθήο δηαηξηβήο είλαη ν ραξαθηεξηζκφο ησλ θπζηθψλ πιεζπζκψλ αγξηνθεξαζηάο θαη ησλ θαιιηεξγνχκελσλ πνηθηιηψλ θεξαζηάο ηνπ ειιαδηθνχ ρψξνπ κε νπδέηεξνπο (neutral) θαη ιεηηνπξγηθνύο (functional) κνξηαθνχο δείθηεο γηα ηελ νξζνινγηθνπνίεζε θαη αχμεζε ηεο παξαγσγήο θαη ηελ δηαηώληζε ηεο ζην κέιινλ ππφ ην πξίζκα ηεο θιηκαηηθήο κεηαβνιήο. Οη επηκέξνπο ζθνπνί είλαη: (1) ε ζπιινγή γελεηηθνχ πιηθνχ απφ νθζαικνχο, άλζε, θχιια θαη θαξπνχο φισλ ησλ Διιεληθψλ πνηθηιηψλ θεξαζηάο (Prunus avium L.) (2) ε κειέηε ηεο γελεηηθήο πνηθηιόηεηαο κεηαμχ ησλ πνηθηιηψλ θαη αληηπξνζσπεπηηθψλ πιεζπζκψλ ηνπ ειιαδηθνχ ρψξνπ κε ρξήζε κνξηαθψλ γελεηηθψλ δεηθηψλ, ε κειέηε ηεο γελεηηθήο πνηθηιφηεηαο θαη ηεο πιεζπζκηαθήο δνκήο θπζηθψλ πιεζπζκψλ θεξαζηάο αληηπξνζσπεπηηθψλ ηεο εμάπισζεο ηνπ είδνπο ζηελ Διιάδα θαη ε ηαπηνπνίεζε θαη ν κνξηαθφο ραξαθηεξηζκφο θάζε πνηθηιίαο θεξαζηάο κε ρξήζε κνξηαθψλ δεηθηψλ SSR (Απιέο Δπαλαιακβαλφκελεο Αιιεινπρίεο) θαη I-SSR (Μεηαμχ Απιψλ Δπαλαιακβαλφκελσλ Αιιεινπρηψλ) θαη ε δηεξεχλεζε ησλ γελεηηθψλ νκνηνηήησλ κεηαμχ ησλ εμεηαδφκελσλ γελνηχπσλ, (3) ε κνξηαθή ηαπηνπνίεζε ησλ θπξηφηεξσλ ππνθεηκέλσλ θεξαζηάο κε ηε ρξήζε 22

23 κηθξνδνξπθνξηθψλ δεηθηψλ (4) ε κειέηε ιεηηνπξγηθώλ γνληδίσλ θαη ε εθαξκνγή ιεηηνπξγηθώλ δεηθηώλ θαη ζπγθεθξηκέλα ε ηαπηνπνίεζε ησλ S-αιιεινκόξθσλ ησλ ειιεληθψλ πνηθηιηψλ θαη ν δηαρσξηζκφο ησλ πνηθηιηψλ ζε νκάδεο κε βάζε ηνλ ηχπν ηνπ S- αιιεινκφξθνπ πξνθεηκέλνπ λα βειηηζηνπνηεζεί ε δηαρείξηζε θαη ε απνδνηηθφηεηα ησλ Διιεληθψλ νπσξψλσλ, (5) ε κειέηε ηεο ιεηηνπξγηθήο πνηθηιόηεηαο ησλ θπζηθψλ πιεζπζκψλ αγξηνθεξαζηάο θαη (6) ε εμεξεχλεζε θαη έιεγρνο ζε επίπεδν πνηθηιφηεηαο απιψλ λνπθιενηηδηθψλ πνιπκνξθηζκψλ (SNP) γνληδίσλ πνπ ζπλδένληαη κε βηνηηθέο θαη αβηνηηθέο θαηαπνλήζεηο. Βηβιηνγξαθηθή αλαζθόπεζε Καηαγσγή ηεο θεξαζηάο Οη αξραίνη Έιιελεο πίζηεπαλ φηη πξνεξρφηαλ απφ ηε Μηθξά Αζία θαη πην ζπγθεθξηκέλα απφ ηελ πφιε ηεο Κεξαζνχληαο (εμ νπ θαη ην φλνκα) ζηελ Αλαηνιία ηεο ζεκεξηλήο Σνπξθίαο, θνληά ζηε Mαχξε Θάιαζζα. χκθσλα κε κηα άιιε εθδνρή ην φλνκα ηεο θεξαζηάο πξνέξρεηαη απφ ηε ιέμε θεξαία, εμαηηίαο ηεο νξζφθιαδεο δηακφξθσζεο ηνπ δέλδξνπ. Ο Θεφθξαζηνο, ν αξραίνο ηζηνξηθφο πνπ θαηέγξαςε ηα είδε ησλ θπηψλ, αλαθέξεη φηη ε θεξαζηά επδνθηκεί φπνπ θαη ε θηιχξα (θιακνπξηά) θαη πεξηέγξαςε ην θεξάζη σο έλα θξνχην ρξψκαηνο εξπζξνχ ην νπνίν έκνηαδε ζην ζρήκα κε δηφζππξν θαη ζην κέγεζνο κε θαζφιη. Η εηζαγσγή θαη θαιιηέξγεηα πνιιψλ πνηθηιηψλ εγθπκνλεί θηλδχλνπο γηα ην ζσζηφ εκπφξην θαη ηνχην δηφηη νη εθηάζεηο πνπ θαιιηεξγνχληαη κε θεξάζηα δελ είλαη πνιχ κεγάιεο θαη πξνθεηκέλνπ λα εμαζθαιηζηνχλ ζεκαληηθέο πνζφηεηεο γηα εκπνξία επηβάιιεηαη λα ππάξρνπλ ιίγεο πνηθηιίεο θαη λα σξηκάδνπλ δηαδνρηθά έηζη ψζηε λα κελ δεκηνπξγνχληαη αηρκέο πξνζθνξάο, αθελφο, θαη, αθεηέξνπ, λα ππάξρνπλ θεξάζηα ζηελ αγνξά απφ πνιχ λσξίο (Μάτν) σο θαη ην ηέινο ηνπ θαινθαηξηνχ. Η παξαγσγή θεξαζηψλ ζηελ Διιάδα αλέξρεηαη πεξί ηνπο ηφλνπο, πνιχ κηθξή ζπγθξηλφκελε κε απηή άιισλ ρσξψλ φπσο ηεο Ιηαιίαο ή ηεο γεηηνληθήο καο Σνπξθίαο θαη επνκέλσο πξνθεηκέλνπ λα είκαζηε εκπνξηθά αληαγσληζηηθνί απφ άπνςε πνζνηήησλ πξέπεη λα επηθεληξψζνπκε ηελ παξαγσγή ζε ιίγεο θαη θαιέο πνηθηιίεο. Γηα ηνπο ιφγνπο απηνχο είλαη αλαγθαίν λα πξνηηκεζνχλ απφ ηνπο θεξαζνπαξαγσγνχο πνηθηιίεο θαιά πξνζαξκνζκέλεο ζηηο εδαθνθιηκαηνινγηθέο ζπλζήθεο ηεο πεξηνρήο πνπ ζα θαιιηεξγεζνχλ. 23

24 Η θαιιηέξγεηα ηεο θεξαζηάο ζεσξείηαη κηα απφ ηηο πιένλ δπλακηθέο δελδξνθνκηθέο θαιιηέξγεηεο θαη ηνχην δηφηη εμάγνληαη ζεκαληηθέο πνζφηεηεο ( ηφλνη/έηνο) πνπ δελ θαιχπηνπλ ηελ παγθφζκηα αγνξά. Σν κέιινλ ηνπ θεξαζηνχ ζεσξείηαη επνίσλν θαη επνκέλσο θαιφ είλαη ε θαιιηέξγεηα λα επεθηαζεί ζε εκηνξεηλέο θαη νξεηλέο πεξηνρέο (θαη ε Διιάδα επηπρψο ή δπζηπρψο δηαζέηεη πάξα πνιιέο απφ απηέο), πεξηνρέο πνπ κπνξνχλ λα παξάγνπλ θαιήο πνηφηεηαο θεξάζη θαη ηαπηφρξνλα ζεσξνχληαη κεηνλεθηηθέο. Η πηζηνπνίεζε ησλ πνηθηιηψλ θεξαζηάο κπνξεί λα βνεζήζεη ηελ εκπνξία αθνχ ζα δψζεη πξνζηηζέκελε αμία ζην πξντφλ. Κεξαζηά (Prunus avium L.) - Βνηαληθή ηαμηλόκεζε Η θεξαζηά αλήθεη ζηελ νηθνγέλεηα Rosaceae (ππννηθνγέλεηα Prunoideae), ζην γέλνο Prunus L. θαη ζην ππνγέλνο Cerasus Pers. Oη θαιιηεξγνχκελεο πνηθηιίεο θαη ε άγξηα θεξαζηά αλήθνπλ ζην είδνο Prunus avium L. Δίλαη ζπλήζσο δηπινεηδήο (2n=16, n=8), αιιά έρνπλ βξεζεί θαη ηχπνη ηξηπινεηδείο (3n=24) θαη ηεηξαπινεηδείο (4n=32). Βνηαληθνί ραξαθηήξεο ηνπ είδνπο P. avium Η θεξαζηά είλαη δέληξν θπιινβφιν, κεγάινπ κεγέζνπο, κε βιάζηεζε ζπλήζσο νξζφθιαδε. Σα θύιια είλαη απιά, θαη ελαιιαγή, ειιεηςνεηδή, δηπιά νδνλησηά θαη αδελνθφξα. Οη νθζαικνί δηαθξίλνληαη ζε μπινθφξνπο θαη απινχο αλζνθφξνπο (Δηθφλα 1.2). Σα άλζε είλαη ιεπθά κε καθξχ πνδίζθν θαη παξάγνληαη πξηλ απφ ηελ έθπηπμε ησλ θχιισλ απφ απινχο αλζνθφξνπο νθζαικνχο. Κάζε άλζνο απνηειείηαη απφ πέληε ζέπαια, πέληε πέηαια, έλαλ χπεξν θαη πεξίπνπ ηξηάληα ζηήκνλεο (Δηθφλα 1.2). Ο χπεξνο απνηειείηαη απφ ηελ σνζήθε θαη έλα ζηχιν. Η σνζήθε είλαη πεξίγπλε, κνλφρσξε, κε δχν ζπεξκαηηθέο βιάζηεο, απφ ηηο νπνίεο γνληκνπνηείηαη ε κία, πνπ εμειίζζεηαη ζε ζπέξκα ηνπ θαξπνχ. 24

25 Δηθόλα 1.2: Άλζε θαη αλζνθόξνη νθζαικνί θεξαζηάο. Ο θαξπόο είλαη δξχπε θαη έρεη ζρήκα ζθαηξηθφ έσο θαξδηφζρεκν. Ο θινηφο είλαη ιεπηφο, κε ρξψκα θίηξηλν ή θφθθηλν ή καχξν. Η ζάξθα είλαη θίηξηλε έσο βαζπθφθθηλε, ηξαγαλή ή καιαθή, εθπχξελε ή εκηζππχξελε, κε γιπθηά γεχζε (Δηθφλα 1.3). Ο ππξήλαο είλαη ζθαηξηθφο έσο ειιεηςνεηδήο, ιείνο θαη δηαθξηηηθφο κνξθνινγηθά, ρξήζηκνο γηα ηε δηάθξηζε ησλ πνηθηιηψλ. Δηθόλα 1.3: Καξπόο θεξαζηάο. 25

26 Σύπνη δεηθηώλ Μνξθνινγηθνί δείθηεο Οη κνξθνινγηθνί δείθηεο απνηεινχλ ηνπο πξψηνπο δείθηεο πνπ ρξεζηκνπνηήζεθαλ. Σα κνξθνινγηθά γλσξίζκαηα πνπ έρνπλ παξαιιαθηηθφηεηα ραξηνγξαθνχληαη ζε έλα πιεζπζκφ, θαζνξίδεηαη ε ζχλδεζή ηνπο κε θάπνην επηζπκεηφ ή αλεπηζχκεην γλψξηζκα θαη πξαγκαηνπνηείηαη ε έκκεζε επηινγή ρξεζηκνπνηψληαο ην κνξθνινγηθφ δείθηε. Τπάξρνπλ σζηφζν, παξάγνληεο πνπ επεξεάδνπλ ηελ έθθξαζε ησλ κνξθνινγηθψλ δεηθηψλ. Ο πξψηνο έγθεηηαη ζηνλ κεγάιν βαζκφ εμάξηεζεο απφ ηνπο πεξηβαιινληηθνχο παξάγνληεο. πρλά νη ζπλζήθεο ζηηο νπνίεο αλαπηχζζεηαη έλα θπηφ είλαη δπλαηφ λα επεξεάδνπλ ηελ έθθξαζε ησλ κνξθνινγηθψλ δεηθηψλ θαη λα νδεγήζνπλ ζε ιαλζαζκέλα ζπκπεξάζκαηα. Γεχηεξνλ, ηα γλσξίζκαηα ζπρλά έρνπλ αλεπηζχκεηε εηθφλα φπσο ν λαληζκφο θαη αιβηληζκφο. Σέινο, ε πξαγκαηνπνίεζε βειηησηηθψλ πξνγξακκάησλ κε ηνπο ζπγθεθξηκέλνπο δείθηεο είλαη ρξνλνβφξα, απαηηεί ρεηξνλαθηηθή εξγαζία θαη ν κεγάινο πιεζπζκφο ησλ θπηψλ απαηηεί κεγάια πεηξακαηηθά ηεκάρηα θαη ζεξκνθήπηα γηα ηελ θαιιηέξγεηα ηνπο (Stuber θ.ά. 1999). Βηνρεκηθνί Γείθηεο Σα αιιεινέλδπκα (ηζνέλδπκα) είλαη παξαιιαθηηθφηεηεο ησλ ελδχκσλ πνπ θσδηθνπνηνχληαη απφ δνκηθά γνλίδηα. Σα έλδπκα είλαη πξσηεΐλεο πνπ ζπλίζηαληαη απφ ακηλνμέα, κεξηθά απφ ηα νπνία είλαη ειεθηξηθά θνξηηζκέλα (Δηθφλα 1.4). Απηφ έρεη σο απνηέιεζκα, ηα έλδπκα λα έρνπλ ειεθηξηθφ θνξηίν πνπ εμαξηάηαη απφ ηε ζχζηαζε ησλ ακηλνμέσλ πνπ απνηεινχλ ηελ πξσηεΐλε. ηαλ ζπκβεί κία κεηάιιαμε ζην DNA, πνπ νδεγεί ζηελ αληηθαηάζηαζε ελφο ακηλνμένο, είλαη πηζαλφλ ην ειεθηξηθφ θνξηίν ηεο πξσηεΐλεο λα ηξνπνπνηεζεί θαη ε δηακφξθσζε ηνπ κνξίνπ λα αιιάμεη. Οη κεηαβνιέο ηνπ ειεθηξηθνχ θνξηίνπ θαη ηεο δηακφξθσζεο κπνξνχλ λα επηθέξνπλ αιιαγέο ζην ξπζκφ κεηαθίλεζεο ησλ πξσηετλψλ ζε έλα ειεθηξηθφ πεδίν. Η παξαιιαθηηθφηεηα κπνξεί λα αληρλεπζεί κε ηελ ειεθηξνθφξεζε ζε πεθηή κε ηε ρξήζε εμεηδηθεπκέλσλ ελδπκηθψλ ρξψζεσλ πνπ πεξηέρνπλ ην ππφζηξσκα γηα ην έλδπκν, ζπκπαξαγφλησλ θαη ελφο νμεηδσκέλνπ άιαηνο. πλήζσο δχν ή πεξηζζφηεξεο γνληδηαθέο ζέζεηο κπνξνχλ λα δηαθξηζνχλ γηα έλα έλδπκν θαη απηέο θαινχληαη ηζφηνπνη. Γη απηφ ην ιφγν θαη ε παξαιιαθηηθφηεηα ησλ αιιεινελδχκσλ αλαθέξεηαη θαη σο παξαιιαθηηθφηεηα ηζνελδχκσλ. 26

27 Σν θχξην πιενλέθηεκα ησλ ηζνελδχκσλ είλαη ε απιφηεηα. Δπεηδή ε αλάιπζε ηνπο δελ απαηηεί ηελ απνκφλσζε DNA ή ηε δηαζεζηκφηεηα γλσζηψλ αιιεινπρηψλ, εθθηλεηψλ θαη ηρλειαηψλ, είλαη γξήγνξε θαη εχρξεζηε. Μεξηθά είδε, εληνχηνηο, κπνξνχλ λα απαηηήζνπλ ηδηαίηεξε βειηηζηνπνίεζε ησλ ηερληθψλ γηα νξηζκέλα έλδπκα. Οη απιέο αλαιπηηθέο δηαδηθαζίεο, επηηξέπνπλ ζε κεξηθά ηζνέλδπκα λα εθαξκνζηνχλ κε ζρεηηθά ρακειφηεξν θφζηνο, αλάινγα κε ην αληηδξαζηήξην ρξψζεο ηνπ ελδχκνπ πνπ ρξεζηκνπνηείηαη. Σν θχξην κεηνλέθηεκα ησλ ηζνελδχκσλ είλαη ν ζρεηηθά κηθξφο αξηζκφο ηνπο θαη ην ρακειφ επίπεδν πνιπκνξθηζκνχ ηνπο. Δπηπιένλ, νη πξσηεΐλεο κε ηελ ίδηα ειεθηξνθνξεηηθή θηλεηηθφηεηα (νκν-κεηαλάζηεπζε) κπνξνχλ λα κελ είλαη νκφινγεο γηα ζρεηηθά απνκαθξπζκέλα γνληδηψκαηα. Σα ηζνέλδπκα ζπρλά ζεσξνχληαη κνξηαθνί δείθηεο δεδνκέλνπ φηη αληηπξνζσπεχνπλ ελδπκηθέο παξαιιαγέο θαη ηα έλδπκα είλαη κφξηα πνπ αληαλαθινχλ ηνλ πνιπκνξθηζκφ πνπ ππάξρεη ζε επίπεδν DNA. Δληνχηνηο, ηα ηζνέλδπκα είλαη βηνρεκηθνί δείθηεο πνπ κνηάδνπλ ζηελ πξαγκαηηθφηεηα κε ηνπο θαηλνηππηθνχο δείθηεο, δεδνκέλνπ φηη κπνξνχλ λα επεξεαζηνχλ απφ ηηο πεξηβαιινληηθέο ζπλζήθεο. Γηα παξάδεηγκα, ην ζρέδην δσλψλ πνπ ιακβάλεηαη γηα ζπγθεθξηκέλν ηζνελδπκηθφ δείθηε κπνξεί λα αιιάμεη αλάινγα κε ηνλ ηχπν ηζηνχ πνπ ρξεζηκνπνηείηαη γηα ηελ αλάιπζε (π.ρ. ξίδα, θχιιν). Απηφ ζπκβαίλεη δηφηη έλα γνλίδην πνπ εθθξάδεηαη ζε έλαλ ηζηφ κπνξεί λα κελ εθθξάδεηαη ζε άιινπο ηζηνχο. Αληίζεηα, νη κνξηαθνί δείθηεο, επεηδή είλαη βαζηζκέλνη ζηηο δηαθνξέο ζηελ αθνινπζία ηνπ DNA, δελ επεξεάδνληαη απφ ην πεξηβάιινλ. Απηφ ζεκαίλεη φηη ηα ίδηα ζρέδηα δσλψλ ιακβάλνληαη πάληα γηα ηνλ ίδην γελφηππν. Σα ηζνέλδπκα έρνπλ βξεη εθαξκνγή ζε πνιιέο κειέηεο γελεηηθήο πιεζπζκψλ, ζπκπεξηιακβαλνκέλσλ ησλ κεηξήζεσλ ηνπ πνζνζηνχ ζηαπξνγνληκνπνίεζεο (Erskine θαη Muehlbauer 1991), ηεο δνκήο θαη ηεο απφθιηζεο πιεζπζκψλ (Freville θ.ά. 2001). Δπίζεο είλαη ηδηαίηεξα ρξήζηκα ζηε κειέηε ηεο παξαιιαθηηθφηεηαο ησλ θαιιηεξγεηψλ θαη ηεο ζπγγέλεηάο ηνπο (Hamrick θαη Godt 1997). Έρνπλ ρξεζηκνπνηεζεί, ζπρλά ζε ζπλδπαζκφ κε άιινπο δείθηεο γηα ηε κειέηε παξαιιαθηηθφηεηαο (Lamboy 1994; Ronning θαη Schnell 1994), ησλ δηα-εηδηθψλ ζρέζεσλ (Garvin θαη Weeden 1994), ηνπ ηξφπνπ γελεηηθήο θιεξνλφκεζεο (Warnke θ.ά. 1998) θαη ηνλ πξνζδηνξηζκφ ησλ γνλέσλ ζηα πβξίδηα (Parani θ.ά. 1997). 27

28 Δηθόλα 1.4: Παξάδεηγκα ηζνελδπκηθώλ δεηθηώλ. ηελ εηθόλα απεηθνλίδνληαη κε λνύκεξα ηα άηνκα πνπ αλαιύνληαη γηα θάζε ηζνέλδπκν ελώ κε γξάκκαηα νη δηαθνξεηηθέο δώλεο πνπ απνηππώλνπλ ηελ έθθξαζε ηνπ θάζε ελδύκνπ κεηά από ειεθηξνθόξεζε ζε πεθηή ακύινπ. Μνξηαθνί δείθηεο Οη κνξηαθνί δείθηεο άξρηζαλ λα αλαπηχζζνληαη απφ ηε δεθαεηία ηνπ 1980 θαη έθηνηε κηα ηεξάζηηα πνηθηιία δεηθηψλ έρεη επηλνεζεί γηα ηε δηεπθφιπλζε ηεο γελεηηθήο αλάιπζεο. Η βάζε ηεο αλάπηπμεο κνξηαθψλ δεηθηψλ είλαη νη δηαθνξέο ζηελ αιιεινπρία ηνπ DNA κεηαμχ αιιεινκφξθσλ γνληδίσλ θαη ν κεγάινο αξηζκφο θαηεγνξηψλ ηνπο νθείιεηαη ζηηο δηάθνξεο ηερληθέο κε ηηο νπνίεο είλαη δπλαηή ε αλίρλεπζε απηψλ ησλ δηαθνξψλ, ελψ ζπλερψο λέεο ηερληθέο επηηξέπνπλ ηελ αλάπηπμε λέσλ δεηθηψλ θάζε ρξφλν (Δηθφλα 1.6). Οη θχξηεο ηερληθέο αλίρλεπζεο κνξηαθψλ πνιπκνξθηζκψλ κπνξεί λα δηαρσξηζηνχλ ζε απηέο πνπ βαζίδνληαη ζηνλ πβξηδηζκφ ησλ λνπθιετθψλ νμέσλ θαη ζε απηέο πνπ βαζίδνληαη ζηνλ πνιιαπιαζηαζκφ κηαο αιιεινπρίαο κε PCR. Νεψηεξεο ηερληθέο εμειίμεηο επέηξεςαλ αλάπηπμε ζπζηεκάησλ κνξηαθψλ δεηθηψλ πνπ ζηεξίδνληαη ζηελ αιιεινχρηζε ζπγθεθξηκέλσλ πεξηνρψλ ελψ δείθηεο πνπ ζηεξίδνληαη ζηελ ηερλνινγία ησλ κηθξνζπζηνηρηψλ αληρλεχνπλ πνιπκνξθηζκνχο ζε επίπεδν γνληδηψκαηνο ρσξίο λα απαηηείηαη πξνεγνχκελε γλψζε ζπγθεθξηκέλσλ αιιεινπρηψλ. Οη πεξηζζφηεξνη δείθηεο πνπ εθαξκφδνληαη ζήκεξα ζηε βειηίσζε ησλ θπηψλ βαζίδνληαη ζηνλ πνιιαπιαζηαζκφ κηαο αιιεινπρίαο κε PCR (Σζαπηάξεο θ.ά.). ήκεξα νη κνξηαθνί δείθηεο ρξεζηκνπνηνχληαη ηφζν ζηε βαζηθή έξεπλα ησλ θπηψλ φζν θαη ζηε βειηίσζε θπηψλ φπνπ βξίζθνπλ εθαξκνγή ζηνλ ραξαθηεξηζκφ θπηηθψλ γελεηηθψλ πιηθψλ, ζηελ απνκφλσζε γνληδίσλ, 28

29 ζηελ εηζαγσγή κε ηε ρξήζε δεηθηψλ επλντθψλ αιιειφκνξθσλ γνληδίσλ θαη ζηελ πξνζηαζία πνηθηιηψλ (Henry 2001). Έλαο ηππηθφο κνξηαθφο δείθηεο πξνέξρεηαη απφ κηα κηθξή πεξηνρή ηνπ DNA πνπ παξνπζηάδεη πνιπκνξθηζκφ ζηελ αθνινπζία ησλ λνπθιενηηδίσλ κεηαμχ ησλ αηφκσλ κέζα ζε έλα είδνο. Υηιηάδεο θαηλνηππηθά νπδέηεξνη, ηπραίνη δείθηεο DNA κπνξνχλ λα παξαρζνχλ γηα νπνηαδήπνηε είδνο θαη έρνπλ ρξεζηκνπνηεζεί επηηπρψο ζε πνιιέο κειέηεο γηα λα αληηπξνζσπεπζνχλ ηα γνληδηψκαηα ζε κειέηεο βηνπνηθηιφηεηαο (Δηθφλα 1.5) (Sunnucks 2000) ή γηα λα ραξηνγξαθεζνχλ ηα γνλίδηα επηζπκεηψλ γλσξηζκάησλ (http://www.zmdb.iastate.edu/plantgdb/). Δληνχηνηο, ν γελεηηθφο ζχλδεζκνο κεηαμχ ελφο ζπγθεθξηκέλνπ νπδέηεξνπ θαη ελφο αιιειφκνξθνπ γνληδίνπ κηαο πεξηνρήο ζηφρνπ, πνπ δεκηνπξγείηαη απφ κειέηεο QTL, κπνξεί λα ζπάζεη απφ γελεηηθφ αλαζπλδπαζκφ. Απηφ πεξηνξίδεη ηε ρξήζε ησλ νπδέηεξσλ δεηθηψλ σο δηαγλσζηηθφ εξγαιείν (Rafalski θαη Tingey 1993). Πξφζθαηα, πξνγξάκκαηα γηα δνκηθή θαη ιεηηνπξγηθή γνληδησκαηηθή έρνπλ θαζηεξσζεί γηα δηάθνξα είδε θπηψλ (π.ρ. θ.α.). Η γλψζε πνπ παξάγεηαη ζε απηά ηα πξνγξάκκαηα ζα επηηξέςεη ηε ζπζηεκαηηθή αλάπηπμε ησλ ιεηηνπξγηθψλ δεηθηψλ, νη νπνίνη πξνέξρνληαη απφ ηηο πνιπκνξθηθέο πεξηνρέο κέζα ζηα γνλίδηα έρνληαο επηπηψζεηο ζηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο. Οη κνξηαθνί δείθηεο πξέπεη λα ζπγθεληξψλνπλ ηα πεξηζζφηεξα απφ ηα παξαθάησ γλσξίζκαηα ψζηε λα παξνπζηάδνπλ ηε κέγηζηε ρξεζηκφηεηα: Παξνπζία πνιπκνξθηζκνχ. Απιή θιεξνλνκηθφηεηα. Τςειφο ζπληειεζηήο θιεξνλνκηθφηεηαο. ηαζεξφο θαηλφηππνο θάησ απφ πνηθίιεο πεξηβαιινληηθέο ζπλζήθεο θαζψο αμηνπνηείηαη ν πνιπκνξθηζκφο πνπ παξνπζηάδεηαη ζηελ αιιεινπρία ησλ βάζεσλ ηνπ DNA θαη φρη ζηελ παξαιιαθηηθφηεηα έθθξαζεο ησλ γνληδίσλ. Γηαζπνξά ζε νιφθιεξν ην γνληδίσκα. Αλεμαξηεζία ηεο βησζηκφηεηαο θαη ηνπ θαηλνηχπνπ ησλ θπηψλ. 29

30 Η κεζνδνινγία αλαγλψξηζεο λα είλαη ρακεινχ θφζηνπο, λα κελ έρεη αξλεηηθή επίδξαζε ζην θπηφ θαη λα είλαη εχθνιε θαη δπλαηή θαηά ηα λεαξά ζηάδηα ηεο αλάπηπμεο ησλ θπηψλ. Γηάθξηζε νκφινγσλ εηεξφινγσλ. Δηθόλα 1.5: Ζ εμέιημε ησλ δεηθηώλ. Οη κνξηαθνί δείθηεο κπνξνχλ επίζεο λα θαηεγνξηνπνηεζνχλ κε βάζε ην είδνο ησλ κνξηαθψλ δηαθνξψλ πνπ αληρλεχνπλ ζε κηα αιιεινπρία, ζε απηνχο πνπ βαζίδνληαη: (1) ζηελ αλίρλεπζε κεηαιιάμεσλ ζηε ζέζε πξφζδεζεο ησλ εθθηλεηψλ ηεο PCR ή ησλ ζέζεσλ θνπήο πεξηνξηζηηθψλ ελδχκσλ, (2) ζηελ έλζεζε ή ηελ απαινηθή κηαο αιιεινπρίαο κεηαμχ ησλ εθθηλεηψλ ή ησλ ζέζεσλ θνπήο πεξηνξηζηηθψλ ελδχκσλ, (3) ζηελ αιιαγή ηνπ αξηζκνχ γξακκηθά επαλαιακβαλφκελσλ αιιεινπρηψλ κεηαμχ δχν εθθηλεηψλ ή ησλ ζέζεσλ θνπήο πεξηνξηζηηθψλ ελδχκσλ, ή ηέινο (4) ζηελ αλίρλεπζε κνλφ-λνπθιενηηδηθψλ πνιπκνξθηζκψλ. Μηα θαηεγνξηνπνίεζε ησλ κνξηαθψλ δεηθηψλ αλάινγα κε ηε κνξηαθή ηνπο βάζε θαίλεηαη ζηελ Δηθφλα 4. Οη πεξηζζφηεξνη κνξηαθνί δείθηεο αλήθνπλ ζηελ θαηεγνξία ησλ αλψλπκσλ DNA δεηθηψλ πνπ αληρλεχνπλ γεληθά νπδέηεξε παξαιιαθηηθφηεηα. Απηφ ζεκαίλεη φηη ε παξνπζία ή απνπζία ηνπ δείθηε κπνξεί λα πξνζδηνξίζεη κφλν ηε δηαθνξά ησλ αηφκσλ θαη φρη λα επεξεάζεη ηε δηαθνξά ζηελ εθδήισζε ηνπ γλσξίζκαηνο πνπ καο ελδηαθέξεη. Δπίζεο είλαη ζεκαληηθφ νη κνξηαθνί 30

31 δείθηεο, αλεμάξηεηα απφ ηελ ηερληθή πνπ ηνπο αληρλεχνπκε, λα είλαη απεξηφξηζηνη ζε αξηζκφ ψζηε λα κπνξεί λα θαιχπηνπλ ππθλά φιν ην γνληδίσκα, θαη λα αληρλεχνληαη ζηαζεξά θαη εχθνια ζε πιηθά πνπ πξνέξρνληαη απφ δηαθνξεηηθνχο ηζηνχο, φξγαλα, αλαπηπμηαθά ζηάδηα ή πεξηβάιινληα. Με βάζε ηα γελεηηθά ηνπο ραξαθηεξηζηηθά νη δείθηεο κπνξεί λα αληρλεχνπλ: (1) κνλή ζέζε, πνιιαπιά ζπγθπξίαξρα αιιειφκνξθα, κε παξαδείγκαηα ηνπο RFLPs θαη ηνπο κηθξνδνξπθφξνπο. (2) Πνιιαπιέο ζέζεηο, απιά θπξίαξρα αιιειφκνξθα, κε θχξηα παξαδείγκαηα ηνπο AFLPs θαη ηνπο RAPDs. Παξαθάησ ζα δνχκε πην αλαιπηηθά ηνπο θπξηφηεξνπο κνξηαθνχο δείθηεο πνπ ρξεζηκνπνηνχληαη ζηε βειηίσζε ησλ θπηψλ (Σζαπηάξεο θ.ά. 2012). Δηθόλα 1.6: Καηεγνξηνπνίεζε ησλ κνξηαθώλ δεηθηώλ αλάινγα κε ηε κνξηαθή ηνπο βάζε (ηξνπνπνηήζεθε από ηνπο Σζαπηάξεο θ.ά. 2012). Δθαξκνγέο ησλ κνξηαθώλ δεηθηώλ Οη κνξηαθνί δείθηεο είλαη πνιχηηκα εξγαιεία ηεο γελεηηθήο αλάιπζεο κε πνιιέο εθαξκνγέο πνπ εθηείλνληαη απφ ηνλ εληνπηζκφ ζπγθεθξηκέλσλ γνληδίσλ κέρξη ηελ θαζεαπηή βειηίσζε ησλ θπηψλ κε ρξήζε δεηθηψλ. Ιδηαίηεξα ζήκεξα, φπνπ κηα πιεζψξα 31

32 γνληδησκάησλ πνιιψλ νξγαληζκψλ έρεη αιιεινπρεζεί θαη ε πιεξνθνξία απηή είλαη δηαζέζηκε ζε βάζεηο δεδνκέλσλ, νη κνξηαθνί δείθηεο απνδεηθλχνπλ ηελ ρξεζηκφηεηά ηνπο ζηελ απινχζηεπζε ηεο γνληδησκαηηθήο αλάιπζεο γηα ηνλ εληνπηζκφ γνληδίσλ θαη ηελ δεκηνπξγία γελεηηθψλ ραξηψλ πςειήο ππθλφηεηαο. Απηά ηα ζεκαληηθά εξγαιεία έρνπλ άκεζε εθαξκνγή ζηε βειηίσζε ησλ θπηψλ θαζψο επηηξέπνπλ πην εχθνιε θαη αμηφπηζηε επηινγή γελνηχπσλ θαη ζηα ηξία ζεκαληηθά βήκαηα ηεο βειηίσζεο, δειαδή ηε δεκηνπξγία γελεηηθήο παξαιιαθηηθφηεηαο, ηελ επηινγή ησλ θαηάιιεισλ γνλέσλ γηα ηε δεκηνπξγία ηνπ αξρηθνχ πιεζπζκνχ πνπ ζα εθαξκνζηεί ε επηινγή, θαη ηέινο ηελ επηινγή ησλ ππέξηεξσλ γελνηχπσλ ζηνλ πιεζπζκφ επηινγήο. Δπίζεο άιιεο ζεκαληηθέο εθαξκνγέο ησλ κνξηαθψλ δεηθηψλ αθνξνχλ ηε θπινγελεηηθή αλάιπζε πνπ άλνημε λένπο νξίδνληεο ζηελ εμειηθηηθή (Σζαπηάξεο θ.ά. 2012). Πνιπκνξθηζκόο Μεγέζνπο Πεξηνξηζηηθώλ Τκεκάησλ DNA (RFLP) Σν πξψην ζχζηεκα κνξηαθψλ δεηθηψλ πνπ αλαπηχρζεθε ηε δεθαεηία ηνπ 1970, νη δείθηεο RFLP, βαζίζηεθε ζε δπν ηερληθέο πνπ κφιηο είραλ επηλνεζεί: ηελ θαηεξγαζία κε πεξηνξηζηηθά έλδπκα θαη ηνλ πβξηδηζκφ. Απηνί είλαη θαη νη κφλνη δείθηεο πνπ εθαξκφζηεθαλ βαζηδφκελνη ζηνλ πβξηδηζκφ θαη αληρλεχνπλ θπξίσο κεηαιιάμεηο ζε ζέζεηο θνπήο πεξηνξηζηηθψλ ελδχκσλ θαη έλζεζε ή απαινηθή κηαο αιιεινπρίαο κεηαμχ δχν ζέζεσλ θνπήο πεξηνξηζηηθψλ ελδχκσλ. πλνπηηθά ε κεζνδνινγία πεξηιακβάλεη ηελ θνπή ηνπ ζπλνιηθνχ κεγαινκνξηαθνχ DNA ησλ θπηηάξσλ ελφο ηζηνχ (π.ρ. θχιιν) κε έλα ή πεξηζζφηεξα πεξηνξηζηηθά έλδπκα κε απνηέιεζκα ηελ παξαγσγή ελφο πιεζπζκνχ κηθξφηεξσλ κνξίσλ DNA πνπ δηαρσξίδνληαη ζχκθσλα κε ην κήθνο ηνπο κε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο. Παξά ην γεγνλφο φηη ηα κφξηα απηά είλαη νξαηά αλ βαθηνχλ κε βξσκηνχρν αηζίδην, δελ είλαη επδηάθξηηεο νη δηαθνξέο ηνπο θαζψο ππάξρεη κεγάινο αξηζκφο κνξίσλ κε ζπλερή θαηαλνκή κήθνπο, απφ ιίγεο δεθάδεο κέρξη θαη πάλσ απφ δέθα ρηιηάδεο βάζεηο, πνπ εκθαλίδνληαη ζαλ ζπλερφκελε θσηεηλή πεξηνρή (smear) ζηελ πεθηή, πνπ ελδερνκέλσο λα πεξηέρεη θαη θάπνηεο επδηάθξηηεο δψλεο ζπγθεθξηκέλσλ κεγεζψλ πνπ παξάγνληαη απφ ηελ πέςε επαλαιακβαλφκελσλ αιιεινπρηψλ. Απηή ε πιεξνθνξία δελ επαξθεί γηα ηε δηαπίζησζε αλ δπν δηαθνξεηηθά άηνκα ελφο πιεζπζκνχ παξνπζηάδνπλ πνιπκνξθηζκφ ζηελ θνπή ηνπ ζπλφινπ ηνπ DNA ηνπο κε έλα έλδπκν. Έηζη επηλνήζεθε κηα ηερληθή αλίρλεπζεο δηαθνξψλ ζπγθεθξηκέλσλ αιιεινπρηψλ πνπ πξνέξρνληαη απφ ηελ θαηεξγαζία κε πεξηνξηζηηθά έλδπκα. Γηα ηελ αλίρλεπζε ηέηνησλ δηαθνξψλ ρξεζηκνπνηνχκε ηελ ηερληθή ηνπ πβξηδηζκνχ κε έλαλ ηρλειάηε πνπ δελ είλαη 32

33 ηίπνηα άιιν παξά έλα θισλνπνηεκέλν θνκκάηη DNA ηνπ ίδηνπ νξγαληζκνχ, θαη δηαπηζηψλεηαη αλ ππάξρεη πνιπκνξθηζκφο γηα ην ζπγθεθξηκέλν θνκκάηη πνπ είλαη νκφινγν κε ηνλ ηρλειάηε. Σα δηαρσξηζκέλα ηκήκαηα DNA ηεο ειεθηξνθφξεζεο κεηαθέξνληαη κε Νφηηα κεηαθνξά ζε κηα κεκβξάλε φπνπ κεηνπζηψλνληαη θαη ζηαζεξνπνηνχληαη. Ο ηρλειάηεο επηζεκαίλεηαη κε θζνξίδνπζεο ή ξαδηελεξγέο νπζίεο, κεηνπζηψλεηαη θαη απηφο, θαη πβξηδίδεη κε ηηο ζπκπιεξσκαηηθέο ηνπ αιπζίδεο πνπ είλαη ζηαζεξνπνηεκέλεο ζηε κεκβξάλε. Αλάινγα κε ηελ παξνπζία ή απνπζία αληίζηνηρσλ ζέζεσλ θνπήο κε ην πεξηνξηζηηθφ έλδπκν πνπ ρξεζηκνπνηήζακε, ζα δνχκε ηα ίδηα ή δηαθνξεηηθά επηζεκαζκέλα κφξηα ζηα δηάθνξα γελεηηθά πιηθά πνπ εμεηάδνπκε. Δπίζεο δηαθνξέο κπνξεί λα νθείινληαη ζε πξνζζήθε/απαινηθή βάζεσλ κεηαμχ αιιεινκφξθσλ δηαθνξεηηθψλ γελνηχπσλ. Οη δείθηεο RFLP θιεξνλνκνχληαη κε ζπγθπξίαξρν ηξφπν θαη κπνξεί λα είλαη απεξηφξηζηνη ζε αξηζκφ. Δπίζεο ε αιιεινπρία ηνπ θάζε ηρλειάηε-δείθηε δελ ρξεηάδεηαη λα είλαη γλσζηή. Απνηεινχλ ην πξψην ζχζηεκα κνξηαθψλ δεηθηψλ πνπ ρξεζηκνπνηήζεθε ζηε βειηίσζε ησλ θπηψλ, αιιά κεηά ηελ αλαθάιπςε ηεο PCR ε ρξήζε δεηθηψλ RFLP είλαη πεξηνξηζκέλε θπξίσο εμαηηίαο ηεο κεγάιεο πνζφηεηαο ζπλνιηθνχ DNA πνπ απαηηείηαη γηα θνπή κε πεξηνξηζηηθά έλδπκα, ηεο δπζθνιίαο ζηελ εθαξκνγή ησλ ηερληθψλ αλίρλεπζήο ηνπο θαη ηνπ ζεκαληηθνχ θφζηνπο ηνπο (Σζαπηάξεο θ.ά. 2012). Τπραίν Δληζρπκέλν Πνιπκνξθηθό DNA (RAPD) Η αλίρλεπζε δεηθηψλ RAPD ήηαλ ε πξψηε εθαξκνγή πνπ αμηνπνίεζε ηελ PCR γηα ηελ αλίρλεπζε ηεο γελεηηθήο παξαιιαθηηθφηεηαο ζε επίπεδν DNA. Σν ζχζηεκα απηφ βαζίδεηαη ζηε ρξήζε ελφο κφλν κηθξνχ εθθηλεηή (ζπλήζσο 10 λνπθιενηηδίσλ) κε ηπραία αιιεινπρία, γηα ηελ ελίζρπζε κε PCR ηπραίσλ ηκεκάησλ ηνπ DNA ησλ αηφκσλ ελφο πιεζπζκνχ (Δηθφλα 1.7). Γηα λα πνιιαπιαζηαζηεί έλα ηκήκα κε έλαλ εθθηλεηή, ζα πξέπεη ν εθθηλεηήο απηφο λα βξεη κηα ζπκπιεξσκαηηθή αιιεινπρία θαη ζηα δπν άθξα ηνπ ηκήκαηνο απηνχ αιιά κε αληίζεηεο δηεπζχλζεηο (δειαδή ζην έλα άθξν ζηε κηα αιπζίδα ηνπ DNA θαη ζην άιιν άθξν ζηελ άιιε). ηαλ ε πεξηνρή αλάκεζα ζηα ζεκεία πβξηδηζκνχ-πξφζδεζεο ηνπ εθθηλεηή είλαη απφ 100 έσο 3000 βάζεηο παξάγνληαη κφξηα πνιιαπιαζηαζκέλνπ DNA πνπ εκθαλίδνληαη ζαλ δηαθξηηέο δψλεο ζηελ ειεθηξνθφξεζε. Ο πνιπκνξθηζκφο κεηαμχ ησλ δηαθνξεηηθψλ αηφκσλ πνπ εκθαλίδεηαη ζαλ δηαθνξά ζην πξφηππν δσλψλ ηεο ειεθηξνθφξεζεο κπνξεί λα νθείιεηαη ζε αιιαγέο ζηε ζέζε πξφζδεζεο ηνπ εθθηλεηή, κε απνηέιεζκα απνηπρία πνιιαπιαζηαζκνχ ηνπ ηκήκαηνο θαη εκθάληζεο ηεο δψλεο, θαη ζε πξνζζήθε/απαινηθή βάζεσλ ζην ελδηάκεζν ησλ 33

34 πνιιαπιαζηαζκέλσλ ηκεκάησλ, πνπ νδεγεί ζηε δηαθνξνπνίεζε ηνπ κήθνπο ηεο αιιεινπρίαο πνπ εληζρχεηαη. ε θάζε αληίδξαζε κπνξεί λα εληζρχνληαη πεξηζζφηεξεο απφ κηα δψλεο, γεγνλφο πνπ ππνδειψλεη φηη κπνξεί λα αλαιχνληαη πεξηζζφηεξα ηνπ ελφο αιιειφκνξθα. Οη δείθηεο RAPD ζπκπεξηθέξνληαη ζαλ θπξίαξρνη ραξαθηήξεο, πνπ ζεκαίλεη φηη έλα αιιειφκνξθν πνπ εληζρχεηαη εκθαλίδεηαη ζαλ κηα δψλε ηφζν ζε νκφδπγε φζν θαη ζε εηεξφδπγε θαηάζηαζε, ελψ ην αιιειφκνξθν πνπ δελ εληζρχεηαη δελ κπνξεί λα αληρλεπζεί. Γηα ην ιφγν απηφ ε ηερληθή είλαη κφλν κεξηθά απνηειεζκαηηθή ζε ζρήκαηα βειηίσζεο πνπ ρξεζηκνπνηνχλ ηελ γελεαινγηθή επηινγή φπνπ είλαη απαξαίηεην λα αλαγλσξίδνληαη ηα εηεξνδχγσηα άηνκα κεηαμχ ησλ απνγφλσλ. Έλα αθφκε πξφβιεκα ησλ δεηθηψλ απηψλ είλαη ε επαηζζεζία ηεο PCR ζε αιιαγή ζπλζεθψλ ηεο αληίδξαζεο κε απνηέιεζκα λα κελ έρεη θαιή επαλαιεςηκφηεηα, ηδηαίηεξα φηαλ εθαξκφδεηαη ζε δηαθνξεηηθά εξγαζηήξηα. Ωζηφζν, ε κεζνδνινγία ησλ δεηθηψλ RAPD είλαη πνιχ γξήγνξε θαη απιή ελψ απαηηεί ειάρηζηεο πνζφηεηεο DNA θαη ην θφζηνο είλαη ρακειφ, νπφηε κπνξεί λα εθαξκνζηεί ζηελ αλάιπζε κεγάινπ αξηζκνχ δεηγκάησλ δίλνληαο ζεκαληηθή πιεξνθνξία γηα πνιπκνξθηζκνχο ρσξίο λα ρξεηάδεηαη πξνεγνχκελε γλψζε ηεο αιιεινπρίαο ησλ δηαθνξεηηθψλ αιιεινκφξθσλ. Δηθόλα 1.7: Αξρέο κνξηαθώλ δεηθηώλ RAPD. 34

35 Πνιπκνξθηζκόο Μήθνπο εληζρπκέλσλ Τκεκάησλ (AFLP) Σν ζχζηεκα δεηθηψλ AFLP βαζίδεηαη ζηνλ πνιπκνξθηζκφ ησλ ηκεκάησλ θνπήο ηνπ ζπλνιηθνχ DNA κε πεξηνξηζηηθά έλδπκα, φπσο θαη νη δείθηεο RFLP, κε ηε δηαθνξά φηη ε αλαγλψξηζε ησλ ηκεκάησλ απηψλ δελ γίλεηαη κε πβξηδηζκφ αιιά κε PCR. Η ηερληθή ρξεζηκνπνηεί πξνζαξκνζηέο πνπ ζπλδένληαη κε ηε βνήζεηα ηνπ ελδχκνπ ιηγάζε κε ηα άθξα ησλ ηκεκάησλ πνπ πξνθχπηνπλ απφ θαηεξγαζία κε δχν ζπλήζσο πεξηνξηζηηθά έλδπκα, έλα πνπ αλαγλσξίδεη ζέζεηο 4 θαη έλα 6 βάζεσλ. Καηφπηλ γίλεηαη αληίδξαζε PCR κε κήηξα ηα ηκήκαηα απηά θαη εθθηλεηέο πνπ είλαη ζπκπιεξσκαηηθνί κε ηελ αιιεινπρία ησλ πξνζαξκνζηψλ. Σα πξντφληα ηεο αληίδξαζεο επηζεκαίλνληαη κε ξαδηελεξγά ή θζνξίδνληα λνπθιενηίδηα θαη νπηηθνπνηνχληαη ζε ειεθηξνθφξεζε πεθηήο αθξπιακίδεο. Η ηερληθή παξάγεη κεγάιε ππθλφηεηα δεηθηψλ αθνχ ζηελ ειεθηξνθφξεζε μερσξίδνπλ δψλεο πνπ θαζεκηά αληηζηνηρεί ζε έλαλ AFLP δείθηε (πνπ επηζεκαίλεη ηε ζέζε ελφο αιιεινκφξθνπ). Έηζη ε ηερληθή έρεη ην πιενλέθηεκα λα αληρλεχεη κεγάιν αξηζκφ δεηθηψλ ζε κηα αληίδξαζε ρσξίο πξναπαηηνχκελε γλψζε ηεο αιιεινπρίαο ή ηε ρξήζε ηρλειάηε. Δπίζεο είλαη ιηγφηεξν επαίζζεηε απφ ηα RAPDs ζε δηαθπκάλζεηο ησλ ζπλζεθψλ ηεο PCR κε απνηέιεζκα λα έρεη θαιιίηεξε επαλαιεςηκφηεηα, είλαη φκσο ηερληθά πην απαηηεηηθή. Οη δείθηεο πνπ αληρλεχνληαη είλαη φπσο θαη νη RAPDs θπξίαξρνη θαη κνλναιιειηθνί (ην θπξίαξρν αιιειφκνξθν αληρλεχεηαη ελψ ην άιιν φρη). Ο κεγάινο φγθνο πιεξνθνξηψλ πνπ πξνθχπηεη κε κηα κφλν αληίδξαζε PCR ζην ζχζηεκα δεηθηψλ AFLP έθαλε ηνπο δείθηεο απηνχο πνιχ δεκνθηιείο ζε κειέηεο αλάιπζεο ηεο βηνπνηθηιφηεηαο, αλάιπζεο παξαιιαθηηθφηεηαο ζε ζπιινγέο ηξαπεδψλ γελεηηθνχ πιηθνχ, θαη ζηε γελεηηθή ραξηνγξάθεζε (Σζαπηάξεο θ.ά. 2012). Μηθξνδνξπθόξνη ή Απιέο Δπαλαιακβαλόκελεο Αιιεινπρίεο (SSR) Οη επθαξπσηηθνί νξγαληζκνί έρνπλ πνιιέο επαλαιακβαλφκελεο αιιεινπρίεο ζην DNA ηνπο. Σέηνηεο κηθξέο επαλαιήςεηο αιιεινπρηψλ 2-5 λνπθιενηηδίσλ πνπ επαλαιακβάλνληαη θνξέο έρνπλ νλνκαζηεί κε πνιιά δηαθνξεηηθά νλφκαηα φπσο κηθξνδνξπθφξνη, SSRs, STRs, VNTRs), θαη απνηεινχλ εμαηξεηηθή πεγή γελεηηθψλ δεηθηψλ θαζψο παξνπζηάδνπλ πςειή παξαιιαθηηθφηεηα σο πξνο ηνλ αξηζκφ επαλαιήςεσλ ζε πνιινχο νξγαληζκνχο (ρήκα 1.1). Έηζη, γηα παξάδεηγκα, κηα αιιεινπρία ελφο δηλνπθιενηηδίνπ AG κπνξεί λα επαλαιακβάλεηαη 20 θνξέο ζε ζπγθεθξηκέλε ζέζε ζην DNA ελφο αιιειφκνξθνπ ελψ ζην άιιν αιιειφκνξθν 30 θνξέο. Η αλίρλεπζε απηψλ ησλ δηαθνξψλ κπνξεί λα γίλεη εχθνια κε PCR αλ εληζρχζνπκε ηελ 35

36 πεξηνρή ησλ επαλαιήςεσλ ρξεζηκνπνηψληαο εηδηθνχο εθθηλεηέο νκφινγνπο κε αιιεινπρίεο εθαηέξσζελ ηεο επαλάιεςεο. Σφηε, ππνζέηνληαο φηη αιιεινπρία ηεο πεξηνρήο είλαη ε ίδηα ζηα δπν αιιειφκνξθα θαη φηη ε κφλε δηαθνξά νθείιεηαη ζηνλ αξηζκφ επαλαιήςεσλ ηνπ δηλνπθιενηηδίνπ, ηα εληζρπκέλα ηκήκαηα ζα έρνπλ δηαθνξά κήθνπο 20 λνπθιενηίδηα πνπ είλαη εχθνιν λα αληρλεπζεί ζε κηα εηδηθή πεθηή αγαξφδεο πςειήο δηαρσξηζηηθήο ηθαλφηεηαο. Βέβαηα θαη θάζε πξνζζήθε/απαινηθή λνπθιενηηδίσλ πνπ κπνξεί λα έρεη ζπκβεί αλάκεζα ζηηο ζέζεηο ησλ εθθηλεηψλ κπνξεί λα αληρλεπζεί σο παξαιιαθηηθφηεηα. Η ηερληθή δίλεη απινχο ζπγθπξίαξρνπο δείθηεο, κηαο γνληδηαθήο ζέζεο, κε κεγάιε παξαιιαθηηθφηεηα θαη πςειή επαλαιεςηκφηεηα, αιιά απαηηεί πξνεγνχκελε γλψζε ηεο αιιεινπρίαο ηεο πεξηνρήο γηα ζρεδηαζκφ εθθηλεηψλ. Απηφ είλαη ζεκαληηθφ εγρείξεκα θαη απνηειεί κεηνλέθηεκα ηεο ηερληθήο φηαλ εθαξκφδεηαη ζε νξγαληζκνχο πνπ δελ έρνπλ αιιεινπρεζεί. ήκεξα φκσο, θαζψο ηα γνληδηψκαηα πνιιψλ ζεκαληηθψλ θαιιηεξγνχκελσλ θπηψλ είλαη γλσζηά, έρνπλ αλαπηπρζεί βηνπιεξνθνξηθέο κεζνδνινγίεο αλίρλεπζεο επαλαιακβαλφκελσλ αιιεινπρηψλ θαη ζρεδηαζκνχ εθθηλεηψλ πνπ δηεπθνιχλνπλ ζεκαληηθά ηελ ρξήζε ηνπο ζηελ αλάιπζε ηεο γελεηηθήο παξαιιαθηηθφηεηαο θαη ηε βειηίσζε ησλ θπηψλ απηψλ. ρήκα 1.1. ρεκαηηθή αλαπαξάζηαζε ηεο ηερληθήο ησλ SSR κνξηαθώλ δεηθηώλ. Με ηε ρξήζε θαηάιιεισλ εθθηλεηώλ από ηηο ακθίπιεπξεο πεξηνρέο ησλ επαλαιακβαλόκελσλ πεξηνρώλ, νη δηαθνξέο πνπ ππάξρνπλ ζηνλ αξηζκό ησλ επαλαιήςεσλ κεηαμύ ησλ γελνηύπσλ κπνξνύλ λα νπηηθνπνηεζνύλ ζε πεθηέο metaphor αγαξόδεο θαη αθξπιακίδεο θαζώο θαη κε ειεθηξνθόξεζε ζε ηξηρνεηδή. ηε ζπλέρεηα κε θαηάιιεια ινγηζκηθά πξνγξάκκαηα πξαγκαηνπνηείηαη ε εύξεζε ηνπ αξηζκνύ θαη ηνπ κεγέζνπο ησλ δηαθνξεηηθώλ αιιειόκνξθσλ. 36

37 Πνιπκνξθηζκνί Μεηαμύ Δπαλαιακβαλόκελσλ Αιιεινπρηώλ (ISSR) Οη κνξηαθνί δείθηεο ISSR είλαη ηκήκαηα DNA απφ 100 έσο 300 bp πνπ εδξάδνληαη κεηαμχ παξαθείκελσλ θαη αληίζεηα πξνζαλαηνιηζκέλσλ κηθξνδνξπθνξηθψλ πεξηνρψλ. Οη ISSR κνξηαθνί δείθηεο εληζρχνληαη κέζσ ηεο ηερληθήο ηεο PCR ρξεζηκνπνηψληαο σο εθθηλεηέο αιιεινπρίεο απφ κηθξνδνξπθφξνπο κε ιίγα επηιεγκέλα λνπθιενηίδηα σο πιεπξηθά ησλ κε επαλαιακβαλφκελσλ πεξηνρψλ (16-18 bp). Πεξίπνπ 10 κε 60 ηκήκαηα απφ πνιιαπιέο πεξηνρέο εληζρχνληαη ηαπηφρξνλα, δηαρσξίδνληαη κε ειεθηξνθφξεζε θαη αλαιχνληαη σο παξνπζία ή απνπζία δσλψλ ζπγθεθξηκέλνπ κεγέζνπο (Δηθφλα 1.8). Η απνπζία αλάγθεο γηα χπαξμε γλσζηψλ αιιεινπρηψλ γηα ηελ θαηαζθεπή ησλ εθθηλεηψλ απνηειεί ην θχξην πιενλέθηεκα ησλ ISSRs. Δπίζεο νη απαηηήζεηο ζε DNA είλαη κηθξέο ιφγσ ηνπ φηη ε αλαιπηηθή δηαδηθαζία πεξηιακβάλεη PCR. Δπηπιένλ ηα ISSRs είλαη ηπραία δηαζθνξπηζκέλα ζε φιν ην γνληδίσκα. Ωο ηερληθή πνπ εληζρχεη ηαπηφρξνλα δηαθνξεηηθέο γνληδησκαηηθέο πεξηνρέο ηα ISSRs έρνπλ ην κεηνλέθηεκα ηεο πηζαλφηεηαο χπαξμεο δχν δσλψλ κε ίδην κέγεζνο ζην ζρέδην δσλψλ πνπ λα κελ πξνέξρνληαη απφ νκφινγεο πεξηνρέο. Δμαηηίαο ησλ ζρεδίσλ απνηππσκάησλ πνιιαπιψλ πεξηνρψλ πνπ ιακβάλνληαη, ηα ISSRs κπνξνχλ λα ρξεζηκνπνηεζνχλ ζε κειέηεο γελεηηθήο ηαπηνπνίεζεο, πηζηνπνίεζε θιψλσλ θαη ζηειερψλ θαη ζε ηαμηλνκηθέο κειέηεο κεηαμχ ζπγγεληθψλ εηδψλ. Δπηπξφζζεηα ηα ISSRs ζεσξνχληαη ρξήζηκνη κνξηαθνί δείθηεο γηα κειέηεο γελεηηθήο ραξηνγξάθεζεο (Godwin θ.ά. 1997; Zietkiewicz θ.ά. 1994). Δηθόλα 1.8: Αξρέο κνξηαθώλ δεηθηώλ ISSR. 37

38 Λεηηνπξγηθνί ή εληνπηζκέλνη ζε γνλίδηα κνξηαθνί δείθηεο Σα ηειεπηαία ρξφληα, ζηελ ηερλνινγία ησλ κνξηαθψλ δεηθηψλ έρεη παξαηεξεζεί κία κεηαηφπηζε απφ ηνπο ιεγφκελνπο RDMs, πνπ αλαπηχρζεθαλ απφ γνληδησκαηηθέο αιιεινπρίεο ή απφ cdnas, ζηνπο κνξηαθνχο δείθηεο πνπ αληηπξνζσπεχνπλ ηα κεηαγξαθήκαηα ή άιιεο θσδηθέο πεξηνρέο. Απηή ε λέα θαηεγνξία κνξηαθψλ δεηθηψλ έρνπλ πεξηγξαθεί σο GMMs. Οη GMMs έρνπλ ηαμηλνκεζεί ζε δχν νκάδεο (Bowers θ.ά. 2003): 1. GTMs: πξνέξρνληαη απφ ηνπο πνιπκνξθηζκνχο πνπ ζπκβαίλνπλ εληφο ησλ γνληδίσλ, σζηφζν δε ζπζρεηίδνληαη απαξαίηεηα κε ηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο π.ρ. κε κεηαθξαδφκελεο πεξηνρέο ησλ EST αιιεινπρηψλ (Aggarwal θ.ά. 2007; Schmitt θ.ά. 2006). 2. FMs: πξνέξρνληαη απφ ηηο πνιπκνξθηθέο αιιεινπρίεο ή πεξηνρέο κέζα ζηηο θσδηθέο πεξηνρέο ησλ γνλίδησλ θαη επνκέλσο, πνπ ζπζρεηίδνληαη κε ηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο (π.ρ. κνξηαθνί δείθηεο πνπ βαζίδνληαη ζε ππνςήθηα γνλίδηα). Οη FMs δείθηεο, αλάινγα κε ηε ζπκκεηνρή ηνπο ζηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο, ηαμηλνκνχληαη πεξαηηέξσ ζε δχν ππφ-νκάδεο α) έκκεζνη ιεηηνπξγηθνί δείθηεο (IFMs), ησλ νπνίσλ ν ξφινο ζηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο είλαη έκκεζα γλσζηφο θαη β) DFMs, γηα ηνπο νπνίνπο ν ξφινο γηα ηε θαηλνηππηθή παξαιιαθηηθφηεηα ηνπ γλσξίζκαηνο είλαη θαιά απνδεδεηγκέλνο. Οη νπδέηεξνη κνξηαθνί δείθηεο πξνέξρνληαη απφ ηπραίεο πνιπκνξθηθέο πεξηνρέο ηνπ γνληδηψκαηνο ελψ νη GTMs πξνέξρνληαη απφ πνιπκνξθηζκφ πνπ ππάξρεη ζηηο αιιεινπρίεο ησλ γνληδίσλ. Οη RDMs θαη νη GTMs κπνξεί λα δεκηνπξγεζνχλ αλεμαξηήησο ηεο ζπζρέηηζήο ηνπο κε θάπνην θαηλνηππηθφ ραξαθηήξα θάηη πνπ δε ζπκβαίλεη κε ηνπο FMs πνπ πξνέξρνληαη απφ πνιπκνξθηθέο πεξηνρέο κέζα ζηα γνλίδηα πνπ επηδξνχλ ζηε θαηλνηππηθή παξαιιαθηηθφηεηα ελφο γλσξίζκαηνο. Έηζη ε αλάπηπμε ιεηηνπξγηθψλ κνξηαθψλ δεηθηψλ απαηηεί αιιεινπρίεο αιιειφκνξθσλ απφ ιεηηνπξγηθά ραξαθηεξηζκέλα γνλίδηα απφ ηηο νπνίεο πνιπκνξθηθά, ιεηηνπξγηθά κνηίβα πνπ επηδξνχλ ζηνλ θαηλφηππν ηνπ θπηνχ κπνξνχλ λα αλαγλσξηζηνχλ. Δπηπιένλ ε ρξήζε ησλ ιεηηνπξγηθψλ κνξηαθψλ δεηθηψλ εμαξηάηαη απφ ηε δηαζεζηκφηεηα ηζρπξψλ ηερλνινγηψλ δνθηκήο δεηθηψλ (Gupta θαη al. 2002). 38

39 Σν θιεηδί γηα ηελ αλάπηπμε ησλ ιεηηνπξγηθψλ κνξηαθψλ δεηθηψλ είλαη ε αιιεινπρία ελφο γνληδίνπ κε ραξαθηεξηζκέλε ιεηηνπξγία. Απφ ην 2001 θαη ηε δεκνζίεπζε ζην πεξηνδηθφ Nature ηνπ γνληδηψκαηνο ηνπ θπηνχ πξφηππν Arabidopsis thaliana ν αξηζκφο ησλ γνληδησκάησλ παξνπζηάδεη ζηαζεξή αχμεζε, θηάλνληαο ζηελ θνξχθσζε ηνπ ην 2012 κε 13 δεκνζηεχζεηο γνληδησκάησλ. ήκεξα έρνπλ δεκνζηεπηεί 50 θπηηθά γνληδηψκαηα θαη ν αξηζκφο ηνπο αλακέλεηαη λα απμεζεί ζε εθαηνληάδεο ζηα επφκελα ρξφληα (Todd θαη Jackson 2013). ηελ αξαβίδνςε φπνπ απνηειεί θπηφ πξφηππν, ιηγφηεξν απφ ην 10 % ησλ γνληδίσλ ηεο έρνπλ ραξαθηεξηζηεί σο πξνο ηε ιεηηνπξγία ηνπο (Breyne θαη Zabeau 2001). ε άιια είδε, ν αξηζκφο ιεηηνπξγηθά ραξαθηεξηζκέλσλ αθνινπζηψλ είλαη νπζηαζηηθά ρακειφηεξνο. Δληνχηνηο, κε βάζε ηελ νκνινγία ζηηο αθνινπζίεο, νη ππνζεηηθέο ιεηηνπξγίεο κπνξνχλ λα νξηζηνχλ ζε πνζνζηφ % ησλ εθθξαζκέλσλ αθνινπζηψλ γηα νπνηαδήπνηε είδνο (Ronning θ.ά. 2003). Απηή ε πξνζέγγηζε ησλ γνληδίσλ θαη νη ζπληαηληθέο ζρέζεηο κεηαμχ ησλ θπηηθψλ γνληδησκάησλ (Barnes 2002; Freeling 2001; Ware θ.ά. 2002) έρνπλ ρξεζηκνπνηεζεί επηηπρψο γηα λα πξνζδηνξίζνπλ γνλίδηα πνπ είραλ ζπζρέηηζε κε αγξνλνκηθά γλσξίζκαηα (Collins θ.ά. 1998; Quint θ.ά. 2002). Δπηπιένλ, νη αλαιχζεηο πςειήο ξπζκν-απφδνζεο, φπσο ην πξνθίι έθθξαζεο, έρνπλ αλαπηπρζεί πξφζθαηα (Breyne θαη Zabeau 2001) γηα λα πξνζδηνξίζνπλ ππνςήθηα γνλίδηα ζε επξεία θιίκαθα. Άιιεο κέζνδνη, ζπκπεξηιακβαλνκέλεο ηεο παξεκβνιήο-rna (RNA-interference) (Denli θαη Hannon 2003), T-DNA, επηζήκαλζεο κεηαζεηψλ γνληδίσλ (May θαη Martienssen 2003; Walden 2002) θαη ραξηνγξάθεζεο QTL γνληδίσλ έθθξαζεο (Jansen θαη Nap 2001) κπνξνχλ λα ρξεζηκνπνηεζνχλ γηα λα θαζνξίζνπλ ηε ιεηηνπξγία ησλ γνληδίσλ. πκπεξαζκαηηθά, ηα ππνςήθηα γνλίδηα κπνξνχλ λα πξνζδηνξηζηνχλ γηα ηα πεξηζζφηεξα αγξνλνκηθά γλσξίζκαηα θαη θπηηθά είδε νδεγψληαο ζηελ παξαγσγή ησλ κνξηαθψλ δεηθηψλ GMMs. Οη FMs είλαη αλψηεξνη κνξηαθνί δείθηεο έλαληη ησλ RDMs θαη ησλ GTMs ζε πνιιέο εθαξκνγέο εμαηηίαο ηεο πιήξεο ζχλδεζήο ηνπο κε ιεηηνπξγηθά κνηίβα. ε αληίζεζε κε ηνπο RDMs θαη ηνπο GTMs, νη FMs επηηξέπνπλ ηελ αμηφπηζηε εθαξκνγή ησλ δεηθηψλ ζε πιεζπζκνχο ρσξίο ηελ πξνεγνχκελε ραξηνγξάθεζή ηνπο, ηελ ρξήζε δεηθηψλ ζε ραξηνγξαθεκέλνπο πιεζπζκνχο ρσξίο ην ξίζθν ηεο απψιεηαο πιεξνθνξηψλ εμαηηίαο ηνπ αλαζπλδπαζκνχ θαη ηελ θαιχηεξε αληηπξνζψπεπζε ηεο γελεηηθήο παξαιιαθηηθφηεηαο ζε άγξηνπο θαη βειηησκέλνπο πιεζπζκνχο. Σν κνλαδηθφ κεηνλέθηεκα ησλ GMMs κνξηαθψλ δεηθηψλ είλαη ην ρακειφ ηνπ επηπέδνπ πνιπκνξθηζκνχ πνπ παξνπζηάδνπλ ζε ζχγθξηζε κε 39

40 ηνπ RDMs. Απηφ γηαηί πξνέξρνληαη απφ ηηο ζπληεξεκέλεο ιεηηνπξγηθέο πεξηνρέο ηνπ γνληδηψκαηνο. Κισλνπνηεκέλεο Αιιεινπρίεο σο Μνξηαθνί δείθηεο (STS, EST, SSCP, SNP) Απνηεινχλ ζπζηήκαηα κνξηαθψλ δεηθηψλ πνπ βαζίδνληαη ζε θισλνπνηεκέλνπο γνληδηαθέο ζέζεηο. Έηζη STS θαη ESTs είλαη γνληδηαθέο ζέζεηο πνπ ηαπηνπνηνχληαη βάζεη ηεο αιιεινπρίαο ηνπο θαη ν πνιπκνξθηζκφο αληρλεχεηαη κε ηελ ηερληθή ηεο PCR. Η αληίδξαζε ηεο PCR εθηειείηαη κε δχν εμεηδηθεπκέλνπο εθθηλεηέο ζπκπιεξσκαηηθνχο εθαηέξσζελ ησλ θισλνπνηεκέλσλ άθξσλ. SNPs Οη SNPs κνξηαθνί δείθηεο αλαθέξνληαη ζε δηαθνξνπνίεζε ζε επίπεδν αιιεινπρίαο DNA φπνπ έλα λνπθιενηίδην (A, T, C ή G) ζε έλα ζεκείν ηνπ γνληδηψκαηνο δηαθέξεη κεηαμχ ησλ αηφκσλ ελφο είδνπο ή ελφο πιεζπζκνχ (Δηθφλα 1.9). Γηα παξάδεηγκα, νη αιιεινπρίεο TTGGCTA θαη TTGGTTA απνηεινχλ ηκήκαηα ηεο ίδηαο γνληδηαθήο ζέζεο θαη δηαθέξνπλ ζε έλα λνπθιενηίδην. Η πξψηε αιιεινπρία έρεη ζηελ 5ε ζέζε κία θπηνζίλε (C), ελψ ε δεχηεξε κία ζπκίλε (Σ). ηελ πεξίπησζε απηή ζεσξνχκε φηη απηά απνηεινχλ δχν αιιειφκνξθα ηεο ζπγθεθξηκέλεο γνληδηαθήο ζέζεο. ρεδφλ φια ηα SNPs έρνπλ κφλν δχν δηαθνξεηηθέο θαηαζηάζεηο ζε φια ηα άηνκα, δειαδή έρνπλ κφλν δχν αιιειφκνξθα θαη γη απηφ νλνκάδνληαη δη-αιιειηθά. Αλ θαη ηερληθά ηα SNPs είλαη έλαο άιινο ηξφπνο λα θνηηάμνπκε ηελ δηαθνξνπνίεζε ζε επίπεδν DNA (αιιεινπρίαο), απνηεινχλ κηα μερσξηζηή νκάδα γελεηηθψλ δεηθηψλ, επεηδή ζπληζηνχλ κηα πξνζέγγηζε γηα ηελ εχξεζε πιεξνθνξηαθψλ αιιεινπρηθψλ δεδνκέλσλ. 40

41 Δηθόλα 1.9: Παξάδεηγκα κνξηαθνύ δείθηε SNP. ηαλ ν έιεγρνο ηεο δηαθνξνπνίεζεο ησλ αηφκσλ ελφο πιεζπζκνχ γίλεηαη κε αιιεινχρηζε ηνπ DNA, ηφηε απαηηείηαη ζχγθξηζε ησλ παξαγφκελσλ αιιεινπρηψλ ησλ ππφ εμέηαζε αηφκσλ γηα λα δνχκε πφζε δηαθνξνπνίεζε ππάξρεη. Αληίζεηα ζηα SNPs ζα πξέπεη αξρηθά λα αλαγλσξηζηνχλ θαη λα ηαμηλνκεζνχλ σο SNPs θαη ζηε ζπλέρεηα λα ρξεζηκνπνηεζνχλ γηα λα ραξαθηεξηζηνχλ γελεηηθά ηα άηνκα ελφο πιεζπζκνχ. Σα SNPs κπνξνχλ λα αλαγλσξηζηνχλ είηε κε έλα άκεζν ηξφπν φπνπ γίλεηαη αιιεινχρηζε ζπγθεθξηκέλσλ ηκεκάησλ DNA πνπ έρνπλ πνιιαπιαζηαζηεί κέζσ ηεο PCR κε γεληθνχο ή εηδηθνχο εθθηλεηέο είηε κέζσ αιιεινχρηζεο «αλψλπκσλ» γνληδηαθψλ ζέζεσλ πνπ έρνπλ πνιιαπιαζηαζηεί κε κεζφδνπο πνπ ζηνρεχνπλ ζε πνιιέο γνληδηαθέο ζέζεηο ηαπηφρξνλα (AFLPs). O ξπζκφο κεηάιιαμεο ησλ SNPs είλαη ηεο ηάμεο ηνπ (Brumfield θ.ά. 2003), πνπ είλαη κηθξφηεξνο ησλ κηθξνδνξπθνξηθψλ. Ωο εθ ηνχηνπ ηα SNPs απνηεινχλ έλα πνιιά ππνζρφκελν γελεηηθφ δείθηε γηα ηελ απνζαθήληζε εξσηεκάησλ ηεο πιεζπζκηαθήο γελεηηθήο. Ωζηφζν, ηα SNPs έρνπλ πνιχ κηθξή ηζηνξία θαη θαζψο ν αξηζκφο ηνπο απμάλεη είλαη πηζαλφ λα απνδεηρζνχλ πνιχ ρξήζηκα ζε έλα κεγάιν εχξνο εθαξκνγψλ, φπσο γηα ηελ ηαπηνπνίεζε αηφκσλ θαη ηελ εθηίκεζε ηεο γελεηηθήο πνηθηιφηεηαο κέζα ζηνπο πιεζπζκνχο (Morin θ.ά. 2004). Τπάξρεη έλα αξηζκφο απφ κεζφδνπο πνπ ρξεζηκνπνηνχληαη γηα ηελ εχξεζε SNPs ζε κηα γνληδηαθή πεξηνρή φπσο ε απεπζείαο αιιεινχρηζε, ν πνιπκνξθηζκφο δηακφξθσζεο απιήο αιπζίδαο (SSCP), ρεκηθή πέςε ιάζνο δεπγαξσκάησλ (CCM), ε ελδπκηθή πέςε ιάζνο δεπγαξψκαηνο (EMC) θαη ε ζχγθξηζε θακππιψλ ηήμεο ζε πςειή αλάιπζε (HRM). 41

42 Λεηηνπξγηθή πνηθηιόηεηα Ο ραξαθηεξηζκφο ηεο γελεηηθήο πνηθηιφηεηαο ηφζν ζε θπζηθνχο πιεζπζκνχο φζν θαη κεηαμχ βειηησκέλσλ πνηθηιηψλ είλαη δσηηθήο ζεκαζίαο γηα ηελ απνηειεζκαηηθή δηαηήξεζε θαη αμηνπνίεζε ησλ γελεηηθψλ πφξσλ ζηα δηάθνξα πξνγξάκκαηα βειηίσζεο ησλ θπηψλ. Μνξηαθνί δείθηεο έρνπλ απνδεηρζεί κέρξη ζήκεξα ρξήζηκα εξγαιεία γηα ηελ εθηίκεζε ηεο γελεηηθήο πνηθηιφηεηαο ζε ζπιινγέο γελεηηθνχ πιηθνχ (Haussmann θ.ά. 2004; Maccaferri θ.ά. 2006). Η αμηνιφγεζε ηνπ γελεηηθνχ πιηθνχ κε ηνπο GMM κνξηαθνχο δείθηεο κπνξεί λα εληζρχζεη ην ξφιν ησλ γελεηηθψλ δεηθηψλ αλαιχνληαο ηελ παξαιιαθηηθφηεηα ζηα κεηαγξαθηθά θαη γλσζηήο ιεηηνπξγίαο γνλίδηα (Varshney θ.ά. 2005). Δλψ νη γνληδηαθνί SSR κνξηαθνί δείθηεο ρξεζηκνπνηήζεθαλ γηα κειέηεο γελεηηθήο πνηθηιφηεηαο κπνξνχλ λα δνθηκαζηνχλ θαη γηα ηελ ζχλδεζε ηνπο κε ηελ θαηλνηππηθή παξαιιαθηηθφηεηα ή κε θάπνηα βηνινγηθή ιεηηνπξγία (Ayers θ.ά. 1997). Η παξνπζία ησλ SSR ζηα κεηαγξαθήκαηα ησλ γνληδίσλ ππνδειψλεη φηη ζα κπνξνχζαλ λα έρνπλ έλα ξφιν ζηελ γνληδηαθή έθθξαζε ή ιεηηνπξγία. Ωζηφζν, δελ έρεη αθφκε πξνζδηνξηζηεί εάλ θάπνηα αζπλήζηζηε θαηλνηππηθή παξαιιαθηηθφηεηα ζα κπνξνχζε λα ζρεηίδεηαη κε ην κήθνο ησλ SSRs ζηηο θσδηθνπνηεκέλεο πεξηνρέο, φπσο έρεη αλαθεξζεί γηα δηάθνξεο αζζέλεηεο ζην αλζξψπηλν (Cummings θαη Zoghbi 2000). Παξάιιεια, ε ρξήζε ησλ κνξηαθψλ δεηθηψλ SNP γηα κειέηεο πνηθηιφηεηαο κπνξεί λα ζπζρεηίζεη ηα SNPs ησλ θσδηθνπνηεκέλσλ ελάληηα ησλ κε-θσδηθνπνηεκέλσλ πεξηνρψλ ηνπ γνληδίνπ κε ηελ παξαιιαθηηθφηεηα ηνπ ραξαθηεξηζηηθνχ γλσξίζκαηνο. Η παξαιιαθηηθφηεηα πνπ ζπλδέεηαη κε επηβιαβείο ραξαθηήξεο, φκσο, είλαη ιηγφηεξν πηζαλφ λα εθπξνζσπεζεί ζην γελεηηθφ πιηθφ ησλ θαιιηεξγνχκελσλ εηδψλ απφ φ, ηη κεηαμχ ησλ θπζηθψλ πιεζπζκψλ, επεηδή νη αλεπηζχκεηεο κεηαιιάμεηο ζπλήζσο επηιέγνληαη απφ ηνπο βειηησηηθνχο πιεζπζκνχο (Cho θ.ά. 2000). Γηάθνξεο κειέηεο πνπ αθνξνχλ ιεηηνπξγηθνχο κνξηαθνχο δείθηεο έρνπλ βξεζεί ρξήζηκεο αθελφο γηα ηελ εθηίκεζε ησλ γελεηηθψλ ζρέζεσλ (βιέπε Varshney θ.ά. (2005)) αθεηέξνπ γηα ηελ εμέηαζε ηεο ιεηηνπξγηθήο πνηθηιφηεηαο ζε ζρέζε κε ηελ πξνζαξκνζηηθή παξαιιαθηηθφηεηα (Eujayl θ.ά. 2001). Θεσξείηαη πηζαλφ φηη κε ηελ αλάπηπμε ησλ ιεηηνπξγηθψλ δεηθηψλ ζηα πεξηζζφηεξν ζεκαληηθά θαιιηεξγνχκελα είδε ε κειέηε ηεο γελεηηθήο πνηθηιφηεηαο ζα γίλεη πην νπζηαζηηθή απφ ηελ αιιαγή ζηελ έκθαζε πνπ δίλεηαη 42

43 απφ ηελ αμηνιφγεζε ηεο αλψλπκεο πνηθηιφηεηαο (anonymous diversity) ζε ιεηηνπξγηθή γελεηηθή πνηθηιφηεηα ζην εγγχο κέιινλ. Παξφιν απηά, νη νπδέηεξνη κνξηαθνί δείθηεο ζα παξακείλνπλ λα είλαη ρξήζηκνη ζηηο πεξηπηψζεηο φπνπ α) νη ιεηηνπξγηθνί δείθηεο δελ είλαη θαη β) γηα ηελ αληηκεηψπηζε ζπγθεθξηκέλσλ ζηφρσλ π.ρ. νπδέηεξε νκαδνπνίεζε ηνπ γελεηηθνχ πιηθνχ. Σύγθξηζε ιεηηνπξγηθώλ (GMMs) θαη νπδέηεξσλ (RDMs) κνξηαθώλ δεηθηώλ. Απφ ηελ αλάπηπμε ησλ πξψησλ κνξηαθψλ δεηθηψλ, δειαδή ηα RFLPs ην 1980 (Botstein θ.ά. 1980), έλα επξχ θάζκα ησλ κνξηαθψλ δεηθηψλ έρνπλ θέξεη ηελ επαλάζηαζε ζηελ θιαζηθή βειηίσζε ησλ θαιιηεξγνχκελσλ θπηηθψλ εηδψλ (Δηθφλα 5). εκαληηθά βήκαηα έρνπλ γίλεη γηα ηε βειηίσζε ησλ θαιιηεξγεηψλ κέζσ ησλ ζπκβαηηθψλ RDMS. Γηα παξάδεηγκα, απηνί νη κνξηαθνί δείθηεο, εθηφο απφ ην λα ξίμνπλ θσο ζηελ νξγάλσζε, ηε δηαηήξεζε θαη ηελ εμέιημε ησλ θπηηθψλ γνληδησκάησλ, έρνπλ βνεζήζεη, επίζεο, γελεηηζηέο θαη νη βειηησηέο ησλ θπηψλ κε γνλίδηα ζεκαληέο ψζηε λα θαηαζθεπάζνπλ ράξηεο QTL γηα ραξαθηεξηζηηθά κε νηθνλνκηθή ζεκαζία. Αθφκα, νη πεξηζζφηεξνη απφ απηνχο είλαη «αλψλπκνη» δείθηεο, δειαδή ε βηνινγηθή ιεηηνπξγία ηνπο είλαη άγλσζηε. πγθξηηηθά, κηα ππνζεηηθή ιεηηνπξγία γηα ηελ πιεηνςεθία ησλ κνξηαθψλ δεηθηψλ, πνπ πξνέξρνληαη απφ ηα γνλίδηα ή ηα ESTs, σζηφζν, κπνξεί λα πξνθχςεη ρξεζηκνπνηψληαο εξγαιεία βηνπιεξνθνξηθήο: νη ελ ιφγσ δείθηεο GMMs ζπλήζσο αλαθέξνληαη ζαλ ιεηηνπξγηθνί δείθηεο (Varshney θ.ά. 2005). Παξά ην γεγνλφο φηη, κε ηελ ζηελή έλλνηα ηνπ φξνπ, νη ιεηηνπξγηθνί δείθηεο βαζίδνληαη ζε ιεηηνπξγηθά γνλίδηα ζηα νπνία νθείινληαη εηδηθέο βηνρεκηθέο ή θπζηνινγηθέο ιεηηνπξγίεο θαη σο εθ ηνχηνπ ε FMs κπνξεί λα ζεσξεζεί σο κηα θαηεγνξία ησλ GMMs (Καηersen θαη Lübberstedt 2003). Οη ιεηηνπξγηθνί δείθηεο, φπσο θαη νη νπδέηεξνη κπνξνχλ λα αληρλεχζνπλ πνιπκνξθηζκνχο κήθνπο θαη αιιεινπρίαο ζε εθθξαδφκελεο πεξηνρέο ηνπ γνληδηψκαηνο αιιά παξέρνπλ ηζρπξφηεξε θαη πεξηζζφηεξν απηνκαηνπνηεκέλε δηαδηθαζία αλάιπζεο. Ωζηφζν ζπγθξηηηθά κε ηνπο νπδέηεξνπο δείθηεο ηα έμνδα αλάπηπμεο ησλ ιεηηνπξγηθψλ δεηθηψλ εμαξηψληαη απφ πηα ζπγθεθξηκέλε θαηεγνξία ησλ GMMs πξφθεηηαη λα αλαπηπρζεί (Πίλαθαο 1.1). Δλ νιίγνηο, εάλ νη ιεηηνπξγηθνί δείθηεο βαζίδνληαη ζε πνιπκνξθηθή ζέζε θαη απηφ επαιεζεπηεί, νη δείθηεο απηνί είλαη αλψηεξνη απφ ηνπο νπδέηεξνπο φζνλ αθνξά ηε ρξήζε ηνπο σο δηαγλσζηηθά εξγαιεία ζην ζηελ επηινγή ππνβνεζνχκελε κε κνξηαθνχο δείθηεο (MAS) (Andersen θαη Lübberstedt 2003). 43

44 Πίλαθαο 1.1: ύγθξηζε ιεηηνπξγηθώλ (GMMs) θαη νπδέηεξσλ (RDMs) κνξηαθώλ δεηθηώλ. Υαξαθηεξηζηηθό GMMs RDMs SSRs, SNPs RFLPs RAPD/AFLP/ ISSR Γεδνκέλα απφ Αλάγθε γηα γνλίδηα/ests Γελ δεδνκέλα Απαξαίηεηα είλαη απαηηείηαη αιιεινπρίαο απαξαίηεηα Γελ απαηηείηαη Κόζηνο παξαγσγήο Υακειφ Τςειφ Τςειφ Μέηξηα ρακειφ Υέξηα εξγαζίαο Λίγα Πνιιά Πνιιά Λίγα Δπίπεδν πνιπκνξθηζκνύ Υακειφ Τςειφ Υακειφ Μέηξηα ρακειφ Μεηαθνξά ζε άιια είδε Τςειή Υακειή Τςειή Μέηξηα ρακειή Λεηηνπξγίεο ησλ δεηθηώλ Υξεζηκόηεηα ζηελ ππνβνεζνύκελε από κνξηαθνύο δείθηεο επηινγή Γλσζηέο ηηο πεξηζζφηεξεο θνξέο Άγλσζηεο ηηο πεξηζζφηεξεο θνξέο Άγλσζηεο Άγλσζηεο Δμαηξεηηθνί Τςειή Υακειή Υακειή Σύγθξηζε θακππιώλ ηήμεο ζε πςειή αλάιπζε (HRM) Η ζχγθξηζε θακππιψλ ηήμεο ζε πςειή αλάιπζε (HRM) έρεη εηζαρζεί αξθεηά ρξφληα πξηλ, επεθηείλνληαο ηηο δπλαηφηεηεο ηεο αλάιπζεο ησλ θακππιψλ ηήμεο ηνπ DNA απφ έλα πξφηππν δηαγλσζηηθφ ραξαθηεξηζηηθφ γλψξηζκα ζηελ πνζνηηθή PCR (Wilhelm θαη Pingoud 2003) ζε κηα επαίζζεηε κέζνδν αλίρλεπζεο κεηαιιάμεσλ. Σν βαζηθφ πεδίν ηεο εθαξκνγήο είλαη ν αμηφπηζηνο θαη γξήγνξνο πξνζδηνξηζκφο ησλ κνξηαθψλ δεηθηψλ SNP (Wu θ.ά. 2008) (Δηθφλα 1.10), φπνπ ε επαηζζεζία ηεο κεζφδνπ ήδε έρεη απνδεηρηεί επξέσο (Reed θαη Wittwer 2004). Δπίζεο ρξεζηκνπνηείηαη γηα ηελ εχξεζε ηεο κεζπιίσζεο ηνπ DNA (Wojdacz θαη Dobrovic 2007). Δπηπιένλ, ε HRM αλάιπζε έρεη απνδεηρηεί φηη έρεη εθαξκνγή θαη γηα κεγαιχηεξεο παξεθθιίζεηο ζηελ αιιεινπρία φπσο νη ITDs (Vaughn θαη Elenitoba-Johnson 2004). Υξεζηκνπνηήζεθε γηα ηελ αλίρλεπζε ησλ άγλσζησλ κεηαιιάμεσλ ζε κηα πεξηνρή ρακειήο πνιππινθφηεηαο (Price θ.ά. 2007) θαη πξφζθαηα επίζεο γηα ηελ αλάιπζε ησλ SSRs κε ζθνπφ ηελ ηαπηνπνίεζε πνηθηιηψλ ακπέινπ θαη ειηάο 44

45 (Mackay θ.ά. 2008). Η HRM κπνξεί λα ζεσξεζεί σο απφγνλνο ηεο ηερλνινγίαο qpcr, φπνπ νη θζνξίδνπζεο ρξσζηηθέο νπζίεο ρξεζηκνπνηνχληαη γηα λα αληρλεχζνπλ ηελ πνζφηεηα ηνπ dsdna θαηά ηε δηάξθεηα ηεο PCR. ην ηέινο ηεο PCR, ην επίπεδν ζεκάησλ θζνξηζκνχ είλαη πςειφ, ιφγσ ηεο πςειήο πνζφηεηαο ηνπ dsdna κε ηε ρξσζηηθή νπζία θζνξηζκνχ πνπ ζπζζσξεχεηαη ζηε δηαδηθαζία. Σα δηκεξή ησλ εθθηλεηψλ θαη άιια αλεπηζχκεηα πξντφληα κπνξνχλ ζηε ζπλέρεηα λα δηαρσξηζηνχλ ζηα πεξηζζφηεξα φξγαλα qpcr κε ηελ ηήμε ηνπ dsdna θαη κηαο ζηαδηαθήο κέηξεζεο ηνπ κεησκέλνπ θζνξηζκνχ. Η απφζηαζε κεηαμχ ησλ ηηκψλ ηνπ Tm επηηξέπεη ηε δηάθξηζε ηνπ πξντφληνο ζηφρνπ θαη ησλ αλεπηζχκεησλ πξντφλησλ (Wilhelm θαη Pingoud 2003). Η ηερλνινγηθή πξφνδνο δηεπθφιπλε κηα κείσζε ηεο απφζηαζεο ησλ βαζκψλ ζεξκνθξαζίαο κεηαμχ ησλ ζεκείσλ κέηξεζεο θζνξηζκνχ ζηε δηαδηθαζία ηήμεο ζηελ ηάμε ησλ δεθάησλ. Απηφ δίλεη ηε δπλαηφηεηα γηα ηελ παξαγσγή πεξηζζνηέξσλ δεδνκέλσλ θαη ηε ζρεδίαζε κηαο πςειήο αλάιπζεο θακπχιεο ηνπ επηπέδνπ θζνξηζκνχ (Δηθφλα 1.10). Οη ιακβαλφκελεο θακπχιεο HRM είλαη ηδηαίηεξα ραξαθηεξηζηηθέο γηα θάζε εληζρπκέλν πξντφλ θαη εμαξηψληαη απφ ην πεξηερφκελν ζε GC, ην κήθνο ηνπ εληζρπκέλνπ πξντφληνο θαη ηελ αιιεινπρία ησλ βάζεσλ ζε απηφ (Ririe θ.ά. 1997). Δηθόλα 1.10: Αλίρλεπζε κνξηαθώλ δεηθηώλ SNP κε HRM αλάιπζε. 45

46 Η παξαιιαθηηθφηεηα ζηηο SSR πεξηνρέο απεηθνλίδεηαη ζπρλά απφ ηελ ειεθηξνθφξεζε ζε πεθηέο (metaphor ή πνιπαθξπιακίδεο) πνπ είλαη θπξίσο επαίζζεηεο κφλν σο πξνο ην κήθνο ηνπ εληζρπκέλνπ πξντφληνο. Η ειεθηξνθφξεζε ζε πεθηέο είλαη φρη κφλν ρξνλνβφξα, αιιά κπνξεί επίζεο λα νδεγήζεη ζε πξνβιήκαηα ζηελ αλάιπζε ιφγσ ζνιψλ δσλψλ. ήκεξα ε θνηλή κέζνδνο αλάιπζεο ησλ κνξηαθψλ δεηθηψλ SSR είλαη ε ειεθηξνθφξεζε ζε ηξηρνεηδή πνπ απαηηεί ηε ρξήζε επηζεκαζκέλσλ εθθηλεηψλ. Η κέζνδνο απηή απαηηεί ηνπιάρηζηνλ έλα επηπξφζζεην βήκα κεηά ηελ PCR ελψ παξακέλεη ην πξφβιεκα ηνπ πςεινχ θφζηνπο ηεο αλάιπζεο. Πνιπκνξθηζκνί αιιεινκόξθσλ γακεηνθπηηθνύ απηναζπκβίβαζηνπ Η πιεηνςεθία ησλ αλζνθφξσλ θπηψλ παξάγεη ηέιεηα άλζε πνπ πεξηέρνπλ ηφζν ηα αξζεληθά φζν θαη ηα ζειπθά αλαπαξαγσγηθά φξγαλα ζε κηθξή απφζηαζε κεηαμχ ηνπο. πλεπψο, ζα αλακελφηαλ πςειή έθηαζε απηνγνληκνπνίεζεο εάλ δελ ππήξραλ κεραληζκνί παξεκπφδηζεο ηνπ ζπγθεθξηκέλνπ θαηλνκέλνπ. Οη απφγνλνη πνπ είλαη πξντφληα απηφεπηθνλίαζεο παξνπζηάδνπλ κεησκέλε πξνζαξκνζηηθφηεηα. Έηζη ηα θπηά έρνπλ πηνζεηήζεη πιεζψξα κεραληζκψλ ξχζκηζεο ηεο αλαπαξαγσγήο, φπσο ην απηναζπκβίβαζην, κέζσ ησλ νπνίσλ εκπνδίδεηαη ε απηφ-γνληκνπνίεζε θαη επλνείηαη ε ζηαπξφ-γνληκνπνίεζε. Σν απηναζπκβίβαζην δίλεη ηελ δπλαηφηεηα ζηνλ χπεξν ελφο άλζνπο λα δηαθξίλεη κεηαμχ γελεηηθά ζπγγελνχο (απηφ-) θαη γελεηηθά κε ζπγγελνχο (ζηαπξφ-) γχξεο. Η αλαγλψξηζε ηεο γχξεο ησλ ζπγθεθξηκέλσλ θαηεγνξηψλ νδεγεί ζηελ αλαζηνιή ηεο βιάζηεζεο ηνπ γπξενθφθθνπ ζηε ζηηγκαηηθή επηθάλεηα ή ζηελ αλαζηνιή ηεο αλάπηπμεο ηνπ γπξενζσιήλα ζην εζσηεξηθφ ηνπ ζηχινπ. πλεπψο, ην απηναζπκβίβαζην είλαη έλαο πξνδπγσηηθφο αλαπαξαγσγηθφο θξαγκφο κέζσ ηνπ νπνίνπ αζπκβίβαζηνη γπξεφθνθθνη/γπξενζσιήλεο εκπνδίδνληαη απφ ην λα ελαπνζέζνπλ ηα ζπεξκαηηθά θχηηαξα ζηελ σνζήθε θαη λα πξαγκαηνπνηεζεί ε γνληκνπνίεζε (Δηθφλα 1.11). 46

47 Δηθόλα 1.11: Μεραληζκόο γακεηνθπηηθνύ απηναζπκβίβαζηνπ. Πνηθηιόηεηα S-αιιεινκόξθσλ Η κειέηε ησλ ζπζηεκάησλ γακεηνθπηηθνχ απηναζπκβίβαζηνπ μεθίλεζε κε ηε ρξήζε δη-αιιειηθψλ ζρεδίσλ δηαζηαχξσζεο γηα λα εθηηκεζεί ν αξηζκφο ησλ S- αιιεινκφξθσλ ζε θπζηθνχο πιεζπζκνχο (Lawrence 2000). Απηέο νη κειέηεο έδεημαλ φηη έλαο κεγάινο αξηζκφο αιιεινκφξθσλ ήηαλ παξφλ ζε θπζηθνχο πιεζπζκνχο νθηψ εηδψλ κε GSI απηναζπκβίβαζην φπσο πξνβιέπεηαη θάησ απφ επηινγή εμαξηψκελε απφ ηηο ζπρλφηεηεο. Πξφζθαηα, ε πξφνδνο ζηελ θαηαλφεζε ηεο κνξηαθήο βάζεο ησλ ζπζηεκάησλ αζπκβίβαζηνπ ζε δηάθνξεο νηθνγέλεηεο θπηψλ επέηξεςε ηελ αλάπηπμε κεζφδσλ πνπ βαζίδνληαη ζηελ PCR θαη έρνπλ σο ζηφρν ηε κειέηε ηεο παξαιιαθηηθφηεηαο ησλ S- αιιεινκφξθσλ. Με ηηο κεζφδνπο πνπ βαζίδνληαη ζηελ PCR είλαη δπλαηφ λα εληνπηζηνχλ S-αιιειφκνξθα θαη λα επηηξαπεί ε κειέηε ηεο πνηθηιφηεηαο θαη ηνπ αξηζκνχ ησλ S- αιιεινκφξθσλ. Βαζηθφ ξφιν ζηελ αλάπηπμε ηεο έξεπλαο απηήο έπαημε ε δηαπίζησζε φηη έλδπκα RNaζών δεκηνπξγνχληαη ζηνλ ζηχιν ηεο γακεηνθπηηθήο S-γνληδηαθήο ζέζεο θαη είλαη ππεχζπλεο γηα ηελ αλαγλψξηζε ηεο γχξεο θαη ηελ απφξξηςε ηνπο, ζε ηξείο νηθνγέλεηεο θπηψλ ηα Solanaceae, ηα Scrophulariaceae θαη ηα Rosaceae (McClure θαη Franklin-Tong 2006; Sassa θ.ά. 2010). Γηα ηα θπηά κε γακεηνθπηηθφ απηφ-αζπκβίβαζην ζχζηεκα, ν (Wright 1939) πξνέβιεςε φηη σο κέηξηαο ζπρλφηεηαο κεηάιιαμε ηεο ηάμεσο ηνπ 10 3, έλαο πιεζπζκφο 50 αηφκσλ κπνξεί λα ππνθξχπηεη έσο θαη 8 S-αιιειφκνξθα, ελψ έλαο πιεζπζκφο 200 αηφκσλ ελδέρεηαη λα πεξηέρεη πεξίπνπ 15 S-αιιειφκνξθα. Μεηαγελέζηεξεο εκπεηξηθέο κειέηεο ηεο πνηθηιφηεηαο ησλ S-αιιεινκφξθσλ, κε ηε ρξήζε δηα-αιιειηθψλ ζρεκάησλ 47

48 δηαζηαχξσζεο ή κνξηαθέο-γελεηηθέο πξνζεγγίζεηο γηα ηνλ ππνινγηζκφ ησλ S-γελνηχπσλ, έδεημαλ φηη ε παξαηεξνχκελε πνηθηιφηεηα εληφο ησλ πιεζπζκψλ είλαη πξάγκαηη πςειή (Castric θαη Vekemans 2004; Lawrence 2000). Βηβιηνγξαθία Aggarwal, R. K., Hendre, P. S., Varshney, R. K., Bhat, P. R., Krishna, K. V. and Singh, L Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet 114: Andersen, J. R. and Lübberstedt, T Functional markers in plants. Trends in Plant Science 8(11): Barnes, S Comparing Arabidopsis to other flowering plants. Curr Opin Plant Biol 5(2): Botstein, D., White, R. L., Skolnick, M. and Davis, R. W Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32(3): Bowers, J. E., Abbey, C., Anderson, S., Chang, C., Draye, X., Hoppe, A. H., Jessup, R., Lemke, C., Lennington, J., Li, Z. and others A high-density genetic recombination map of sequence-tagged sites for sorghum, as a framework for comparative structural and evolutionary genomics of tropical grains and grasses. Genetics 165(1): Breyne, P. and Zabeau, M Genome-wide expression analysis of plant cell cycle modulated genes. Curr Opin Plant Biol 4(2): Castric, V. and Vekemans, X Plant self-incompatibility in natural populations: a critical assessment of recent theoretical and empirical advances. Molecular Ecology 13(10): Cho, Y. G., Ishii, T., Temnykh, S., Chen, X., Lipovich, L., McCouch, S. R., Park, W. D., Ayres, N. and Cartinhour, S Diversity of microsatellites derived from genomic libraries and GenBank sequences in rice (Oryza sativa L.). Theoretical and Applied Genetics 100(5): Collins, N. C., Webb, C. A., Seah, S., Ellis, J. G., Hulbert, S. H. and Pryor, A The isolation and mapping of disease resistance gene analogs in maize. Mol Plant Microbe Interact 11(10): Cummings, C. J. and Zoghbi, H. Y Fourteen and counting: unraveling trinucleotide repeat diseases. Human Molecular Genetics 9(6): Denli, A. M. and Hannon, G. J RNAi: an ever-growing puzzle. Trends Biochem Sci 28(4): Erskine, W. and Muehlbauer, F. J Allozyme and morphological variability, outcrossing rate and core collection formation in lentil germplasm. Theoretical and Applied Genetics 83(1): Eujayl, I., Sorrells, M., Baum, M., Wolters, P. and Powell, W Assessment of genotypic variation among cultivated durum wheat based on EST-SSRs and genomic SSRs. Euphytica 119(1-2): Freeling, M Grasses as a single genetic system: reassessment Plant Physiol 125(3):

49 Freville, H., Justy, F. and Olivieri, I Comparative allozyme and microsatellite population structure in a narrow endemic plant species, Centaurea corymbosa Pourret (Asteraceae). Molecular Ecology 10(4): Garvin, D. F. and Weeden, N. F Genetic Linkage Between Isozyme, Morphological, and DNA Markers in Tepary Bean. Journal of Heredity 85(4): Godwin, I. D., Aitken, E. A. and Smith, L. W Application of inter simple sequence repeat (ISSR) markers to plant genetics. Electrophoresis 18(9): Gupta, P. K. and al., e Molecular markers: principles and methodology. In Molecular Techniques in Crop Improvement (Jain, S.M. θ.ά., eds). Kluwer Academic Publishers:9-54. Hamrick, J. L. and Godt, M. J. W Allozyme diversity in cultivated crops. Crop Science 37(1): Haussmann, B. I. G., Hess, D. E., Omanya, G. O., Folkertsma, R. T., Reddy, B. V. S., Kayentao, M., Welz, H. G. and Geiger, H. H Genomic regions influencing resistance to the parasitic weed Striga hermonthica in two recombinant inbred populations of sorghum. Theoretical and Applied Genetics 109(5): Henry, R. J Plant Genotyping. Jansen, R. C. and Nap, J. P Genetical genomics: the added value from segregation. Trends Genet 17(7): Lamboy, W. F The Accuracy of the Maximum Parsimony Method for Phylogeny Reconstruction with Morphological Characters. Systematic Botany 19(4): Lawrence, M. J Population Genetics of the Homomorphic Self-incompatibility Polymorphisms in Flowering Plants. Annals of Botany 85(suppl 1): Maccaferri, M., Sanguineti, M. C., Natoli, V., Ortega, J. L. A., Salem, M. B., Bort, J., Chenenaoui, C., De Ambrogio, E., del Moral, L. G. and De Montis, A A panel of elite accessions of durum wheat (Triticum durum Desf.) suitable for association mapping studies. Plant Genetic Resources: characterization and utilization 4(01): Mackay, J. F., Wright, C. D. and Bonfiglioli, R. G A new approach to varietal identification in plants by microsatellite high resolution melting analysis: application to the verification of grapevine and olive cultivars. Plant Methods 4:8. Madesis, P., Ganopoulos, I. and Tsaftaris, A Microsatellites: Evolution and Contribution. Pages 1-13 Microsatellites. Springer. May, B. P. and Martienssen, R. A Transposon mutagenesis in the study of plant development. Critical Reviews in Plant Sciences 22(1):1-35. McClure, B. A. and Franklin-Tong, V Gametophytic self-incompatibility: understanding the cellular mechanisms involved in self-pollen tube inhibition. Planta 224(2): Parani, M., Rao, C. S., Mathan, N., Anuratha, C. S., Narayanan, K. K. and Parida, A Molecular Phylogeny of mangroves III Parentage analysis of a Rhizophora hybrid using random amplified polymorphic DNA and restriction fragment length polymorphism markers. Aquatic Botany 58(2): Price, E. P., Smith, H., Huygens, F. and Giffard, P. M High-resolution DNA melt curve analysis of the clustered, regularly interspaced short-palindromic-repeat locus of Campylobacter jejuni. Applied and Environmental Microbiology 73(10): Quint, M., Mihaljevic, R., Dussle, M., Xu, L., Melchinger, E. and Lubberstedt, T Development of RGA-CAPS markers and genetic mapping of candidate 49

50 genes for sugarcane mosaic virus resistance in maize. Theor Appl Genet 105(2-3): Rafalski, J. A. and Tingey, S. V Genetic diagnostics in plant breeding: RAPDs, microsatellites and machines. Trends Genet 9(8): Reed, G. H. and Wittwer, C. T Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clinical Chemistry 50(10): Ririe, K. M., Rasmussen, R. P. and Wittwer, C. T Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245(2): Ronning, C. M. and Schnell, R. J Allozyme Diversity in a Germplasm Collection of Theobroma cacao L. Journal of Heredity 85(4): Ronning, C. M., Stegalkina, S. S., Ascenzi, R. A., Bougri, O., Hart, A. L., Utterbach, T. R., Vanaken, S. E., Riedmuller, S. B., White, J. A., Cho, J. and others Comparative analyses of potato expressed sequence tag libraries. Plant Physiol 131(2): Sassa, H., Kakui, H. and Minamikawa, M Pollen-expressed F-box gene family and mechanism of S-RNase-based gametophytic self-incompatibility (GSI) in Rosaceae. Sexual plant reproduction 23(1): Schmitt, B. A., Costa, J. H. and Melo, D. F. d AOX - A functional marker for efficient cell reprogramming under stress? Trends Plant Sci 11: Stuber, C. W., Polacco, M. L. and Senior, M. L Synergy of Empirical Breeding, Marker Assisted selection and Genomics to Increase Crop Yield Potential. Crop Science 39: Sunnucks, P Efficient genetic markers for population biology. Trends in Ecology and Evolution 15(5): Todd, Μ. and Jackson S The First 50 Plant Genomes. The Plant Genome 6.2. Varshney, R. K., Graner, A. and Sorrells, M. E Genic microsatellite markers in plants: features and applications. Trends in Biotechnology 23(1): Vaughn, C. P. and Elenitoba-Johnson, K. S. J High-resolution melting analysis for detection of internal tandem duplications. Journal of Molecular Diagnostics 6(3): Walden, R T-DNA tagging in a genomics era. Critical Reviews in Plant Sciences 21(3): Ware, D. H., Jaiswal, P., Ni, J., Yap, I. V., Pan, X., Clark, K. Y., Teytelman, L., Schmidt, S. C., Zhao, W., Chang, K. and others Gramene, a tool for grass genomics. Plant Physiol 130(4): Warnke, S. E., Douches, D. S. and Branham, B. E Isozyme analysis supports allotetraploid inheritance in tetraploid creeping bentgrass (Agrostis palustris Huds.). Crop Science 38(3): Wilhelm, J. and Pingoud, A Real-time polymerase chain reaction. Chembiochem 4(11): Wojdacz, T. K. and Dobrovic, A Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Research 35(6). Wright, S The distribution of self-sterility alleles in populations. Genetics 24(4): Wu, Z. D., Soliman, K. M., Bolton, J. J., Saba, S. and Jenkins, J. N Identification of differentially expressed genes associated with cotton fiber 50

51 development in a chromosomal substitution line (CS-B22sh). Functional & Integrative Genomics 8(2): Zietkiewicz, E., Rafalski, A. and Labuda, D Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20(2): Νηάθεο,., Παπαζηεξγηάδνπ, Δ., Γεσξγίνπ, Κ., Μπακπαιώλαο, Γ., Γεσξγηάδεο, Θ., Παπαγεσξγίνπ, Μ., Λαδαξίδνπ, Θ. and Σζηανύζε, Β Οδεγία 92/43/ΔΟΚ. Σν Έξγν Οηθνηφπσλ ζηελ Διιάδα: Γίθηπν ΦΤΗ πκβφιαην αξηζκφο Β4-3200/94/756, Γελ Γηεχζπλζε ΥΙ Δπηηξνπή Δπξσπατθψλ Κνηλνηήησλ, Μνπζείν Γνπιαλδξή Φπζηθήο Ιζηνξίαο - Διιεληθφ Κέληξν Βηνηφπσλ Τγξνηφπσλ. Σζαπηάξεο, Α., Πνιύδσξνο Α. θαη Νηάληνπ-Οκπετληάη, Η Βειηίσζε Φπηψλ. Θεζζαινλίθε. 51

52 Κεθάιαην 2: Τιηθά θαη Μέζνδνη 2.1 Φπηηθό γελεηηθό πιηθό Σν θπηηθφ γελεηηθφ πιηθφ πνπ ρξεζηκνπνηήζεθε πεξηιακβάλεη είθνζη κία θαιιηεξγνχκελεο πνηθηιίεο θεξαζηάο, πέληε θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο ηνπ ειιαδηθνχ ρψξνπ, έμη ππνθείκελα θεξαζηάο θαη κεηαπνηεκέλα πξντφληα θεξαζηάο. Γηα ηελ αλάιπζε πνηθηιηψλ θεξαζηάο κε ηελ ρξήζε SSR θαη ISSR κνξηαθψλ δεηθηψλ ρξεζηκνπνηήζεθαλ αξρηθά 21 πνηθηιίεο γηα ηηο νπνίεο ππήξραλ ζηαηηζηηθά ζηνηρεία σο πξνο ηα κνξθν-θπζηνινγηθά ηνπο ραξαθηεξηζηηθά απφ πεηξακαηηθά δεδνκέλα ηνπ Ιλζηηηνχηνπ Φπιινβφισλ Γέλδξσλ. ε είθνζη κία πνηθηιίεο θαιιηεξγνχκελεο θεξαζηάο (Prunus avium L.) ζηελ Διιάδα, αμηνινγήζεθε ε κνξθνινγηθή, θπζηνινγηθή θαη γελεηηθή πνηθηιφηεηα. ιεο απηέο νη πνηθηιίεο βξίζθνληαη ζηελ ειιεληθή ηξάπεδα γελεηηθνχ πιηθνχ ζηελ Νάνπζα (Πίλαθαο 2.1) θαη αληηπξνζσπεχνπλ ηελ γελεηηθή πνηθηιφηεηα ησλ ειιεληθψλ πνηθηιηψλ θεξαζηάο. Οη δεθαελλέα απφ απηέο είλαη ειιεληθέο παξαδνζηαθέο πνηθηιίεο, ελψ νη δχν ( Burlat θαη Van ) ρξεζηκνπνηήζεθαλ σο κάξηπξεο γηα πνζνηηθά ραξαθηεξηζηηθά θαη γηα κνξηαθή αλάιπζε. Οη πνηθηιίεο ήηαλ δηαηεηαγκέλεο ζε δηάηαμε RCBD κε ηξεηο επαλαιήςεηο θαη ηέζζεξα θπηά ζε θάζε πεηξακαηηθή κνλάδα θαη ην πείξακα ήηαλ δηάξθεηαο ηξηψλ εηψλ. Σα θπηά θαιιηεξγήζεθαλ ζε απνκνλσκέλν αγξφ ηνπ Ιλζηηηνχηνπ Φπιινβφισλ Γέλδξσλ θαη εθαξκφζηεθαλ φκνηεο θαη άξηζηεο θαιιηεξγεηηθέο ηερληθέο. Γηα ηελ αλάιπζε ησλ ππνθεηκέλσλ θεξαζηάο κε ηελ ζπλδπαζκέλε ρξήζε κνξηαθψλ δεηθηψλ SSR θαη HRM ρξεζηκνπνηήζεθαλ ηα θπξηφηεξα ππνθείκελα. πγθεθξηκέλα ε αλάιπζε αθνξνχζε ηα ππνθείκελα Cab-6P, Maxma-14, Gisela-5, Gisela-6, Piku-1 θαη PHL-6 ηα νπνία βξίζθνληαη ζε ex situ ζπιινγέο ηνπ Ιλζηηηνχηνπ Φπιινβφισλ Γέλδξσλ. Γηα ηελ αλάιπζε πιεζπζκψλ άγξηαο θεξαζηάο κε ηελ ρξήζε SSR θαη ISSR κνξηαθψλ δεηθηψλ ρξεζηκνπνηήζεθαλ πέληε θπζηθνί πιεζπζκνί άγξηαο θεξαζηάο (Πίλαθαο 2.2), πνπ θαιχπηνπλ ην κεγαιχηεξν κέξνο ηεο βνξείνπ Διιάδνο θαη απνηέιεζαλ αληηθείκελν δεηγκαηνιεςίαο: ηξείο απφ ηελ πεξηνρή ηεο Μαθεδνλίαο (Βφξξαο, Υνινκψληαο, Καηάθπην) θαη δχν απφ ηελ επξχηεξε πεξηνρή ηεο Θξάθεο (Υατληνχ, Νπκθαία). χκθσλα κε ηηο παξαηεξήζεηο ζηελ χπαηζξν νη θπζηθνί πιεζπζκνί απνηεινχληαλ απφ ηνπιάρηζηνλ δέληξα ηα νπνία βξίζθνληαη σο απνκνλσκέλα άηνκα ή ζε κηθξέο νκάδεο ζε νξεηλέο πεξηνρέο (Aravanopoulos θ.ά. 2008). 52

53 Γηα ηνλ έιεγρν απζεληηθφηεηαο ζε επίπεδν πνηθηιίαο ειέγρζεθαλ ηέζζεξηο εκπνξηθέο καξκειάδεο φπσο επίζεο θαη κπηζθφηα πνπ πεξηείραλ θεξάζη. Γχν καξκειάδεο πνπ δεκηνπξγήζεθαλ ζην εξγαζηήξην θαη ρξεζηκνπνηήζεθαλ σο πιηθφ αλαθνξάο. Πίνακασ 1.1: Ποικιλίεσ, κωδικοποίθςθ, ςυχνότθτα και γεωγραφικι καταγωγι των εξεταηόμενων ποικιλιών καλλιεργοφμενθσ κεραςιάσ. No Πνηθηιία Κσδηθνπνίεζε πρλόηεηα Γεσγξαθηθή πεξηνρή 1 Proimo Kolindrou PK πάληα Βφξεηα Διιάδα 2 Tragana Edessis TE Γηαδεδνκέλε Βφξεηα Διιάδα 3 Mpakirtzeika MP Γηαδεδνκέλε Βφξεηα Διιάδα 4 Basiliadi BA πάληα Βφξεηα Διιάδα 5 Tragana Edessis-Naousis TEN Γηαδεδνκέλε Βφξεηα Διιάδα 6 Hybrid Tragana Edessis x Unknown HTEU πάληα Βφξεηα Διιάδα 7 Mavro Anastasias MA πάληα Βφξεηα Διιάδα 8 Kokkino Anastasias KA πάληα Βφξεηα Διιάδα 9 Hybrid Tragana Edessis x Germersdorfer HTEG πάληα Βφξεηα Διιάδα 10 Lemonidi LE πάληα Βφξεηα Διιάδα 11 Agiorgitiko Lilantiou AL πάληα Νφηηα Διιάδα 12 Kifisias KI πάληα Νφηηα Διιάδα 13 Proimo Axaias PA πάληα Νφηηα Διιάδα 14 Mavro Proimo Vitalou MPV πάληα Νφηηα Διιάδα 15 Kapsiotika KAP πάληα Νφηηα Διιάδα 16 Napoleon Karamela NK πάληα Νφηηα Διιάδα 17 Petrokeraso Axaias PEA πάληα Νφηηα Διιάδα 18 Fraoula Volou FV Γηαδεδνκέλε Νφηηα Διιάδα 19 Samou SA πάληα Νφηηα Διιάδα 20 Burlat BU Γηαδεδνκέλε Γηεζλήο 21 Van VA Γηαδεδνκέλε Γηεζλήο 53

54 Πίλαθαο 2.2: Γεσγξαθηθέο ηνπνζεζίαο ησλ θπζηθώλ πιεζπζκώλ αγξηνθεξαζηάο. Δθηηκώκελν Κσδηθνπνίεζε Γεσγξαθηθή Γεσγξαθηθό Γεσγξαθηθό Τςόκεηξν κέγεζνο Μέγεζνο Πιεζπζκνύ ηνπνζεζία πιάηνο κήθνο (m) πιεζπζκνύ δείγκαηνο απνγξαθήο VOR Βφξξαο, Ηκαζία 21 o o HOL Υνινκψληαο, Υαιθηδηθή 23 ν ν KAT Καηάθπην, Γξάκα 23 o o HAI Υατληνχ, Ξάλζε 24 ν ν NIM Νπκθαία, Ρνδφπε 25 o o Δηθόλα 2.1: Άηνκα ηνπ θπζηθνύ πιεζπζκνύ αγξηνθεξαζηάο Καηάθπην. 54

55 2.2 Αλάιπζε ησλ θπζηνινγηθώλ θαη κνξθνινγηθώλ ραξαθηεξηζηηθώλ Σα θχιια ζπιιέρζεθαλ ζε ψξηκν ζηάδην πεξίπνπ ζηα ηέιε ηνπ Ινπιίνπ. Απφ θάζε έλα απφ ηα ηέζζεξα δέλδξα απφ θάζε πνηθηιία, έγηλε δεηγκαηνιεςία εθηά θχιισλ θάζε έηνο θαη κεηξήζεθαλ νη παξαθάησ παξάκεηξνη ρξεζηκνπνηψληαο έλα ειεθηξνληθφ παρχκεηξν κε επαηζζεζία ± 0.01 mm. Σα άλζε ζπιιέρζεθαλ ζε πιήξε άλζεζε (δέθα άλζε απφ θάζε έλα απφ ηα ηέζζεξα δέλδξα θάζε πνηθηιίαο θάζε έηνο). Οη θαξπνί ζπιιέρζεθαλ ζε πιήξε σξηκφηεηα. Η σξίκαλζε ησλ θαξπψλ θαζνξίζηεθε κε βάζε ηα ραξαθηεξηζηηθά ηνπ ρξψκαηνο ησλ ππφ κειέηε πνηθηιηψλ, ιακβάλνληαο ππ φςελ πιεξνθνξίεο πνπ ζπιιέμακε απφ ηνπο θαιιηεξγεηέο, ηελ πξνζσπηθή εκπεηξία θαη ηελ παξαηήξεζε. Έλα δείγκα ζπλνιηθά 106 θαξπψλ ηεο θεξαζηάο, ζπιιέρζεθε απφ θάζε έλα απφ ηα ηέζζεξα ππφ κειέηε δέλδξα απφ θάζε πνηθηιία θάζε έηνο. Απφ ην ζπλνιηθφ δείγκα ηα εθαηφ ρξεζηκνπνηήζεθαλ γηα λα θαζνξίζνπλ ην κέζν βάξνο ηνπ θαξπνχ. Σα ππφινηπα έμη ρξεζηκνπνηήζεθαλ γηα λα πξνζδηνξηζηεί κηα ζεηξά απφ πνηνηηθέο θαη πνζνηηθέο παξακέηξνπο. Γεθαεθηά κνξθνινγηθά θαη βηνρεκηθά ραξαθηεξηζηηθά ησλ θχιισλ, ησλ αλζέσλ θαη ησλ θαξπψλ ρξεζηκνπνηήζεθαλ γηα λα νκαδνπνηήζνπλ θάζε πνηθηιία: απφδνζε παξαγσγήο (kg/tree), ηχπνο θχιινπ (score), αξηζκφο αλζηζκέλσλ νθζαικψλ αλά ζπεξ (score), ζρήκα ησλ ειάζκαηνο (score), ην κήθνο ηνπ ειάζκαηνο (score), ρξφλνο άλζεζεο (εκέξεο), ζρήκα θαξπνχ (score), βάξνο ησλ ζπγθνκηζζέλησλ θαξπψλ (g), κέγεζνο θαξπνχ (score), κέζν κήθνο θαξπνχ (mm, ζε έλα αληηπξνζσπεπηηθφ θπηφ), κέζν πιάηνο θαξπνχ (mm), ρξψκα επηδεξκίδαο θαξπνχ (score), ηξαγαλφηεηα θαξπνχ (score), ρξφλνο ζπγθνκηδήο (εκέξεο), δηαιπηά ζηεξεά (%), νγθνκεξνχκελε νμχηεηα (%) θαη αλαινγία δηαιπηψλ ζηεξεψλ θαη νγθνκεηξνχκελεο νμχηεηαο (score). Απηά ηα ραξαθηεξηζηηθά πξνηείλνληαη απφ ηελ Γηεζλή Έλσζε Πξνζηαζίαο Νέσλ Πνηθηιηψλ ησλ Φπηψλ (UPOV, 1976; IPGRI, 1985). Σν ζχζηεκα γηα ηα απνηειέζκαηα θαη ηε βαζκνλφκεζε είλαη απηφ πνπ ρξεζηκνπνηείηαη απφ ηελ UPOV θαη ηελ IPGRI. Οη κεηξήζεηο γίλνληαλ θαηά ην πιείζηνλ θαη φπνπ ήηαλ δπλαηφ ηελ ίδηα εκέξα ψζηε λα απνθεπρζνχλ νη δηαθνξέο ιφγσ αλαπηπμηαθνχ ζηαδίνπ ηνπ δέλδξνπ θαη ηνπ πεξηβάιινληνο. 55

56 2.3 Δθρύιηζε θαη απνκόλσζε DNA Η ζπιινγή ησλ θχιισλ έγηλε θαηά ηηο πξσηλέο ψξεο. Σα λεαξά θχιια ηνπνζεηήζεθαλ ζε ςπγείν θαη αθνινχζεζε εθρχιηζε DNA ζχκθσλα κε ηε κέζνδν CTAB (Doyle θαη Doyle, 1990). πγθεθξηκέλα πάξζεθαλ 0,3 g θπηηθνχ ηζηνχ απφ θάζε γελφηππν θαη αθνχ ηνπνζεηήζεθαλ ζε κηθξνθπγνθεληξηθφ ζσιήλα καδί κε 800 κl ξπζκηζηηθνχ δηαιχκαηνο CTAB, 10 κl β-κεξθαπηναηζαλφιεο (1%v/v) θαη 2 κl RNA-άζεο πνιηνπνηήζεθαλ κε ηελ βνήζεηα κηθξνχ πιαζηηθνχ απνζηεηξσκέλνπ γνπδηνχ. Αθνινχζσο ην δηάιπκα κεηαθέξζεθε ζε πδαηφινπηξν ζηνπο 60 ºC γηα 15 ιεπηά πεξίπνπ. Σν ππεξθείκελν δηάιπκα πάξζεθε κεηά απφ θπγνθέληξηζε γηα 20 ιεπηά ζηα g. Αθνινχζεζε απνκάθξπλζε ησλ πξσηετλψλ κε δηάιπκα ρισξνθνξκίνπ / ηζνακπιηθήο αιθνφιεο 24:1 θαη θαζίδεζε ηνπ DNA κε ρξήζε 2/3 ηνπ φγθνπ ηζνπξνπαλφιεο θαη 0,1 Μ νμηθνχ λαηξίνπ κε θπγνθέληξηζε 5 ιεπηψλ ζηηο g κεηά απφ ςχμε ηνπ δηαιχκαηνο γηα 30 ιεπηά ζηνπο 20 ºC. Αθνινχζεζε θαζαξηζκφο ηνπ DNA κε δηάιπκα αηζαλφιεο 70% θαη 3 Μ νμηθνχ θαιίνπ δχν θνξέο θαη κηα θνξά κε θαζαξή αηζαλφιε. ηε ζπλέρεηα ην θαζαξφ πιένλ DNA δηαιχζεθε ζε 200 κl δηαιχκαηνο ΣΔ. 2.4 Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο (PCR) γηα ηελ αλάιπζε κε ηνπο SSR θαη ISSR κνξηαθνύο δείθηεο. Η PCR κε ηνπο εθθηλεηέο SSR (Πίλαθαο 2.3) πξαγκαηνπνηήζεθε ζε ηειηθφ φγθν 8 κl πνπ πεξηείρε 20 ng εθκαγείν DNA απφ θεξάζη, 0.3 µm απφ θάζε εθθηλεηή θαη 2 x Qiagen Multiple PCR master mix buffer (Qiagen, Crawley, UK). Οη θαζνδηθνί εθθηλεηέο ήηαλ επηζεκαζκέλνη ζην 5 άθξν κε ηεο θζνξίδνπζεο ρξσζηηθέο νπζίεο IR700/IR800. Σα ραξαθηεξηζηηθά ησλ ζεξκνθξαζηψλ πνπ ρξεζηκνπνηήζεθαλ ζπκπεξηιακβαλνκέλσλ θαη ηηο ζεξκνθξαζηψλ πβξηδηζκνχ θαίλνληαη ζε δεκνζηεπκέλεο εξγαζίεο ζχκθσλα κε ηνπο (Clarke θαη Tobutt 2003; Downey θαη Iezzoni 2000; Testolin θ.ά. 2000; Vaughan θαη Russell 2004). Η εχξεζε ησλ γελνηχπσλ έγηλε ζε απηφκαην αλαιπηή LI-COR 4200 DNA Analyzer, κε ρξήζε επηζεκαζκέλσλ εθθηλεηψλ πνπ θζνξίδνπλ ζηα 700 θαη 800 nm. Ο δηαρσξηζκφο ησλ αιιεινκφξθσλ θάζε δείγκαηνο έγηλε ζε πεθηή πνιπαθξπιακίδεο ζπγθέληξσζεο 6,5% (LI-COR KB PlusTM). Tν κήθνο ηεο πεθηήο ήηαλ 25 cm θαη ην πάρνο ηεο 0,25 cm. ηελ πεθηή θνξηψζεθε πνζφηεηα 1 κl αξαησκέλνπ πξντφληνο PCR απφ ην θάζε δείγκα. Η αξαίσζε θπκάλζεθε απφ 1:5 γηα δείγκαηα ζπγθέληξσζεο DNA κηθξφηεξεο απφ 10 ngκl-1, κέρξη θαη 1:40 γηα δείγκαηα κε κεγαιχηεξε απφ 20 ngκl -1 ζπγθέληξσζε. Η αξαίσζε έγηλε κε απνδηαηαθηηθή ρξσζηηθή πνπ πεξηείρε θνξκακίδην θαη 56

57 «ξπζκηζηηθφ δηάιπκα θφξησζεο» ζε αληίζηνηρε αλαινγία 2:1. Σα δείγκαηα, πξηλ ηελ ηνπνζέηεζή ηνπο ζηελ πεθηή, απνδηαηάρζεθαλ γηα 10 ιεπηά ζηνπο 99 o C. Σν κέζν ηεο ειεθηξνθφξεζεο ήηαλ TBE 1, ελψ ε δηάξθεηά ηεο ήηαλ 70 ιεπηά ζε ηάζε 1500 V. Σν θζνξίδνλ ζήκα ησλ δεηγκάησλ αληρλεχζεθε απφ ην ιέηδεξ ηνπ απηφκαηνπ αλαιπηή θαη απεηθνλίζηεθε ζε ππνινγηζηή. Η εχξεζε ησλ γελνηχπσλ έγηλε κε ην πξφγξακκα SagaGT ηεο εηαηξείαο LI-COR απφ δχν εξεπλεηέο, πξνθεηκέλνπ λα γίλεη δηαζηαχξσζε ησλ απνηειεζκάησλ. εκεηψλεηαη, ηέινο, πσο γηα ηνλ πξνζδηνξηζκφ ηνπ αθξηβνχο κεγέζνπο (ζε bp) ησλ δσλψλ ζηελ ειεθηξνθφξεζε ρξεζηκνπνηήζεθε ν κάξηπξαο κνξηαθψλ κεγεζψλ LI-COR Size Stθαηard IRDyeTM 700 & 800 ( bp) ηνπ νπνίνπ ηα κεγέζε ησλ δσλψλ (ζε bp) είλαη: 350, 325, 300, 255, 230, 204, 200, 175, 145, 120, 105, 100, 94, 75 θαη 50. Η PCR κε ηνπο εθθηλεηέο ISSR (Πίλαθαο 2.4) πξαγκαηνπνηήζεθε ζε ηειηθφ φγθν 25 κl πνπ πεξηείρε 30 ng εθκαγείν DNA απφ θεξάζη, 2.5 κl of 10 Taq DNA, 2 mm MgCl2, 0,2 mm dntps, 40 pmol γηα θάζε απιφ εθθηλεηή, 1 U DyNAzyme II DNA polymerase (Finnzymes, Espoo, Finlθαη). Οη θχθινη ηεο PCR πξαγκαηνπνηήζεθαλ ζε ζπζθεπή PTC 200 (MJ Research). Η ελίζρπζε κέζσ ηεο PCR, ζπλίζηαηαη απφ ηελ αξρηθή πεξίνδν γηα ηελ απνδηάηαμε (ζηάδην κεηνπζίσζεο) ηνπ DNA θαη ηελ ελεξγνπνίεζε ηνπ ελδχκνπ ηεο πνιπκεξάζεο ζηνπο 94 0 C γηα 5 min, αθνινπζνχκελε απφ 35 θχθινπο ζηνπο 94 0 C (βήκα 1 ) γηα 30s γηα ηελ απνδηάηαμε ηνπ DNA, ζηνπο C (αλάινγα ηνλ εθθηλεηή) (βήκα 2) γηα 90 s γηα ηνλ πβξηδηζκφ ησλ εθθηλεηψλ θαη ζηνπο 72 0 C (βήκα 3) γηα 90 sec γηα ηελ αληηγξαθή ηνπ επηιεγκέλνπ ηκήκαηνο ηνπ DNA απφ ηνπο εθθηλεηέο. Μεηά απφ 35 θχθινπο, γηα ηνλ ηειηθφ πνιπκεξηζκφ, ε ζεξκνθξαζία δηαηεξήζεθε ζηνπο 72 0 C γηα 5 ιεπηά. Η ειεθηξνθφξεζε ησλ δεηγκάησλ ηεο PCR πξαγκαηνπνηήζεθε ζε πεθηή αγαξφδεο 1.5 %. Η θσηνγξάθεζε ηεο πεθηήο πξαγκαηνπνηήζεθε κε ηε ζπζθεπή uvitec (UVItec LIMITED Avebury House 36A Union Lane Cambridge CB4 1QB, United Kingdom) θαη γηα ηελ εχξεζε ηνπ αθξηβνχο κεγέζνπο ησλ δσλψλ ρξεζηκνπνηήζεθε ην ινγηζκηθφ πξφγξακκα UVIDocMw version (UVI Tech, St John s Innovation Center, Cawley Road, CAMBRIDGE). 57

58 Πίλαθαο 2.2: Αιιεινπρίεο εθθηλεηώλ SSR κνξηαθώλ δεηθηώλ. Όλνκα εθθηλεηή Φζνξίδνπζα ρξσζηηθή νπζία Αιιεινπρία EMPAS10F IR-700 IR700-GCTAATATCAAATCCCAGCTCTC EMPAS10R TGAAGAAGTATGGCTTCTGTGG EMPAS11F IR-700 IR700-ACCACTTTGAGGAACTTGGG EMPAS11R CTGCCTGGAAGAGCAATAAC EMPAS12F IR-700 IR700-TGTGCTAATGCCAAAAATACC EMPAS12R ACATGCATTTCAACCCACTC EMPAS14F IR-700 IR700-TCCGCCATATCACAATCAAC EMPAS14R TTCCACACAAAAACCAATCC EMPAS02F IR-700 IR700-CTACTTCCATGATTGCCTCAC EMPAS02R AACATCCAGAACATCAACACAC EMPAS06F IR-700 IR700-AAGCGGAAAGCACAGGTAG EMPAS06R TTGCTAGCATAGAAAAGAATTGTAG EMPA004F IR-800 IR800-TACGGTAGGCTTCTGCAAGG EMPA004R TTGGCAGGTTCTGTTCACAT EMPA005F IR-800 IR800-TGGGTTTGAGCAATATGCAA EMPA005R CACCAATACACATGCACACG EMPA018F IR-800 IR800-TCCAAGAACAAAGCCAAAATC EMPA018R TTGGCAGGTTCTGTTCACAT PceGA34F IR-800 IR800-GAACATGTGGTGTGCTGGTT PceGA34R TCCACTAGGAGGTGCAAATG UDP98-412F IR-800 IR800-AGGGAAAGTTTCTGCTGCAC UDP98-412R GCTGAAGACGACGATGATGA PS12A02F IR-800 IR800-GCCACCAATGGTTCTTCC PS12A02R AGCACCAGATGCACCTGA UPD97-402F IR-800 IR800-CTAGTTGTGCACACTCACGC UPD97-402R GTCGCAGGAACAGTAAGCCT UDP96-005F IR-800 IR800-GTAACGCTCGCTACCACAAA UDP96-005R CACCCAGCTCATACACCTCA UPD98-022F IR-800 IR800-CTAGTTGTGCACACTCACGC UPD98-022R GTCGCAGGAACAGTAAGCCT ps12a02f GCCACCAATGGTTCTTCC ps12a02r AGCACCAGATGCACCTGA BPPCT-002-F TCGACAGCTTGATCTTGACC BPPCT-002-R CAATGCCTACGGAGATAAAAGAC BPPCT-026-F ATACCTTTGCCACTTGCG BPPCT-026-R TGAGTTGGAAGAAAACGTAACA PceGA34-F GAACATGTGGTGTGCTGGTT PceGA34-R TCCACTAGGAGGTGCAAATG UDP F AGGGAAAGTTTCTGCTGCAC UDP R GCTGAAGACGACGATGATGA 58

59 Πίλαθαο 2.3: Αιιεινπρίεο εθθηλεηώλ ISSR κνξηαθώλ δεηθηώλ. Όλνκα εθθηλεηή (UBC) Δθθηλεηήο (5'-3') Θεξκνθξαζία πβξηδηζκνύ ( o C) Δύξνο κεγέζνπο δώλεο UBC-811 GAG AGA GAG AGA GAG AC UBC-816 CAC ACA CAC ACA CAC AT UBC-821 GTG TGT GTG TGT GTG TT UBC-823 TCT CTC TCT CTC TCT CC UBC-827 ACA CAC ACA CAC ACA CG UBC-834 AGA GAG AGA GAG AGA GYT UBC-841 GAG AGA GAG AGA GAG AYC UBC-860 TGT GTG TGT GTG TGT GRA UBC-881 GGG TGG GGT GGG GTG UBC-891 HVH TGT GTG TGT GTG TG Αιπζηδσηή Αληίδξαζε ηεο Πνιπκεξάζεο (PCR) γηα ηελ αλάιπζε κε ηνπο ιεηηνπξγηθνύο κνξηαθνύο δείθηεο ηνπ γνληδίνπ ηεο SRNάζεο Γηα ηελ PCR αλάιπζε ρξεζηκνπνηήζεθαλ νη επηζεκαζκέλνη εθθηλεηέο (IRD800 ή IRD700) PaConsI-F (MCTTGTTCTTGSTTTYGCTTTCTTC) θαη PaConsI-R2 (GCCATTGTTGCACAAATTGA) (Sonneveld et al. 2006) ψζηε λα εληζρχζνπλ πεξηνρέο πνπ πεξηέρνληαη ζην πξψην εζψλην ηεο SRNάζεο. Η εχξεζε ησλ γελνηχπσλ έγηλε ζε απηφκαην αλαιπηή LI-COR 4200 DNA Analyzer, κε ρξήζε επηζεκαζκέλσλ εθθηλεηψλ πνπ θζνξίδνπλ ζηα 700 θαη 800 nm. Ο δηαρσξηζκφο ησλ αιιεινκφξθσλ θάζε δείγκαηνο πξαγκαηνπνηήζεθε ζε πεθηή πνιπαθξπιακίδεο ζπγθέληξσζεο 6,5% (LI-COR KB Plus TM ). Tν κήθνο ηεο πεθηήο ήηαλ 25 cm θαη ην πάρνο ηεο 0,25 cm. Σα απνηειέζκαηα αλαιχζεθαλ κε ην ινγηζκηθφ SAGA GT. Σα εληζρπκέλα πξντφληα πεξηιακβάλνπλ ηνπο εθθηλεηέο PaConsII-F (GGCCAAGTAATTATTCAAACC) θαη PaConsII-R (CAWAACAAARTA CCACTTCATGTAAC) πνπ πεξηέρνληαη ζην δεχηεξν εζψλην ηεο SRNάζεο ειεθηξνθνξήζεθαλ ζε πεθηή αγαξφδεο 1.5% φπσο πεξηγξάθηεθαλ απφ ηνπο Sonneveld θ.ά. (2003). 59

60 2.6 Αλάιπζε HRM ησλ κνξηαθώλ δεηθηώλ SSR θαη SNP Η PCR θαη ε HRM πξαγκαηνπνηήζεθαλ ζε κία ζπζθεπή RotorGene 6600 (Corbett Research Pty Ltd, Sydney, Australia) θαη ηα απνηειέζκαηα αλαιχζεθαλ κε ηε ρξήζε ηνπ RotorGene 6000 ινγηζκηθνχ πξνγξάκκαηνο, έθδνζε Αλαιχζεθαλ ζπλνιηθά 21 πνηθηιίεο θεξαζηάο κε έμη δεχγε SSR θαη 9 δεχγε κνξηαθψλ δεηθηψλ SNP (Koepke θ.ά. 2012) κε ηελ ρξήζε ηεο HRM (Πίλαθαο 2.5). Πίλαθαο 2.5: Αιιεινπρίεο εθθηλεηώλ κνξηαθώλ δεηθηώλ SNP. Όλνκα εθθηλεηή Αλνδηθόο (5'-3') Καζνδηθόο (5'-3') PRUAVContig1734 TTTTGGTCATTGAGAGTACAGAGG CAAGCCGATAACTCAAAACCA PRUAVContig2786 CGAAAATTAAATGAAGCCAAGAA CGGTAGTTTCAAAATTCAAGTTCA PRUAVContig2817 TTTGGGGTTTGAGGATGTGT TGATTGATGTTGCCAAAAGG PRUAVContig1467 CCGTTTTTATTCCGTGTTCG GGTCCTGGTCCATATCCGTA PRUAVContig1509 GCCTAGACACTTTCTGCTGCT CGTAAGTGCATGTAATTAACTCTGG PRUAVContig743 CCCATGCGGAGTTTACATTA AAAGCTCACTAGGTACAAGCAAG PRUAVContig285 CAGTTCATGACCCCCAAGAA TTGAAGAAGCTCCACTCTTTCAC Σα 15 κl ηνπ φγθνπ αληίδξαζεο ηεο PCR πεξηείραλ 0.5 U Platinum Quantitive PCR SuperMix-UDG (Invitrogen), 1X PCR buffer, 2.5 mm MgCl2, 0.2 mm dntp, 300 nm απφ θάζε εθθηλεηή, 1.5 κm ρξσζηηθή Syto 9 (Invitrogen, Paisley, UK) θαη 1 κl DNA (ζπγθέληξσζε 20 ng/ κl). Οη ζπλζήθεο ηεο PCR ήηαλ: επψαζε ζηνπο 50 0 C γηα 2 min θαη ζηε ζπλέρεηα ζηνπο 95 0 C γηα 2 min, αθνινπζνχκελε απφ 40 θχθινπο επψαζεο ζηνπο 95 0 C γηα 10 s, ζηνπο 55 0 C γηα 15 s θαη 60 0 C γηα 20 sec. Η HRM πξαγκαηνπνηήζεθε ακέζσο κεηά ηελ PCR αλάινγα κε ηα δεχγε ησλ εθθηλεηψλ απφ ηνπο 70 0 C έσο ηνπο 90 0 C κε θαηαγξαθή θζνξηζκνχ θάζε 0,2 0 C θαη κε απφζηαζε 2 s κεηαμχ ησλ θαηαγξαθψλ. Γηα λα επηβεβαησζεί φηη ζε θάζε αληίδξαζε ηα φκνηα δείγκαηα σο πξνο ηελ αιιεινπρία ηνπ DNA παξάγνπλ ηηο ίδηεο θακπχιεο ηήμεσο ρξεζηκνπνηήζεθαλ ηξείο επαλαιήςεηο απφ ηηο πνηθηιίεο Burlat θαη Van γηα ηνλ κνξηαθφ δείθηε EMPAS02. πγθεθξηκέλα ρξεζηκνπνηήζεθαλ ηξία δείγκαηα DNA απφ θάζε πνηθηιία πνπ πξνήιζαλ απφ δηαθνξεηηθέο απνκνλψζεηο. 60

61 Σα απφιπηα επίπεδα θζνξηζκνχ πξηλ θαη κεηά ηελ ηήμε νκαινπνηήζεθαλ ζην 100 % θαη 0% αληίζηνηρα γηα λα κεηξεζνχλ νπνηαδήπνηε δηαθνξεηηθά επίπεδα θζνξηζκνχ πνπ παξάγνληαη απφ ηηο δηάθνξεο αληηδξάζεηο. Η HRM βαζίδεηαη πεξηζζφηεξν ζην ζρήκα ησλ θακππιψλ ηήμεσο παξά ζηελ απφιπηε ηηκή ηνπ Tm πνπ πξνέξρεηαη απφ ην αξλεηηθφ παξάγσγν (negative derivative, φπσο γίλεηαη κε ηε ρξήζε ηεο ρξσζηηθήο SYBR Green). Γη απηφ ε θακπχιεο ηήμεσο ζηε ζπλέρεηα νκαινπνηνχληαη θαηά κήθνο ηνπ άμνλα ηεο ζεξκνθξαζίαο ( κεηαηφπηζε ζεξκνθξαζίαο ) γηα ηνλ θαιχηεξν δηαρσξηζκφ ησλ θακππιψλ ηνπ DNA (Montgomery θ.ά. 2007). 2.7 Μνξηαθή ζηαηηζηηθή αλάιπζε Η κνξηαθή ζηαηηζηηθή αλάιπζε πεξηιακβάλεη ηφζν ελδν-πιεζπζκηαθή φζν θαη δηαπιεζπζκηαθή αλάιπζε. Η ελδν-πιεζπζκηαθή αλάιπζε γηα θάζε κηθξνδνξπθνξηθή γνληδηαθή ζέζε πεξηιακβάλεη ηνπο αθφινπζνπο ππνινγηζκνχο ησλ νπνίσλ νη καζεκαηηθνί ηχπνη δίλνληαη ζην Παξάξηεκα Ι: 1. Αξηζκφ (Na), δξαζηηθφ αξηζκφ (n e ) θαη ζπρλφηεηα αιιεινκφξθσλ. 2. Αλακελφκελε εηεξνδπγσηία (Ηe). 3. Παξαηεξνχκελε εηεξνδπγσηία (Ηo). 4. Πνζνζηφ πνιπκνξθηζκνχ θάζε γνληδηαθήο ζέζεο (P) 5. Βαζκφο πεξηερφκελνπ πνιπκνξθηζκνχ (PIC; Polymorphic Information Content). 6. Πηζαλφηεηα ηαπηνπνίεζεο (P ID ; Probability of Identity). 7. Πηζαλφηεηα χπαξμεο κεδεληθψλ αιιεινκφξθσλ (Null alleles)- f n. Δπηπιένλ, γηα θάζε πιεζπζκφ ππνινγίζηεθαλ ζην ζχλνιν ησλ κηθξνδνξπθνξηθψλ γνληδηαθψλ ζέζεσλ νη παξάκεηξνη: 8. Πιήζνο αιιεινκφξθσλ (A R ). 9. Πιήζνο απνθιεηζηηθψλ αιιεινκφξθσλ (pa R ). 10. πληειεζηήο νκνκημίαο (F IS ). 11. Αλακελφκελε εηεξνδπγσηία (Ηe). 12. Παξαηεξνχκελε εηεξνδπγσηία (Ηo). 13. Γείθηεο πνηθηιφηεηαο Shannon (I). 61

62 2.7 Βηβιηνγξαθία Aravanopoulos, A. F., Avramidou, E. and Ganopoulos, I Genetics of wild cherry (Prunus avium L.) in Greece. Growing Valuable Broadleaved Tree Species October 06th -08th 2008, Freiburg/ Germany. Clarke, J. B. and Tobutt, K. R Development and characterization of polymorphic microsatellites from Prunus avium 'Napoleon'. Molecular Ecology Notes 3(4): Downey, S. L. and Iezzoni, A. F Polymorphic DNA markers in black cherry (Prunus serotina) are identified using sequences from sweet cherry, peach, and sour cherry. Journal of the American Society for Horticultural Science 125(1): Koepke, T., Schaeffer, S., Krishnan, V., Jiwan, D., Harper, A., Whiting, M., Oraguzie, N. and Dhingra, A Rapid gene-based SNP and haplotype marker development in non-model eukaryotes using 3'UTR sequencing. BMC Genomics 13(1):18. Montgomery, J., Wittwer, C. T., Palais, R. and Zhou, L Simultaneous mutation scanning and genotyping by high-resolution DNA melting analysis. Nat Protoc 2(1): Sonneveld, T., Tobutt, K. R. and Robbins, T. P Allele-specific PCR detection of sweet cherry self-incompatibility (S) alleles S1 to S16 using consensus and allelespecific primers. Theoretical and Applied Genetics 107(6): Sonneveld, T., Robbins, T. P. and Tobutt, K. R Improved discrimination of selfincompatibility S-RNase alleles in cherry and high throughput genotyping by automated sizing of first intron polymerase chain reaction products. Plant Breeding 125(3): Testolin, R., Marrazzo, T., Cipriani, G., Quarta, R., Verde, I., Dettori, M. T., Pancaldi, M. and Sansavini, S Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3): Vaughan, S. P. and Russell, K Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 4(3):

63 Κεθάιαην 3: Μνξηαθή κειέηε ηεο γελεηηθήο πνηθηιόηεηαο ηεο αγξηνθεξαζηάο ζηα λόηηα όξηα εμάπισζεο ηνπο κε κηθξνδνξπθνξηθνύο δείθηεο 3.1 Δηζαγσγή Δίδε θπηψλ ηα νπνία αλαπαξάγνληαη ελ κέξεη αγελψο θαη παξνπζηάδνπλ κηθξνχο, απνκνλσκέλνπο πιεζπζκνχο δηάζπαξησλ αηφκσλ είλαη πην επηξξεπή ζηελ γελεηηθή, πεξηβαιινληηθή θαη δεκνγξαθηθή ζηνραζηηθφηεηα (Ellstrand θαη Elam 1993), θπξίσο ζηηο λφηηεο πεξηνρέο ηεο εμάπισζεο ηνπο (πιεζπζκνί ζηα άθξα εμάπισζεο (Hampe θαη Petit 2005)), φπνπ αλακέλεηαη λα εθδειψλνληαη νη ζθνδξφηεξεο θιηκαηηθέο αιιαγέο. Καηά ζπλέπεηα, βξίζθνληαη ζε θίλδπλν λα απνιέζνπλ ηελ γελεηηθή πνηθηιφηεηα ηνπο θαζψο θαη ηηο πξνζαξκνζηηθέο δπλαηφηεηεο ηνπο σο απνηέιεζκα γεγνλφησλ, φπσο ε κείσζε ηεο ξνήο γνληδίσλ κεηαμχ ησλ πιεζπζκψλ, ε κείσζε ηνπ αλαζπλδπαζκνχ ιφγσ ηεο κεξηθήο αγελνχο αλαπαξαγσγήο, ηα απμεκέλα επίπεδα ελδνγακίαο, ε απνκάθξπλζε ησλ επηβιαβψλ αιιεινκφξθσλ θαη ε απμεκέλε εκθάληζε γελεηηθήο εθηξνπήο. Η δεκνγξαθία είλαη ν θχξηνο παξάγνληαο πνπ επεξεάδεη ηε γελεηηθή εμειηθηηθή ηζηνξία, παξ 'φια απηά νπδέηεξνη κνξηαθνί δείθηεο κπνξνχλ λα αληρλεχζνπλ ζηνραζηηθφηεηα ζε έλα ζπγθεθξηκέλν δεκνγξαθηθφ πιαίζην πνπ δηακνξθψλεηαη απφ κε ζηνραζηηθέο δπλάκεηο, φπσο ε επηινγή. Η επίδξαζε ησλ αλσηέξσ παξαγφλησλ, ζηε δηαηήξεζε ηεο γελεηηθήο πνηθηιφηεηαο θαη ηεο δνκήο ησλ ππαξρφλησλ πιεζπζκψλ είλαη πςίζηεο ζεκαζίαο, πξνθεηκέλνπ λα δηαζθαιηζηεί ε δπλαηφηεηα πξνζαξκνγήο ησλ πιεζπζκψλ θαη λα δηαηππσζεί ε θαηάιιειε δηαρείξηζε θαη δηαηήξεζε ζηξαηεγηθψλ γηα ηελ αεηθνξία (Belletti θ.ά. 2008; Boshier θαη Amaral 2004; Tessier du Cros θ.ά. 1999). Η αγξηνθεξαζηά (Prunus avium L.) είλαη πνιπεηέο, μπιψδεο, αγγεηφζπεξκν είδνο κε αζπλερή θαηαλνκή πνπ ραξαθηεξίδεη κηθξνχο δηάζπαξηνπο πιεζπζκνχο, ζε δηαθνξεηηθέο ππθλφηεηεο ζρεδφλ ζε φιεο ηηο πεξηνρέο ηεο Δπξψπεο (Beaver θ.ά. 1995). Η αγξηνθεξαζηά είλαη έλα απζηεξά αιιφγακν δηπινεηδέο (2n = 2x = 16 (Crane θαη Brown 1937)), πνπ πνιιαπιαζηάδεηαη αγελψο κέζσ παξαθπάδσλ θαη εγγελψο απφ έληνκα θαη ηελ επαθφινπζε δηαζπνξά ζπφξσλ απφ ηα πνπιηά θαη ηα ζειαζηηθά (Mohanty θ.ά. 2001). Πξφθεηηαη γηα έλα ζεκαληηθφ νηθνλνκηθά, επγελέο είδνο κε πνιχηηκε αλζεθηηθή μπιεία θαη 63

64 εδψδηκνπο θαξπνχο (Russell 2003). Η επξσπατθή εμάπισζε ηεο άγξηαο θέξαζηαο, θαζψο θαη ησλ θαιιηεξγνχκελσλ κνξθψλ ηεο, είλαη ην απνηέιεζκα κηαο ζχλζεηεο αιιειεπίδξαζεο κεηαμχ κεηά-παγεηψδνπο απνίθηζεο θαη αλζξσπνγελνχο επέθηαζεο. Μειέηεο ηνπ ρισξνπιάζηε ηνπ DNA ζην Ρ. avium (παξ φηη είλαη πεξηνξηζκέλεο θαη γεσγξαθηθά ειιηπήο), ππνδειψλνπλ ηελ παξνπζία δηαθφξσλ κεηα-παγεησδψλ απνηθηαθψλ δηαδξνκψλ (Russell 2003). Η πξφσξε εμεκέξσζε ηνπ είδνπο Prunus έρεη αλαθεξζεί ζηε Μηθξά Αζία απφ ην 7000 π.υ. (Behre 1978) θαη ην P. avium θαίλεηαη λα θαιιηεξγήζεθε γηα πξψηε θνξά ζηελ Διιάδα ηνπιάρηζηνλ απφ ην 2300 π.υ. ζχκθσλα κε ηνλ Θεφθξαζην (Hedrick 1915). Η θεξαζηά εηζήρζε ζηε Γπηηθή Δπξψπε απφ ηνπο Ρσκαίνπο (Zohary θαη Hopf 2000) θαη ππάξρνπλ ζπζζσξεπκέλα ζηνηρεία απφ πνιιαπιά ζπκβάληα εμεκέξσζεο (Mariette θ.ά. 2010). Η ζεκεξηλή εμάπισζε ηνπ είδνπο παξνπζηάδεη ηα λνηην-αλαηνιηθά φξηα ηνπ ζηελ Διιάδα, ζρεκαηίδνληαο κηθξνχο απνκνλσκέλνπο πιεζπζκνχο. Οη αξρηθέο έξεπλεο ηεο γελεηηθήο πνηθηιφηεηαο ζηελ αγξηνθεξαζηά βαζίζηεθαλ ζε κνξθνινγηθά ραξαθηεξηζηηθά (Meier-Dingel θ.ά. 1997; Weiser 1996) θαη αθνινχζεζαλ αλαιχζεηο παξαιιαθηηθφηεηαο κε ηζνέλδπκα (Frascaria θ.ά. 1993; Mariette θ.ά. 1997; Santi θ.ά. 1990), κε AFLP δείθηεο (Tavaud θ.ά. 2001) θαη κε ρισξνπιαζηηθφ DNA (Mohanty θ.ά. 2001). Η αλάπηπμε ησλ SSR δεηθηψλ (Clarke θαη Tobutt 2003; Vaughan θαη Russell 2004) άλνημε ην δξφκν γηα πην ιεπηνκεξείο έξεπλεο ηεο γελεηηθήο πνηθηιφηεηαο ζην είδνο Ρ. avium (Aravanopoulos θ.ά. 2008; Guarino θ.ά. 2009; Schueler θ.ά. 2006). Παξ 'φια απηά, νη γνληδηαθέο πιεξνθνξίεο, ηδίσο ζηα λφηηα φξηα ηεο θπζηθήο εμάπισζεο ηνπ είδνπο παξακέλνπλ ηφζν δηάζπαξηεο, φζν θαη ην ίδην ην είδνο. Οη SSRs, σο ζπγθπξίαξρνη θαη άθξσο πνιπκνξθηθνί δείθηεο πνπ εμειίζζνληαη ηαρχηεξα απφ ηα θπηνπιαζκηθά ή ηα ππξεληθά γνλίδηα, είλαη ηδηαηηέξσο ρξήζηκνη γηα ηελ θαηαλφεζε ηεο δνκήο ελφο πιεζπζκνχ ζε κηα γεσγξαθηθή θαη εμειηθηηθή θιίκαθα. Μηα άιιε κέζνδνο γελεηηθήο κειέηεο πιεζπζκψλ πνπ βαζίδεηαη ζηνπο ISSR δείθηεο, επηηξέπεη ηελ αλίρλεπζε ησλ πνιπκνξθηζκψλ κεηαμχ ησλ κηθξνδνξπθνξηθψλ γνληδηαθψλ ζέζεσλ (Zietkiewicz θ.ά. 1994). πσο νη δηαθνξεηηθνί δείθηεο έρνπλ δηαθνξεηηθέο ηδηφηεηεο θαη αληαλαθινχλ δηαθνξεηηθέο πηπρέο ηεο γελεηηθήο πνηθηιφηεηαο (Karp θ.ά. 1996), έηζη θαη νη ISSRs κπνξεί λα ειέγμνπλ κηα πξφζζεηε εθηίκεζε αληηζηνίρεζεο ηεο γεσγξαθηθήο θαη γελεηηθήο πνηθηινκνξθίαο. Η αλάιπζε κε ISSR δείθηεο έρεη ρξεζηκνπνηεζεί γηα ηελ αμηνιφγεζε ηεο γελεηηθήο πνηθηιφηεηαο ζε πνιπάξηζκα θπηηθά είδε, ζπκπεξηιακβαλνκέλεο ηεο θαζηαληάο (Mattioni θ.ά. 2008), ηεο κνπξηάο (Kar θ.ά. 2008) 64

65 θαη ηεο θαιιηεξγνχκελεο θεξαζηάο (Κεθάιαην 5). Απ φζν γλσξίδνπκε, απηή είλαη ε πξψηε θνξά πνπ ε ISSR αλάιπζε εθαξκφδεηαη ζηελ αγξηνθεξαζηά. Η ζεκαληηθφηεηα ησλ πιεζπζκψλ ζηα άθξα εμάπισζεο ηνπ είδνπο έρεη γίλεη ζέκα έληνλσλ ζπδεηήζεσλ κε επίθεληξν ηελ εγθπξφηεηα ηεο ππφζεζεο θέληξνπ-πεξηθέξεηαο πνπ θάλεη δηάθξηζε κεηαμχ ησλ άθζνλσλ πιεζπζκψλ πνπ θαηαλέκνληαη ζηνλ ππξήλα ηεο εμάπισζεο ησλ εηδψλ θαη ησλ κηθξψλ απνζπαζκαηηθψλ πιεζπζκψλ πνπ θαηαλέκνληαη ζηελ πεξηθέξεηα ηεο εμάπισζεο ησλ εηδψλ (Eckert θ.ά. 2008; Hampe θαη Petit 2005; Lesica θαη Allendorf 1995). Δάλ νη πιεζπζκνί ζηα άθξα εμάπισζεο ζπκπεξηθέξνληαη φπσο πξνβιέπεηαη απφ ηελ ππφζεζε απηή, ηφηε ηφζν ην δξαζηηθφ κέγεζνο ηνπ πιεζπζκνχ φζν θαη ν ξπζκφο ηεο ξνήο γνληδίσλ ζα πξέπεη λα είλαη πςειφηεξα ζην "πινχζην" θέληξν θαη ρακειφηεξα ζηα φξηα εμάπισζεο ησλ εηδψλ (Eckert θ.ά. 2008; Sagarin θαη Gaines 2002). Απφ ηελ άιιε, ελδερνκέλσο ηα πξφηππα γελεηηθήο πνηθηιφηεηαο λα είλαη θαζνξηζκέλα κε βάζε ηελ παιαηφηεξε θιηκαηηθή δπλακηθή παξά ηε δεκνγξαθηθή θαη γελεηηθή ζηνραζηηθφηεηα per se θαη σο εθ ηνχηνπ νη πιεζπζκνί ζηα φξηα εμάπισζεο θαη φρη νη θεληξηθνί θηινμελνχλ ην κεγαιχηεξν κέξνο ηεο γελεηηθήο πνηθηιφηεηαο ησλ εηδψλ (Hampe θαη Petit 2005; Hewitt 2000; Hewitt 2004). χκθσλα κε ην πξφηππν "θέληξνπ-πεξηθέξεηαο», νη πιεζπζκνί ζηα φξηα εμάπισζεο είλαη πεξηνξηζκέλεο θαη ακθηβφινπ δηαηήξεζεο (Lesica θαη Allendorf 1992) θαη ελδερνκέλσο θαη αλαπαξαγσγηθήο αμίαο. Άξα κπνξεί λα αληηκεησπίζνπλ πην γξήγνξε εμαθάληζε, επαλεπνηθεζε ή ηζρπξά ζεκεία γελεηηθήο ζηελσπνχ ηνπ πιεζπζκνχ πνπ ίζσο νδεγήζνπλ ζε ζηνραζηηθή κείσζε ηεο γελεηηθήο πνηθηιφηεηαο θαη ηνπ εμειηθηηθνχ δπλακηθνχ εληφο ηνπ πιεζπζκνχ (Eckert θ.ά. 2008; Hoffman θαη Parsons 1996). Η αλακελφκελε κείσζε ηεο γελεηηθήο πνηθηιφηεηαο ηνπο θαη ε κεγαιχηεξε γελεηηθή δηαθνξνπνίεζε επηδεηλψλεηαη αθφκε πεξηζζφηεξν απφ ηελ έθζεζή ηνπο ζε ζεκαληηθέο πεξηβαιινληηθέο πηέζεηο ζε αληίζεζε κε ηνπο θεληξηθνχο πιεζπζκνχο (Eckert θ.ά. 2008). Απφ ηελ άιιε πιεπξά, εάλ ην ηζηνξηθφ επνίθεζεο ήηαλ ε βαζηθή θηλεηήξηα δχλακε ζηε δηακφξθσζε ηεο γελεηηθήο πνηθηιφηεηαο ζε ζχγθξηζε κε ηε δεκνγξαθία θαη ηηο ηνπηθέο ζπλζήθεο, νη πιεζπζκνί ζηα φξηα εμάπισζεο κπνξεί λα απνηειέζνπλ κηα πνιχηηκε δεμακελή δηαηήξεζεο ηεο ελδνεηδηθήο γελεηηθήο πνηθηιφηεηαο (Hewitt 2004; Petit θ.ά. 2003). Οη πιεζπζκνί ζηα φξηα εμάπισζεο κπνξεί λα ζπκβάινπλ ζηελ δηαηήξεζε ζπάλησλ αιιεινκφξθσλ θαη ζπλδπαζκψλ γνληδίσλ ζεκαληηθψλ γηα ηελ πξνζαξκνγή ζε αθξαίεο πεξηβαιινληηθέο ζπλζήθεο (Hampe θαη Petit 2005; Lesica θαη Allendorf 1992) θαη ηελ 65

66 επηβίσζε θαη εμέιημε ησλ δψλησλ νξγαληζκψλ. Η καθξφρξνλε δηαηήξεζε ηνπο ελδερνκέλσο λα έρεη δηακνξθψζεη ηα παξφληα βηνγεσγξαθηθά πξφηππα κέζσ ηεο επίδξαζεο ηνπο ζηελ κείσζε ησλ εμαθαλίζεσλ ησλ εηδψλ. Οη πιεζπζκνί ζηα φξηα εμάπισζεο έρνπλ παίμεη πηζαλφηαηα ζεκαληηθφ ξφιν ζηε δηαηήξεζε ηεο βηνπνηθηιφηεηαο ζε νιφθιεξε ηελ Σεηαξηνγελή πεξίνδν (Hampe θαη Petit 2005) θαη σο εθ ηνχηνπ κπνξνχλ λα ζεσξεζνχλ σο βαζηθφ εμειηθηηθφ θιεηδί πςίζηεο ζεκαζίαο γηα ηε δηαηήξεζε θαη ηελ πξνζηαζία ησλ γνληδηαθψλ πφξσλ. Οη ζηφρνη απηήο ηεο κειέηεο είλαη: (1) λα αμηνινγεζεί θαη λα ζπγθξηζεί ε γελεηηθή δνκή θαη ε πνηθηιφηεηα ησλ θπζηθψλ πιεζπζκψλ αγξηνθεξαζηάο ζηα λφηηα φξηα εμάπισζεο ηνπ είδνπο κε ηε ρξήζε ησλ θπξίαξρσλ (ISSR) θαη ζπγθπξίαξρσλ (SSR) κνξηαθψλ δεηθηψλ, (2) λα δηεξεπλεζεί ε γελεηηθή εθηξνπή κεηαμχ ησλ θπζηθψλ πιεζπζκψλ, (3) λα θαζνξηζηεί ν ηξφπνο κε ηνλ νπνίν ε δεκνγξαθηθή ηζηνξία θαη ε ππνθείκελε ζηνραζηηθφηεηα κπνξεί λα θαζνξίζνπλ ηελ γελεηηθή δνκή ηνπ πιεζπζκνχ, ην δξαζηηθφ κέγεζνο ηνπ πιεζπζκνχ θαη ηελ γνληδηαθή ξνή θαη (4) λα ππνβνεζήζεη ηε δεκηνπξγία πξαθηηθψλ δηαρείξηζεο θαη δηαηήξεζεο ησλ θπζηθψλ πιεζπζκψλ αγξηνθεξαζηάο. Δπηκέξνπο Τιηθά θαη Μέζνδνη Η πιεζπζκηαθή γελεηηθή αλάιπζε θαη ε εχξεζε ηζνξξνπίαο ζχλδεζεο (LD) πξαγκαηνπνηήζεθαλ κε ηε ρξήζε ησλ πξνγξακκάησλ Genetix 4.05 (http://www.genetix.univ-montp2.fr/genetix.htm) θαη Popgene (http:// Η LD αλαθέξεηαη ζηε κε ηπραία ζπζρέηηζε αιιεινκφξθσλ ζε δχν ή πεξηζζφηεξνπο γνληδηαθέο ζέζεηο, φρη απαξαίηεηα ζην ίδην ρξσκφζσκα. Οη ζπρλφηεηεο ησλ αιιεινκφξθσλ, ε παξαηεξνχκελε εηεξνδπγσηία (H O ), ε αλακελφκελε εηεξνδπγσηία (H E ; γελεηηθή πνηθηιφηεηα) θαη ν δείθηεο πνηθηιφηεηαο Shannon (I) ππνινγίζηεθε γηα ηνπο πιεζπζκνχο αγξηνθεξαζηάο. Ο ζπληειεζηήο νκνκημίαο κέζα ζε έλαλ ππνπιεζπζκφ F IS είλαη ε πηζαλφηεηα ελφο αηφκνπ λα θέξεη έλα δεχγνο αιιεινκφξθσλ πνπ έρεη θιεξνλνκεζεί θαηαθφξπθα, ιφγσ χπαξμεο θνηλνχ πξνγφλνπ. Παίξλεη ηηκέο απφ -1 έσο +1. Αξλεηηθή ηηκή F IS ζεκαίλεη απνπζία νκνκημίαο ελψ αληίζεηα ζεηηθή ηηκή F IS ππνδεηθλχεη ηελ χπαξμε νκνκημίαο. Ο ππνινγηζκφο ησλ ηηκψλ ηνπ ζπληειεζηή νκνκημίαο έγηλε κε ην πξφγξακκα FSTAT (Goudet 1995). ζνλ αθνξά ηε δηα- 66

67 πιεζπζκηαθή ζηαηηζηηθή αλάιπζε, εθηφο απφ ηε ζχγθξηζε ησλ γελεηηθψλ παξακέηξσλ αλάκεζα ζηνπο πιεζπζκνχο, πξαγκαηνπνηήζεθε έιεγρνο ηεο γελεηηθήο δηαθνξνπνίεζεο ησλ πιεζπζκψλ κε ηα πξνγξάκκαηα FSTAT (Goudet 1995) κε βάζε ηηο ηηκέο F ST. Ο έιεγρνο ηζνξξνπίαο Hardy-Weinberg πξαγκαηνπνηήζεθε κε ην ινγηζκηθφ PopGene32 (Yeh θ.ά. 1999). Σν πιήζνο ησλ αιιεινκφξθσλ (A R ) θαη ησλ απνθιεηζηηθψλ αιιεινκφξθσλ (αιιειφκνξθα πνπ είλαη κνλαδηθά ζε έλαλ πιεζπζκφ; (pa R ) ππνινγίζηεθαλ κε ην ινγηζκηθφ HP-RARE (Kalinowski 2005). Η αιιαγή ηεο αιιεινπρίαο πνπ πεξηβάιιεη ην κηθξνδνξπθνξηθφ DNA είλαη πηζαλφ λα εκπνδίδεη ηνλ εθθηλεηή λα πβξηδίζεη κε ην DNA-ζηφρν, ζηε δηάξθεηα ελίζρπζεο ελφο SSR δείθηε, κε απνηέιεζκα ηε δεκηνπξγία κεδεληθνχ αιιεινκφξθνπ (Chapuis θαη Estoup 2007; Dakin θαη Avise 2004). Γηα ηελ κνξηαθή αλάιπζε κε SSR δείθηεο ην πξφγξακκα FSTAT ρξεζηκνπνηήζεθε γηα λα ππνινγηζηεί ν ζπληειεζηήο δηαθνξνπνίεζεο F ST (Weir θαη Cockerham 1984) θαη ν ζπληειεζηήο δηαθνξνπνίεζεο R ST (Slatkin 1995) ζε φινπο ηνπο πιεζπζκνχο. Γηα ηελ κνξηαθή αλάιπζε κε ISSR δείθηεο ην πξφγξακκα FSTAT ρξεζηκνπνηήζεθε γηα λα ππνινγηζηεί ν ζπληειεζηήο δηαθνξνπνίεζεο G ST (Weir θαη Cockerham 1984) Οη ακεξφιεπηεο γελεηηθέο απνζηάζεηο κεηαμχ ησλ πιεζπζκψλ εθηηκήζεθαλ ζχκθσλα κε ηνλ Nei (1978) θάλνληαο ρξήζε ηνπ ινγηζκηθνχ PopGene32 (Yeh θ.ά. 1999). Οη ζρέζεηο κεηαμχ ησλ πιεζπζκψλ αξρηθά δηεξεπλήζεθαλ κε ηε κε ζηαζκηζκέλε κέζνδν νκαδνπνίεζεο UPGMA θαη θαηαζθεπάζηεθε δελδξφγξακκα βαζηζκέλν ζηηο γνληδηαθέο απνζηάζεηο θαηά Nei (1978) θαη γηα ηνπο δχν ηχπνπο κνξηαθψλ δεηθηψλ (SSR/ISSR). Η ηεξαξρηθή θαηαλνκή ηεο γελεηηθήο πνηθηινκνξθίαο κεηαμχ θαη εληφο ησλ πιεζπζκψλ γηα ηνπο δχν ηχπνπο κνξηαθψλ δεηθηψλ ραξαθηεξίζηεθε επίζεο απφ αλάιπζε ηεο κνξηαθήο δηαθχκαλζεο (AMOVA; Excoffier θ.ά. 1992; Michalakis θαη Excoffier 1996). Πξαγκαηνπνηήζεθε ηεξαξρηθή AMOVA ρξεζηκνπνηψληαο ην ινγηζκηθφ παθέην GENALEX 6 (Peakall θαη Smouse 2006b). Οη δνθηκέο εθηειέζηεθαλ ρξεζηκνπνηψληαο εθηηκήζεηο πνπ βαζίζηεθαλ ζε απνζηάζεηο Φ ST. Γηεμήρζεζαλ δνθηκαζίεο ζεκαληηθφηεηαο ρξεζηκνπνηψληαο ζπλδπαζκνχο εληφο ηνπ ζπλφινπ δεδνκέλσλ. Με ην ινγηζκηθφ STRUCTURE (Pritchard θ.ά. 2000) ειέγρζεθαλ νη ππνζέζεηο χπαξμεο ππνπιεζπζκψλ. Σν πξφγξακκα απηφ κε βάζε ηηο ζπρλφηεηεο ησλ αιιεινκφξθσλ θάλεη αληηζηνίρεζε ησλ αηφκσλ ζηνπο δηάθνξνπο πιεζπζκνχο. Πξνυπνζέηεη ηελ χπαξμε ηζνξξνπίαο Hardy-Weinberg θαζψο θαη ηζνξξνπία ζχλδεζεο. 67

68 Δπηπιένλ πξαγκαηνπνηήζεθε αλάιπζε θπξίσλ ζπληεηαγκέλσλ PCoA γηα ηηο πξψηεο δχν θχξηεο ζπληζηψζεο κε ρξήζε ηνπ πξνγξάκκαηνο GeneAlEx 6.0 (Peakall θαη Smouse, 2006). Η ζπγθπξίαξρε θχζε ησλ SSR κνξηαθψλ δεηθηψλ επηηξέπεη κηα πην ιεπηνκεξή αλάιπζε θαη ζπγθεθξηκέλα ηελ FCA, ρξεζηκνπνηψληαο ην ινγηζκηθφ GENETIX 4.05 (Belkhir 1999). Η αμηνιφγεζε ηνπ δξαζηηθνχ κεγέζνπο πιεζπζκνχ (N E ) έγηλε κε ηε ρξήζε δχν δηαθνξεηηθψλ κεζνδνινγηψλ: Μία κέζνδνο πνπ βαζίδεηαη ζε αληζνξξνπία ζχλδεζεο (Hill 1981), εθαξκφζηεθε γηα λα πξνζδηνξηζηεί ην δξαζηηθφ κέγεζνο ηνπ θάζε πιεζπζκνχ θάλνληαο ρξήζε ηνπ ππνινγηζκνχ πνπ πξνηάζεθε απφ ηνπο (Bartley θ.ά. 1992) θαη πινπνηήζεθε κε ην ινγηζκηθφ N E Estimator (Peel θ.ά. 2004). Η δεχηεξε κέζνδνο ρξεζηκνπνηεί πεξηζζφηεξεο απφ κία γνληδηαθέο ζέζεηο γηα ηελ εθηίκεζε ηνπ δξαζηηθνχ κεγέζνπο ηνπ πιεζπζκνχ θαη παξέρεη αμηφπηζηεο αμηνινγήζεηο αθφκε θαη γηα κηθξνχο πιεζπζκνχο κε έλαλ ειάρηζην αξηζκφ SSR δεηθηψλ (Vitalis θαη Couvet 2001). Η εθηίκεζε βαζίζηεθε ζην θαηά Wright Fisher πξφηππν λήζνπ ην νπνίν ππνζέηεη φηη φινη νη κεηαλάζηεο πξνέξρνληαη απφ έλαλ ηπραίν δείγκα απφ φινπο ηνπο πιεζπζκνχο θαη έγηλε ε ρξήζε ηνπ ινγηζκηθνχ ESTIM 1.2. (Vitalis θαη Couvet 2001). Η ηζηνξηθή ξνή γνληδίσλ (N m ) κεηαμχ ησλ πιεζπζκψλ ππνινγίζζεθε εκκέζσο βαζηζκέλε ζηηο παξακέηξνπο G ST (ISSR) θαη R ST (SSR). Δπηπξφζζεηα, ππνινγίζηεθε ε γνληδηαθή ξνή ρξεζηκνπνηψληαο ηε κέζνδν απνθιεηζηηθψλ αιιεινκφξθσλ θαηά Slatkin s (1985) ε νπνία βαζίδεηαη ζηε κέζε ζπρλφηεηα ησλ κνλαδηθψλ αιιεινκφξθσλ πνπ βξίζθνληαη ζηνπο ηνπηθνχο πιεζπζκνχο. Οη γνληδηαθέο επηδξάζεηο ησλ δεκνγξαθηθψλ παξαγφλησλ ζηνπο πιεζπζκνχο εμεηάζηεθαλ κε βάζε ηνπο δείθηεο SSR κεηά απφ δχν πξνζεγγίζεηο. Αξρηθά, νη πξφζθαηεο ζηελψζεηο πιεζπζκψλ εμεξεπλήζεθαλ θάλνληαο ρξήζε ηεο εκπεηξηθήο πξνζέγγηζεο ησλ Luikart θαη Cornuet (1998) ε νπνία ζπγθξίλεη ηελ γελεηηθή πνηθηιφηεηα κε ηελ αλακελφκελε γελεηηθή πνηθηιφηεηα ζε θαηάζηαζε ηζνξξνπίαο πνπ ππνινγίδεηαη απφ ηνλ παξαηεξνχκελν αξηζκφ αιιεινκφξθσλ ππφ ηζνξξνπία κεηάιιαμεο-γελεηηθήο εθηξνπήο. Η δεχηεξε πξνζέγγηζε πεξηιακβάλεη δνθηκέο αιιαγήο θαηαλνκήο ζπρλνηήησλ ησλ αιιεινκφξθσλ L-ζρήκαηνο (Luikart θαη Cornuet 1998). Ακθφηεξεο νη αλαιχζεηο δηεμήρζεζαλ ρξεζηκνπνηψληαο ην ινγηζκηθφ BOTTLENECK ver (Cornuet θαη Luikart 1996; Piry θ.ά. 1999). 68

69 3.2 Απνηειέζκαηα Δλδνπιεζπζκηαθή γελεηηθή πνηθηιόηεηα Έλα ζχλνιν 46 δσλψλ ISSR ειήθζεζαλ απφ ηνπο πέληε επηιεγκέλνπο εθθηλεηέο θαη αληηζηνηρνχζαλ θαηά κέζν φξν ζε 9,2 δψλεο αλά εθθηλεηή. Σν κέγεζνο ησλ ISSR δσλψλ θπκαηλφηαλ απφ 400 έσο bp (Πίλαθαο 3.1). Σν πνζνζηφ πνιπκνξθηζκνχ (Ρ) ζε επίπεδν πιεζπζκνχ θπκαίλνληαλ απφ 50% (πιεζπζκφο Βφξξαο) ζε 69,57% (πιεζπζκφο Υατληνχ), κε κέζε ηηκή 59,13%. Ο δξαζηηθφο αξηζκφο ησλ αιιεινκφξθσλ αλά γελεηηθή ζέζε (n e ) θπκαηλφηαλ απφ 1,238 (πιεζπζκφο Βφξξαο) έσο 1,306 (πιεζπζκφο Υατληνχ) κε κία κέζε ηηκή 1,270 (Πίλαθαο 3.2). Η ηηκή ηνπ δείθηε Shannon (Ι) έδεημε παξφκνηεο ηάζεηο θαη θπκάλζεθε απφ 0,225 έσο 0,295 ζηνπο πιεζπζκνχο Βφξξαο θαη Υατληνχ, αληίζηνηρα (κέζνο φξνο Ι = 0,258). Ο ζπληειεζηήο γελεηηθήο πνηθηιφηεηαο ηνπ Nei (H e ), ζην επίπεδν ηνπ πιεζπζκνχ θπκάλζεθε απφ 0,145 (πιεζπζκφο Βφξξαο) έσο 0,189 (πιεζπζκφο Υατληνχ) κε κηα κέζε ηηκή 0,166. Σα απνηειέζκαηα έδεημαλ φηη ε γελεηηθή πνηθηιφηεηα ηνπ Ρ. avium απφ ηνλ πιεζπζκφ Υατληνχ ήηαλ ε κεγαιχηεξε κεηαμχ ησλ πέληε πιεζπζκψλ. Ο πιεζπζκφο Βφξξαο παξνπζίαζε ηε κηθξφηεξε γελεηηθή πνηθηιφηεηα. Η γελεηηθή πνηθηιφηεηα ηνπ ζπλνιηθνχ δείγκαηνο ήηαλ ζρεηηθά πςειή (P = 100%, ne = 1,329, I = 0,338, H e = 0,209 Πίλαθαο 3.2). 69

70 Πίλαθαο 3.1: Υαξαθηεξηζηηθά θαη παξάκεηξνη γελεηηθήο πνηθηιόηεηαο ησλ ISSR θαη SSR κνξηαθώλ δεηθηώλ. Δθθηλεηήο (UBC) Θεξκνθξαζία Τβξηδηζκνύ ( o C) Δύξνο κεγέζνπο δώλεο Πνζνζηό Πνιπκνξθηζκνύ (%) Γνληδηαθή Θέζε n a Μέγεζνο αιιεινκόξθνπ (bp) H e F ST R ST F IS f n EMPA ,756 0,068 0,141 0,039 0, / ,7 EMPA ,771 0,119 0,216 0,064 0, EMPAS ,752 0,133 0,012 0,134 0, EMPAS ,798 0,082 0,098 0,148* 0, EMPAS ,723 0,099 0,061-0,007* 0,000 EMPAS ,772 0,118 0,027 0,133 0,047 EMPAS ,742 0,093 0,027 0,036 0,015 EMPAS ,560 0,078 0,068 0,291* 0,111 PS12A ,706 0,107 0,056 0,040 0,028 UDP ,778 0,028 0,018 0,049 0,052 PCEGA ,784 0,126 0,233 0,287* 0,117 Μέζνο Όξνο ,9 12,7-0,740 0,095 0,114 0,110 0,049 70

71 Δηθόλα 3.1: STRUCTURE αλάιπζε ησλ πέληε θπζηθώλ πιεζπζκώλ αγξηνθεξαζηάο. Γηα ηα δεδνκέλα απφ ηνπο SSR δείθηεο, παξαηεξήζεθαλ ζπλνιηθά 140 αιιειφκνξθα ζηηο 11 γνληδηαθέο ζέζεηο πνπ κειεηήζεθαλ. Ο αξηζκφο ησλ αιιεινκφξθσλ αλά γελεηηθή ζέζε θπκαίλνληαλ απφ νθηψ (EMPAS014) έσο 15 (EMPAS002, EMPAS011, PCEGA34) κε κηα κέζε ηηκή Α = 12,7. Η ζπρλφηεηα ησλ κεδεληθψλ αιιεινκφξθσλ (f n ) ήηαλ γεληθά ρακειή (κέζε ηηκή f n 0.05) θαη ήηαλ πην έληνλε (0.10 f n 0.12) ζε δχν γνληδηαθέο ζέζεηο κφλν (EMPAS014, PCEGA34), ελψ ε αλακελφκελε εηεξνδπγσηία (H e ) θπκαηλφηαλ απφ (EMPAS014) έσο 0,798 (EMPAS006). Αληρλεχζεθαλ κεδεληθά αιιειφκνξθα, ηα νπνία κπνξεί λα πξνθχςνπλ απφ ηελ ζπζζψξεπζε κεηαιιάμεσλ ζηηο ζέζεηο δέζκεπζεο ησλ εθθηλεηψλ. Σξεηο ζέζεηο (EMPAS006, EMPAS014 θαη PCEGA34) φπνπ ε ζπρλφηεηα ησλ κεδεληθψλ αιιεινκφξθσλ ππεξέβε ην 6% απνθιείζηεθαλ θαηά ηε 71

72 δηάξθεηα ησλ ππνινγηζκψλ ηνπ ζπληειεζηή νκνκημίαο F IS (Chapuis θαη Estoup 2007). Ο ζπληειεζηήο νκνκημίαο (F IS ρσξίο ηα κεδεληθά αιιειφκνξθα) θπκάλζεθε απφ -0,007 (EMPAS010) έσο (EMPAS014). ε ηέζζεξηο γνληδηαθέο ζέζεηο (EMPAS006, EMPAS010, EMPAS014 θαη PCEGA34) ε ηηκή F IS παξέθθιηλε ζεκαληηθά απφ ην κεδέλ (Πίλαθαο 3.1). Ο αξηζκφο ησλ αιιεινκφξθσλ A R αλά γελεηηθή ζέζε αλεμάξηεηα απφ ην κέγεζνο δείγκαηνο θπκάλζεθε απφ 6,455 (Νπκθαία) έσο 6,939 (Υνινκψληαο). Απνθιεηζηηθά αιιειφκνξθα παξαηεξήζεθαλ ζην 10% ηνπ ζπλνιηθνχ αξηζκνχ ησλ AR. Η κέζε εηεξνδπγσηία ήηαλ πςειφηεξε ζηελ Καηάθπην (0.765) θαη ε ρακειφηεξε ζηελ Υατληνχ (0.720). ην επίπεδν ηνπ πιεζπζκνχ, ε SSR αλάιπζε έδεημε πςειά επίπεδα γελεηηθήο κεηαβνιήο ζηνπο πιεζπζκνχο Καηάθπην θαη Νπκθαία, θαη ζρεηηθά πςειά επίπεδα ζηνπο ππφινηπνπο ηξεηο πιεζπζκνχο Υνινκψληαο, Υατληνχ θαη Βφξξαο (Πίλαθαο 3.2). Γχν απφ ηνπο πέληε πιεζπζκνχο έδεημαλ ζεκαληηθά ζεηηθέο ηηκέο F IS, ππνδεηθλχνληαο έλα έιιεηκκα εηεξνδπγσηίαο ζηνπο πιεζπζκνχο ηνπ Ρ. avium, πνπ εθδειψλεηαη πεξηζζφηεξν ζηνλ πιεζπζκφ Καηάθπην (F IS = 0,117, Πίλαθαο 3.2). Πίλαθαο 3.2: Γελεηηθή πνηθηιόηεηα ζε επίπεδν πιεζπζκνύ θαη είδνπο γηα ηνπο πέληε θπζηθνύο πιεζπζκνύο αγξηνθεξαζηάο. ISSR SSR Πιεζπζκνί n e I H e P (%) G ST n e H e AR par F IS F IS κεηά από δηόξζσζε F ST R ST Βόξξαο 1,238 0,225 0,145 50,00 4,120 0,734 6,833 0,860 0,004-0,016 Υνινκώληαο 1,304 0,285 0,185 63,04 3,952 0,730 6,939 1,050 0,083* 0,072 Καηάθπην 1,254 0,241 0,155 54,35 4,520 0,765 6,500 0,320 0,117* 0,117* Υατληνύ 1,306 0,295 0,189 69,57 4,315 0,720 7,519 0,500 0,093 0,053 Νπκθαία 1,249 0,241 0,154 58,70 4,360 0,752 6,455 0,380 0,102 0,142 Μέζνο όξνο 1,270 0,258 0,166 59,13 0,740 6,849 0,622 0,079 0,073 Δπίπεδν είδνπο 1,329 0,338 0, ,113 0,824 0,097 0,123 72

73 3.2.2 Γελεηηθή πνηθηιόηεηα κεηαμύ ησλ πιεζπζκώλ Η γελεηηθή δηαθνξνπνίεζε είλαη κηα ζεκαληηθή παξάκεηξνο πξνθεηκέλνπ λα αμηνινγεζεί ε γελεηηθή δνκή ησλ πιεζπζκψλ ελφο είδνπο. Γηα ηνπο ISSR δείθηεο, ν ζπληειεζηήο (G ST ) ηεο ηάμεσο ηνπ 0,113, ππνδεηθλχεη γελεηηθή δηαθνξνπνίεζε κεηαμχ ησλ πιεζπζκψλ. ζνλ αθνξά ηελ αληζνξξνπία ζχλδεζεο, ππήξρε έλαο πιεζπζκφο (Υατληνχ) πνπ παξνπζίαζε έλαλ πςειφ αξηζκφ ζπλδπαζκψλ γνληδηαθψλ πεξηνρψλ (> 20 απφ ζχλνιν 65) κε ζηαηηζηηθά ζεκαληηθέο ηηκέο (ξ <0,05). Μεηά ηε δηφξζσζε Bonferroni, ππήξρε ζεκαληηθή (ξ <0,05) αληζνξξνπία ζχλδεζεο κεηαμχ 23 δεπγψλ γνληδηαθψλ ζέζεσλ ζηνλ πιεζπζκφ Υατληνχ θαη κεηαμχ 15 δεπγψλ ζηνλ πιεζπζκφ Καηάθπην. Ο κηθξφηεξνο αξηζκφο ζεκαληηθψλ ζπλδπαζκψλ αληρλεχζεθε ζηνλ πιεζπζκφ Βφξξαο, φπνπ κφλν πέληε δεχγε γνληδηαθψλ ζέζεσλ είραλ ζεκαληηθέο (ξ <0.05) ηηκέο αληζνξξνπίαο ζχλδεζεο. χκθσλα κε ηελ AMOVA ηνπ ζπλφινπ δεδνκέλσλ ISSR, εληνπίζηεθαλ πνιχ ζεκαληηθέο (ξ <0,001) γνληδηαθέο δηαθνξέο κεηαμχ ησλ πέληε πιεζπζκψλ Ρ. avium. Σξηάληα έμη ηνηο εθαηφ ηεο ζπλνιηθήο γελεηηθήο πνηθηιφηεηαο απνδφζεθε ζηελ δηαθνξνπνίεζε κεηαμχ ησλ πιεζπζκψλ. Η AMOVA (Φ ST = 0,338) ππνζηεξίδεη ηα απνηειέζκαηα ηεο ζηαηηζηηθήο αλάιπζεο ηεο γελεηηθήο πνηθηιφηεηαο ηνπ Nei (1978) θαη ηνπ δείθηε Shannon I, ππνδεηθλχνληαο γελεηηθή δηαθνξνπνίεζε κεηαμχ ησλ πιεζπζκψλ (Πίλαθαο 3.3). Πίλαθαο 3.3: Αλάιπζε κνξηαθή παξαιιαθηηθόηεηαο γηα ηνπο πέληε θπζηθνύο πιεζπζκνύο αγξηνθεξαζηάο βαζηζκέλεο ζε ISSR θαη SSR δείθηεο. Πεγή παξαιιαθηηθόηεηαο d,f, SSD πλνιηθή δηαθύκαλζε (%) Μεηαμύ ησλ πιεζπζκώλ 4 185, Φ- ζηαηηζηηθή P ηηκή SSR Δληόο ησλ πιεζπζκώλ , Φ ST =0,338 <0,001 ύλνιν , Μεηαμύ ησλ πιεζπζκώλ 4 170, ISSR Δληόο ησλ πιεζπζκώλ , Φ ST = 0,162 <0,001 ύλνιν ,

74 Έηζη γηα λα ειεγρζεί πεξαηηέξσ ε δηαθνξνπνίεζε ησλ γνληδίσλ κεηαμχ ησλ πιεζπζκψλ, αμηνινγήζεθαλ νη ακεξφιεπηεο γνληδηαθέο απνζηάζεηο θαηά Nei (1978) (Πίλαθαο 3.4). Οη γνληδηαθέο απνζηάζεηο θαηά Nei κε βάζε ηελ αλάιπζε ISSR θπκαηλφηαλ απφ 0,028 έσο 0,232 (θάησ απφ ηε δηαγψλην) κε κέζν φξν Η κεγαιχηεξε γελεηηθή δηαθνξά (0,232) ζεκεηψζεθε κεηαμχ ησλ πιεζπζκψλ Βφξξαο θαη Υατληνχ θαη ε κηθξφηεξε (0,028) κεηαμχ ησλ πιεζπζκψλ Καηάθπην θαη Υατληνχ. Πίλαθαο 3.4: Γνληδηαθέο απνζηάζεηο θαηά Nei (1978) όπσο ππνινγίζηεθαλ γηα ηνπο πέληε θπζηθνύο πιεζπζκνύο αγξηνθεξαζηάο. Πιεζπζκνί Υνινκώληαο Υατληνύ Καηάθπην Νπκθαία Βόξξαο Υνινκώληαο **** 0,3934 0,5631 0,6736 0,4367 Υατληνύ 0,0406 **** 0,4765 0,5919 0,4144 Καηάθπην 0,0352 0,0277 **** 0,3834 0,3994 Νπκθαία 0,0706 0,0725 0,0752 **** 0,4175 Βόξξαο 0,1764 0,2315 0,1897 0,1659 **** Οη ζρέζεηο κεηαμχ ησλ πιεζπζκψλ απεηθνλίδνληαη ζε δελδξφγξακκα ρξεζηκνπνηψληαο ηνλ αιγφξηζκν UPGMA κε βάζε ηελ απφζηαζε θαηά Nei (1978). Έλα δελδξφγξακκα πνπ πξνήιζε απφ ηε ρξήζε ησλ ISSR δεηθηψλ νκαδνπνίεζε ηνπο πέληε πιεζπζκνχο ζε δχν θχξηεο νκάδεο (Δηθφλα 3.2). Ο πιεζπζκφο Βφξξαο ζρεκάηηζε μερσξηζηή νκάδα πνπ δειψλεη ηελ ειάζζνλα νκνηφηεηα κε ηνπο άιινπο ηέζζεξηο ππφ κειέηε πιεζπζκνχο. Η ηειεπηαία νκάδα δηαηξείηαη ζε δχν ππν-νκάδεο πνπ απνηεινχληαη απφ ηνπο πιεζπζκνχο Υνινκψληαο, Υατληνχ θαη Καηάθπην (πξψηε ππν-νκάδα) θαη Νπκθαία (δεχηεξε ππν-νκάδα). 74

75 Δηθόλα 3.2: UPGMA δελδξόγξακκα ζηεξηδόκελν ζηηο γνληδηαθέο απνζηάζεηο θαηά Nei (1978), δείρλεη ηηο ζρέζεηο ησλ πέληε εμεηαδόκελσλ πιεζπζκώλ κε ρξήζε ISSR (πάλσ) θαη SSR δεηθηώλ (θάησ). Δπηπιένλ, ηα απνηειέζκαηα ηεο αλάιπζεο θπξίσλ ζπληεηαγκέλσλ (PCoA) απεηθφληζαλ ηξεηο κεγάιεο νκάδεο, νη νπνίεο ήηαλ ζχκθσλεο κε ην δελδξφγξακκα UPGMA (Δηθφλα 3.2), εηδηθά φζνλ αθνξά ηνλ ζαθή δηαρσξηζκφ ηνπ πιεζπζκνχ Βφξξαο θαη ηνλ ζρεκαηηζκφ ελφο κεγάινπ ζπκπιέγκαηνο πνπ αληηζηνηρεί ζηνπο ελαπνκείλαληεο πιεζπζκνχο. Οη δχν πξψηεο θχξηεο ζπληεηαγκέλεο αληηπξνζσπεχνπλ ην 56.36% ηεο ζπλνιηθήο παξαιιαθηηθφηεηαο (Δηθφλα 3.3). Δηθόλα 3.3: Αλάιπζε θπξίσλ ζπληεηαγκέλσλ ησλ πέληε θπζηθώλ πιεζπζκώλ αγξηνθεξαζηάο κε ηε ρξήζε κνξηαθώλ δεηθηώλ ISSR. 75

76 Οη παξάκεηξνη F ST νη νπνίνη κεηαβάιινληαη κεηαμχ ησλ SSR ζέζεσλ, θπκαίλνληαη απφ 0,028 (UDP98-412) έσο 0,126 (PCEGA34) (Πίλαθαο 3.1). Η θαζνιηθή γελεηηθή δηαθνξνπνίεζε φισλ ησλ πιεζπζκψλ γηα ηνπο SSR δείθηεο εθηηκήζεθε κε αλαιχζεηο F ST θαη R ST (0,097 θαη 0,123, αληίζηνηρα). ιεο νη ηηκέο ησλ δεπγψλ F ST (0,076-0,128) θαη R ST (0,082 έσο 0,147) ήηαλ εμαηξεηηθά ζηαηηζηηθά ζεκαληηθέο (p <0,001) (Πίλαθαο 3.5). Οη γνληδηαθνί ζπληειεζηέο δηαθνξνπνίεζεο (F ST,R ST ) ππέδεημαλ ζεκαληηθή παξαιιαθηηθφηεηα ηνπ πιεζπζκνχ Ρ. avium ζε επίπεδν είδνπο (κεηξίσο πςειέο ηηκέο F ST, Πίλαθαο 3.2). Πίλαθαο 3.5: Εεύγε εθηηκώκελσλ ηηκώλ F ST (θάησ δηαγώληνο) θαη R ST (πάλσ δηαγώληνο) κεηαμύ ησλ πέληε θπζηθώλ πιεζπζκώλ αγξηνθεξαζηάο. Πιεζπζκόο Υνινκώληαο Υατληνύ Καηάθπην Νπκθαία Βόξξαο Υνινκώληαο - 0,095*** 0,087*** 0,104*** 0,105*** Υατληνύ 0,092*** - 0,082*** 0,138*** 0,147*** Καηάθπην 0,109*** 0,100*** - 0,111*** 0,122*** Νπκθαία 0,128*** 0,121*** 0,076*** - 0,102*** Βόξξαο 0,095*** 0,094*** 0,080*** 0,086*** - Η αλάιπζε AMOVA γηα ηνπο SSR δείθηεο παξήγαγε παξφκνηα απνηειέζκαηα (ζηαηηζηηθά ζεκαληηθέο ηηκέο Φ, Πίλαθαο 3.3). Δπίζεο απνθάιπςε πςειφ πνζνζηφ δηαθχκαλζεο ιφγσ πιεζπζκηαθήο δνκήο (88%). Οη ακεξφιεπηεο γελεηηθέο απνζηάζεηο ηνπ Nei (1978) θπκαίλνληαλ απφ 0,383 (Καηάθπην έλαληη Νπκθαία) έσο 0,674 (Υνινκψληαο έλαληη Νπκθαία). Μεηά ηελ αλάιπζε UPGMA νη πιεζπζκνί Ρ. avium θαηεγνξηνπνηήζεθαλ ζε δχν νκάδεο (Δηθφλα 3.2). Η FCA ησλ δεδνκέλσλ SSR παξνπζίαζε έλαλ ζαθή δηαρσξηζκφ ησλ πιεζπζκψλ (Δηθφλα 3.4). Έλα κεγάιν κέξνο ηεο ζπλνιηθήο γελεηηθήο παξαιιαθηηθφηεηαο (79%) επεμεγείηαη κε ζε έλαλ ρακειφ δηάζηεκα πνιπκεηαβιεηφ (ηξηζδηάζηαην). Ο δηαρσξηζκφο ηνπ 1 νπ άμνλα δηαρψξηζε ηνπο πιεζπζκνχο. Πην ελδηαθέξνλ ήηαλ ν δηαρσξηζκφο ηνπ 2 νπ άμνλα πνπ απνθάιπςε ην ζρεκαηηζκφ δχν νκάδσλ: ηελ πξψηε πνπ πεξηιακβάλεη ηνπο ειιεληθνχο βφξεηναλαηνιηθνχο πιεζπζκνχο Ρ. avium (Υατληνχ, Καηάθπην, Νπκθαία) θαη ε δεχηεξε πνπ 76

77 ζπκπεξηιακβάλεη ηνπο βφξεην-θεληξηθνχο ειιεληθνχο πιεζπζκνχο (Υνινκψληαο, Βφξξαο). Η αλάιπζε ηεο γελεηηθήο δνκήο κε δείθηεο SSR δηεμήρζε ρσξίο λα ιεθζνχλ ππφςε νη πθηζηάκελεο πιεξνθνξίεο ζρεηηθά κε ηε γεσγξαθηθή πξνέιεπζε ησλ δεηγκάησλ θαη ε πςειφηεξε πηζαλφηεηα ησλ δεδνκέλσλ ιακβάλεηαη γηα Κ = 5. Σν ζχλνιν δεδνκέλσλ ρσξίζηεθε ζε νκάδεο ή νκάδεο γνληδίσλ πνπ αληηπξνζσπεχνπλ γεληθά ηνλ γεσγξαθηθφ δηαρσξηζκφ (Δηθφλα 3.1): άηνκα ησλ πιεζπζκψλ Υνινκψληαο, Υατληνχ, Καηάθπην, Νπκθαία θαη Βφξξαο έηεηλαλ λα ηαμηλνκεζνχλ ζε δηαθνξεηηθέο νκάδεο. Υακειά επίπεδα πξφζκημεο παξαηεξήζεθαλ ζε ηέζζεξηο πιεζπζκνχο. Έλα κέηξην επίπεδν αλάκημεο αληρλεχζεθε ζηνλ πιεζπζκφ Καηάθπην. Η θαηά Bayes αλάιπζε πνπ εθαξκφζηεθε ζε δεδνκέλα ISSR δεηθηψλ έδεημε παξφκνηα νκαδνπνίεζε ησλ γελνηχπσλ. Παξνπζηάζηεθαλ ζηνηρεία αληηζηνίρεζεο ηεο γεσγξαθηθήο απφζηαζεο κε ηελ νκαδνπνίεζε ησλ πιεζπζκψλ ηδηαίηεξα ζηελ FCA (Δηθφλα 3.4) Αμηνιόγεζε ηνπ δξαζηηθνύ κεγέζνπο πιεζπζκνύ, ηεο γελεηηθήο εθηξνπήο, ηεο γνληδηαθήο ξνήο θαη ηεο ζηέλσζεο πιεζπζκνύ Δηθόλα 3.4: Παξαγνληηθή αλάιπζε αληηζηνηρηώλ (FCA) ησλ πέληε εμεηαδόκελσλ πιεζπζκώλ αγξηνθεξαζηάο κε ηε ρξήζε SSR δεηθηώλ. 77

78 Οη πιεζπζκνί κε ηα πςειφηεξα δξαζηηθά κεγέζε πιεζπζκνχ-πνπ ππνινγίζηεθαλ κε ην πξφγξακκα N E Estimator ήηαλ ε Νπκθαία θαη ην Καηάθπην (ην N E θπκαίλεηαη απφ 82,3 έσο 84,1) (Πίλαθαο 3.6). Ο πιεζπζκφο κε ην πςειφηεξν δξαζηηθφ κέγεζνο πιεζπζκνχ ήηαλ ν Βφξξαο (NE = % CI: ). Η κέζνδνο αληζνξξνπίαο ζχλδεζεο (Hill 1981) παξείρε επίζεο ρακειέο έσο κέηξηεο εθηηκήζεηο ηνπ κέζνπ φξνπ N E ζηνπο πιεζπζκνχο N E = 64,54), αιιά πνιχ επξχηεξα δηαζηήκαηα εκπηζηνζχλεο (95% CI θχκαλζε 27,7-269,9). Σα εθηηκψκελα δξαζηηθά κεγέζε πιεζπζκνχ κε βάζε ην ινγηζκηθφ ESTIM γηα φινπο ηνπο P. avium πιεζπζκνχο θπκαίλνληαη απφ N E = (Υνινκψληαο, Γηάζηεκα εκπηζηνζχλεο 95%, CI = ) έσο ην ζεσξεηηθά άπεηξν (Νπκθαία, Γηάζηεκα εκπηζηνζχλεο 95% CI = ). πγθεθξηκέλα, ηα ρακειφηεξα 95% CIs ήηαλ πεξίπνπ 40 γηα φινπο ηνπο βφξεην-αλαηνιηθνχο πιεζπζκνχο (Πίλαθαο 3.6). Οη έκκεζεο εθηηκήζεηο ηεο παξακέηξνπ Nm, πνπ πξνθχπηνπλ απφ ηελ G ST (ISSR) θαη ηελ R ST (SSR) ήηαλ 1,962 θαη 1,782 αληίζηνηρα. Η αληίζηνηρε ηηκή Nm πνπ ππνινγίζηεθε απφ ηε κέζνδν απνθιεηζηηθψλ αιιεινκφξθσλ (Slatkin 1985) ήηαλ 1,190. Πξνθαλψο, φιεο απηέο νη εθηηκήζεηο εκθαλίδνπλ ζηαζεξά ρακειφ επίπεδν ηεο ηζηνξηθήο γνληδηαθήο ξνήο κεηαμχ ησλ ππφ κειέηε P. avium πιεζπζκψλ. Σν απνηέιεζκα απηφ εληζρχεηαη πεξαηηέξσ απφ κηα αλάιπζε αλάζεζεο (ρξεζηκνπνηψληαο ην ινγηζκηθφ GENECLASS2), ε νπνία αληρλεχεη κφλν κεηαλάζηεπζε πξψηεο γεληάο κεηαμχ ησλ πιεζπζκψλ Υατληνχ θαη Καηάθπην, γεγνλφο πνπ ππνδειψλεη φηη ζρεδφλ θακία ζχγρξνλε γνληδηαθή ξνή δελ ιακβάλεη ρψξα κεηαμχ ησλ θπζηθψλ πιεζπζκψλ ηεο αγξηνθεξαζηάο. Πίνακασ 3.6: Εκτίμθςθ του δραςτικοφ μεγζκουσ πλθκυςμοφ και ζλεγχοσ ιςορροπίασ μετάλλαξθσ-εκτροπισ. Πιεζπζκόο N E Estimator N E ESTIM TPM Αιιαγή πξνγξάκκαηνο ιεηηνπξγίαο Υνινκώληαο 44,5 (30,3-78,6) 49,93 (19,05- ) 0,517 (ns) Φπζηνινγηθή Υατληνύ 67,5 (42,7-146,3) 183,75 (39,14- ) 0,517 (ns) Φπζηνινγηθή Καηάθπην 84,1 (51,1-211,5) 202,47 (40,28- ) 0,649 (ns) Φπζηνινγηθή Νπκθαία 82,3 (46,9-269,9) (53,45- ) 0,026* Φπζηνινγηθή Βόξξαο 44,3 (27,7-98,5) 237,87 (22,51- ) 0,103 (ns) Φπζηνινγηθή N E : δξαζηηθφ κέγεζνο πιεζπζκνχ, TPM: δηθαζηθφ πξφηππν, ns: non-significant test, *p < 0.05, ** p <

79 Οη ελ δπλάκεη πιεζπζκνί ζε θαηάζηαζε γελεηηθήο ζηελσπνχ εξεπλήζεθαλ κε ην πξφηππν TPM κεηά απφ κία δνθηκή κεγέζνπο κεηαιιαγήο αιιεινκφξθσλ (Hardy θ.ά. 2003), πνπ αλέθεξε φηη νη κεηαιιάμεηο δελ θαίλεηαη λα ζπκβάινπλ ζηελ γελεηηθή δηαθνξνπνίεζε ζηελ ζπγθεθξηκέλε θιίκαθα. ηαλ ην κνληέιν TPM εθαξκφζηεθε, ρξεζηκνπνηήζεθαλ δνθηκέο Wilcoxon γηα ηελ αλίρλεπζε γελεηηθήο ζηελσπνχ ζηνπο πιεζπζκνχο ππνδεηθλχνληαο κηα κάιινλ αζζελή γελεηηθή ζηελσπφ (p <0.05) κφλν ζηνλ πιεζπζκφ Νπκθαία (Πίλαθαο 3.6). 3.3 πδήηεζε Δλδνπιεζπζκηαθή γελεηηθή πνηθηιόηεηα ηελ πιεζπζκηαθή γελεηηθή νη γελεηηθνί δείθηεο πνπ βαζίδνληαη ζηνπο κηθξνδνξπθφξνπο είλαη έλα ηδηαίηεξα ηζρπξφ θξηηήξην γηα ηελ αλίρλεπζε δηαθνξνπνίεζεο εμαηηίαο ηνπ πςεινχ πνιπκνξθηζκνχ ηνπο. Υξεζηκνπνηψληαο ηνπο κνξηαθνχο δείθηεο ISSR θαη SSR εθηηκήζεθε ε ελδνπιεζπζκηαθή γελεηηθή πνηθηιφηεηα θαη δηεξεπλήζεθε ε γελεηηθή δνκή ζε πέληε θπζηθνχο πιεζπζκνχο θεξαζηάο. Η κέζε γελεηηθή πνηθηιφηεηα ησλ πιεζπζκψλ (He = 0,740) ήηαλ πςειή θαη ζε ζπκθσλία κε ηελ πςειή εηεξνδπγσηία ζηνπο κηθξνδνξπθφξνπο ζηα πεξηζζφηεξα είδε θεξαζηάο (Sanou θ.ά. 2005). ηελ πξαγκαηηθφηεηα, ήηαλ πςειφηεξεο απφ ηηο αληίζηνηρεο ηηκέο ζε άιιεο κειέηεο πνπ πξαγκαηνπνηήζεθαλ ζε δηαρεηξηδφκελνπο θαη κε δηαρεηξηδφκελνπο ππάξρνληεο πιεζπζκνχο αγξηνθεξαζηάο πνπ πξνέξρνληαλ απφ ηελ θεληξηθά θαη βφξεηα ζεκεία θπζηθήο εμάπισζεο ηνπ είδνπο (Γαιιία, Κεληξηθή Δπξψπε, Ηλσκέλν Βαζίιεην, (Mariette θ.ά. 2010; Stoeckel θ.ά. 2006; Vaughan θ.ά. 2007). Ο κέζνο φξνο ηνπ αξηζκνχ ησλ αιιεινκφξθσλ ζηηο δηάθνξεο γνληδηαθέο ζέζεηο ήηαλ επίζεο πςειφο (A R = 6,849), αιιά ρακειφηεξνο απφ ηηο κέζεο ηηκέο πνπ αλαθέξζεθαλ ζε άιιεο κειέηεο ζηελ θεξαζηά κε SSR δείθηεο (Mariette θ.ά. 2010; Stoeckel θ.ά. 2006; Vaughan θ.ά. 2007). Σν ίδην θαηλφκελν παξαηεξήζεθε θαη κεηά απφ ζχγθξηζε ησλ κέζσλ ηηκψλ He θαη A R πνπ ππνινγίζακε κε ηηο αληίζηνηρεο κέζεο ηηκέο ησλ Vaughan θ.ά. (2007) νη νπνίνη ρξεζηκνπνίεζαλ πιεζπζκνχο απφ ην Ηλσκέλν Βαζίιεην. Η αμηνιφγεζε ησλ ίδησλ 10 θνηλψλ γνληδηαθψλ ζέζεσλ SSR έδεημε φηη ε He θαη ν A R ήηαλ 0,744 θαη 6,590 αληίζηνηρα ζηελ δηθή καο κειέηε, θαη 0,692 θαη 7,524 ζηελ κειέηε ησλ Vaughan θ.ά. (2007). Η pa R δελ κπνξνχζε λα ζπγθξηζεί κε πξνεγνχκελεο κειέηεο ζε πιεζπζκνχο θεξαζηάο, δεδνκέλνπ φηη δελ έρεη αλαθεξζεί γηα ηελ αγξηνθεξαζηά. Σν πιήζνο ησλ αιιεινκφξθσλ είλαη ζαθέζηαηα πην θαηαηνπηζηηθφ γηα ηελ εθηίκεζε ηεο γελεηηθήο δηάβξσζεο ζηνπο θπζηθνχο 79

80 πιεζπζκνχο απφ ηελ αλακελφκελε εηεξνδπγσηία (Spencer θ.ά. 2000) πνπ είλαη πην επαίζζεηε ζηηο επηδξάζεηο ηεο δεκνγξαθηθήο ζηελσπνχ θαη ησλ άκεζσλ ζπλεπεηψλ ηεο. Σα πςειά επίπεδα δηαθχκαλζεο κεηαμχ ησλ πιεζπζκψλ παξαηεξήζεθαλ επίζεο κε βάζε ηνλ δείθηε πνηθηιφηεηαο ηνπ Shannon (Ι=0,338 γηα ISSR δείθηεο). Οη παξαπάλσ ηηκέο ήηαλ πςειφηεξεο απφ απηέο πνπ έρνπλ θαηαγξαθεί ζε πιεζπζκνχο P. mahaleb θαη P. αfricana κε βάζε ηνπο δείθηεο RAPD (Dawson θαη Powell 1999; Jordano θαη Godoy 2000). Φαίλεηαη φηη νη ππφ κειέηε πιεζπζκνί παξνπζηάδνπλ γεληθά επαξθή, αλ φρη πςειή γελεηηθή πνηθηιφηεηα, ε νπνία βεβαηψλεη ηε κειινληηθή ζηαζεξφηεηα ηνπο. Σν απνηέιεζκα απηφ δηαθέξεη απφ φ,ηη ζα αλακελφηαλ γηα ηνπο πιεζπζκνχο θαηαθπγίσλ απφ παγεηψλεο πνπ έρνπλ ζεσξεζεί κνλαδηθνί γηα ηνλ πινχην ησλ αιιεινκφξθσλ, αιιά φρη γηα ηελ πνηθηιφηεηα ηνπ γνληδίνπ (Widmer θαη Lexer 2001). ε απηή ηελ πεξίπησζε, είλαη ζαθέο φηη νη νξηαθνί-πεξηθεξεηαθνί πιεζπζκνί πνπ κειεηήζακε ζε ζχγθξηζε κε ηνπο θεληξηθνχο πιεζπζκνχο απφ ηε Γαιιία θαη ην Ηλσκέλν Βαζίιεην παξνπζηάδνπλ ρακειφηεξν πινχην αιιεινκφξθσλ θαη πςειφηεξε γελεηηθή πνηθηιφηεηα. Ωο εθ ηνχηνπ, ηα απνηειέζκαηά καο δελ θαίλεηαη λα είλαη ζχκθσλα κε ην κνληέιν θέληξνπ-πεξηθέξεηαο (Lesica θαη Allendorf 1992) θαη νη νξηαθνί-πεξηθεξεηαθνί πιεζπζκνί αγξηνθεξαζηάο ηεο Διιάδαο παξνπζηάδνπλ ζεκαληηθά επίπεδα γελεηηθήο πνηθηιφηεηαο, ζε ζπκθσλία κε ηε ζεσξία ησλ Hampe θαη Petit (2005). Βξέζεθε πεξίζζεηα νκνδχγσησλ γηα δέθα απφ ηηο έληεθα ππφ κειέηε κηθξνδνξπθνξηθέο γνληδηαθέο ζέζεηο. Γηα φινπο ηνπο πιεζπζκνχο παξαηεξήζεθε ζεηηθφο ζπληειεζηήο νκνκημίαο (κέζε F IS = 0,079), αιιά ε ηηκή F IS ήηαλ ζηαηηζηηθά ζεκαληηθή κφλν ζε δχν απφ ηνπο πέληε πιεζπζκνχο πνπ κειεηήζεθαλ. Οη Mariette θ.ά. (2010) αλέθεξαλ επίζεο αλεπάξθεηα εηεξνδχγσησλ αηφκσλ ζε θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο (F IS = 0,04). ε γεληθέο γξακκέο, ε ηηκή ηεο F IS ππνδεηθλχεη κία απφζηαζε απφ ηελ ηζνξξνπία Hardy-Weinberg πνπ νθείιεηαη ζηελ έιιεηςε εηεξνδχγσησλ. Απηφ ην απνηέιεζκα δηαθέξεη ζε θάπνην βαζκφ απφ ηελ πιεηνλφηεηα ησλ πξνεγνχκελσλ απνηειεζκάησλ ζε θπζηθνχο πιεζπζκνχο θεξαζηάο φπνπ έρεη αλαθεξζεί πεξίζζεηα εηεξνδχγσησλ θπξίσο ζε πιεζπζκνχο πνπ πξνέξρνληαη απφ ηνλ ππξήλα ηεο θπζηθήο εμάπισζεο ηνπ είδνπο π.ρ. Γαιιία θαη Ιηαιία, (Ducci θαη Santi 1997; Frascaria θ.ά. 1993; Stoeckel θ.ά. 2006)). Απηή ε πξφηαζε ζα κπνξνχζε λα επεμεγήζεη ηελ δηαθνξά κεηαμχ ησλ απνηειεζκάησλ ηεο παξνχζαο κειέηεο θαη ησλ πξνεγνχκελσλ, εθφζνλ ζηελ πεξίπησζή καο ηα άηνκα ππνβιήζεθαλ ζε δεηγκαηνιεςία κε απνζηάζεηο ηνπιάρηζηνλ

81 m κεηαμχ ηνπο. ηαλ απνθεχγεηαη ε δεηγκαηνιεςία αληηγξάθσλ θιψλσλ εθ ξηδνβιαζηψλ, ν πιεζπζκφο ζην ζχλνιφ ηνπ ελδέρεηαη λα κελ ραξαθηεξίδεηαη απφ πεξίζζεηα εηεξνδπγσηίαο. Σέινο, ηα απμεκέλα επίπεδα νκνδπγσηίαο θαη ε απφζηαζε απφ ηελ ηζνξξνπία Hardy-Weinberg ζα κπνξνχζε επίζεο λα νθείινληαη ζην δεπγάξσκα κεηαμχ ησλ ζπλδεδεκέλσλ αηφκσλ, ην κηθξφ κέγεζνο ηνπ πιεζπζκνχ, ή ηε δηάζπαξηε εμάπισζε ηνπ είδνπο, ε νπνία δελ κπνξεί λα ζρεκαηίζεη πάληα πιεζπζκνχο κε ηπραία ζχδεπμε (Boys θ.ά. 2005; Degen θ.ά. 2006; Durel θ.ά. 1996) Γελεηηθή πνηθηιόηεηα κεηαμύ ησλ πιεζπζκώλ Οη SSR δείθηεο παξνπζίαζαλ πςειφηεξε γελεηηθή πνηθηιφηεηα εληφο ηνπ πιεζπζκνχ θαη ρακειφηεξε γελεηηθή δηαθνξνπνίεζε κεηαμχ ησλ πιεζπζκψλ ζε ζρέζε κε ηνπο ISSR, πηζαλφλ ιφγσ ηνπ πςειφηεξνπ πνιπκνξθηζκνχ ησλ ISSR (Gaudeul θ.ά. 2004) θαη ηεο πηζαλήο ππνεθηίκεζεο ηεο εηεξνδπγσηίαο ηνπο (Tang θ.ά. 2008). Ωζηφζν, γηα ηελ ζρεηηθή δηαθνξνπνίεζε κεηαμχ ησλ πιεζπζκψλ κε ISSR θαη SSR δείθηεο αληρλεχηεθαλ παξφκνηεο ηηκέο (G ST = 0,113, F ST = 0,097, Πίλαθαο 3.3). πσο ήηαλ αλακελφκελν, ηα απνηειέζκαηα ηεο AMOVA έδεημαλ φηη ην κεγαιχηεξν κέξνο ηεο δηαθχκαλζεο θαηαλεκήζεθε εληφο ησλ πιεζπζκψλ. Η παξαιιαθηηθφηεηα κεηαμχ ησλ πιεζπζκψλ ήηαλ εμαηξεηηθά ζεκαληηθή θαη έθζαζε ην 34% ζηελ αλάιπζε κε ηνπο ISSR δείθηεο, αιιά κφλν 16% ζηελ αλάιπζε κε ηνπο SSR δείθηεο (Πίλαθαο 3.5). Αθφκα θαη ε ρακειφηεξε δηαθνξνπνίεζε πνπ παξαηεξείηαη ζηελ SSR αλάιπζε κπνξεί λα εμεγεζεί απφ ηα πςειφηεξα πνζνζηά κεηάιιαμεο ησλ SSR δεηθηψλ (Hedrick 1999; Queney θ.ά. 2001; Schlötterer 2000; Tang θ.ά. 2008) ή ηεο νκνπιαζίαο (Gaudeul θ.ά. 2004). Οη παξαπάλσ εθηηκήζεηο ήηαλ πςειφηεξεο απφ απηέο πνπ αληρλεχηεθαλ ζε πξνεγνχκελεο έξεπλεο ζηελ αγξηνθεξαζηά, πνπ βαζίδνληαλ ζε δηαθνξεηηθνχο ηχπνπο γνληδηαθψλ δεηθηψλ. Οη Santi (1988), Frascaria θ.ά. (1993) θαη Mariette θ.ά. (1997) βξήθαλ ζρεηηθά ρακειή γελεηηθή δηαθνξνπνίεζε κεηαμχ δεηγκάησλ ζε ηέζζεξηο (F ST = 0,012), ηέζζεξηο (F ST = 0,049) θαη πέληε πιεζπζκνχο (F ST = 0,052) αληίζηνηρα, κε ηε ρξήζε ηζνελδπκηθψλ δεηθηψλ ζε πιεζπζκνχο πνπ θαηάγνληαη απφ ηε Γαιιία. Οη Stoeckel θ.ά. (2006) βξήθαλ ηηκή F ST = 0,066 ρξεζηκνπνηψληαο δείθηεο SSR θαη S-γνληδίνπ κειεηψληαο πιεζπζκνχο αγξηνθεξαζηάο ζηε Γαιιία, ελψ νη Vaughan θ.ά. (2007) αλέθεξαλ κηα F ST = 0,022 ζε πιεζπζκνχο ηνπ Ηλσκέλνπ Βαζηιείνπ. χκθσλα κε ηνπο Mariette θ.ά. (2010) ε F ST κεηαμχ αγξηνθεξαζηάο θαη παξαδνζηαθψλ πνηθηιηψλ ζηε Γαιιία έρεη εθηηκεζεί φηη είλαη F ST = 0,060. Πξάγκαηη, ηα είδε δέληξσλ πνπ ππνβάιινληαη ζε κεζφδνπο βειηίσζεο ρσξίο 81

82 δηαζηαπξψζεηο ηείλνπλ λα εθδειψλνπλ πςειή ελδνπιεζπζκηάθε γελεηηθή πνηθηιφηεηα θαη ρακειή έσο κέηξηα δηαθνξνπνίεζε ησλ πιεζπζκψλ (Hamrick θ.ά. 1992), σο ζπλέπεηα ηεο κεγάιεο ξνήο γνληδίσλ. Σν ζεκαληηθφ πνζνζηφ ηεο δηαθνξνπνίεζεο κεηαμχ ησλ πιεζπζκψλ απηήο ηεο κειέηεο αληαλαθιά πηζαλψο έλαλ ζεκαληηθφ δηαρσξηζκφ θαη κηα απνκφλσζε ησλ Διιεληθψλ πιεζπζκψλ ζε ζχγθξηζε κε εθείλνπο ηεο Γπηηθήο Δπξψπεο. ζνλ αθνξά ηελ αληζνξξνπία ζχλδεζεο ηα δεχγε ησλ γνληδηαθψλ ζέζεσλ κε ζεκαληηθή αληζνξξνπία ήηαλ δηαθνξεηηθά ζε θάζε έλαλ απφ ηνπο πέληε πιεζπζκνχο, ππνδειψλνληαο φηη ε αληζνξξνπία νθεηιφηαλ πηζαλψο ζε δηαθνξεηηθέο δεκνγξαθηθέο πξνειεχζεηο απηψλ ησλ πιεζπζκψλ. πλνιηθά, ππάξρεη ζπζζψξεπζε ζηνηρείσλ πνπ απνδεηθλχνπλ φηη ζηνπο πιεζπζκνχο πνπ βξίζθνληαη ζηα φξηα εμάπισζεο ηνπ είδνπο ε ελδερφκελε δξάζε ηεο ηζηνξηθήο γελεηηθήο εθηξνπήο, θαη ε απνκφλσζε ηνπο επλνεί ηε γελεηηθή δνκή θαη ηε δηαθνξνπνίεζε (Eckert θ.ά. 2008; Hampe θαη Petit 2005; Schaal θαη Leverich 1996; Vucetich θαη Waite 2003). Σα δελδξνγξάκκαηα UPGMA παξνπζίαζαλ γεληθά παξφκνηα απνηειέζκαηα. Η θχξηα δηαπίζησζε αθνξά θπξίσο ην δπηηθφηεξν πιεζπζκφ πνπ κειεηήζεθε (Βφξξαο, Δηθφλα 3.1). Ο πιεζπζκφο Βφξξαο θαίλεηαη ζεκαληηθά δηαθνξνπνηεκέλνο ηδηαίηεξα ζηελ αλάιπζε κε ISSR δείθηεο (Δηθφλα 3.2). Μηα δηαθνξά κεηαμχ ησλ δχν δηαγξακκάησλ εληνπίζηεθε γηα έλα θεληξηθφ πιεζπζκφ (Καηάθπην) κεηαμχ εθείλσλ πνπ κειεηήζεθαλ ζηνλ άμνλα απφ Γπζκάο πξνο Αλαηνιάο (Δηθφλα 3.1). Απηφο ν πιεζπζκφο εκθαλίζηεθε λα αλήθεη ζε δηαθνξεηηθέο νκάδεο ζηελ ISSR θαη SSR αλάιπζε αληίζηνηρα (Δηθφλα 3.2). Απφ ηα απνηειέζκαηα ηεο PCoA γηα ηνπο ISSR δείθηεο δηαθάλεθε φηη ηξεηο νκάδεο ρσξίδνληαη ηθαλνπνηεηηθά. ε αληηζηνηρία κε ην δελδξφγξακκα θαηά UPGMA, ε δηαθνξνπνίεζε ηνπ πιεζπζκνχ Βφξξαο θαη ζε κηθξφηεξν βαζκφ ηνπ πιεζπζκνχ Νπκθαία, ήηαλ εκθαλήο. Αθφκε πην ελδηαθέξνπζα θαη θαηαηνπηζηηθή κε βάζε ηελ θχζε ησλ δεδνκέλσλ ησλ δεηθηψλ θαη ην πςειφ πνζνζηφ ηεο ζπλνιηθήο παξαιιαθηηθφηεηαο πνπ δηθαηνινγείηαη ζε ρακειφ πνιπκεηαβιεηφ δηάζηεκα, ήηαλ ε αλάιπζε FCA βαζηζκέλε ζηνπο δείθηεο SSR. Σα απνηειέζκαηα ήηαλ ζχκθσλα κε ηηο πξνεγνχκελεο αλαιχζεηο θαη ησλ δχν δεηθηψλ, αιιά ε πξνθαλήο δηάθξηζε ησλ δχν νκάδσλ πνπ ζρεκαηίδνληαη (βφξεην-θεληξηθνί θαη βφξεην-αλαηνιηθνί πιεζπζκνί, Δηθφλα 3.4) ήηαλ ζαθψο πην δηεπθξηληζηηθή κε απηή ηελ πξνζέγγηζε. Η πηζαλή πξφζκημε ησλ πιεζπζκψλ ειέγρζεθε κε ην ινγηζκηθφ STRUCTURE, ην νπνίν απνθάιπςε φηη θάζε πιεζπζκφο πνπ κειεηήζεθε αληηζηνηρνχζε ζε κηα κνλαδηθή 82

83 δεμακελή γνληδίσλ. Σα απνηειέζκαηα ηεο αλάιπζεο STRUCTURE επαιεζεχνληαη πεξαηηέξσ θαη απφ ηα απνηειέζκαηα ησλ αλαιχζεσλ PCoA θαη FCA, ππνδεηθλχνληαο φηη ηα πεξηζζφηεξα άηνκα είλαη ζπγθεληξσκέλα ζε δηαθξηηέο πιεζπζκηαθέο νκάδεο (Δηθφλα 3.3, Δηθφλα 3.4). Η παξνπζία ησλ απνθιεηζηηθψλ αιιεινκφξθσλ ζε θάζε πιεζπζκφ (Πίλαθαο 3.3), επίζεο απνδεηθλχεη θάπνην βαζκφ αλεμαξηεζίαο. Η αλάιπζε κε ην ινγηζκηθφ STRUCTURE εληφπηζε έλα ρακειφ επίπεδν πξφζκημεο ησλ ππφ κειέηε πιεζπζκψλ αγξηνθεξαζηάο. Η δηαθνξνπνίεζε ησλ πιεζπζκψλ, φπσο απεηθνλίδεηαη απφ ηηο παξαπάλσ αλαιχζεηο, δεηά ηνλ ιεπηνκεξή θαζνξηζκφ ηεο δνκήο ησλ πιεζπζκψλ ηεο αγξηνθεξαζηάο πνπ παξνπζηάδεη δηπιή ζεκαζία: αθελφο επηηξέπεη ηελ δηαρείξηζε ησλ δαζψλ θαη αθεηέξνπ δηεπθνιχλεη ηε δεκηνπξγία ελφο θαηάιιεινπ πξνγξάκκαηνο δηαηήξεζεο ησλ θπζηθψλ πιεζπζκψλ Γξαζηηθό κέγεζνο πιεζπζκνύ, γελεηηθή εθηξνπή, γνληδηαθή ξνή θαη δηεξεύλεζε πιεζπζκώλ ππό γελεηηθή ζηελσπό Οη εθηηκήζεηο ηνπ δξαζηηθνχ κεγέζνπο ηνπ πιεζπζκνχ παξέρνπλ έλα κέηξν ησλ επηπηψζεσλ πνπ πξνθαινχλ ή είλαη αλάινγεο κε ηελ γελεηηθή εθηξνπή ζηνπο θπζηθνχο πιεζπζκνχο. Σν δξαζηηθφ κέγεζνο ηνπ πιεζπζκνχ (N E ) ππνινγίδεηαη απφ ηελ αληζνξξνπία ζχλδεζεο θαη ηηο κεζφδνπο ησλ Wright-Fisher. Η αγξηνθεξαζηά φπσο ππνδεηθλχεηαη απφ ηελ αλάιπζε STRUCTURE θαίλεηαη λα παξνπζηάδεη πεξηνξηζκέλε δηαζπνξά, σζηφζν, φηαλ ην ζπλνιηθφ πνζνζηφ κεηαλάζηεπζεο είλαη ρακειφ, ε δηαθνξνπνίεζε αθφκε θαη κεηαμχ ησλ γεηηνληθψλ πιεζπζκψλ είλαη θνληά ζε εθείλε πνπ αλακέλεηαη ζε έλα κνληέιν επείξσλ-λήζνπ (Kalinowski 2002; Kimura θαη Maruyama 1971; Rousset 2000). Η εθηίκεζε ηνπ κεγέζνπο ηνπ πιεζπζκνχ είλαη επίζεο ζρεηηθά πςειή ζε ζρέζε ηελ ππφζεζε ηεο ηζνξξνπία κεηαλάζηεπζεο-γελεηηθήο εθηξνπήο (Vitalis θαη Couvet 2001). Ακθφηεξεο νη κέζνδνη είλαη ζπλεπψο αμηφπηζηεο γηα ηελ παξνχζα κειέηε θαη ππνδεηθλχνπλ επαξθή επίπεδα ησλ δξαζηηθψλ κεγεζψλ γηα φινπο ηνπο πιεζπζκνχο πνπ πηζαλφηαηα είλαη αξθεηφ γηα ηε ζηαζεξφηεηά θαη ηελ πξνζαξκνζηηθή εμέιημε ηνπο ζην κέιινλ ππφ ην πξίζκα ηεο θιηκαηηθήο αιιαγήο. Δίλαη ελδηαθέξνλ φηη νη βφξεην-αλαηνιηθνί πιεζπζκνί παξνπζηάδνπλ αξθεηά πςειά επίπεδα N E ζε ζχγθξηζε κε ηνπο βφξεην-θεληξηθνχο. Δηδηθά ν πιεζπζκφο Υνινκψληαο θαίλεηαη λα έρεη έλα ζπγθξηηηθά πεξηνξηζκέλν δξαζηηθφ κέγεζνο πιεζπζκνχ. Η εκθάληζε δηάζπαξησλ πιεζπζκψλ κπνξεί λα νδεγήζεη ζε πςειή γελεηηθή πνηθηιφηεηα κεηαμχ ησλ πιεζπζκψλ θαη ησλ πεξηβαιιφλησλ ζηα νπνία βξίζθνληαη, 83

84 θπξίσο ιφγσ ηεο έθζεζήο ηνπο ζε γελεηηθή εθηξνπή (Belletti θ.ά. 2008). Δπηπιένλ, ηα εληνκνγνληκνπνηνχκελα είδε δαζηθψλ δέληξσλ κε δηάζπαξηε εμάπισζε, φπσο ε αγξηνθεξαζηά, κπνξεί λα εκθαλίζνπλ γελεηηθή εθηξνπή ιφγσ κε ηπραίαο ζχδεπμεο (Demesure θ.ά. 2000), θάηη πνπ επεξεάδεη ηελ εκθάληζε, έθηαζε θαη έληαζε ηεο γελεηηθήο εθηξνπήο ηφζν κεηαμχ φζν θαη εληφο ησλ πιεζπζκψλ, αθφκε θαη ζε ζηαπξνγνληκνπνηνχκελα είδε (Belletti θ.ά. 2008). Δπηπιένλ, νη ζπρλέο κεηψζεηο ζην κέγεζνο ησλ πιεζπζκψλ ηεο αγξηνθεξαζηάο πνπ κπνξεί λα ζπκβνχλ θαη λα πξνθαιέζνπλ θαηλφκελα γελεηηθήο ζηελσπνχ (Belletti θ.ά. 2008) θαη θαη επέθηαζε λα απμήζνπλ πεξαηηέξσ ηελ γελεηηθή εθηξνπή θαη ηελ δηαθνξνπνίεζε (Demesure θ.ά. 2000). Ωζηφζν, νη παξαπάλσ δηαδηθαζίεο δελ ήηαλ πξνθαλήο ζηελ παξνχζα κειέηε. Έλα πνζνζηφ ηεο γελεηηθήο εθηξνπήο κπνξεί γηα παξάδεηγκα λα εμεγεί ηε ζεκαληηθή αλεπάξθεηα εηεξνδπγσηίαο ζε δχν πιεζπζκνχο, αιιά ζπλνιηθά ηα δξαζηηθά κεγέζε πιεζπζκνχ ήηαλ αξθεηά κεγάια ππνδεηθλχνληαο ηε γεληθή ζηαζεξφηεηα ηνπ πιεζπζκνχ, παξά ηε ζεκαληηθή θαη κάιινλ ηζρπξή δηαθνξνπνίεζε πιεζπζκνχ (ε κεηαμχ- ησλ πιεζπζκψλ κέζε δηαθχκαλζε ήηαλ 20% ηεο ζπλνιηθήο δηαθχκαλζεο ιακβάλνληαο ππφςε θαη ηηο αλαιχζεηο ησλ κνξηαθψλ δεηθηψλ). Οη ηηκέο ηεο ηζηνξηθήο ξνήο γνληδίσλ πνπ εθηηκψληαη απφ ηα απνθιεηζηηθά αιιειφκνξθα (Slatkin 1985) θαη ηε κέζνδν δηαθνξνπνίεζεο ηνπ πιεζπζκνχ (G ST θαη R ST ) είλαη ζπγθιίλνπζεο (Nm = 1,190-1,962) θαη αλαθέξνπλ κέηξηα έσο ρακειή ξνή γνληδίσλ κεηαμχ ησλ πιεζπζκψλ αγξηνθεξαζηάο. Η ηηκή Nm ηεο αγξηνθεξαζηάο είλαη θνληά ζην κέζν φξν ησλ ζηαπξνγνληκνπνηνχκελσλ θαη εληνκφγακσλ εηδψλ (Nm = 1,154, (Hamrick θαη Godt 1990)). ε ζπκθσλία είλαη θαη ηα απνηειέζκαηα ηεο STRUCTURE αλάιπζεο αιιά ζεσξεηηθά δελ επαξθνχλ γηα ηελ πξφιεςε ηεο γελεηηθήο δηαθνξνπνίεζεο κεηαμχ ησλ πιεζπζκψλ ιφγσ ηεο εθηξνπήο (Slatkin 1987). Γηα ηελ αλίρλεπζε ηεο γελεηηθήο ζηελσπνχ ρξεζηκνπνηήζεθε ε δνθηκή Wilcoxon γηα πεξίζζεηα εηεξνδπγσηίαο κε βάζε ην πξφηππν TPM, πνπ είλαη έλαο ζπλδπαζκφο ησλ πξνηχπσλ SMM θαη ΙΑΜ δίλνληαο έηζη πην αμηφπηζηα απνηειέζκαηα (Di Rienzo θ.ά. 1994; Spencer θ.ά. 2000). Οη ζεκαληηθέο απνθιίζεηο ζχκθσλα κε ην TPM πξφηππν ίζσο ππνδεηθλχνπλ κηα πξφζθαηε κείσζε ηνπ κεγέζνπο πιεζπζκνχ ή δηαθπκάλζεηο ηνπ πιεζπζκνχ (Kang θ.ά. 2008) κφλν ζηνλ πιεζπζκφ Νπκθαία (Πίλαθαο 3.5). Η δεχηεξε πξνζέγγηζε πνπ ρξεζηκνπνηήζεθε γηα ηελ ηζηνξηθή αλίρλεπζε ηεο γελεηηθήο ζηελσπνχ πνπ βαζίδεηαη ζε κηα κεηαηφπηζε ηνπ ηξφπνπ θαηαλνκήο ησλ ζπρλνηήησλ ησλ αιιεινκφξθσλ 84

85 δελ εληνπίδεη θαλέλα ζεκάδη πξφζθαηεο γελεηηθήο ζηελσπνχ. Οη πέληε πιεζπζκνί εκθαλίδνπλ θαλνληθή θαηαλνκή ζπρλνηήησλ ησλ αιιεινκφξθσλ. Δθφζνλ ην απνηειεζκαηηθφ κέγεζνο πιεζπζκνχ δελ θαίλεηαη λα είλαη ζεκαληηθά ρακειφ ζηνπο πιεζπζκνχο ηνπ χζηεξνπ-άθξνπ κπνξνχκε λα ππνζέζνπκε φηη θάζε κεηαβαηηθή κείσζε ζην κέγεζνο ζε απηνχο ηνπο πιεζπζκνχο δελ έρεη νδεγήζεη ζε ζεκαληηθή γελεηηθή ζηελσπφ. πγθξίζεηο σο πξνο ηελ ζηελσπφ δελ είλαη δηαζέζηκεο γηα ηελ θεξαζηά. Ωζηφζν, ζηελ καχξε θεξαζηά (Prunus serotina) ζε κηα ζχγθξηζε ηζαγελψλ πνηθηιηψλ ηεο Βφξεηαο Ακεξηθήο θαη εηζαρζέλησλ επξσπατθψλ πιεζπζκψλ δηεξεπλήζεθαλ πηζαλά ζεκεία γελεηηθήο ζηελσπνχ. ηελ εγγελή ζεηξά δελ αληρλεχζεθε γελεηηθή ζηελσπφο, ελψ νξηζκέλνη πιεζπζκνί ζηηο εηζαρζέληεο ζεηξέο εκθάληζαλ γελεηηθή ζηελσπφ (Pairon θ.ά. 2010). Η ζρεηηθή βηβιηνγξαθία ππνδεηθλχεη φηη νη ζηελσπνί πνπ έρνπλ εληνπηζηεί κέζσ ηεο αλάιπζεο δεηθηψλ SSR είλαη κάιινλ πην ζπρλέο ζηνπο επαλά-απνηθηζζέληεο παξά ζηνπο ηζαγελήο πιεζπζκνχο (Kato θ.ά. 2010; Omondi θ.ά. 2010; Pairon θ.ά. 2010). 3.4 Γεληθή ζπδήηεζε θαη ζπκπεξάζκαηα Σα απνηειέζκαηα απνθάιπςαλ πςειά πνζνζηά γελεηηθήο πνηθηιφηεηαο θαη ζεκαληηθή δηαθνξνπνίεζε πιεζπζκψλ, φπνπ πεξίπνπ ην 80% ηεο ζπλνιηθήο παξαιιαθηηθφηεηαο ππάξρεη κέζα ζηνπο πιεζπζκνχο αγξηνθεξαζηάο ζηα φξηα εμάπισζεο ηνπ είδνπο. Απηέο νη ηηκέο ήηαλ πςειφηεξεο απφ εθείλεο πνπ αλαθέξζεθαλ γηα ηνπο πιεζπζκνχο απφ ην θέληξν εμάπισζεο ηνπ είδνπο, ελψ ν πινχηνο ησλ αιιεινκφξθσλ ήηαλ ρακειφηεξνο. Οη πιεζπζκνί ήηαλ κάιινλ απνκνλσκέλνη γελεηηθά, ραξαθηεξηδφκελνη απφ πνιχ ρακειά επίπεδα γνληδηαθήο ξνήο. Ωζηφζν δελ εληνπίζηεθαλ ζεκαληηθά ζεκεία γελεηηθήο ζηελσπνχ πιεζπζκνχ, φζν ην ρακειφηεξν δξαζηηθφ κέγεζνο πιεζπζκνχ ήηαλ N E > 44 (Πίλαθαο 3.5). πλνιηθά, θαίλεηαη φηη αθφκε θαη ζηα λφηηα φξηα ηεο εμάπισζεο ησλ εηδψλ φπσο ε αγξηνθεξαζηά, δελ είλαη εκθαλήο δεκν-γελεηηθή ζηνραζηηθφηεηα. Η ππφζεζε θέληξνπ-πεξηθέξεηαο δελ ηζρχεη απφιπηα ζε απηά ηα δεδνκέλα, ελψ ε έλλνηα ηνπ νξίνπ εμάπισζεο ησλ πιεζπζκψλ, φπσο πξνηάζεθε απφ ηνπο Hampe θαη Petit (2005) πεξηγξάθεη πνιχ θαιχηεξα ηα παξαηεξνχκελα απνηειέζκαηα. Παξφια απηά, ε ζεκαζία ηεο ηζηνξηθήο δπλακηθήο εμέιημεο κε βάζε ην θιίκα σο ηνλ θχξην, ή ην κφλν παξάγνληα ζηε δηακφξθσζε ηεο δηαηεξνχκελεο γελεηηθήο πνηθηιφηεηαο θαη ηεο δνκήο ησλ πιεζπζκψλ ηνπ νξίνπ εμάπισζεο δελ είλαη ζαθήο. Δθηφο απφ κηα γεληθή έιιεηςε ζρεηηθψλ γνληδηαθψλ δεδνκέλσλ γηα ηα Βαιθάληα (Hewitt 2000), ε αγξηνθεξαζηά σο έλα 85

86 είδνο εληνκφθηιν κε ρακειή παξαγσγή γχξεο (Faegri θαη Iversen 1989) ζπάληα παξνπζηάδεη πξνθίι γχξεο θαη έηζη δελ επηηξέπεηαη κηα ζαθήο αλίρλεπζε ησλ παγεησληθψλ θαηαθπγίσλ in situ. Η γεσγξαθηθή ζέζε ηεο κειέηεο απηήο, εθηφο ηνπ φηη ζεσξείηαη παγεηψδεο θαηαθχγην γηα πνιιά είδε ηεο επξσπατθήο ρισξίδαο, ππήξμε ππφ ζπλερή θαη ηζρπξή αλζξσπνγελή επίδξαζε, ηνπιάρηζηνλ θαηά ηα ηειεπηαία 4000 ρξφληα, κε απνηέιεζκα λα αλαπηπρζεί κηα πνιχπιεπξε αιιειεπίδξαζε ηεο θχζεο θαη ηνπ αλζξψπνπ αλαθνξηθά κε ηελ εγθαηάζηαζε ηνπ πιεζπζκνχ, ηελ επέθηαζε θαη ηε ξνή γνληδίσλ. Οη θπζηθνί νδνί κεηαλάζηεπζεο ζα κπνξνχζαλ λα έρνπλ επεξεαζηεί απφ ηερλεηέο θπηείεο απφ ζρεηηθά λσξίο επηιεγκέλεο πνηθηιίεο θεξαζηάο πνπ κπνξεί ζηαδηαθά λα εμειίρζεθαλ ζε θπζηθέο. Σν απνηέιεζκα κπνξεί λα είλαη έλα πνιχπινθν «κσζατθφ» ζσδφκελεο γελεηηθήο πνηθηιφηεηαο θαη δηαθνξνπνίεζεο, φπνπ ε πξφζκημε δηαθνξεηηθψλ θαηαγσγψλ θαηά ηε δηάξθεηα ηνπ εθ λένπ επνηθηζκνχ κπνξεί λα δψζεη πνιχπινθα ζρήκαηα εμάπισζεο ηεο γελεηηθήο πνηθηιφηεηαο (Arana θ.ά. 2010; Petit θ.ά. 2003). Οη Mohanty θ.ά. (2001), κειεηψληαο ην ρισξνπιαζηηθφ DNA ζε 23 επξσπατθνχο πιεζπζκνχο αγξηνθεξαζηάο έδεημαλ ηελ απνπζία ηζρπξήο θπινγελεηηθήο δνκήο πνπ απνδίδεηαη ζηνπο κεραληζκνχο δηαζπνξάο ζπκπεξηιακβαλνκέλσλ θαη ησλ αλζξσπνγελψλ δξαζηεξηνηήησλ. Παξ 'φια απηά, απηή ε κειέηε, θαζψο θαη ε κειέηε ησλ επηιεγκέλσλ θιψλσλ αγξηνθεξαζηάο (Avramidou θ.ά. 2010) έρνπλ δείμεη αξθεηά ηζρπξή γελεηηθή δνκή ζηνπο βφξεηνπο ειιεληθνχο πιεζπζκνχο. ηελ ηειεπηαία πεξίπησζε, δχν μερσξηζηέο γνληδηαθέο δεμακελέο ηαπηνπνηήζεθαλ αθφκε θαη εληφο ελφο ηνπηθά πεξηνξηζκέλνπ πιεζπζκνχ (Vathytopos, NE Greece, (Avramidou θ.ά. 2010)). Σα απνηειέζκαηα απηήο ηεο κειέηεο κπνξεί λα είλαη ρξήζηκα ζηελ πξνζηαζία ησλ θπηνγελεηηθψλ πφξσλ πνπ απνζθνπεί ζηελ εμαζθάιηζε ηνπ καθξνπξφζεζκνπ πξνζαξκνζηηθνχ εμειηθηηθνχ δπλακηθνχ ηνπ είδνπο. Οη ππφ κειέηε πιεζπζκνί κπνξεί λα ζεσξεζνχλ σο πιεζπζκνί πςειήο πξνηεξαηφηεηαο γηα ζθνπνχο δηαηήξεζεο γνληδίσλ πνπ κπνξεί λα επηηεπρζεί κε ηε δηαηήξεζε κνλάδσλ δηαηήξεζεο γνληδίσλ κεηαμχ ησλ θπζηθψλ πιεζπζκψλ πνπ ραξαθηεξίδνληαη απφ πςειή γελεηηθή πνηθηιφηεηα θαη ησλ μερσξηζηψλ γνληδηαθψλ δεμακελψλ. Η νκαδνπνίεζε ησλ πιεζπζκψλ παξέρεη κηα έλδεημε ησλ νκάδσλ ηνπ πιεζπζκνχ πνπ ζα πξέπεη λα εθπξνζσπνχλ έλα ζχζηεκα δηαηήξεζεο γνληδίσλ ηεο αγξηνθεξαζηάο. πκπεξαζκαηηθά φινη νη πιεζπζκνί αγξηνθεξαζηάο πνπ κειεηήζεθαλ κπνξνχλ λα ρξεζηκνπνηεζνχλ ζε έλα πξφγξακκα βειηίσζεο. Μφλν ν πιεζπζκφο Υνινκψληαο, εμαηηίαο ηνπ αξθεηά πεξηνξηζκέλνπ δξαζηηθνχ κεγέζνπο πιεζπζκνχ ηνπ, 86

87 κπνξεί λα έρεη αλάγθε απφ θάπνηα κειινληηθή πξνζηαζία κέζσ ηεο δηαρείξηζεο ησλ δαζψλ. Δίλαη απίζαλν απηφο ν πιεζπζκφο λα θηλδπλεχζεη ζην άκεζν κέιινλ ιφγσ γελεηηθψλ παξαγφλησλ, αιιά ην πεξηνξηζκέλν δξαζηηθφ κέγεζνο πιεζπζκνχ ηνλ θαζηζηά επάισην ζε κειινληηθέο απψιεηεο γελεηηθήο πνηθηιφηεηαο. Έλαο πηζαλφο απνθιεηζκφο απφ ηε πινηνκία κπνξεί λα παξέρεη γηα κηα δεθαεηία επαξθή κέζα γηα ηε δηεπθφιπλζε κειινληηθήο αλαγέλλεζεο θαη αχμεζεο ηνπ κεγέζνπο πιεζπζκνχ. Οη ππφινηπνη πιεζπζκνί, ηδηαίηεξα ζηα βφξεην-αλαηνιηθά άθξα, δελ θαίλεηαη λα ρξεηάδνληαη θάπνηα ζπγθεθξηκέλε άκεζε παξέκβαζε θαη δηαρείξηζε ησλ δαζψλ θαη ζα κπνξνχζαλ λα ρξεζηκνπνηεζνχλ ζηελ δηαηήξεζε γνληδίσλ. πλνιηθά, ε βφξεην-αλαηνιηθή νκάδα πνπ απεηθνλίδεηαη θπξίσο ζηελ FCA ζα κπνξνχζε λα εθπξνζσπείηαη απφ ηνλ πιεζπζκφ Υατληνχ, σο κνλάδα δηαηήξεζεο γνληδίσλ. Απφ ηελ βφξεην-θεληξηθή νκάδα, ν πιεζπζκφο Βφξξαο ζα κπνξνχζε λα ζπκπεξηιεθζεί ζε κηα ελδερφκελε έιιεηςε κηαο θαιχηεξεο ελαιιαθηηθήο ιχζεο, ιφγσ ηνπ φηη απηή ε γεσγξαθηθή πεξηνρή δελ έρεη κειεηεζεί εθηελψο. Σν κφλν πξφβιεκα είλαη ε κηθξή ηηκή ηνπ N E θαηψηεξνπ νξίνπ εκπηζηνζχλεο (N E 30). Δλ θαηαθιείδη, νη βφξεηνη ειιεληθνί πιεζπζκνί αγξηνθεξαζηάο παξνπζηάδνπλ έλαλ πινχην γελεηηθήο πνηθηινκνξθίαο πνπ ελδέρεηαη λα είλαη ηδηαίηεξα πνιχηηκνο θαζψο θαη ζεκαληηθφο γηα ηε δηαηήξεζε ηεο γελεηηθήο πνηθηιφηεηαο θαη ηεο ηνπηθήο πξνζαξκνγήο, εηδηθά θάησ ππφ ηα ζχγρξνλα ζελάξηα θιηκαηηθήο αιιαγήο. 3.5 Βηβιηνγξαθία Arana, M. V., Gallo, L. A., Vendramin, G. G., Pastorino, M. J., Sebastiani, F. and Marchelli, P High genetic variation in marginal fragmented populations at extreme climatic conditions of the Patagonian Cypress Austrocedrus chilensis. Molecular Phylogenetics and Evolution 54(3): Aravanopoulos, A. F., Avramidou, E. and Ganopoulos, I Genetics of wild cherry (Prunus avium L.) in Greece. Growing Valuable Broadleaved Tree Species October 06th -08th 2008, Freiburg/ Germany. Avramidou, E., Ganopoulos, I. V. and Aravanopoulos, F. A DNA fingerprinting of elite Greek wild cherry (Prunus avium L.) genotypes using microsatellite markers. Forestry. Bartley, D., Bagley, M., Gall, G. and Bentley, B Use of Linkage Disequilibrium Data to Estimate Effective Size of Hatchery and Natural Fish Populations. Conservation Biology 6(3): Beaver, J. A., Iezzoni, A. F. and Ramm, C. W Isozyme diversity in sour, sweet and ground cherry. Theoretical and Applied Genetics 90(6):

88 Behre, K Formenkreise von Prunus domestica L. von der Wikingerzeit bis in die fru he Neuzeit nach Fruchtsteinen aus Haithabu und Alt-Schleswig. Berichte der Deutschen Botanischen Gesellschaft 91: Belletti, P., Monteleone, I. and Ferrazzini, D A population genetic study in a scattered forest species, wild service tree [Sorbus torminalis (L.) Crantz], using RAPD markers. European Journal of Forest Research 127(2): Boshier, D. and Amaral, W Threats to forest ecosystems and challenges for the conservation and sustainable use of forest genetic resources. In: Vinceti B, Amaral W, Meilleur B (eds) Challenges in managing forest genetic resources for livelihoods IPGRI, Rome:7-22. Boys, J., Cherry, M. and Dayanandan, S Microsatellite analysis reveals genetically distinct populations of red pine (Pinus resinosa, Pinaceae). Am J Bot 92(5): Chapuis, M.-P. and Estoup, A Microsatellite Null Alleles and Estimation of Population Differentiation. Mol Biol Evol 24(3): Clarke, J. B. and Tobutt, K. R Development and characterization of polymorphic microsatellites from Prunus avium 'Napoleon'. Molecular Ecology Notes 3(4): Cornuet, J. and Luikart, G Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144: Crane, M. and Brown, A Incompatibility and sterility in the sweet cherry, Prunus avium L.. Journal of Pomology and Horticultural Science 15: Dakin, E. E. and Avise, J. C Microsatellite null alleles in parentage analysis. Heredity 93(5): Dawson, I. K. and Powell, W Genetic variation in the Afromontane tree Prunus africana, an endangered medicinal species. Molecular Ecology 8(1): Degen, B., Blanc, L., Caron, H., Maggia, L., Kremer, A. and Gourlet-Fleury, S Impact of selective logging on genetic composition and demographic structure of four tropical tree species. Biological Conservation 131(3): Demesure, B., Guerrouη, B. L., Lucchi, G., Prat, D. and Petit, R.-J Genetic variability of a scattered temperate forest tree: Sorbus torminalis L. (Crantz). Ann For Sci 57(1): Di Rienzo, A., Peterson, A. C., Garza, J. C., Valdes, A. M., Slatkin, M. and Freimer, N. B Mutational processes of simple-sequence repeat loci in human populations. Proceedings of the National Academy of Sciences of the United States of America 91(8): Ducci, F. and Santi, F The distribution of clones in managed and unmanaged populations of wild cherry (Prunus avium). Can J For Res 27: Durel, C. E., Bertin, P. and Kremer, A Relationship between inbreeding depression and inbreeding coefficient in maritime pine (Pinus pinaster). TAG Theoretical and Applied Genetics 92(3): Eckert, C. G., Samis, K. E. and Lougheed, S. C Genetic variation across species geographical ranges: the central marginal hypothesis and beyond. Molecular Ecology 17(5): Ellstrand, N. C. and Elam, D. R Population Genetic Consequences of Small Population Size: Implications for Plant Conservation. Annual Review of Ecology and Systematics 24(1):

89 Faegri, K. and Iversen, J Textbook of pollen analysis. 4th ed by K Fægri, PE Kaland & K Krzywinski John Wiley & Sons, Chichester. Frascaria, N., Santi, F. and Guyon, P Genetic differentiation within and among populations of chestnut (Castanea sativa Mill.) and wild cherry (Prunus avium L.). Heredity 70: Gaudeul, M., Till-Bottraud, I., Barjon, F. and Manel, S Genetic diversity and differentiation in Eryngium alpinum L. (Apiaceae): comparison of AFLP and microsatellite markers. Heredity 92(6): Goudet, J FSTAT (Version 1.2): A computer program to calculate F-statistics. Journal of Heredity 86(6): Guarino, C., Santoro, S., De Simone, L. and Cipriani, G Prunus avium: nuclear DNA study in wild populations and sweet cherry cultivars. Genome 52(4): Hampe, A. and Petit, R. J Conserving biodiversity under climate change: the rear edge matters. Molecular Ecology 8(5): Hamrick, J. and Godt, M Allozyme diversity in plant species. Plant population genetics, breeding and genetic variation in plants: Hamrick, J., Godt, M. and Sherman-Broyles, S Factors influencing levels of genetic diversity in woody plant species. New Forests 6: Hedrick, P Highly variable loci and their interpretation in evolution and conservation. Evolution 53: Hedrick, U. P The cherries of New York. J B Lyon, Albany, NY. Hewitt, G The genetic legacy of the Quaternary ice ages. Nature 405(6789): Hewitt, G. M Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London Series B: Biological Sciences 359(1442): Hill, W. G Estimation of effective population size from data on linkage disequilibrium. Genetics Research 38: Hoffman, A. and Parsons, P Extreme Environmental Change and Evolution. Cambridge University Press, Cambridge, UK. Jordano, P. and Godoy, J. A RAPD variation and population genetic structure in Prunus mahaleb (Rosaceae), an animal-dispersed tree. Molecular Ecology 9(9): Kalinowski, S How many alleles per locus should be used to estimate genetic distances? Heredity 88: Kalinowski, S. T hp-rare 1.0: a computer program for performing rarefaction on measures of allelic richness. Molecular Ecology Notes 5(1): Kang, M., Wang, J. and Huang, H Demographic bottlenecks and low gene flow in remnant populations of the critically endangered Berchemiella wilsonii var. pubipetiolata (Rhamnaceae) inferred from microsatellite markers. Conservation Genetics 9(1): Kar, P., Srivastava, P., Awasthi, A. and Urs, S Genetic variability and association of ISSR markers with some biochemical traits in mulberry ( Morus spp.) genetic resources available in India. Tree Genetics & Genomes 4(1): Karp, A., Seberg, O. L. E. and Buiatti, M Molecular techniques in the assessment of botanical diversity. Annals of Botany 78(2): Kato, S., Iwata, H., Tsumura, Y. and Mukai, Y Genetic structure of island populations of Prunus lannesiana var. speciosa revealed by chloroplast DNA, AFLP and nuclear SSR loci analyses. Journal of plant research 124(1):

90 Kimura, M. and Maruyama, T Pattern of neutral polymorphism in a geographically structured population. Genetics Research 18(02): Lesica, P. and Allendorf, F When are peripheral populations valuable for conservation? Cons Biol 9: Lesica, P. and Allendorf, F. W Are small populations of plants worth preserving. Conservation Biology 6(1): Luikart, G. and Cornuet, J Empirical evaluation of a test for identifying recently bottlenecked populations from allele frequency data. Conserv Biol 12: Mariette, S., Lefranc, M., Legrand, P., Taneyhill, D., Frascaria-Lacoste, N. and Machon, N Genetic variability in wild cherry populations in France. Effects of colonizing processes. TAG Theoretical and Applied Genetics 94(6): Mariette, S., Tavaud, M., Arunyawat, U., Capdeville, G., Millan, M. and Salin, F Population structure and genetic bottleneck in sweet cherry estimated with SSRs and the gametophytic self-incompatibility locus. BMC Genetics 11:13. Mattioni, C., Cherubini, M., Micheli, E., Villani, F. and Bucci, G Role of domestication in shaping Castanea sativa genetic variation in Europe. Tree Genetics & Genomes 4(3): Meier-Dingel, A., Svolba, J. and Kleinschmit, J Selektierte, mikrovermehrte Vogelkirschen-Klone. AlIg Forstz/Der Wald 52: Mohanty, A., Martin, J. P. and Aguinagalde, I A population genetic analysis of chloroplast DNA in wild populations of Prunus avium L. in Europe. Heredity 87(Pt 4): Nei, M. 1978a. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: Omondi, S. F., Kireger, E., Dangasuk, O. G., Chikamai, B., Odee, D. W., Cavers, S. and Khasa, D. P Genetic diversity and population structure of Acacia senegal (L) Willd. in Kenya. Tropical Plant Biology 3(1): Pairon, M., Petitpierre, B., Campbell, M., Guisan, A., Broennimann, O., Baret, P. V., Jacquemart, A.-L. and Besnard, G Multiple introductions boosted genetic diversity in the invasive range of black cherry (Prunus serotina; Rosaceae). Annals of Botany 105(6): Peel, D., Ovenden, J. and Peel, S NeEstimator: software for estimating effective population size, Version 1.3. Petit, R. J., Aguinagalde, I., de Beaulieu, J. L., Bittkau, C., Brewer, S., Cheddadi, R., Ennos, R., Fineschi, S., Grivet, D., Lascoux, M. and others Glacial refugia: Hotspots but not melting pots of genetic diversity. Science 300(5625): Piry, S., Luikart, G. and Cornuet, J Bottleneck: a computer program for detecting recent reductions in the effective population size using allele frequency data. J Hered 90: Pritchard, J., Stephens, M. and Donnelly, P Inference of population structure using multilocus genotype data. Genetics 155(2): Queney, G., Ferrand, N., Weiss, S., Mougel, F. and Monnerot, M Stationary Distributions of Microsatellite Loci Between Divergent Population Groups of the European Rabbit (Oryctolagus cuniculus). Mol Biol Evol 18(4): Rousset Genetic differentiation between individuals. Journal of Evolutionary Biology 13(1):

91 Russell, K EUFORGEN Technical Guidelines for genetic conservation and use for wild cherry (Prunus avium) International Plant Genetic Resources Institute, Rome, Italy. Sagarin, R. D. and Gaines, S. D The 'abundant centre' distribution: to what extent is it a biogeographical rule? Ecology Letters 5(1): Sanou, H., Lovett, P. N. and Bouvet, J.-M Comparison of quantitative and molecular variation in agroforestry populations of the shea tree <i> (Vitellaria paradoxa</i> C.F. Gaertn) in Mali. Molecular Ecology 14(8): Santi, F., Lemoine, M. and Bruant, B Genetic markers for Prunus avium L: inheritance and linkage of isozyme loci. Ann For Sci 47(2): Schaal, B. A. and Leverich, W. J Molecular Variation in Isolated Plant Populations. Plant Species Biology 11(1): Schlötterer, C Evolutionary dynamics of microsatellite DNA. Chromosoma 109(6): Schueler, S., Tusch, A. and Scholz, F Comparative analysis of the withinpopulation genetic structure in wild cherry (Prunus avium L.) at the selfincompatibility locus and nuclear microsatellites. Molecular Ecology 15(11): Slatkin, M Rare alleles as indicators of gene flow. Evolution 39: Slatkin, M Gene flow and the geographic structure of natural populations. Science 236(4803): Slatkin, M A measure of population subdivision based on microsatellite allele frequencies. Genetics 139(1): Spencer, C. C., Neigel, J. E. and Leberg, P. L Experimental evaluation of the usefulness of microsatellite DNA for detecting demographic bottlenecks. Molecular Ecology 9(10): Stoeckel, S., Grange, J., Fernandez-Manjarres, J., Bilger, I., Frascaria-Lacoste, N. and Mariette, S Heterozygote excess in a self-incompatible and partially clonal forest tree species. Mol Ecol 15: Tang, S., Dai, W., Li, M., Zhang, Y., Geng, Y., Wang, L. and Zhong, Y Genetic diversity of relictual and endangered plant Abies ziyuanensis (Pinaceae) revealed by AFLP and SSR markers. Genetica 133(1): Tavaud, M., Zanetto, A., Santi, F. and Dirlewanger, E Structuration of genetic diversity in cultivated and wild cherry trees using AFLP markers. International Society for Horticultural Science, Leuven, BELGIQUE. Tessier du Cros, E., Ma`tya`s, C. and Kriebel, H Contribution of genetics to the sustained management of global forest resources conclusions and recommendations. In: Ma`tya`s C (ed) Forest genetics and sustainability, forestry sciences 63(Kluwer, Dordrecht):pp Vaughan, S. P., Cottrell, J. E., Moodley, D. J., Connolly, T. and Russell, K Distribution and fine-scale spatial-genetic structure in British wild cherry (Prunus avium L.). Heredity 98(5): Vaughan, S. P. and Russell, K Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 4(3): Vitalis, R. and Couvet, D estim 1.0: a computer program to infer population parameters from one- and two-locus gene identity probabilities. Molecular Ecology Notes 1(4):

92 Vucetich, J. A. and Waite, T. A Spatial patterns of demography and genetic processes across the species' range: Null hypotheses for landscape conservation genetics. Conservation Genetics 4(5): Weir, B. and Cockerham, C Estimating F-statistics for the analysis of population structure. Evolution 38(6): Weiser, F Ergebnisse einer 33-jahrigen Einzelbaum-Nachkommenschaftsprufung nach freiem Abbliihen von Vogelkirsche, Prunus avium L. var. avium. Silvae Genetica 45: Widmer, A. and Lexer, C Glacial refugia: sanctuaries for allelic richness, but not for gene diversity. Trends in Ecology & Evolution 16(6): Yeh, F., Boyle, T., Rongcai, Y., Ye, Z. and Xian, J Popgene version Microsoft window-based Freeware for population Genetic Analysis. Zietkiewicz, E., Rafalski, A. and Labuda, D Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20: Zohary, D. and Hopf, M Domestication of Plants in the Old World. 3rd edition Oxford University Press, Oxford. 92

93 Κεθάιαην 4: Γνληδησκαηηθή πνηθηιόηεηα ησλ S-αιιεινκόξθσλ ζηελ αγξηνθεξαζηά (Prunus avium L.) 4.1 Δηζαγσγή Η θπζηθή επηινγή κεηαβάιιεη ηελ θαηαλνκή ησλ ζπρλνηήησλ ησλ αιιεινκφξθσλ ζηνπο πιεζπζκνχο κε δηαθνξεηηθφ ηξφπν ζε ζχγθξηζε κε ηηο ζέζεηο πνπ ππφθεηληαη ζε άιινπο παξάγνληεο, φπσο ε γελεηηθή εθηξνπή, ε κεηαλάζηεπζε θαη ε κεηάιιαμε (Hartl θαη Clark 2006). πλήζσο, ε επηινγή κεηψλεη ηελ παξαιιαθηηθφηεηα ησλ πιεζπζκψλ. Ωζηφζν, ε εμηζνξξνπεηηθή επηινγή απνηειεί κηα γεληθή εμαίξεζε ζε απηφλ ηνλ θαλφλα. Η εμηζνξξνπεηηθή επηινγή θαηαιήγεη ζε ζηαζεξά κε νπδέηεξεο θαηαλνκέο ζπρλνηήησλ ησλ αιιειφκνξθσλ, ζπλεπψο θαη ζηε δηαηήξεζε ησλ αιιεινκφξθσλ ζηνλ πιεζπζκφ. Έλα ηππηθφ κνληέιν αξλεηηθήο εμηζνξξνπεηηθήο επηινγήο κε βάζε ηελ ζπρλφηεηα (NFDS,: Maruyama θαη Fuerst 1984) πνπ είλαη ίζσο θαη ην πην θιαζηθφ παξάδεηγκα ηνπ NFDS, πεξηιακβάλεη ζπζηήκαηα ηνπ απηναζπκβίβαζηνπ (SI) (Wright 1939). Η ζηαπξν-γνληκνπνίεζε ζηα θπηά επλνείηαη ιεηηνπξγηθά απφ εηδηθά γελεηηθά ζπζηήκαηα (Barrett 2003) θαη ζρεδφλ ην ήκηζπ ησλ θπηηθψλ εηδψλ πεξηέρνπλ ζπζηήκαηα απηναζπκβίβαζηνπ γηα ηνλ πεξηνξηζκφ ηεο νκνκημίαο (Barret 2002). Σν γακεηνθπηηθφ απηναζπκβίβαζην βαζηδφκελν ζην έλδπκν RNάζε (GSI) είλαη θπινγελεηηθά ην πην δηαδεδνκέλν ζχζηεκα (~ 60% ησλ εηδψλ έρνπλ ηνλ κεραληζκφ SI, ). Γεληθψο, εάλ έζησ θαη έλαο θφθθνο γχξεο πεξηέρεη έλα απφ ηα αιιειφκνξθα ηνπ απηναζπκβίβαζηνπ (Sαιιειφκνξθα) απνηπγράλεη ε γνληκνπνίεζε, δεδνκέλνπ φηη ν γπξενζσιήλαο δελ κπνξεί λα αλαπηπρζεί (Franklin-Tong θαη Franklin 2003). Η απηνγνληκνπνίεζε είλαη επνκέλσο αδχλαηε θαη ε ζχδεπμε κεηαμχ ζπγγελψλ αηφκσλ κεηψλεηαη. Σν πξφηππν NFDS πθίζηαηαη ζηελ γνληδησκαηηθή ζέζε πνπ ζρεηίδεηαη κε ην απηναζπκβίβαζην (Castric θαη Vekemans 2004) εθφζνλ θάζε λέν εηζεξρφκελν S- αιιειφκνξθν έρεη έλα επηιεθηηθφ πιενλέθηεκα ζηε ζχδεπμε, ην νπνίν παξάγεη έλαλ πςειφ αξηζκφ αιιεινκφξθσλ εληφο ησλ πιεζπζκψλ. Απηφ ην απνηέιεζκα είλαη πξντφλ ηεο αλσηέξσ δηαδηθαζίαο αλαπαξαγσγηθήο επηινγήο πνπ νδεγεί ζε αχμεζε ηεο πξνζαξκνζηηθφηεηαο ησλ ζπάλησλ θαζψο θαη ησλ λέσλ αιιεινκφξθσλ (Wright 1939). Σα 93

94 S-αιιειφκνξθα είλαη ζηελά ζπλδεδεκέλα ηφζν ιφγσ ηεο ζηελήο θπζηθήο ζχλδεζεο ηνπο ζην ρξσκφζσκα φζν θαη ηνπ κεησκέλνπ ζπληειεζηή αλαζπλδπαζκνχ ηεο ζέζεο (Kamau θ.ά. 2007). Σν δεχηεξν απνηέιεζκα ηνπ πξνηχπνπ NFDS ζε επίπεδν πιεζπζκνχ είλαη ε παξαδνρή φηη φια ηα S-αιιειφκνξθα είλαη επηιεθηηθά ηζνδχλακα θαη σο εθ ηνχηνπ ε έληαζε επηινγήο πνπ αζθείηαη ζε έλα S-αιιειφκνξθν εμαξηάηαη κφλν απφ ηε ζπρλφηεηα ηνπ. πλεπψο, ε επηιεθηηθή ηζνδπλακία κεηαμχ ησλ δηαθφξσλ αιιεινκφξθσλ ζα πξέπεη λα νδεγεί ζε ηζνξξνπία ησλ αιιειηθψλ ζπρλνηήησλ (ππφζεζε ηζνπιεζίαο, δειαδή φια ηα S-αιιειφκνξθα πξέπεη λα πθίζηαληαη ζε κηα θνηλή ζπρλφηεηα, ίζε κε ην αληίζηξνθν ηνπ αξηζκνχ ησλ S-αιιεινκφξθσλ (Steiner θαη Gregorius 1999; Stoeckel θ.ά. 2011; Wright 1939). πκπεξαζκαηηθά, ην αλακελφκελν γελεηηθφ απνηέιεζκα ησλ πξνηχπσλ NFDS κεηαμχ ησλ πιεζπζκψλ είλαη κείσζε ζηελ δηαθνξνπνίεζε πιεζπζκνχ (ζε ζχγθξηζε κε ηνπο νπδέηεξεο γνληδηαθέο ζέζεηο) ιφγσ ηνπ απμεκέλνπ ξπζκνχ δξαζηηθήο κεηαλάζηεπζεο ζηελ ζέζε γνληδηψκαηνο πνπ ζπλδέεηαη κε ηελ S-γνληδηαθή ζέζε (Glémin θ.ά. 2005; Stoeckel θ.ά. 2008). Σν κνληέιν NFDS κπνξεί λα ζεσξεζεί σο κηα εμειηθηηθή δχλακε δηακνξθσκέλε απφ ηε κεηαλάζηεπζε (Schierup 1998) αληίζηξνθε κε ηελ γελεηηθή παξέθθιηζε, δεδνκέλνπ φηη απηή ε πίεζε επηινγήο ηείλεη λα απμήζεη άκεζα ηε ζπρλφηεηα ησλ ζπάλησλ αιιεινκφξθσλ θαη έηζη πεξηνξίδεη ηελ απψιεηα ησλ αιιεινκφξθσλ πνπ πξνθαιείηαη απφ ηελ γελεηηθή εθηξνπή (Wright 1939). Δπηπιένλ, εάλ έλα είδνο θπηνχ ραξαθηεξίδεηαη ηφζν απφ δηαζπνξά φζν θαη απφ απηναζπκβίβαζην κπνξεί λα αλαπηπρζεί ηνπηθφο αληαγσληζκφο κεηαμχ ησλ εμειηθηηθψλ επηδξάζεσλ ηνπο. Απηφο ν αληαγσληζκφο εθδειψλεηαη δηαθνξεηηθά ζε δείθηεο ζπλδεδεκέλνπο κε ηελ S-γνληδηαθή ζέζε (ιφγσ ηνπ κεησκέλνπ αλαζπλδπαζκνχ θνληά ζηελ S-γνληδηαθή ζέζε (Kamau θ.ά. 2007; Kawabe θ.ά. 2006) ζε ζρέζε κε δείθηεο πνπ δελ είλαη ζπλδεδεκέλνη κε ηελ S-γνληδηαθή ζέζε. ηηο κέξεο καο είλαη δηαζέζηκα δηάθνξα κνξηαθά ζπζηήκαηα ψζηε λα δηεξεπλεζνχλ νη επηπηψζεηο ηεο S-ξηβνλνπθιεάζεο (S-RNase), βαζηζκέλεο ζηα ζπζηήκαηα GSI ζε έλα αξθεηά αλαιπηηθφ επίπεδν, επεηδή ηα ραξαθηεξηζηηθά ηνπ χπεξνπ θαη ηεο γχξεο ησλ ζπζηεκάησλ απηψλ έρνπλ ήδε εληνπηζηεί θαη ηα αληίζηνηρα γνλίδηα έρνπλ αιιεινπρεζεί ζε θάπνηα είδε (Newbigin θ.ά. 2008). Η αγξηνθεξαζηά, είλαη έλα απηναζπκβίβαζην, πνιιαπιψλ ρξήζεσλ, επγελέο δαζηθφ είδνο πνπ ρξεζηκνπνηείηαη γηα παξαγσγή πςειήο πνηφηεηαο μπιείαο θαη αηζζεηηθήο αμίαο θαη απνηειεί έλα πνιχ θαιφ κνληέιν γηα ηνλ έιεγρν ηνπ NFDS ζπζηήκαηνο θαη ησλ ζρεηηθψλ ππνζέζεσλ. Σα ζπζηήκαηα GSI ηεο αγξηνθεξαζηάο θαζνξίδνληαη απφ ηηο 94

95 πνιιαπιψλ-s-αιιεινκφξθσλ γνληδηαθέο ζέζεηο πνπ θσδηθνπνηνχλ ηηο S-ξηβνλνπθιεάζεο ζηνλ ζηχιν (Bošković θαη Tobutt 1996) θαη ηηο S-απινεηδείο F-πξσηεΐλεο ζηε γχξε (Yamane θ.ά. 2003). ηαλ ηα S-αιιειφκνξθα ηεο γχξεο ζπλδένληαη κε έλα απφ ηα S- αιιειφκνξθα ηνπ ζηχινπ, νη S-ξηβνλνπθιεάζεο αλαζηέιινπλ ηελ αλάπηπμε ηνπ γπξενζσιήλα ζην ζηχιν. Έρνπλ θισλνπνηεζεί δηάθνξα S-αιιειφκνξθα θαη έδεημαλ λα πεξηέρνπλ αξθεηέο εμαηξεηηθά ζπληεξεκέλεο πεξηνρέο θαη έηζη νη δχν εθθηλεηέο έρνπλ ζρεδηαζηεί εηδηθά γηα ηα αιιειφκνξθα απηά γηα ηελ ελίζρπζε ηνπο ζε θάζε έλα απφ ηα δχν εμψληα (Sonneveld θ.ά. 2001; Sonneveld θ.ά. 2003). Ακθφηεξα ηα εζψληα, εηδηθά ην δεχηεξν, παξνπζηάδνπλ νπζηαζηηθφ πνιπκνξθηζκφ ζην κήθνο ησλ αιιεινκφξθσλ, επηηξέπνληαο ζηα πεξηζζφηεξα απφ ηα αιιειφκνξθα ηελ δηάθξηζε αλάινγα κε ην κέγεζνο ησλ πξντφλησλ ηεο αιπζηδσηήο αληίδξαζεο πνιπκεξάζεο (PCR). Γηα ηα ζπζηήκαηα GSI, ν Wright (1939) αλέθεξε φηη ζε έλαλ κέηξην ξπζκφ κεηάιιαμεο/κεηαλάζηεπζεο ηνπ 10-3, ζε έλαλ πιεζπζκφ 50 αηφκσλ ζα πξέπεη λα θηινμελνχληαη πεξίπνπ νθηψ δηαθνξεηηθά S-αιιειφκνξθα, ελψ ζε έλαλ πιεζπζκφ ησλ 200 αηφκσλ ζα ππάξρνπλ πεξίπνπ 15 S-αιιειφκνξθα. Δκπεηξηθέο κειέηεο ζρεηηθά κε ηελ πνηθηιφηεηα ησλ S-αιιειφκνξθσλ, ρξεζηκνπνηψληαο είηε δηαιιειηθά ζπζηήκαηα δηαζηαπξψζεσλ είηε πξνζεγγίζεηο κνξηαθήο γελεηηθήο γηα ηελ αμηνιφγεζε ησλ S- γελνηχπσλ, έδεημαλ φηη ε δηάθξηζε ησλ S-αιιειφκνξθσλ κεηαμχ ησλ πιεζπζκψλ είλαη απμεκέλε (Busch θαη Schoen 2008; Castric θαη Vekemans 2004). Η γελνηχπεζε ησλ S- αιιειφκνξθσλ ζηελ αγξηνθεξαζηά νδήγεζε ζηελ ηαρεία επηβεβαίσζε ησλ S- αιιεινκφξθσλ θαη ησλ νκάδσλ αζπκβαηφηεηαο ζε πνιιέο πνηθηιίεο θαη γελνηχπνπο, φπσο επίζεο θαη ζηνλ εληνπηζκφ λέσλ πηζαλψλ S-αιιεινκφξθσλ κέζσ ζπζρεηηζκνχ κε ηα πξντφληα ηεο PCR (Choi θ.ά. 2002; De Cuyper θ.ά. 2005b; Hauck θ.ά. 2002; Sonneveld θ.ά. 2003; Tao θ.ά. 1999; Yamane θ.ά. 2000; Zhou θ.ά. 2002). Η γελνηχπεζε ησλ S- αιιεινκφξθσλ έρεη γίλεη έλα ρξήζηκν εξγαιείν γηα ηελ εθηίκεζε ηεο βηνπνηθηιφηεηαο ζηνπο πιεζπζκνχο αγξηνθεξαζηάο, ζηηο πνηθηιίεο (De Cuyper θ.ά. 2005a; Schueler θ.ά. 2006) θαζψο θαη ηηο ζπιινγέο γελεηηθνχ πιηθνχ (Gisbert θ.ά. 2008; Marchese θ.ά. 2007; Schuster θ.ά. 2007). Με ηε ρξήζε δηαθφξσλ κεζφδσλ έρνπλ αλαθεξζεί κέρξη ζήκεξα έσο 16 δηαθνξεηηθά S-αιιειφκνξθα θαη 29 νκάδεο αζπκβαηφηεηαο (Schuster θ.ά. 2007). ηελ κειέηε απηή παξνπζηάδνληαη ηα απνηειέζκαηα πνπ αθνξνχλ ηελ θαηαλνκή θαη ηε γελεηηθή δνκή ησλ αιιεινκφξθσλ ζηελ γνληδηαθή ζέζε ηνπ γακεηνθπηηθνχ απηναζπκβίβαζηνπ ζε πέληε πιεζπζκνχο άγξηαο θεξαζηάο. Δπίζεο ρξεζηκνπνηήζακε 95

96 πξνεγνχκελα δεκνζηεπκέλα δεδνκέλα γηα έληεθα ππξεληθνχο κηθξνδνξπθφξνπο (SSR) απφ ηνπο ίδηνπο πιεζπζκνχο (Κεθάιαην 3) ζε κηα ζπγθξηηηθή αλάιπζε ηεο γελεηηθήο δνκήο ηνπ πιεζπζκνχ θαη ηε δηαθνξνπνίεζε ησλ S- γνληδηαθψλ ζέζεσλ, θαζψο θαη ηελ θαηαλνκή ησλ S-αιιεινκφξθσλ ζηηο ειιεληθέο (Κεθάιαην 6) θαη ζε άιιεο επξσπατθέο πνηθηιίεο θεξαζηάο (Boskovic θαη Tobutt 2001, De Cuyper θ.ά. 2005). Οη ζηφρνη απηήο ηεο κειέηεο ήηαλ: (1) λα πξνζδηνξηζηεί ε πνηθηιφηεηα ησλ αιιεινκφξθσλ ησλ S- ξηβνλνπθιεαζψλ κε ηελ εθηίκεζε ησλ αξηζκψλ θαη ησλ ζπρλνηήησλ ησλ αιιεινκφξθσλ ζηελ S-γνληδηαθή ζέζε γηα πέληε θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο ζηελ Διιάδα, (2) λα ζπγθξηζεί ε πνηθηιφηεηα ησλ S-γνληδηαθψλ ζέζεσλ ησλ ειιεληθψλ θπζηθψλ πιεζπζκψλ θαη ε γελεηηθή πνηθηιφηεηα ησλ ειιεληθψλ θαη άιισλ δπηηθνεπξσπατθψλ πνηθηιηψλ θαη (3) λα δηεξεπλεζεί ην κνληέιν NFDS θαη νη ζπλέπεηέο ηνπ φζνλ αθνξά (α) ηνλ αξηζκφ ησλ S- αιιεινκφξθσλ θαη ηελ γελεηηθή πνηθηιφηεηα ζηελ S-γνληδηαθή ζέζε, (β) ηελ ηζνπιεζεία, (γ) ηελ νπδέηεξε κνξηαθή εμέιημε ηεο S- γνληδηαθήο ζέζεο, (δ) ηνλ ξπζκφ κεηαλάζηεπζεο θαη (ε) ηε δηαθνξνπνίεζε ησλ πιεζπζκψλ. Επιμέρουσ Υλικά και Μέθοδοι Η πιεζπζκηαθή γελεηηθή αλάιπζε θαη ε εχξεζε ηζνξξνπίαο ζχλδεζεο (LD) πξαγκαηνπνηήζεθαλ κε ηε ρξήζε ησλ πξνγξακκάησλ Genetix 4.05 (http://www.genetix.univ-montp2.fr/genetix.htm) θαη Popgene (http:// Η LD αλαθέξεηαη ζηε κε ηπραία ζπζρέηηζε αιιεινκφξθσλ ζε δχν ή πεξηζζφηεξνπο γνληδηαθέο ζέζεηο, φρη απαξαίηεηα ζην ίδην ρξσκφζσκα. Οη ζπρλφηεηεο ησλ αιιεινκφξθσλ, ε παξαηεξνχκελε εηεξνδπγσηία (H O ), ε αλακελφκελε εηεξνδπγσηία (H E ; γελεηηθή πνηθηιφηεηα) θαη ν δείθηεο πνηθηιφηεηαο Shannon (I) ππνινγίζηεθε γηα ηνπο πιεζπζκνχο αγξηνθεξαζηάο. Ο ζπληειεζηήο νκνκημίαο κέζα ζε έλαλ ππνπιεζπζκφ F IS είλαη ε πηζαλφηεηα ελφο αηφκνπ λα θέξεη έλα δεχγνο αιιεινκφξθσλ πνπ έρεη θιεξνλνκεζεί θαηαθφξπθα, ιφγσ χπαξμεο θνηλνχ πξνγφλνπ. Παίξλεη ηηκέο απφ -1 έσο +1. Αξλεηηθή ηηκή F IS ζεκαίλεη απνπζία νκνκημίαο ελψ αληίζεηα ζεηηθή ηηκή F IS ππνδεηθλχεη ηελ χπαξμε νκνκημίαο. Ο ππνινγηζκφο ησλ ηηκψλ ηνπ ζπληειεζηή νκνκημίαο έγηλε κε ην πξφγξακκα FSTAT (Goudet 1995). ζνλ αθνξά ηε δηαπιεζπζκηαθή ζηαηηζηηθή αλάιπζε, εθηφο απφ ηε ζχγθξηζε ησλ γελεηηθψλ παξακέηξσλ αλάκεζα ζηνπο πιεζπζκνχο, πξαγκαηνπνηήζεθε έιεγρνο ηεο γελεηηθήο δηαθνξνπνίεζεο ησλ πιεζπζκψλ κε ηα πξνγξάκκαηα FSTAT (Goudet 1995) κε βάζε ηηο ηηκέο F ST. 96

97 Η ηεξαξρηθή θαηαλνκή ηεο γελεηηθήο πνηθηινκνξθίαο κεηαμχ θαη εληφο ησλ πιεζπζκψλ γηα ηνπο δχν ηχπνπο κνξηαθψλ δεηθηψλ ραξαθηεξίζηεθε επίζεο απφ αλάιπζε ηεο κνξηαθήο δηαθχκαλζεο (AMOVA; (Excoffier θ.ά. 1992; Michalakis θαη Excoffier 1996). Πξαγκαηνπνηήζεθε ηεξαξρηθή AMOVA ρξεζηκνπνηψληαο ην ινγηζκηθφ παθέην GENALEX 6 (Peakall θαη Smouse 2006b). Οη δνθηκέο εθηειέζηεθαλ ρξεζηκνπνηψληαο εθηηκήζεηο πνπ βαζίζηεθαλ ζε απνζηάζεηο Φ ST. Γηεμήρζεζαλ δνθηκαζίεο ζεκαληηθφηεηαο ρξεζηκνπνηψληαο ζπλδπαζκνχο εληφο ηνπ ζπλφινπ δεδνκέλσλ. Η νπδεηεξφηεηα κηαο νξηζκέλεο γνληδηαθή ζέζε ειέγρζεθε ζπγθξίλνληαο ηηο παξαηεξνχκελεο ζπρλφηεηεο ησλ αιιεινκφξθσλ κε ηελ αλακελφκελε θαηαλνκή ησλ νπδέηεξσλ αιιεινκφξθσλ πνπ βαζίδνληαη ζηε ζεσξία ηνπ δεηγκαηνιεςίαο ηνπ Ewens s (Ewens 1972) θάλνληαο ρξήζε ηνπ νκνδπγσηηθνχ θξηηεξίνπ Watterson (Watterson 1974). Η δνθηκή πξαγκαηνπνηήζεθε κε ην ινγηζκηθφ Arlequin ver.3.0 (Excoffier θ.ά. 2005) κε ζθνπφ λα ειεγρζεί ε νπδεηεξφηεηα ηνπ γνληδίνπ S-RNase θαη ησλ SSR γνληδηαθψλ ζέζεσλ. Οη δνθηκέο ππνινγίζηεθαλ ζχκθσλα κε ηνλ αιγφξηζκν ηνπ (Manly 1985). Οη (Garrigan θαη Hedrick 2003) πξφηεηλαλ ηελ ρξήζε απηήο ηεο δνθηκήο γηα ηελ νπδεηεξφηεηα ησλ γνληδηαθψλ ζέζεσλ γηα ηε δηάθξηζε κεηαμχ ησλ δεκνγξαθηθψλ γεγνλφησλ θαη ηεο εμηζνξξνπεηηθήο επηινγήο. Γηα ηνλ εληνπηζκφ ηεο παξνπζίαο ίζσλ ζπρλνηήησλ αιιεινκφξθσλ ζε δηαθνξεηηθνχο πιεζπζκνχο (ππφζεζε ηζνπιεζείαο) φπσο αλακέλεηαη ζε έλα κεγάιν παλκηθηηθφ πιεζπζκφ κε ζεσξεηηθά άπεηξν κέγεζνο εμεηάζηεθαλ νη ζπρλφηεηεο ησλ S- αιιεινκφξθσλ γηα ίζε θαηαλνκή ζε θάζε έλαλ απφ ηνπο πέληε εμεηαδφκελνπο πιεζπζκνχο αγξηνθεξαζηάο κε ηε ρξήζε ελφο ηξνπνπνηεκέλνπ ειέγρνπ ρ 2 πνπ πεξηγξάθηεθε απφ ηνπο (Campbell θαη Lawrence 1981). πσο πξνηάζεθε απφ ηνλ (Mantel 1974), απηή ε ζηαηηζηηθή αθνινπζεί πεξίπνπ κηα θαηαλνκή ρ 2 κε n a -1 βαζκνχο ειεπζεξίαο θαη n a ν αξηζκφο ησλ αιιεινκφξθσλ (Stoeckel θ.ά. 2008). Οη ζπρλφηεηεο ησλ S-αιιεινκφξθσλ ππνινγίζηεθαλ σο ην πνζνζηφ φισλ ησλ αλαγλσξηζζέλησλ αιιεινκφξθσλ ζηνπο 93 γελνηχπνπο αγξηνθεξαζηάο κε ην ινγηζκηθφ GenAlEx 6 (Peakall θαη Smouse 2006a). Αληίζηνηρνη ππνινγηζκνί πξαγκαηνπνηήζεθαλ ζε ηξείο κεγάιεο δεκνζηεπκέλεο βάζεηο δεδνκέλσλ κε ζθνπφ ηε ζχγθξηζε (Boskovic θαη Tobutt 2001; De Cuyper θ.ά. 2005b). Γηα ηελ απφθηεζε κηαο ζπλνιηθήο εθηίκεζεο ηεο πνηθηιφηεηαο ησλ S-αιιεινκφξθσλ γηα πιεζπζκνχο φπνπ δελ έγηλε εμαληιεηηθή δεηγκαηνιεςία φισλ ησλ αηφκσλ, ν ζπλνιηθφο αξηζκφο ησλ S-αιιεινκφξθσλ ππνινγίζηεθε ζχκθσλα κε ηνλ (Paxman 1963) φπνπ a = n (1 (1 2/n) m ), φπνπ a 97

98 είλαη ν παξαηεξνχκελνο αξηζκφο ησλ αιιεινκφξθσλ, n ν δξαζηηθφο αξηζκφο ησλ S- αιιεινκφξθσλ, θαη m ν αξηζκφο ησλ αηφκσλ πνπ έγηλε δεηγκαηνιεςία αλά πιεζπζκφ (Brennan θ.ά. 2002; Holderegger θ.ά. 2008). Γηα ζπγθξηηηθνχο ζθνπνχο εθαξκφζηεθε ε δηαδηθαζία Paxman (1963) θαη γηα φιεο ηηο SSR γνληδηαθέο ζέζεηο. 4.2 Απνηειέζκαηα θαη ζπδήηεζε Η θαηαλνκή ζπρλνηήησλ ησλ S-αιιεινκόξθσλ ζε άγξηνπο πιεζπζκνύο θεξαζηάο ηελ κειέηε απηή αληρλεχηεθαλ ζπλνιηθά 16 S-αιιειφκνξθα ζηνπο πέληε θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο. Δπίζεο ρξεζηκνπνηήζεθε ε εξγαζία ησλ (Vaughan θ.ά. 2008) σο πιαίζην αλαθνξάο γηα ηνλ θαζνξηζκφ ησλ S-αιιεινκφξθσλ. Ο αξηζκφο ησλ S-αιιεινκφξθσλ αλά πιεζπζκφ ήηαλ κεηξίσο πςειφο θαη θπκάλζεθε απφ 7 έσο 12 κε κέζε ηηκή αλά πιεζπζκφ ίζε κε (s = 2,17) (Πίλαθαο 4.1, Δηθφλα 4.1). Ο κέγηζηνο αξηζκφο ησλ S-αιιεινκφξθσλ (12) βξέζεθε ζηνπο πιεζπζκνχο Καηάθπην θαη Βφξξαο. Αθφκε θαη ζε κηθξά κεγέζε δείγκαηνο πιεζπζκνχ, (n = 15, πιεζπζκφο Βφξξαο), βξέζεθε κεγάινο αξηζκφο S-αιιεινκφξθσλ. Ο αξηζκφο ησλ S-αιιεινκφξθσλ αλά πιεζπζκφ αιιάδεη ειαθξά κφλν φηαλ ππάξρεη ειιηπήο δεηγκαηνιεςία (Paxman 1963) θαη παξνπζίαζε ζηελ πξνθεηκέλε πεξίπησζε έλα κέζν φξν 11,00 (s = 2.91: Πίλαθαο 4.1). Έλα παξφκνην απνηέιεζκα παξαηεξήζεθε επίζεο φηαλ ε κέζνδνο Paxman (1963) εθαξκφζηεθε ζε SSR γνληδηαθέο ζέζεηο. χκθσλα κε ηηο πξνβιέςεηο ηνπ πξνηχπνπ NFDS, αλακέλεηαη έλαο κεγάινο αξηζκφο S-αιιεινκφξθσλ εληφο ησλ πιεζπζκψλ. Πξάγκαηη, φηαλ ν κέζνο αξηζκφο ησλ S-αιιεινκφξθσλ αλά πιεζπζκφ ζπγθξίζεθε κε ηελ αληίζηνηρε ηηκή ησλ νπδέηεξσλ SSR δεηθηψλ (Κεθάιαην 3), ν αξηζκφο ησλ αιιεινκφξθσλ ζηελ S-γνληδηαθή ζέζε ήηαλ πςειφηεξνο θαη ε παξαηεξνχκελε δηαθνξά ήηαλ ζηαηηζηηθψο ζεκαληηθή ζχκθσλα κε ηνλ έιεγρν t-ηεζη πνπ πξαγκαηνπνηήζεθε (t = 2.963, p = 0.031). Σν απνηέιεζκα απηφ ήξζε ζε ζπκθσλία επίζεο κε ηηο ηηκέο ηνπ δξαζηηθνχ αξηζκνχ αιιεινκφξθσλ (n e = 6,884 ζηελ S-γνληδηαθή ζέζε, ελψ n e = 4,253 ζηηο 11 SSR γνληδηαθέο ζέζεηο). Ο αξηζκφο ησλ S-αιιεινκφξθσλ αλά γνληδηαθή ζέζε, αλεμάξηεηα απφ ην κέγεζνο δείγκαηνο νη ηηκέο A R (πιήζνο αιιεινκφξθσλ), θπκαηλφηαλ απφ (Νπκθαία) έσο 8,360 (Υατληνχ) κε κέζν φξν A R =7.558 ζε ζχγθξηζε κε ην A R =6,849 γηα ηνπο SSR δείθηεο. Αλ θαη ζηελ πξαγκαηηθφηεηα ην πιήζνο ησλ αιιεινκφξθσλ κπνξεί λα αληρλεπζεί κφλν ζην επίπεδν αιιεινπρίαο DNA, ηα αλσηέξσ απνηειέζκαηα ππνζηεξίδνπλ ζε κεγάιν βαζκφ ηελ πξφβιεςε ηνπ Wright (1939) φηη ππάξρεη πςειφ πιήζνο αιιεινκφξθσλ ζηνλ S-γνληδηαθή ζέζε. Σν απνηέιεζκα απηφ είλαη ζε πιήξε αληηζηνηρία κε ηηο πεξηζζφηεξεο 98

99 ζρεηηθέο κειέηεο πνπ αλαθέξνπλ πςειφ πιήζνο αιιεινκφξθσλ ζηελ S-γνληδηαθή ζέζε (Castric θαη Vekemans 2004; Lawrence 2000). Πίλαθαο 4.1: Γεσγξαθηθέο ζέζεηο ησλ πέληε εμεηαδόκελσλ πιεζπζκώλ αγξηνθεξαζηάο. Κσδηθόο πιεζπζκνύ Γεσγξαθηθή Σνπνζεζία Απνγξαθή πιεζπζκν ύ / Μέγεζνο δείγκαηνο H E F IS Αλακελόκελ νο/paxman αξηζκόο S- αιιεινκόξθ σλ VOR Βφξξαο, Ηκαζία 80/15 0,853-0,138 12/13 HOL Υνινκψληαο, Υαιθηθηδηθή 100/18 0,875-0,050 11/12 KAT Καηάθπην, Γξάκα 900/20 0,861-0,136 12/14 HAI Υατληνχ, Ξάλζε 200/20 0,878 0,001 9/9 NIM Νπκθαία, Ρνδφπε 400/20 0,764-0,219 7/7 99

100 Δηθόλα 4.1: πρλόηεηα εκθάληζεο (%) ησλ δηαθνξεηηθώλ S-αιιεινκόξθσλ ζηα 93 άηνκα άγξηαο θεξαζηάο (κπιέ) ζε ζύγθξηζε κε ηηο ζπρλόηεηεο ζηηο 21 πνηθηιίεο θεξαζηάο (θόθθηλν) από ηνπο Ganopoulos et al (2011), ηηο 67 πνηθηιίεο θεξαζηάο (πξάζηλν ησλ Boscovic and Tobutt (2001) θαη εθείλσλ πνπ αλαθέξζεθαλ από ηνπο De Cuyper et al. (2005) ζε 65 γελνηύπνπο αγξηνθεξαζηάο (κώβ). Η ζπλνιηθή ζπρλφηεηα ησλ αιιεινκφξθσλ θπκαηλφηαλ απφ 2,15% (S 28 ) έσο 47,3% (S 30 ). Απφ ην ζχλνιν ησλ 16 S-αιιεινκφξθσλ, έμη (37,5%) ήηαλ θνηλά γηα φινπο ηνπο πιεζπζκνχο αγξηνθεξαζηάο. Γεθαηξία S-αιιειφκνξθα βξέζεθαλ ζε ηνπιάρηζηνλ δχν απφ ηνπο πέληε πιεζπζκνχο πνπ ρξεζηκνπνηνχληαη ζε απηή ηε κειέηε. Σα πην ζπρλά αιιειφκνξθα (S 7, S 17, S 29, S 30, S 31 θαη S 32 ) βξέζεθαλ ζε φινπο ηνπο πιεζπζκνχο. Λίγα S- αιιειφκνξθα βξέζεθαλ ζε ρακειέο ζπρλφηεηεο ζπγθεθξηκέλα κφλν ζηνπο πιεζπζκνχο Υνινκψληαο (δχν S-αιιειφκνξθα) θαη Καηάθπην (έλα S-αιιειφκνξθν), αληηζηνίρσο (Δηθφλα 4.2). Η ζπρλφηεηα εκθάληζεο ησλ S-αιιεινκφξθσλ ζηνπο ειιεληθνχο γελνηχπνπο αγξηνθεξαζηάο ζπγθξίζεθε κε ηελ ζπρλφηεηα εκθάληζεο εθείλσλ πνπ βξέζεθαλ ζε 21 επξέσο θαιιηεξγνχκελεο πνηθηιίεο θεξαζηάο ζηελ Διιάδα (Κεθάιαην 6). πλνιηθά 10 S- αιιειφκνξθα (S 6, S 7, S 10, S 14, S 17, S 19, S 28, S 29, S 30, S 32 ) ήηαλ παξφληα κφλν ζε άγξηνπο πιεζπζκνχο, δχν S-αιιειφκνξθα (S 5, S 9 ) ππήξραλ κφλν ζε πνηθηιίεο, ελψ έμη S- αιιειφκνξθα (S 1, S 2, S 3, S 4, S 13, S 30 ) ήηαλ παξφληα θαη ζηνπο άγξηνπο πιεζπζκνχο θαη ζηηο πνηθηιίεο (Δηθφλα 4.1). Δηθόλα 4.2: πρλόηεηεο ησλ S-αιιεινκόξθσλ ζηνπο πέληε θπζηθνύο πιεζπζκνύο αγξηνθεξαζηάο. 100

101 Δπηπιένλ, ηα απνηειέζκαηα απηά ζπγθξίζεθαλ κε ηα δεδνκέλα απφ 67 πνηθηιίεο πνπ εμεηάζηεθαλ απφ ηνπο Boskovic θαη Tobutt (2001) θαη απφ 65 βειγηθνχο γελνηχπνπο αγξηνθεξαζηάο πνπ πξνέξρνληαη απφ θπζηθνχο πιεζπζκνχο (De Cuyper θ.ά. 2005; Δηθφλα 4.1). πλνιηθά επηά S-αιιειφκνξθα ήηαλ θνηλά κε ηελ κειέηε ησλ Boskovic θαη Tobutt (2001) ελψ 10 ήηαλ θνηλά κε ηελ κειέηε ησλ De Cuyper θ.ά. (2005). Σα S 1 αιιειφκνξθα εκθαλίζηεθαλ ζε πςειή ζπρλφηεηα ζηνπο ειιεληθνχο γελνηχπνπο άγξηαο θεξαζηάο, ελψ ήηαλ ζπάληα ζηελ έξεπλα ησλ De Cuyper θ.ά. (2005). Παξ 'φια απηά, νη ζπρλφηεηεο ησλ αιιεινκφξθσλ S 1 θαη S 2 ήηαλ παξφκνηεο κε απηέο ηεο κειέηεο Boskovic θαη Tobutt (2001) (Δηθφλα 4.1). Πέληε S-αιιειφκνξθα πνπ βξέζεθαλ ζηνπο ειιεληθνχο πιεζπζκνχο άγξηαο θεξαζηάο (S 28, S 29, S 30, S 31, S 32 ) δελ έρνπλ εληνπηζηεί ζηηο επξσπατθέο πνηθηιίεο θαζψο θαη ζηηο κειέηεο ησλ Boskovic θαη Tobutt (2001) θαη De Cuyper θ.ά. (2005). Ωζηφζν, απηά ηα αιιειφκνξθα βξέζεθαλ πξφζθαηα ζε γελνηχπνπο άγξηαο θεξαζηάο ηεο Γπηηθήο Δπξψπεο θαη ραξαθηεξίζηεθαλ σο θαηλνθαλή αιιειφκνξθα απφ ηνπο Vaughan θ.ά. (2008). Αληίζεηα, ηα αιιειφκνξθα S 5, S 9, S 12, S 16, S 18, S 20, S 21 θαη S 22 πνπ απνπζίαδαλ απφ ηνπο ειιεληθνχο πιεζπζκνχο, ππάξρνπλ ζε γλσζηέο δηεζλείο πνηθηιίεο θεξαζηάο (Boskovic θαη Tobutt, 2001), ζε γελνηχπνπο θεξαζηάο ζηελ αλαηνιή (Ipek θ.ά. 2011) θαη είλαη παξφληεο ζηνπο βειγηθνχο πιεζπζκνχο αγξηνθεξαζηάο (De Cuyper θ.ά. 2005) θαζψο θαη ζηηο ειιεληθέο θαιιηεξγνχκελεο πνηθηιίεο θεξαζηάο (Κεθάιαην 6). Η ζπγθξηηηθή αλάιπζε ηεο γελεηηθήο πνηθηιφηεηαο θαη ηεο ξνήο γνληδίσλ ζε θπζηθνχο πιεζπζκνχο άγξηαο θεξαζηάο θαη ζε θαιιηεξγνχκελεο πνηθηιίεο ζηε Βφξεηα Διιάδα έδεημε φηη νη δχν απηέο νκάδεο είλαη πνιχ θαιά δηαρσξηζκέλεο θαη ε αλάκημε ηνπ γελεηηθνχ πιηθνχ είλαη πξαθηηθά ζρεδφλ απνχζα (Κεθάιαην 7). Οη πνηθηιίεο δελ θαίλεηαη λα δηαζηαπξψζεθαλ κε άηνκα θπζηθψλ πιεζπζκψλ ιφγσ ηεο ζεκαληηθήο δηαθνξνπνίεζεο ζην ρξφλν άλζεζεο θαη εμαηηίαο ηεο ζεκαληηθήο γεσγξαθηθήο απφζηαζεο κεηαμχ ησλ δχν νκάδσλ (Κεθάιαην 7). Η γελεηηθή βάζε ηεο ζπιινγήο ησλ πνηθηιηψλ πεξηνξίδεηαη ζε ζχγθξηζε κε απηή ησλ θπζηθψλ πιεζπζκψλ πηζαλφλ σο απνηέιεζκα ηεο παξαηεηακέλεο θαη ηζρπξήο αλζξσπνγελνχο επηινγήο (Avramidou θ.ά. 2010; Κεθάιαην 7. Ωζηφζν, ε παξνπζία ησλ απνθιεηζηηθψλ S-αιιεινκφξθσλ ζηηο θαιιηεξγνχκελεο πνηθηιίεο δείρλεη φηη ηνπιάρηζηνλ νξηζκέλεο πνηθηιίεο δελ έρνπλ ηνπηθή πξνέιεπζε. 101

102 Πίλαθαο 4.2: Γελεηηθή πνηθηιόηεηα ησλ πέληε θπζηθώλ πιεζπζκώλ αγξηνθεξαζηάο ζηελ S-γνληδηαθή ζέζε θαη ζηνπs 11 SSR νπδέηεξνπο κνξηαθνύο δείθηεο. εη δεδνκέλσλ A n e I H e H o AR F ST E N m Ηζνπιεζία VOR 9 6,818 2,020 0,853 1,000 6,833-0,919 - Ίζνο HOL 11 8,000 2,220 0,875 0,944 6,939-0,926-0,165 Ίζνο (ns) KAT 12 7,207 2,211 0,861 1,000 6,500-0,890-0,738 Ίζνο (ns) HAI 12 8,163 2,267 0,878 0,900 7,519-0,912-0,720 Ίζνο (ns) Έιεγρνο Οπδεηεξόηεηαο NIM 7 4,233 1,672 0,764 0,950 6,455-0,859-0,623 Άληζνο (ns) p<0,001 Only SI 10,2 6,884 2,078 0,846 0,958 7,558 0,035 0,901 6,754 F(p)<0,001 SSR ρσξίο ηνλ EMPaS02 7,12 4,246 1,603 0,739 0,685 6,040 0,092 0,816 0,977 - F(p) = 0,209-0,374 Οπδέηεξνο SSR (Κεθάιαην 3) 7,2 4,253 1,609 0,74 0,680 6,849 0,097 0,815 1,190 - F(p) = 0,207-0,374 Οπδέηεξνο - Οη δνθηκέο γηα ηνλ έιεγρν ηεο ίζεο θαηαλνκήο ησλ S-αιιεινκφξθσλ εληφο ησλ πιεζπζκψλ επηβεβαίσζαλ ηελ παξνπζία ηζνπιεζίαο ζε φινπο ηνπο πιεζπζκνχο εθηφο απφ έλαλ, ή αιιηψο ζην 80% ησλ πιεζπζκψλ πνπ κειεηήζεθαλ (Πίλαθαο 2.2). χκθσλα κε ηηο NFDS πξνβιέςεηο νη ζπρλφηεηεο ησλ αιιεινκφξθσλ ζηνπο θπζηθνχο πιεζπζκνχο αλακέλεηαη λα βξίζθνληαη ζε ηζνξξνπία ζηελ S-γνληδηαθή ζέζε (Wright 1939). Η ππφζεζε ηεο ηζνπιεζίαο ππνζηεξίρζεθε ζην είδνο Pyrus pyraster (Holderegger θ.ά. 2008), παξ 'φια απηά δελ επηβεβαηψζεθε ζηελ θεξαζηά (Schueler θ.ά. 2006; Stoeckel θ.ά. 2008) θαζψο θαη ζην είδνο Prunus lannesiana (Kato θαη Mukai 2004). Η δηαθνξεηηθή ζπκπεξηθνξά ησλ πιεζπζκψλ εληφο ηνπ είδνπο δελ είλαη αζπλήζηζηε θαη έρεη παξαηεξεζεί ζηελ θεξαζηά (Stoeckel θ.ά. 2008), ελψ νη απνθιίζεηο απφ ηελ ηζνπιεζία έρνπλ εμεγεζεί ζε ζεσξεηηθφ επίπεδν (Campbell θαη Lawrence 1981; Muirhead 2001). ε δχν εκπεηξηθέο κειέηεο, ν Lawrence (2000) αλέθεξε φηη δελ ππήξρε παξέθθιηζε απφ ηελ ηζνπιεζία ησλ αιιεινκφξθσλ ζε 16 απφ ηα 19 δείγκαηα πιεζπζκψλ απφ 12 είδε, ελψ νη Castric θαη 102

103 Vekemans (2004) αλέθεξαλ φηη απφ ηα 11 είδε κε γακεηνθπηηθφ απηναζπκβίβαζην, δχν πιεζπζκνί έθεξαλ ζεκαληηθή παξέθθιηζε απφ ηελ ππφζεζε ηεο ηζνπιεζίαο. ε πξφζθαηεο κειέηεο έρνπλ παξνπζηαζηεί πεξαηηέξσ απνηειέζκαηα γηα ηελ γελεηηθή αλάκημε ζε πνιπεηή μπιψδε αγγεηφζπεξκα. πλνιηθά, ζηελ ζπγθεθξηκέλε κειέηε θαίλεηαη φηη, αλ θαη νη δνθηκέο γηα ηνλ έιεγρν ηεο ζπρλφηεηαο ησλ αιιεινκφξθσλ έρνπλ ρακειή ζηαηηζηηθή ηζρχ ιφγσ ηνπ κηθξνχ κεγέζνπο δείγκαηνο, ηα πεξηζζφηεξα είδε κε γακεηνθπηηθφ απηναζπκβίβαζην αθνινπζνχλ ηελ ππφζεζε ηεο ηζνξξνπίαο ησλ ζπρλνηήησλ ησλ αιιεινκφξθσλ. Η επηθξάηεζε ηεο ηζνπιεζίαο παξέρεη πεξαηηέξσ ππνζηήξημε ζρεηηθά κε ηελ εκθάληζε ησλ κνληέισλ NFDS ζηνπο ειιεληθνχο πιεζπζκνχο αγξηνθεξαζηάο πνπ κειεηήζεθαλ Η γελεηηθή πνηθηιόηεηα θαη ε νπδεηεξόηεηα ησλ δεηθηώλ Δθηφο απφ ηνλ κεγάιν αξηζκφ ησλ S-αιιεινκφξθσλ, παξαηεξήζεθαλ επίζεο πςειά επίπεδα δηαθνξνπνίεζεο (Πίλαθαο 4.2). Η γελεηηθή πνηθηιφηεηα ζηελ S-γνληδηαθή ζέζε ήηαλ H E = 0,846 (Πίλαθαο 4.2), ηηκή πνιχ πςειφηεξε απφ φηη ε αληίζηνηρε ηηκή ζηηο 11 SSR γνληδηαθέο ζέζεηο (H E = 0,740: Κεθάιαην 3). ηαλ ε ππξεληθή κηθξνδνξπθνξηθή γνληδηαθή ζέζε EMPaS02 πνπ ζπλδέεηαη ζηελά κε ηελ S-γνληδηαθή ζέζε απνκαθξχλζεθε απφ ηελ αλάιπζε, ε πνηθηιφηεηεηα ησλ νπδέηεξσλ δεηθηψλ γηα ηηο ππφινηπεο 10 nssr γνληδηαθέο ζέζεηο ήηαλ αθφκε ρακειφηεξε (Η Δ = 0,685, Πίλαθαο 4.2). Απηά ηα απνηειέζκαηα έξρνληαη ζε ζπκθσλία κε ηελ ελ γέλεη πςειή πνηθηιφηεηα ησλ S- αιιεινκφξθσλ πνπ είλαη έλα ηδηαίηεξν ραξαθηεξηζηηθφ ηεο S-γελεηηθήο ζέζεο ζηα απηφαζπκβίβαζηα θπηηθά είδε (Lawrence 2000). ε επίπεδν πιεζπζκνχ, ε κέζε εηεξνδπγσηία ήηαλ πςειφηεξε ζηνλ πιεζπζκφ Υατληνχ (H E = 0,878) θαη ε ρακειφηεξε ζηνλ πιεζπζκφ Νπκθαία (H E = 0,764). Ιδηαίηεξα ζηνπο πιεζπζκνχο Καηάθπην θαη Υατληνχ βξέζεθαλ πςειά επίπεδα γελεηηθήο πνηθηιφηεηαο ζηελ S-γνληδηαθή ζέζε (Πίλαθαο 4.2). ια ηα δεχγε ηηκψλ F ST (0,0063-0,0342) ήηαλ εμαηξεηηθά ζηαηηζηηθψο ζεκαληηθά (p <0.001, Πίλαθαο 4.3). πλεπψο, ηα επίπεδα ηεο γελεηηθήο πνηθηινκνξθίαο ζηελ S-γνληδηαθή ζέζε ζηελ θεξαζηά είλαη ζε ζπκθσλία κε ηα ζεσξεηηθά πξφηππα ηεο δπλακηθήο ηνπ πιεζπζκνχ ηεο S-γνληδηαθήο ζέζεο. Σν ηεζη νκνδπγσηίαο Ewens-Watterson (Watterson 1974) απνθάιπςε ηζρπξή απφθιηζε απφ ηελ νπδεηεξφηεηα γηα ηελ S-γνληδηαθή ζέζε (p <0,001: Πίλαθαο 4.2). Απφ ηελ άιιε πιεπξά δελ αληρλεχζεθε θακία απφθιηζε απφ ηελ νπδεηεξφηεηα γηα ηηο γνληδηαθέο ζέζεηο nssr (0,207 <Ρ (π) <0,374: Πίλαθαο 4.2). Παξφκνηα απνηειέζκαηα 103

104 βξέζεθαλ επίζεο απφ ηνπο Schueler θ.ά. (2006) ζηελ θεξαζηά (ζε ζχγθξηζε κε ηηο S- θαη nssr γνληδηαθέο ζέζεηο), θαζψο θαη απφ ηνπο (Garrigan θαη Hedrick 2003) ζε πιεζπζκνχο πξνβάησλ φπνπ ζχγθξηλαλ ηνπο MHC (θχξην ζχκπινθν ηζηνζπκβαηφηεηαο) θαη SSR γνληδηαθέο ζέζεηο. Δηδηθά γηα ηηο επηιεγκέλεο νπδέηεξεο γνληδηαθέο ζέζεηο πνπ είλαη ζε ζπληελία κε ηελ S-γνληδηαθή ζέζε ζηελ θεξαζηά ηα παξαπάλσ απνηειέζκαηα κπνξνχλ λα ζεσξεζνχλ σο ππνζηήξημε ηεο ηπραίαο ζχλδεζεο αληζνξξνπίαο ζε απηφ ην είδνο (Arunyawat θ.ά. 2012). Η έληνλε δηαθνξά κεηαμχ ησλ απνηειεζκάησλ ησλ δνθηκψλ νπδεηεξφηεηαο ζηελ S-γνληδηαθή ζέζε θαη ηηο nssr γνληδηαθέο ζέζεηο παξέρεη κηα επηπιένλ ππνζηήξημε γηα ην αληίθηππν ησλ NFDS κνληέισλ ζηνπο πιεζπζκνχο άγξηαο θεξαζηάο ηνπ ειιαδηθνχ ρψξνπ Η γελεηηθή δνκή θαη ε ξνή ησλ γνληδίσλ Ο πςειφο αξηζκφο ησλ S-αιιεινκφξθσλ ζηνπο πιεζπζκνχο αγξηνθεξαζηάο δείρλεη δπλεηηθά πςειή δξαζηηθή ξνή γνληδίσλ κεηαμχ ησλ πιεζπζκψλ γηα ηελ γνληδησκαηηθή ζέζε πνπ ζρεηίδεηαη κε ην ζχζηεκα ηνπ γακεηνθπηηθνχ απηναζπκβίβαζηνπ. Πξάγκαηη, ε ξνή γνληδίσλ πνπ εθηηκήζεθε απφ ηα δεδνκέλα ησλ αιιεινκφξθσλ ηνπ γακεηνθπηηθνχ απηναζπκβίβαζηνπ κε βάζε ηελ RNase ήηαλ Nm = 6,754. Η ηηκή απηή είλαη ζρεδφλ έμη θνξέο κεγαιχηεξε απφ ηελ αληίζηνηρε ηηκή πνπ εθηηκάηαη απφ ηα δεδνκέλα ησλ νπδέηεξσλ δεηθηψλ (nssr) γηα ηνπο ίδηνπο πιεζπζκνχο θαη ηα ίδηα άηνκα (Nm=1,190: Κεθάιαην 3). Έηζη, ε ζεκαληηθή ηζηνξηθή ξνή γνληδίσλ πξνέξρεηαη ζαθψο απφ ηελ S-γνληδηαθή ζέζε. Η ζεσξία πξνβιέπεη έλα κεγαιχηεξν πνζνζηφ δξαζηηθήο κεηαλάζηεπζεο ζηα S- αιιειφκνξθα ηα νπνία είλαη απφ εμηζνξξνπεηηθή επηινγή ζε ζχγθξηζε κε ηα αιιειφκνξθα ησλ νπδέηεξσλ κνξηαθψλ δεηθηψλ (Muirhead 2001; Castric θαη Vekemans 2004). Καηά ζπλέπεηα, ηα απνηειέζκαηα απηά είλαη ζχκθσλα κε ην πξφηππν NFDS γηα ηελ ξνή γνληδίσλ, φπσο εθηηκάηαη απφ ηελ αλάιπζε ησλ S-αιιεινκφξθσλ. Μηα άιιε δηαπίζησζε πνπ είλαη ζπλεπήο ηφζν κε ηα παξαπάλσ απνηειέζκαηα φζν θαη κε ηηο ζεσξεηηθέο πξνβιέςεηο είλαη ε δηαθνξνπνίεζε ησλ πιεζπζκψλ ζηελ S-γνληδηαθή ζέζε. Η ηηκή F ST ζηελ S-γνληδηαθή ζέζε (0.035) ήηαλ ηδηαίηεξα ρακειή ζε ζχγθξηζε κε ην πςειφ βαζκφ δηαθνξνπνίεζεο ηνπ πιεζπζκνχ πνπ παξαηεξείηαη ζηηο νπδέηεξεο γελεηηθέο ζέζεηο ζε απηφ ην είδνο (F ST = 0,097 γηα 11 nssrs: Κεθάιαην 3). Απηφ ην απνηέιεζκα απεηθνλίδεηαη θαζαξά ζηελ Δηθφλα 4.3 φπνπ ζρεδηάζηεθαλ νη ηηκέο H E θαη F ST γηα φιεο ηηο γνληδηαθέο ζέζεηο. ηαλ ε EMPaS02 γνληδηαθή ζέζε πνπ είλαη ζηελά ζπλδεδεκέλε κε ηελ S-γνληδηαθή ζέζε απνκαθξχλζεθε, ην κέγεζνο ηεο δηαθνξάο δελ κεηαβιήζεθε νπζηαζηηθά 104

105 (F ST = 0,092). πλεπψο, ε δηαθνξνπνίεζε ησλ πιεζπζκψλ βξέζεθε λα είλαη πεξίπνπ ηξεηο θνξέο κηθξφηεξε ζηελ S-γνληδηαθή ζέζε ηεο θεξαζηάο ζε ζχγθξηζε κε ην ππφινηπν ηνπ γνληδηψκαηνο. Απηφ ην απνηέιεζκα είλαη ζχκθσλν κε ηνπο Stoeckel θ.ά. (2006, 2008) πνπ βξήθαλ ηελ ηηκή F ST ζηελ S-γνληδηαθή ζέζε λα είλαη ηξεηο θνξέο κηθξφηεξε απφ φ, ηη ε ηηκή F ST ζε επηά κηθξνδνξπθνξηθνχο γνληδηαθέο ζέζεηο κεηαμχ ηξηψλ πιεζπζκψλ θεξαζηάο ζηελ Γαιιία. Οκνίσο, νη πιεζπζκνί αγξηναριαδηάο (Pyrus pyraster) παξνπζίαζαλ ηξεηο θνξέο ρακειφηεξε ηηκή F ST ζηελ S-γνληδηαθή ζέζε (F ST = 0,011) απφ φ,ηη ζε πέληε κηθξνδνξπθνξηθέο νπδέηεξεο γνληδηαθέο ζέζεηο (F ST = 0,039: Holderegger θ.ά. 2008). Δπηπιένλ, νη Glemin θ.ά. (2005) βξήθαλ φηη ε δηαθνξνπνίεζε ηνπ πιεζπζκνχ ζηελ S- γνληδηαθή ζέζε αληηπξνζσπεχεη ην ήκηζπ ηεο δηαθνξνπνίεζεο ησλ 11 nssr ζην απηναζπκβίβαζην είδνο Brassica insularis. Δηθόλα 4.3: Γξαθηθή παξάζηαζε ηεο αλακελόκελεο εηεξνδπγσηίαο H E θαη ηνπ δείθηε F ST γηα ηελ S- γνληδηαθή ζέζε θαη ηνπο SSR κνξηαθνύο δείθηεο. Πίλαθαο 4.34: Εεύγε ηηκώλ F ST ησλ πέληε πιεζπζκώλ αγξηνθεξαζηάο. Population Υνινκώληαο Υατληνύ Καηάθπην Νπκθαία Υατληνύ 0,

106 Καηάθπην 0,0202 0,0331 Νπκθαία 0,0342 0,0666 0,0254 Βόξξαο 0,0063 0,0066 0,0091 0,0211 Πξφζζεηε ππνζηήξημε γηα ηηο αλσηέξσ δηαπηζηψζεηο ειήθζε κε ηε ρξήζε ηεο AMOVA. Η AMOVA έδεημε φηη πεξίπνπ ην 95% ηεο ζπλνιηθήο παξαιιαθηηθφηεηαο ζηελ S-γνληδηαθή ζέζε θαηαλεκήζεθε εληφο ησλ πιεζπζκψλ, ελψ, κεηαμχ ησλ πιεζπζκψλ ε δηαθνξνπνίεζε ήηαλ πεξίπνπ 5% ηεο ζπλνιηθήο παξαιιαθηηθφηεηαο (Φ ST = 0,048; Ρ = 0,001; Πίλαθαο 4.4). Η πεξηνξηζκέλε γελεηηθή δνκή ζηελ S-γνληδηαθή ζέζε ζε ζχγθξηζε κε ηηο γνληδηαθέο ζέζεηο ησλ κηθξνδνξπθνξηθψλ δεηθηψλ θαίλεηαη λα είλαη έλα γεληθφ ραξαθηεξηζηηθφ ησλ θπηψλ πνπ έρνπλ ζπζηήκαηα απηναζπκβίβαζηνπ (Glemin θ.ά. 2005; Brennan θ.ά. 2002; Kamau θ.ά. 2007). ε γεληθέο γξακκέο ηα απνηειέζκαηα ηεο κειέηεο απηήο είλαη ζε ζπκθσλία κε ηελ ζρεηηθή βηβιηνγξαθία θαη ππνδεηθλχνπλ ζαθψο κηα πην πεξηνξηζκέλε γελεηηθή δνκή ζηελ S-γνληδηαθή ζέζε ζε ζχγθξηζε κε ηε γελεηηθή δνκή ησλ νπδέηεξσλ γνληδηαθψλ ζέζεσλ ζηνπο ίδηνπο πιεζπζκνχο (Kamau θ.ά. 2007). Πίλαθαο 4.4: AMOVA αλάιπζε ηεο S-γνληδηαθή ζέζε γηα ηνπο πέληε πιεζπζκνύο αγξηνθεξαζηάο. Πεγή παξαιιαθηηθόηεηαο Βαζκόο ειεπζεξίαο SSD πλνιηθή δηαθύκαλζε (%) Φ-ζηαηηζηηθή Σηκή P Μεηαμύ ησλ πιεζπζκώλ 4 6,026 5% Δληόο ησλ πιεζπζκώλ 88 68,200 95% 0,048 <0,001 ύλνιν 92 74, % 4.3 πκπεξάζκαηα Απφ ηελ αλάιπζε ησλ S-αιιεινκφξθσλ πνπ πξνέξρνληαη απφ πέληε θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο θαη ηελ ζχγθξηζε ησλ γελεηηθψλ παξακέηξσλ ηνπ πιεζπζκνχ κεηαμχ ηεο S-γνληδηαθή ζέζε θαη ησλ νπδέηεξσλ κνξηαθψλ δεηθηψλ, βξέζεθαλ ηα απνηειέζκαηα πνπ αλακέλνληαη ζε κηα γνληδησκαηηθή ζέζε ππφ αξλεηηθή επηινγή 106

107 εμαξηψκελε απφ ηηο ζπρλφηεηεο ησλ γνληδίσλ. Σα απνηειέζκαηα απηά είλαη: (α) ν κεγάινο αξηζκφο αιιεινκφξθσλ θαη πςειφο αιιεινκνξθηθφο πινχηνο ηεο S-γνληδηαθήο ζέζεο, (β) ε επηθξάηεζε ηεο ηζνπιεζίαο, (γ) ε πςειή γελεηηθή πνηθηιφηεηα ησλ S-αιιεινκφξθσλ, (δ) κηα ηζρπξή απφθιηζε απφ ηελ νπδεηεξφηεηα ζηελ S-γνληδηαθή ζέζε, (ε) έλα κεγαιχηεξν πνζνζηφ απνηειεζκαηηθήο κεηαλάζηεπζεο ζηα S-αιιειφκνξθα ζε ζχγθξηζε κε ηα αιιειφκνξθα ησλ νπδέηεξσλ κνξηαθψλ δεηθηψλ, (ζη) ε πην πεξηνξηζκέλε γελεηηθή δνκή ηνπ πιεζπζκνχ ζηελ S-γνληδηαθή ζέζε. Απηά ηα απνηειέζκαηα ππνδεηθλχνπλ φηη ε αξλεηηθή επηινγή πνπ εμαξηάηαη απφ ηηο γνληδηαθέο ζπρλφηεηεο είλαη έλαο εμειηθηηθά ζεκαληηθφο ηξφπνο επηινγήο γηα ηελ γνληδησκαηηθή ζέζε πνπ ζπλδέεηαη κε ηελ S- γνληδηαθή ζέζε ζχκθσλα κε ηηο πξνβιέςεηο ηνπ Wright (1939). ηελ πξάμε, απηά ηα απνηειέζκαηα δείρλνπλ απνπζία πεξηνξηζκψλ ζρεηηθά κε ηε δηαζεζηκφηεηα αηφκσλ γηα γνληκνπνίεζε ζηνπο ζρεηηθά κηθξνχο θπζηθνχο πιεζπζκνχο αγξηνθεξαζηάο πνπ κειεηήζεθαλ. Σα δηαζέζηκα ζηνηρεία ζρεηηθά κε ηε ζχλζεζε ησλ S-αιιειφκνξθσλ ζηνπο ειιεληθνχο θπζηθνχο πιεζπζκνχο θεξαζηάο έρνπλ πιένλ απμεζεί ζε κεγάιν βαζκφ. Ο πξνζδηνξηζκφο ησλ γελνηχπσλ ηεο S-γελεηηθήο ζέζεο είλαη πςίζηεο ζεκαζίαο ζην ζρεδηαζκφ δηαζηαπξψζεσλ ζε πξνγξάκκαηα βειηίσζεο θαη ηα απνηειέζκαηά ηεο κειέηεο απηήο είλαη ρξήζηκα γηα ηελ νξζή επηινγή ησλ θαηάιιεισλ γνλέσλ. Δπηπιένλ, κπνξνχλ επίζεο λα ζπκβάινπλ ζηελ πξφνδν ηεο γελεηηθήο ησλ πιεζπζκψλ θαη ηελ έξεπλα ηνπ απηναζπκβίβαζηνπ ζηελ αγξηνθεξαζηά, θαζψο θαη ζε άιια είδε κε απηναζπκβίβαζην. 4.4 Βηβιηνγξαθία Arunyawat, U., Capdeville, G. l., Decroocq, V. r. and Mariette, S. p Linkage disequilibrium in French wild cherry germplasm and worldwide sweet cherry germplasm. Tree Genetics & Genomes 8(4): Avramidou, E., Ganopoulos, I. V. and Aravanopoulos, F. A DNA fingerprinting of elite Greek wild cherry (Prunus avium L.) genotypes using microsatellite markers. Forestry. Barrett, S. C. H The evolution of plant sexual diversity. Nat Rev Genet 3(4): Barrett, S. C. H Mating strategies in flowering plants: the outcrossingβ selfing paradigm and beyond. Philosophical Transactions of the Royal Society of London Series B: Biological Sciences 358(1434): Boskovic, R. and Tobutt, K. R Genotyping cherry cultivars assigned to incompatibility groups, by analysing stylar ribonucleases. Theoretical and Applied Genetics 103(4): Bošković, R. and Tobutt, K. R Correlation of stylar ribonuclease zymograms with incompatibility alleles in sweet cherry. Euphytica 90(2):

108 Brennan, A. C., Harris, S. A., Tabah, D. A. and Hiscock, S. J The population genetics of sporophytic self-incompatibility in Senecio squalidus L. (Asteraceae) I: S allele diversity in a natural population. Heredity 89(6): Busch, J. W. and Schoen, D. J The evolution of self-incompatibility when mates are limiting. Trends in Plant Science 13(3): Campbell, J. M. and Lawrence, M. J The population genetics of the selfincompatibility polymorphism in Papaver rhoeas. II. The number and frequency of S-alleles in a natural population (R106). Heredity 46(1): Castric, V. and Vekemans, X Plant self-incompatibility in natural populations: a critical assessment of recent theoretical and empirical advances. Molecular Ecology 13(10): Choi, C., Ta, R. and Andersen, R. L Identification of self-incompatibility alleles and pollen incompatibility groups in sweet cherry by PCR based s-allele typing and controlled pollination. Euphytica 123(1):9-20. De Cuyper, B., Sonneveld, T. and Tobutt, K. 2005a. Determining self-incompatibility genotypes in Belgian wild cherries. Mol Ecol 14: De Cuyper, B., Sonneveld, T. and Tobutt, K. R. 2005b. Determining selfincompatibility genotypes in Belgian wild cherries. Molecular Ecology 14(4): Ewens, W. J The sampling theory of selectively neutral alleles. Theoretical Population Biology 3(1): Excoffier, L., Laval, G. and Schneider, S Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1: Excoffier, L., Smouse, P. and Quattro, J Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131: Franklin-Tong, V. E. and Franklin, F. C. H The different mechanisms of gametophytic selfβ incompatibility. Philosophical Transactions of the Royal Society of London Series B: Biological Sciences 358(1434): Garrigan, D. and Hedrick, P. W Perspective: detecting adaptive molecular polymorphism: lessons from the MHC. Evolution 57(8): Gisbert, A. D., Badenes, M. L., Tobutt, K. R., Llacer, G. and Romero, C Determination of the S-allele composition of sweet cherry (Prunus avium L.) cultivars grown in the southeast of Spain by PCR analysis. Journal of Horticultural Science & Biotechnology 83(2): Glémin, S., Gaude, T., Guillemin, M.-L., Lourmas, M., Olivieri, I. and Mignot, A. s Balancing selection in the wild: testing population genetics theory of selfincompatibility in the rare species Brassica insularis. Genetics 171(1): Hauck, N. R., Yamane, H., Tao, R. and Iezzoni, A. F Self-compatibility and incompatibility in tetraploid sour cherry (Prunus cerasus L.). Sexual Plant Reproduction 15(1): Holderegger, R., Häner, R., Csencsics, D., Angelone, S. and Hoebee, S. E S- allele diversity suggests no mate limitation in small populations of a selfincompatible plant. Evolution 62(11): Ipek, A., Gulen, H., Akcay, M. E., Ipek, M., Ergin, S. and Eris, A Determination of self-incompatibility groups of sweet cherry genotypes from Turkey. Genet Mol Res 10(1):

109 Kamau, E., Charlesworth, B. and Charlesworth, D Linkage Disequilibrium and Recombination Rate Estimates in the Self-Incompatibility Region of Arabidopsis lyrata. Genetics 176(4): Kato, S. and Mukai, Y Allelic diversity of S-RNase at the self-incompatibility locus in natural flowering cherry populations (Prunus lannesiana var. speciosa). Heredity 92(3): Kawabe, A., Hansson, B., Forrest, A., Hagenblad, J. and Charlesworth, D Comparative gene mapping in Arabidopsis lyrata chromosomes 6 and 7 and A. thaliana chromosome IV: evolutionary history, rearrangements and local recombination rates. Genetics Research 88(01): Lawrence, M. J Population Genetics of the Homomorphic Self-incompatibility Polymorphisms in Flowering Plants. Annals of Botany 85(suppl 1): Manly, B. F. J The statistics of natural selection on animal populations. Chapman and Hall, London. 484 pp. Mantel, N Some Reasons for Not Using the Yates Continuity Correction on 2 x 2 Contingency Tables: Comment and a Suggestion. Journal of the American Statistical Association 69(346): Marchese, A., Tobutt, K. R., Raimondo, A., Motisi, A., Boskovic, R. I., Clarke, J. and Caruso, T Morphological characteristics, microsatellite fingerprinting and determination of incompatibility genotypes of Sicilian sweet cherry cultivars. Journal of Horticultural Science & Biotechnology 82(1): Maruyama, T. and Fuerst, P Population bottlenecks and nonequilibrium models in population genetics. I. Allele numbers when populations evolve from zero variability. Genetics 108: Michalakis, Y. and Excoffier, L A generic estimation of population subdivision using distances between alleles with special reference for microsatellite loci. Genetics 142(3): Muirhead, C. A Consequences of population structure on genes under balancing selection. Evolution 55(8): Newbigin, E., Paape, T. and Kohn, J. R RNase-Based Self-Incompatibility: Puzzled by Pollen S. The Plant Cell Online 20(9): Paxman, G. J The maximum likelihood estimation of the number of self-sterility alleles in a population. Genetics 48(8): Peakall, R. and Smouse, P. 2006a. Genalex 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6: Peakall, R. and Smouse, P. E. 2006b. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6(1): Schierup, M. H The Number of Self-Incompatibility Alleles in a Finite, Subdivided Population. Genetics 149(2): Schueler, S., Tusch, A. and Scholz, F Comparative analysis of the withinpopulation genetic structure in wild cherry (Prunus avium L.) at the selfincompatibility locus and nuclear microsatellites. Molecular Ecology 15(11): Schuster, M., Flachowsky, H. and Kohler, D Determination of self-incompatible genotypes in sweet cherry (Prunus avium L.) accessions and cultivars of the German Fruit Gene Bank and from private collections. Plant Breeding 126(5):

110 Sonneveld, T., Robbins, T. P., Boskovic, R. and Tobutt, K. R Cloning of six cherry self-incompatibility alleles and development of allele-specific PCR detection. Theoretical and Applied Genetics 102(6-7): Sonneveld, T., Tobutt, K. R. and Robbins, T. P Allele-specific PCR detection of sweet cherry self-incompatibility (S) alleles S1 to S16 using consensus and allelespecific primers. Theoretical and Applied Genetics 107(6): Steiner, W. and Gregorius, H.-R Incompatibility and pollen competition in Alnus glutinosa: Evidence from pollination experiments. Genetica 105(3): Stoeckel, S., Castric, V., Mariette, S. and Vekemans, X Unequal allelic frequencies at the selfβ incompatibility locus within local populations of Prunus avium L.: an effect of population structure? Journal of Evolutionary Biology 21(3): Stoeckel, S., Klein, E. K., Oddou-Muratorio, S., Musch, B. and Mariette, S Microevolution of S-allele frequencies in wild cherry populations: respective impacts of negative frequency dependent selection and genetic drift. Evolution:nono. Tao, R., Yamane, H., Sugiura, A., Murayama, H., Sassa, H. and Mori, H Molecular typing of S-alleles through identification, characterization and cdna cloning for S-RNases in sweet cherry. Journal of the American Society for Horticultural Science 124(3): Vaughan, S. P., Bošković, R. I., Gisbert-Climent, A., Russell, K. and Tobutt, K. R Characterisation of novel S-alleles from cherry (Prunus avium L.). Tree Genetics & Genomes 4(3): Watterson, G. A The Sampling Theory of Selectively Neutral Alleles. Advances in Applied Probability 6(3): Wright, S The distribution of self-sterility alleles in populations. Genetics 24(4): Yamane, H., Ikeda, K., Ushijima, K., Sassa, H. and Tao, R A pollen-expressed gene for a novel protein with an F-box motif that is very tightly linked to a gene for S-RNase in two species of cherry, Prunus cerasus and P-avium. Plant and Cell Physiology 44(7): Yamane, H., Tao, R., Murayama, H., Ishiguro, M., Abe, Y., Soejima, J. and Sugiura, A Determining S- genotypes of two sweet cherry (Prunus avium L.) cultivars, 'Takasago (Rockport Bigarreau)' and 'Hinode (Early Purple)'. Journal of the Japanese Society for Horticultural Science 69(1): Zhou, L., Kappel, F., MacDonald, R., Hampson, C., Bakkeren, G. and Wiersma, P. A Determination of S-geontypes and self-fertility of sweet cherry in Summerland advanced selections. Journal American Pomological Society 56(3):

111 Κεθάιαην 5: Γελεηηθή πνηθηιόηεηα θαη κνξηαθόο ραξαθηεξηζκόο ησλ Διιεληθώλ πνηθηιηώλ θαιιηεξγνύκελεο θεξαζηάο 5.1 Δηζαγσγή Η θεξαζηά (Prunus avium L.), ζπκπεξηιακβάλεη ηελ θαιιηεξγνχκελε θεξαζηά πνπ θαιιηεξγείηαη γηα θαηαλάισζε απφ ηνπο αλζξψπνπο θαη ηελ αγξηνθεξαζηά πνπ θαιιηεξγείηαη γηα ην μχιν ηεο. Οη θεξαζηέο πηζηεχεηαη φηη πξνέξρνληαη απφ ηελ πεξηνρή ηνπ Καχθαζνπ, ζηηο κέξεο καο φκσο εθηείλνληαη απφ ηελ θεληξηθή Δπξψπε κέρξη θαη ηελ δπηηθή Αζία (Webster 1996). Αλακθίβνια ν θαξπφο ηεο θεξαζηάο ήηαλ κηα αξρηθή πεγή ηξνθήο γηα ηνπο πξσηφγνλνπο θαηνίθνπο ηεο Δπξψπεο, φπσο έρεη βξεζεί απφ απνηθίεο ησλ ζπειαίσλ πνπ ρξνλνινγνχληαη ην π.υ. Η θεξαζηά πνιχ πηζαλφλ λα πξσηνθαιιηεξγήζεθε ζηελ Διιάδα (Hedrick 1915; Marshall 1954). Η θαιιηέξγεηα ηεο θεξαζηάο είλαη δηαδεδνκέλε ζηελ Διιάδα (Koukourojiannis 1996). Οη εκπνξηθέο απαηηήζεηο γηα ηελ θαιιηεξγνχκελε θεξαζηά θαηέιεμαλ ζηελ αχμεζε ζχγρξνλσλ γεσξγηθψλ θαιιηεξγεηψλ. Γηα λα αλαγλσξηζηεί θαη λα αλαιπζεί ε γελεηηθή πνηθηιφηεηα ησλ βαζηθψλ πνηθηιηψλ θαιιηεξγνχκελεο θεξαζηάο κπνξεί θάπνηνο λα βαζηζηεί κφλν ζηα θαηλνηππηθά ραξαθηεξηζηηθά (IPGRI 1985; UPOV 1976). Η κνξθνινγηθή αλάιπζε είλαη γξήγνξε θαη ζπλήζεο κέζνδνο γηα ηελ αλαγλψξηζε θαη ηνλ ραξαθηεξηζκφ ηνπ γελεηηθνχ πιηθνχ κέζσ ηνπ θαηλνηχπνπ. Ωζηφζν, ηα θαηλνηππηθά ραξαθηεξηζηηθά επεξεάδνληαη απφ ηνπο παξάγνληεο ηνπ πεξηβάιινληνο θαη κπνξεί λα παξνπζηάζνπλ απμεκέλε γελεηηθή πνηθηιφηεηα σο πξνο ηα επηζπκεηά αγξνλνκηθά ραξαθηεξηζηηθά, (Marinoni θ.ά. 2003) θαη άξα λα κεηψζνπλ θαη ηελ αμηνπηζηία ηεο κεζφδνπ. πλεπψο, γηα λα μεπεξαζηνχλ απηέο νη δπζθνιίεο, νη βαζηδφκελεο ζε DNA κνξηαθέο ηερληθέο ησλ RAPDs (Gerlach θαη Stosser 1997), AFLPs (Struss θ.ά. 2003; Struss θ.ά. 2002) θαη SSRs (Schueler θ.ά. 2003; Struss θ.ά. 2003; Struss θ.ά. 2002; Wunsch θαη Hormaza 2002; Wunsch θαη Hormaza 2004), είλαη επξέσο ρξεζηκνπνηνχκελεο γηα ηνλ ραξαθηεξηζκφ ηνπ γελεηηθνχ πιηθνχ θαη ηελ εθηίκεζε ηεο γελεηηθήο πνηθηιφηεηαο. Οη SSR κνξηαθνί δείθηεο ή αιιηψο κηθξνδνξπθφξνη ζπλήζσο ρξεζηκνπνηνχληαη γηα 111

112 κειέηεο αλαγλψξηζεο γελεηηθνχ πιηθνχ ιφγσ ηεο επθνιίαο ρξήζεο ηνπο θαη ηεο επαλαιεςηκφηεηαο ηνπο θαζψο θαη ιφγσ ηεο ζπγθπξίαξρεο θιεξνλφκεζήο ηνπο θαη ηνπ πςεινχ πνιπκνξθηζκνχ ηνπο. Μηα πην πξφζθαηε κέζνδνο βαζηδνκέλε ζηνπο κηθξνδνξπθφξνπο, ε αλάιπζε κε ISSR δείθηεο, έρεη αλαπηπρζεί θαη ζπκπεξηιακβάλεη πνιιαπιαζηαζκφ ηνπ DNA κε PCR απφ έλαλ εθθηλεηή bp πνπ απνηειείηαη απφ κηα επαλαιακβαλφκελε αιιεινπρία. Απηή ε πξνζέγγηζε είλαη πςειά επαλαιήςηκε θαη έρεη ρακειφ θφζηνο (Powell θ.ά. 1996). Η αλάιπζε κε ISSR κνξηαθνχο δείθηεο έρεη ρξεζηκνπνηεζεί γηα αλαγλψξηζε πνηθηιηψλ ζε πνηθίια θπηηθά είδε, ζπκπεξηιακβαλνκέλνπ ηνπ ξπδηνχ (Joshi θ.ά. 2000), ηεο κειηάο (Goulao θαη Oliveira 2001), ηεο θξάνπιαο (Arnau θ.ά. 2003) θαη ηεο κνπξηάο (Kar θ.ά. 2008). Απφ φζν γλσξίδνπκε, απηή είλαη ε πξψηε θνξά πνπ ε ISSR αλάιπζε έρεη εθαξκνζηεί ζηελ θαιιηεξγνχκελε θεξαζηά. Δθφζνλ δελ έρεη εθαξκνζηεί ζρεηηθή αλάιπζε ζηελ θαιιηεξγνχκελε θεξαζηά, ε παξνχζα κειέηε ζηνρεχεη λα πινπνηήζεη απηήλ ηελ δηαδηθαζία ρξεζηκνπνηψληαο δείθηεο θαη θπηηθφ πιηθφ πνπ παξέρνπλ πςειή ελδνπνηθηιηαθή πνηθηιφηεηα. πλεπψο ρξεζηκνπνηψληαο κνξηαθέο κεζφδνπο βαζηζκέλεο ζηνπο κηθξνδνξπθφξνπο (SSR/ISSR) ραξαθηεξίζακε κηα ζπιινγή απφ ειιεληθέο πνηθηιίεο θεξαζηάο πξνεξρφκελεο απφ ηελ Σξάπεδα Γελεηηθνχ Τιηθνχ θαζψο θαη γελνηχπνπο αλαθνξάο. Σα κνξηαθά δεδνκέλα απφ ηνπο SSRs δείθηεο ρξεζηκνπνηήζεθαλ γηα λα ειεγρζεί ε χπαξμε γελεηηθήο δνκήο ζηελ ππφ κειέηε ζπιινγή. Ο ζηφρνο ήηαλ λα δεκηνπξγεζεί έλα κνξηαθφ πξφηππν ην νπνίν ζα παξέρεη κηα εγγχεζε γελεηηθήο ηαπηφηεηαο θαηά ηελ επεμεξγαζία θαη δηαρείξηζε ηνπ γελεηηθνχ πιηθνχ, ηδηαίηεξα θαηά ηα ζηάδηα ηνπ πνιιαπιαζηαζκνχ θαη ηεο θαηαλνκήο ηνπ πνιιαπιαζηαζζέληνο γελεηηθνχ πιηθνχ. Δπηκέξνπο Τιηθά θαη Μέζνδνη Σα πξντφληα ελίζρπζεο πνπ εκθαλίζηεθαλ ζηελ πεθηή αγαξφδεο απνηππψζεθαλ ζε πίλαθεο φπνπ ζεκεηψζεθαλ ε παξνπζία (1) ή ε απνπζία (0) ησλ αληίζηνηρσλ δσλψλ (δεχγε βάζεσλ) γηα θάζε εθθηλεηή θαη δείγκα. Οη πίλαθεο αλαιχζεθαλ κε ην ινγηζκηθφ FreeTree v (Hampl θ.ά. 2001). Η νκνηφηεηα ησλ δπαδηθψλ δεδνκέλσλ ππνινγίζηεθε κε ρξήζε ηνπ Nei θαη Li δείθηε νκνηνκνξθίαο (Nei θαη Li, 1979) θαη κε βάζε ηηο κήηξεο γελεηηθήο νκνηνκνξθίαο θαηαζθεπάζηεθαλ δελδξνγξάκκαηα θπινγελεηηθήο αλάιπζεο κε ηε κέζνδν UPGMA. Οη πίλαθεο ησλ ζπληειεζηψλ νκνηνκνξθίαο πνπ ππνινγίζηεθαλ απφ 112

113 ην ινγηζκηθφ FreeTree κεηαηξάπεθαλ ζην ινγηζκηθφ MEGA 4 v4.1 (Kumar, Tamura, Nei 2004) κε ζθνπφ ηελ θαιχηεξε απνηχπσζε ηνπ δελδξνγξάκκαηνο. Σν πνζνζηφ πνιπκνξθηζκνχ θάζε γελεηηθήο ζέζεο (P), ν δξαζηηθφο αξηζκφο αιιεινκφξθσλ (n e ), ε αλακελφκελε (H e ), ε παξαηεξνχκελε εηεξνδπγσηία (Ηo) θαη ν δείθηεο πνηθηιφηεηαο Shannon (I), ππνινγίζηεθαλ κε ηε ρξήζε ηνπ ινγηζκηθνχ παθέηνπ PopGene32 (Yeh θ.ά. 1999), θαη γηα ηα δχν είδε κνξηαθψλ δεηθηψλ. Γηα ηελ κνξηαθή αλάιπζε κε SSR δείθηεο, νη ηηκέο PIC θαη P ID ππνινγίζηεθαλ ζχκθσλα κε ηηο παξαθάησ εμηζψζεηο: PIC n n 1 n ( pi ) 2 pi p j i 1 i 1 j i 1 (Botstein θ.ά. 1980) P I D n i 1 p 4 i n 1 i 1 n 2 ( 2 pi p j ) (Paetkau θ.ά. 1995) j i 1 φπνπ p i θαη p j είλαη νη ζπρλφηεηεο ησλ ith θαη jth αιιεινκφξθσλ θαη n είλαη ν ζπλνιηθφο αξηζκφο ηνπ θάζε αιιεινκφξθνπ. Οη παξαπάλσ παξάκεηξνη δίλνπλ κηα εθηίκεζε ηεο δηαθξηηηθήο ηθαλφηεηαο ηνπ θάζε εθθηλεηή πξνζκεηξψληαο φρη κφλν ηνλ αξηζκφ ησλ εκθαληδφκελσλ αιιεινκφξθσλ αιιά θαη ηηο ζρεηηθέο ζπρλφηεηεο ηνπο. Έηζη άηνκα κε ίδην αξηζκφ αιιεινκφξθσλ κπνξνχλ λα έρνπλ δηαθνξεηηθέο ηηκέο PIC θαη P ID νη νπνίεο νθείινληαη ζηε δηαθνξεηηθή θαηαλνκή ησλ αιιεινκφξθσλ (Pasqualone θ.ά., 1999). Οη παξάκεηξνη PIC θαη P ID εθθξάδνπλ ηνλ βαζκφ πνιπκνξθηζκνχ ελφο εθθηλεηή θαη παίξλνπλ ηηκέο κεηαμχ 0 θαη 1. Γηα ηελ αλάιπζε κε κνξηαθνχο δείθηεο ISSR, ε γελεηηθή πνηθηιφηεηα θαηά Nei (He) (Nei 1973) θαη ν πιεξνθνξηαθφο δείθηεο Shannon (I) (Lewontin 1972) ππνινγίζηεθαλ κε ην ινγηζκηθφ POPGEN 1.32 (Yeh θαη Boyle 1997). Ι δηαρσξηζηηθή ηζρχο (Rp) ηνπ θάζε εθθηλεηή είλαη: Rp = IB φπνπ IB (πιεξνθνξηαθή δψλε) παίξλεη ηηκέο: 1 [2 x (0.5 p)], p είλαη ην πνζνζηφ ησλ 21 πνηθηιηψλ πνπ πεξηέρνπλ ηελ δψλε (Prevost θαη Wilkinson 1999). Με ην πξφγξακκα STRUCTURE (Pritchard θ.ά. 2000) ειέγρζεθαλ νη ππνζέζεηο χπαξμεο ππνπιεζπζκψλ. Σν πξφγξακκα απηφ κε βάζε ηηο ζπρλφηεηεο ησλ αιιεινκφξθσλ θάλεη αληηζηνίρεζε ησλ αηφκσλ ζηνπο δηάθνξνπο πιεζπζκνχο. Πξνυπνζέηεη ηελ χπαξμε ηζνξξνπίαο Hardy-Weinberg θαζψο θαη ηζνξξνπία ζχλδεζεο. ηελ παξνχζα κειέηε, ην STRUCTURE ινγηζκηθφ ρξεζηκνπνίεζε κία MCMC δηαδηθαζία 113

114 γηα λα ζπλαγάγεη κε δνκεκέλνπο πιεζπζκνχο, ιακβάλνληαο ππφςε πξνεγνχκελε γεσγξαθηθή ηαμηλφκεζε (Falush θ.ά. 2003). 5.2 Απνηειέζκαηα θαη ζπδήηεζε Πίλαθαο 5.1: Πνηθηιίεο, θσδηθνπνίεζε, ζπρλόηεηα θαη γεσγξαθηθή θαηαγσγή ησλ εμεηαδόκελσλ πνηθηιηώλ θαιιηεξγνύκελεο θεξαζηάο. No Πνηθηιία Κσδηθνπνίεζε πρλόηεηα Γεσγξαθηθή πεξηνρή 1 Proimo Kolindrou PK πάληα Βφξεηα Διιάδα 2 Tragana Edessis TE Γηαδεδνκέλε Βφξεηα Διιάδα 3 Mpakirtzeika MP Γηαδεδνκέλε Βφξεηα Διιάδα 4 Basiliadi BA πάληα Βφξεηα Διιάδα 5 Tragana Edessis-Naousis TEN Γηαδεδνκέλε Βφξεηα Διιάδα 6 Hybrid Tragana Edessis x Unknown HTEU πάληα Βφξεηα Διιάδα 7 Mavro Anastasias MA πάληα Βφξεηα Διιάδα 8 Kokkino Anastasias KA πάληα Βφξεηα Διιάδα 9 Hybrid Tragana Edessis x Germersdorfer HTEG πάληα Βφξεηα Διιάδα 10 Lemonidi LE πάληα Βφξεηα Διιάδα 11 Agiorgitiko Lilantiou AL πάληα Νφηηα Διιάδα 12 Kifisias KI πάληα Νφηηα Διιάδα 13 Proimo Axaias PA πάληα Νφηηα Διιάδα 14 Mavro Proimo Vitalou MPV πάληα Νφηηα Διιάδα 15 Kapsiotika KAP πάληα Νφηηα Διιάδα 16 Napoleon Karamela NK πάληα Νφηηα Διιάδα 17 Petrokeraso Axaias PEA πάληα Νφηηα Διιάδα 18 Fraoula Volou FV Γηαδεδνκέλε Νφηηα Διιάδα 19 Samou SA πάληα Νφηηα Διιάδα 20 Burlat BU Γηαδεδνκέλε Γηεζλήο 21 Van VA Γηαδεδνκέλε Γηεζλήο Μνξηαθόο ραξαθηεξηζκόο θαη αμηνιόγεζε ηεο γελεηηθήο πνηθηινκνξθίαο κε δείθηεο βαζηζκέλνπο ζε κηθξνδνξπθόξνπο (SSR/ISSR) Έλα ζχλνιν ελελήληα δχν αιιεινκφξθσλ εληνπίζηεθαλ ζηνπο δεθαπέληε κηθξνδνξπθφξνπο πνπ εθηηκήζεθαλ (Πίλαθαο 5.2). Ο αξηζκφο ησλ αιιεινκφξθσλ θάζε πεξηνρήο ζηηο είθνζη έλα πνηθηιίεο γιπθνχ θεξαζηνχ θπκάλζεθε απφ 3.00 έσο 8.00 κε κέζν φξν 5,80 (3,48 γηα ηνλ πξαγκαηηθφ αξηζκφ ησλ αιιεινκφξθσλ, Ne) γηα ηνπο δεθαπέληε 114

115 κηθξνδνξπθφξνπο πνπ κειεηήζεθαλ. Ο κέζνο αξηζκφο αιιεινκφξθσλ αλά γνληδηαθή ζέζε πνπ πξνζδηνξίδνληαη ζηελ παξνχζα κειέηε είλαη ν κεγαιχηεξνο ζε ζχγθξηζε κε ηνλ αξηζκφ πνπ εληνπίδεηαη ζε άιιεο κειέηεο ηεο θεξαζηάο. Γηα παξάδεηγκα, νη Clarke θαη Tobutt (2003) ηαπηνπνίεζαλ ηνλ γελφηππν απφ δεθαηέζζεξηο πνηθηιίεο θεξαζηάο κε δεθαελλέα δεχγε εθθηλεηψλ SSR θαη αληρλεχζαλε θαηά κέζν φξν 3,3 αιιειφκνξθα αλά ζέζε, ελψ νη Dirlewanger θ.ά. (2002) ηαπηνπνίεζαλ ηνλ γελφηππν απφ είθνζη έλα πνηθηιίεο θεξαζηάο απφ φιν ηνλ θφζκν κε ηξηάληα ηξία δεχγε εθθηλεηψλ SSR θαη πξνζδηφξηζαλ θαηά κέζν φξν 2,80 αιιειφκνξθα αλά γνληδηαθή ζέζε. Η αλακελφκελε εηεξνδπγσηία ζηελ παξνχζα κειέηε θπκάλζεθε απφ 0,337 έσο 0,804, κε κέζν φξν 0,683. ηηο ηξεηο πξνεγνχκελεο κειέηεο ζηελ θεξαζηά, ε αλακελφκελε εηεξνδπγσηία ήηαλ θαηά κέζν φξν 0,600. (Dirlewanger θ.ά. 2002), 0,460 (Clarke θαη Tobutt 2003) θαη 0,600 (Vaughan θαη Russell 2004). Η παξαηεξνχκελε εηεξνδπγσηία θπκάλζεθε 0,238 έσο 0,952 (κέζε ηηκή 0,711). Οη αλακελφκελεο θαη παξαηεξνχκελεο ηηκέο εηεξνδπγσηίαο ζπγθξίζεθαλ ρξεζηκνπνηψληαο ηνλ δείθηε ζηαζεξνπνίεζεο (F), ν νπνίνο θπκάλζεθε κεηαμχ -0,386 θαη 0,363 θαη είρε κέζν φξν πάλσ απφ φιεο ηηο γνληδηαθέο ζέζεηο -0,032 (Πίλαθαο 5.2). Η ηηκή ηνπ δείθηε ζηαζεξνπνίεζεο (F) ππνδεηθλχεη έλα ζπλνιηθφ πιεφλαζκα ηεο εηεξνδπγσηίαο ζην πιηθφ πνπ κειεηήζεθε. Οη κέζεο ηηκέο γηα ηελ He (0,680) θαη Ho (0,711) ήηαλ πςειέο θαη πνιχ φκνηεο επεηδή ην απην-αζπκβίβαζην ζην γιπθφ θεξάζη πξνιακβάλεη ηελ απηνγνληκνπνίεζε θαη κεηψλεη ηελ ελδνγακία. Οη ηηκέο PIC θπκάλζεθαλ απφ 0,326 έσο 0,779, κε κέζν φξν 0,643. Η ηηκή PIC (0.643) ηεο παξνχζαο κειέηεο βξίζθεηαη ζε ζπκθσλία κε ηελ ηηκή PIC (0.650) πνπ ππνινγίζηεθε απφ ηνπο Marchese θ.ά. (2007) ζε θαιιηεξγνχκελεο πνηθηιίεο θεξαζηάο. Οη ηηκέο P ID θπκάλζεθαλ απφ 0,111 έσο 0,471, κε κέζν φξν 0,232. χκθσλα κε ηηο ηηκέο ησλ PIC θαη P ID, νη πην πιεξνθνξηαθνί δείθηεο είλαη νη PceGA34 θαη EMPA004 (Πίλαθαο 5.2). Δπηπιένλ, ε MPR ππνινγίζηεθε κε βάζε ηελ πην πηζαλή πηζαλφηεηα νκνδπγσηίαο γηα θάζε γνληδηαθή ζέζε. Η MPR ήηαλ 9,569 x E -12 ζηηο πνηθηιίεο γεγνλφο πνπ ππνδεηθλχεη φηη ε πηζαλφηεηα κηα άιιε άγλσζηε θεξαζηά λα έρεη ηνλ ίδην γελφηππν είλαη πνιχ ρακειή. 115

116 Πίλαθαο 5.2: Γελεηηθή πνηθηιόηεηα κεηαμύ ησλ 21 πνηθηιηώλ θεξαζηάο όπσο ππνινγίζηεθε κε SSR κνξηαθνύο δείθηεο. Γελεηηθή πεξηνρή Οκάδα ζύλδεζεο* Θέζε (cm) Na Ne Ho He F PIC P ID EMPA004 G EMPA005 G EMPA015 G EMPA018 G EMPAS01 G EMPAS02 G EMPAS06 G EMPAS10 G EMPAS11 G EMPAS12 G EMPAS14 G UDP G UDP G UDP G PceGA34 G Μέζνο όξνο Total e -11 *Οι ομάδες σύνδεσης και οι θζσεις στον γενετικό χάρτη ζγιναν σύμφωνα με (Clarke θ.ά. 2009) 116

117 Σν ζχλνιν ησλ δέθα ISSR εθθηλεηψλ έδεημε κνηίβα πνιπζπρλνηήησλ ζε θάζε πνηθηιία (Πίλαθαο 5.3). Απηφ ην ζεη εθθηλεηψλ πνιιαπιαζίαζε ζπλνιηθά ελελήληα έλα αμηφπηζηεο θαη επαλαιήςηκεο δψλεο απφ ην DNA ησλ είθνζη ελφο δνθηκαζζέλησλ πνηθηιηψλ θεξαζηάο. Ο ζπλνιηθφο αξηζκφο ησλ δσλψλ θπκαίλνληαλ απφ ηξία έσο δεθαέμη θαη ν αξηζκφο ησλ πνιπκνξθηθψλ δσλψλ απφ δχν έσο δέθα αλά εθθηλεηή. Ο εθθηλεηήο UBC 821 παξήγαγε ηηο ιηγφηεξεο δψλεο (ηξεηο), ελψ ν εθθηλεηήο UBC 834 παξήγαγε ηνλ κεγαιχηεξν αξηζκφ δσλψλ (δεθαέμη). Ο κέζνο αξηζκφο ησλ δσλψλ αλά εθθηλεηή ήηαλ 9,1. Σν κέγεζνο ησλ δσλψλ θπκαίλνληαλ απφ 530 bp (UBC841 θαη UBC860) έσο 3,1 KB (UBC827). Μεηαμχ ησλ αλαιπζέλησλ πνηθηιηψλ, πελήληα κία (57,95%) απφ ηηο δψλεο ησλ ISSR ήηαλ πνιπκνξθηθέο. Η πνηθηινκνξθία ηεο ζπιινγήο Σξάπεδαο Γελεηηθνχ Τιηθνχ δηεξεπλήζεθε κε ηελ γελεηηθή πνηθηιφηεηα θαηά Nei (GD), θαζψο θαη απφ ηνλ δείθηε Shannon (I). Σα ζηνηρεία γηα ην GD θαη ην I γηα φιεο ηηο είθνζη κία πνηθηιίεο αλαιχζεθαλ ρξεζηκνπνηψληαο δέθα ISSR δείθηεο θαη νη αληίζηνηρεο κέζεο ηηκέο ηνπο βξέζεθαλ απφ 0,369 σο 0,546 (Πίλαθαο 5.3). Η R P παξήρε κηα κηθξή έλδεημε ηεο ηθαλφηεηαο ησλ ISSR εθθηλεηψλ λα εληνπίδνπλ δηάθξηζε κεηαμχ πνηθηιηψλ. Η ηηκή (R P ) ηνπ θάζε εθθηλεηή ππνινγίζηεθε γηα λα θαζνξηζηνχλ νη θαηαιιειφηεξνη εθθηλεηέο γηα ηε δηάθξηζε κεηαμχ ησλ πνηθηιηψλ ηεο θεξαζηάο. Οη R P ησλ δέθα εθθηλεηψλ θπκάλζεθε απφ 1,99 γηα ηνλ εθθηλεηή UBC811 έσο 11,05 γηα ηνλ εθθηλεηή UBC834 (Πίλαθαο 5.3), κε κέζε ηηκή 5,24. Σξεηο απφ ηνπο ISSR εθθηλεηέο (UBC834, UBC891 θαη UBC816) θαηείραλ πςειέο ηηκέο R P (11,05, 6,20 θαη 5,60, αληίζηνηρα) θαη είλαη νη πην απνηειεζκαηηθνί γηα ηελ απνηχπσζε ηεο γελεηηθήο πνηθηιφηεηαο ζηηο είθνζη κία πνηθηιίεο ηεο ζπιινγήο Σξάπεδαο Γελεηηθνχ Τιηθνχ. 117

118 Δηθόλα 5.1 Ζιεθηξνθόξεζε αγαξόδεο 1.5% γηα ηνλ ISSR εθθηλεηή UBC834 ζηηο 21 πνηθηιίεο θεξαζηάο. Σα απνηειέζκαηα απηά παξέρνπλ θαζνδήγεζε γηα ηελ κειινληηθή απνηειεζκαηηθή ρξήζε απηψλ ησλ κνξηαθψλ κεζφδσλ ζηε γελεηηθή αλάιπζε ηεο θεξαζηάο. Η ζπιινγή ησλ εθθηλεηψλ πνπ ρξεζηκνπνηήζεθαλ ζε απηή ηε κειέηε, έδσζαλ έλα επαξθή αξηζκφ πνιιαπιαζηαζζέλησλ πξντφλησλ γηα ηε αλάιπζε ηεο γελεηηθήο πνηθηιφηεηαο. Η κειέηε απηή απνθαιχπηεη ηε κεγάιε ζεκαζία ηεο δηαζθάιηζεο ηεο δηαθνξνπνίεζεο ησλ πνηθηιηψλ θεξαζηάο θαη ηελ εθαξκνγή ηεο γηα ζθνπνχο πηζηνπνίεζεο. Μηα ζχγθξηζε ησλ πηλάθσλ γελεηηθήο νκνηφηεηαο απνθάιπςε φηη νη εθηηκήζεηο πνπ βαζίδνληαη ζε SSRs θαη ISSRs ζρεηίδνληαη ζε κεγάιν βαζκφ, ππνδεηθλχνληαο ζπλάθεηα κεηαμχ απηψλ ησλ πξνζδηνξηζκψλ. 118

119 Πίλαθαο 5.3: Γελεηηθή πνηθηιόηεηα ησλ εμεηαδόκελσλ πνηθηιηώλ θεξαζηάο όπσο ππνινγίζηεθε κε ISSR κνξηαθνύο δείθηεο. Δθθηλεηήο (UBC) Θεξκνθξαζία πβξηδηζκνύ ( o C) Δύξνο κεγέζνπο δώλεο Αλαινγία πνιπκνξθηθώλ δσλώλ Πνζνζηό Πνιπκνξθηζκν ύ (%) Γελεηηθή πνηθηιόηεηα (GD) Γείθηεο Shannon (I) Γηαρσξηζηηθή Ηζρύο (R P) / / / / / / / / / / Μέζνο όξνο / Φπινγελεηηθέο ζπγθξίζεηο ησλ SSR θαη ISSR δεηθηώλ Οη SSR δείθηεο δηέθξηλαλ 12 ειιεληθέο πνηθηιίεο θεξαζηάο κε κνλαδηθφ απνηχπσκα, ελψ 7 πνηθηιίεο (LE-TE, FV-NK-ΠΔΑ θαη PA-ΑΔ) κεηψζεθαλ ζε ηξία κε δηαθξηηά δεχγε ππνδεηθλχνληαο ηπρφλ νκσλπκία (Δηθφλα 5.2a). Σν δελδξφγξακκα εκθάληζε ηηο κνξηαθέο ζρέζεηο αλάκεζα ζηηο 21 εμεηαδφκελεο πνηθηιίεο θεξαζηάο θαη ηηο ρψξηζε ζε δχν θχξηεο νκάδεο θαη δηάθνξεο ππννκάδεο (Α1-4 θαη B5-7; Δηθφλα 5.2). ηελ Οκάδα Α, κπνξνχκε λα δηαθξίλνπκε κε ζαθήλεηα δχν ππννκάδεο: ππννκάδα Α-1 + A-2, κε ηηο πνηθηιίεο, ΒΑ, HTEG, HTEU, TEN θαη Van (VA) σο πνηθηιία κάξηπξα. Οη πνηθηιίεο AL θαη ΚΙ βξέζεθε λα ζπλδένληαη ζηελά θαη νκαδνπνηήζεθαλ (Τπννκάδα Β-6). Η ζηελή γελεηηθή ζρέζε απηψλ ησλ πνηθηιηψλ έρεη επηβεβαησζεί ζε απηή ηε κειέηε, σζηφζν, θακία δελ είλαη θιψλνο ηεο άιιεο κε ηε ζηελή γελεηηθή έλλνηα. Απηέο νη πνηθηιίεο δηαθέξνπλ σο πξνο κία απφ ηηο δεθαπέληε δνθηκαζζέληεο πνιπκνξθηθέο ζέζεηο. 119

120 Γηα ηνπο ISSR δείθηεο, ην δελδξφγξακκα πνπ παξάρζεθε απφ ην UPGMA (Δηθφλα 5.2b) κε βάζε ηνπο Nei θαη Li (1979) δείθηεο νκνηφηεηαο, θαηέηαμε ηηο είθνζη κία πνηθηιίεο γιπθνχ θεξαζηνχ ζε ηξεηο θχξηεο νκάδεο κε δχν ππννκάδεο ζε θάζε θχξηα νκάδα (Α1-2, Β1-2 θαη C1-2; Δηθφλα 5.1c). Μεξηθέο πνηθηιίεο θεξαζηάο πνπ πξνέξρνληαλ απφ ηελ ίδηα γεσγξαθηθή ζέζε βξέζεθαλ λα νκαδνπνηνχληαη ζηελά. Γχν πνηθηιίεο, νη επνλνκαδφκελεο MPV θαη SA, παξνπζίαζαλ ηελ πην ζηελή ζρέζε. Σα δχν πβξίδηα, HTEG θαη HTE πνπ θαηαηάζζνληαη ζηελ νκάδα Γ απνηεινχλ κηα μερσξηζηή ππννκάδα (C6) θαη εκθαλίδνπλ ηελ πςειφηεξε γελεηηθή απφζηαζε ζε ζχγθξηζε κε ηηο ππφινηπεο πνηθηιίεο. Υξεζηκνπνηψληαο ηελ ηερλνινγία ησλ δεηθηψλ ISSR (Δηθφλα 5.1) δηαθξίζεθαλ φιεο νη πνηθηιίεο, ζε αληίζεζε κε ηελ πξνεγνχκελε εθαξκνδφκελε κέζνδν ησλ SSR δεηθηψλ. Δπνκέλσο, ε ρξήζε ησλ ISSRs κπνξεί λα αληαλαθιά ζε κεγαιχηεξν βαζκφ ηε γελεηηθή αλάιπζε απφ ηε κέζνδν ησλ SSR, φπσο θάλεθε ζηελ πεξίπησζε ησλ πνηθηιηψλ Λεκνλίδε (LE) θαη Σξαγαλά Δδέζζεο (ΣΔ). Απηέο νη δχν πνηθηιίεο ήηαλ δπζδηάθξηηεο απφ ηνπο SSR δείθηεο, ελψ ε εθαξκνγή ησλ ISSR δεηθηψλ έδεημε φηη απηέο νη πνηθηιίεο, αλ θαη έρνπλ πνιχ ζηελή ζρέζε, είλαη πξάγκαηη δηαθνξεηηθέο. Παξφκνηα απνηειέζκαηα έρνπλ επίζεο βξεζεί γηα ηηο FV, NK, PEA θαζψο θαη γηα ηηο MPV θαη SA πνηθηιίεο γιπθνχ θεξαζηνχ. Οη ISSR δείθηεο, πνπ είραλ αξρηθά ζρεδηαζηεί γηα ηε δηάθξηζε αλάκεζα ζε ζηελά ζπλδεφκελεο πνηθηιίεο θπηψλ (Wolfe 2005), έρνπλ απνδεηρζεί απνηειεζκαηηθνί ζηε κειέηε καο γηα ηα γιπθά θεξάζηα γηα ηελ δηάθξηζε ζηελά ζπλδεδεκέλσλ πνηθηιηψλ πνπ ζε δηαθνξεηηθή πεξίπησζε παξακέλνπλ δπζδηάθξηηεο κε ηε ζπκβαηηθή κέζνδν ησλ SSR. Μηα άιιε θαιιηέξγεηα κε ρακειφ επίπεδν παξαιιαθηηθφηεηαο είλαη ην ιεκφλη (Citrus limon), φπνπ λέεο πνηθηιίεο πξνέξρνληαη θπξίσο απφ ζσκαηηθέο κεηαιιάμεηο θαη ππξεληθή παξαιιαθηηθφηεηα. Αλ θαη έρνπλ πςειφ βαζκφ εηεξνδπγσηίαο, ε πιεηνςεθία ησλ 57 πνηθηιηψλ ιεκνληνχ παξέκεηλε δπζδηάθξηηε, φηαλ αλαιχζεθε κε κηθξνδνξπθφξνπο (SSR), ελψ θαιχηεξε δηάθξηζε επηηεχρζεθε κε ηελ αλάιπζε ηνπ ίδηνπ θπηηθνχ πιηθνχ κε ISSRs (Gulsen θαη Roose 2001). Απφ ηε ζπλδπαζκέλε αλάιπζε ησλ δεδνκέλσλ, θαηαζθεπάζακε έλα δελδξφγξακκα, πξνθεηκέλνπ λα αμηνινγεζεί ε δηαθξηηηθή ηθαλφηεηα θαη ησλ δχν ηερληθψλ (Δηθφλα 5.2c). Σν δελδξφγξακκα πνπ παξάρζεθε απφ ηελ ζπλδπαζκέλε αλάιπζε δεδνκέλσλ (SSR/ISSR) παξνπζίαζε πςειφηεξε αλάιπζε γηα ηνλ δηαρσξηζκφ ησλ δηαθνξεηηθψλ πνηθηιηψλ θεξαζηάο. ιεο νη πνηθηιίεο θεξαζηάο δηαθξίζεθαλ ηθαλνπνηεηηθά θαη νκαδνπνηήζεθαλ ζε ηξεηο θχξηεο νκάδεο, νη νπνίεο ρσξίζηεθαλ ζε κηθξφηεξεο 120

121 ππννκάδεο (Δηθφλα 5.2c). Η νκάδα Α απνηειείηαη απφ πνηθηιίεο απφ ηε Νφηηα Διιάδα, αιιά θαη ηελ εκπνξηθή πνηθηιία Van (VA). Η νκάδα Β απνηειείηαη απφ ηξεηο ππννκάδεο. ηελ ππννκάδα Β6 είλαη νκαδνπνηεκέλα ηα Αγησξγίηηθα Ληιαληίνπ (AL) θαη Κεθηζίαο (ΚΙ), ηα νπνία είλαη άγλσζηεο γελεαινγίαο, γεγνλφο πνπ ππνδειψλεη κηα πηζαλή γελεηηθή ζπγγέλεηα κεηαμχ ηνπο. Έλα άιιν ελδηαθέξνλ ραξαθηεξηζηηθφ είλαη φηη νη πνηθηιίεο Λεκνλίδε (LE) θαη Σξαγαλά Δδέζζεο (ΣΔ), νη νπνίεο ήηαλ φκνηεο ζηελ SSR αλάιπζε θαη ρσξίδνληαλ νξηαθά απφ ηνπο δείθηεο ISSR, δηαθξίλνληαλ μεθάζαξα ζηελ ζπλδπαζκέλε αλάιπζε. Σέινο, ε νκάδα C απνηειείηαη απφ δχν ππννκάδεο (C7, 8). Αμίδεη λα ζεκεησζεί φηη, ηα πβξίδηα HTEG θαη HTEU είλαη νκαδνπνηεκέλα καδί κε θνηλφ γνλέα ηνλ TEN. Γηα ηηο είθνζη κία πνηθηιίεο θεξαζηάο πνπ αλαιχζεθαλ ζηελ παξνχζα κειέηε, ππάξρεη κηα ζεσξεηηθή πξνζδνθία γηα ηελ νκαδνπνίεζε ησλ πνηθηιηψλ ζε δελδξφγξακκα, κε βάζε ηελ βνηαληθή ηνπο γελεαινγία. Σα δελδξνγξάκκαηα γελεηηθήο νκνηφηεηαο έρνπλ θαηαζθεπαζηεί είηε κε ηα απνηειέζκαηα πνπ ιακβάλνληαη απφ SSR ή ISSR αλάιπζε θαζψο θαη απφ ηνλ ζπλδπαζκφ ηνπο. Η θαιχηεξε ζπζρέηηζε κε ηηο ζεσξεηηθέο πξνζδνθίεο θαίλεηαη θαζαξά απφ ην δελδξφγξακκα πνπ έρεη αλαπηπρζεί κε βάζε ηα απνηειέζκαηα ησλ ISSR δεηθηψλ. Η θαιχηεξε δηαθξηηηθή ηθαλφηεηα ηνπ δελδξνγξάκκαηνο πνπ θαηαζθεπάζηεθε κε βάζε ηνπο ISSR δείθηεο, κπνξεί λα εμεγεζεί απφ ηε ζχγθξηζε ησλ αξρψλ ηεο θάζε κεζφδνπ. Γηα παξάδεηγκα, θάζε ηκήκα ISSR αληηπξνζσπεχεη κία κεκνλσκέλε γνληδηαθή ζέζε κε δχν πηζαλά αιιειφκνξθα (0-απνπζία, 1-παξνπζία). ηε βάζε απηή, ηα απνηειέζκαηα πνπ παξνπζηάδνληαη ζηελ παξνχζα κειέηε αληηζηνηρνχλ ζε ζπλνιηθά ελελήληα έλα γνληδηαθέο ζέζεηο. Η ίδηα εξκελεία ρξεζηκνπνηήζεθε γηα ηελ αμηνιφγεζε ησλ απνηειεζκάησλ ηεο SSR αλάιπζεο. Αλ θαη αμηνινγήζεθαλ ελελήληα δχν ηκήκαηα SSR, ζηελ πξαγκαηηθφηεηα αληηπξνζψπεπαλ κφλν δεθαπέληε γνληδηαθέο ζέζεηο. Μεηά ηελ αλάγλσζε ησλ παξαπάλσ, ζα πξέπεη λα γίλεη θαηαλνεηφ φηη δελ ππάξρεη κία ηδαληθή κέζνδνο γηα φιεο ηηο εξσηήζεηο. Γηα ηηο κειέηεο εχξεζεο ηεο ηαπηφηεηαο κηαο πνηθηιίαο, νη SSRs κνξηαθνί δείθηεο έρνπλ έλα ζεκαληηθφ πιενλέθηεκα ζε ζρέζε κε ηνπο ISSRs δεδνκέλνπ φηη είλαη απαιιαγκέλα απφ ηελ ρακειή δηαθξηηηθή ηθαλφηεηα ηεο αγαξφδεο. Απφ ηελ άιιε πιεπξά, νη ISSRs δείθηεο εληνπίδνπλ έλα κεγαιχηεξν αξηζκφ γνληδηαθψλ ζέζεσλ. ε απηέο ηηο ζπλζήθεο νη ISSR δείθηεο, αθφκε θαη κε ηνπο πεξηνξηζκνχο πνπ έρνπλ είλαη θαιχηεξα πξνζαξκνζκέλνη γηα ηελ αλίρλεπζε ησλ ζπγθεθξηκέλσλ μερσξηζηψλ ηχπσλ. Η θπξίαξρε άπνςε θαηά ηε δηάξθεηα ησλ ηειεπηαίσλ εηψλ είλαη φηη νη κηθξνδνξπθνξηθέο πξνζεγγίζεηο πνπ βαζίδνληαη, είηε ζε SSRs ή ζε 121

122 ISSRs, είλαη ζπκπιεξσκαηηθέο κέζνδνη γηα λα πξνζθέξνπλ κηα νινθιεξσκέλε θάιπςε ηνπ γνληδηψκαηνο. Ωο εθ ηνχηνπ, ζηελ γελεαινγηθή αλάιπζε, ε ζπλδπαζκέλε αλάιπζε κε SSR θαη ISSR κνξηαθνχο δείθηεο βξέζεθε λα είλαη ην πην αθξηβέο ζχζηεκα γηα ηελ ηαπηνπνίεζε ησλ πνηθηιηψλ απφ ηελ ίδηα ηε γελεηηθή δεμακελή. Δηθόλα 5.2: Γελδξνγξάκκαηα ησλ είθνζη έλα πνηθηιηώλ θαιιηεξγνύκελεο θεξαζηάο βαζηδκέλα ζε UPGMA αλάιπζε ησλ SSR (επάλσ; a), ISSR (θέληξν; b) θαη SSR/ISSR (θάησ; c) πνιπκνξθηζκώλ. Οη πνηθηιίεο νκαδνπνηνύληαη ζε νκάδεο (A, B θαη C) θαη ζε ππννκάδεο Γελεηηθή δνκή ηεο ζπιινγήο Τξάπεδαο Γελεηηθνύ Υιηθνύ κε SSR θαη ISSR δείθηεο Η αλάιπζε ηεο γελεηηθήο δνκήο κε SSRs (Δηθφλα 5.3) έδεημε φηη γηα Κ = 2 νη πνηθηιίεο θεξαζηάο απφ ηε Βφξεηα Διιάδα νκαδνπνηήζεθαλ κε ηηο δχν δηεζλείο πνηθηιίεο πνπ πεξηιακβάλνληαη ζηελ παξνχζα κειέηε θαη κε ηέζζεξηο πνηθηιίεο απφ ηε Νφηηα Διιάδα (AL, KI, MPV θαη KAP), ελψ νη ππφινηπεο πέληε απφ ηε Νφηηα Διιάδα ήηαλ νκαδνπνηεκέλεο ρσξηζηά. Γελ νκαδνπνηήζεθαλ φιεο νη πνηθηιίεο θεξαζηάο αλάινγα κε ηε γεσγξαθηθή ηνπο πξνέιεπζε. Κάηη πνπ αλακελφηαλ θαζψο ε δηάδνζε ησλ πνηθηιηψλ ζην ρψξν είλαη αλζξσπνγελήο δηαδηθαζία θαη φρη εμειηθηηθή, ζπλεπψο δελ ζπλδέεηαη 122

123 απαξαίηεηα κε ηελ γεσγξαθία νχηε ζε κηθξνθιίκαθα (Ganopoulos θ.ά. 2010) ζηελ θεξαζηά νχηε ζε καθξνθιίκαθα (Roubos θ.ά.) ζηελ ειηά. ην Κ = 3, ε νκάδα ηεο Βφξεηαο Διιάδαο δηαρσξίζηεθε απφ ηηο πνηθηιίεο θεξαζηάο ηεο Νφηηαο Διιάδαο. Η πνηθηιία Burlat ίζσο έρεη κηα νκνηφηεηα ζηελ πξνέιεπζε ηεο κε ηηο δχν πνηθηιίεο απφ ηε Νφηηα Διιάδα. ε πςειφηεξεο ηηκέο Κ, νη λέεο νκάδεο απνηεινχληαλ απφ άηνκα πνπ αλήθνπλ ζε δηαθνξεηηθέο νκάδεο, γεγνλφο πνπ θαζηζηά δχζθνιν λα πξνζδηνξηζηεί ην ππνθείκελν θξηηήξην θαηάηαμεο πνπ ηέζεθε εθ ησλ πξνηέξσλ. Δηθόλα 5.3: Δθηηκώκελε γεσγξαθηθή δνκηθή νκαδνπνίεζε γηα ηηο είθνζη έλα πνηθηιίεο θεξαζηάο κε SSR θαη ISSR κνξηαθνύο δείθηεο. Κάζε άηνκν παξνπζηάδεηαη κε κία θάζεηε ρξσκαηηθή γξακκή ε νπνία δηαηξείηαη ζε ηκήκαηα Κ πνπ αληηπξνζσπεύνπλ ην πνζνζηό ζπκκεηνρήο ηνπ θάζε αηόκνπ ζε Κ νκάδεο. Σα απνηειέζκαηα ηεο αλάιπζεο ηεο γελεηηθήο δνκήο κε ISSR δείθηεο παξνπζηάδνληαη ζηελ Δηθφλα 5.3. Γηα ηηκή Κ = 2 πνηθηιίεο ήηαλ νκαδνπνηεκέλεο παξφκνηα κε ηελ αλάιπζε ηεο δνκήο κε SSR δείθηεο, κε ηηο πνηθηιίεο ηεο Βφξεηαο Διιάδαο πνπ είλαη ζηελ ίδηα νκάδα κε ηηο δχν Γηεζλήο πνηθηιίεο Van θαη Burlat. Γηα ηηκή Κ = 3, νη πνηθηιίεο ηεο λφηηαο Διιάδαο δηαθνξνπνηήζεθαλ ζε έλα λέν πιεζπζκφ, ζε ζπλδπαζκφ κε κηα δηεζλή πνηθηιία ( Van ). Με ηνπο ISSR δείθηεο, ν βαζκφο ηεο ζπζρέηηζεο κε ηηο πνηθηιίεο ηεο λφηηαο Διιάδαο είλαη πξνθαλήο. Μφλν έλα κέξνο απφ ηηο πνηθηιίεο νκαδνπνηήζεθαλ μεθάζαξα αλάινγα κε ηε γεσγξαθηθή πξνέιεπζε, ελψ νη ππφινηπεο 123

124 παξνπζίαζαλ κεξηθή ή αθφκα θαη θπξίαξρε ζπκκεηνρή ησλ πιεζπζκψλ ηνπο θαη ζε άιιεο πεξηνρέο, γηα παξάδεηγκα, ε Van. Σν εχξεκα απηφ πηζαλψο νθείιεηαη ζηηο αλζξψπηλεο επηδξάζεηο φπνπ πνιιέο θνξέο κεηαθηλήζεθαλ πνηθηιίεο ζε δηαθνξεηηθέο ηνπνζεζίεο θαηά ηε δηάξθεηα ησλ πξνεγνχκελσλ ρηιηάδσλ εηψλ θαιιηέξγεηαο ηεο θεξαζηάο. Σα απνηειέζκαηα απηά δείρλνπλ φηη νη παξαδνζηαθέο πνηθηιίεο ηεο Διιάδαο, πνπ αληηζηνηρνχλ ζε πξνθαζνξηζκέλεο πεξηθεξεηαθέο νκάδεο ελ κέξεη αλήθνπλ ζε γελεηηθά δηαθξηηέο νκάδεο. Η κεζνδνινγία ηεο αλάιπζεο ηεο γελεηηθήο δνκήο έρεη ρξεζηκνπνηεζεί πξνεγνπκέλσο ζε άγξηεο θαη θαιιηεξγνχκελεο πνηθηιίεο ειηάο ηεο πεξηνρήο ηεο Μεζνγείνπ απφ ηνπο (Baldoni θ.ά. 2006), πξνθεηκέλνπ λα δηεξεπλήζεη ηε γελεηηθή δνκή ηνπο. Δίλαη ελδηαθέξνλ λα ζεκεησζεί φηη νη πεξηζζφηεξεο απφ ηηο πνηθηιίεο ηεο βφξεηαο Διιάδαο έρνπλ αλαιπζεί κε ηνλ ίδην ηξφπν ζηηο αλαιχζεηο δνκήο ηφζν κε SSR φζν θαη κε ISSR δείθηεο. 5.3 πκπεξάζκαηα Η ζεκαληηθφηεηα ηεο ρξεζηκνπνίεζεο DNA κνξηαθψλ δεηθηψλ ζηε δηαρείξηζε ηεο ζπιινγήο ηξάπεδαο γελεηηθνχ πιηθνχ ηεο θεξαζηάο επηβεβαηψζεθε ζηελ παξνχζα κειέηε, βειηηψλνληαο ηελ δηαηήξεζε θαη δηαρείξηζε ησλ ζρεηηθψλ γελεηηθψλ πφξσλ. Σα δεδνκέλα πνπ ιήθζεθαλ απφ ηελ γελεηηθή πνηθηιφηεηα ήηαλ ρξήζηκα γηα ηελ αλαγλψξηζε ησλ δηπιαζηαζκέλσλ πνηθηιηψλ, ηελ επηβεβαίσζε ησλ ζπλσλχκσλ θαη νκσλχκσλ θαη ηνλ θαζνξηζκφ ησλ εζθαικέλα πξνζδηνξηζκέλσλ πνηθηιηψλ. Οη SSR θαη ISSR κνξηαθνί δείθηεο κπνξνχλ λα ρξεζηκνπνηεζνχλ πξνθεηκέλνπ λα θαζνξηζηνχλ ηα θελά ζηηο δεμακελέο γελεηηθνχ πιηθνχ θαη λα νξγαλσζνχλ νη κειινληηθέο πξνζζήθεο. 5.4 Βηβιηνγξαθία Arnau, G., Lallemand, J. and Bourgoin, M Fast and reliable strawberry cultivar identification using inter simple sequence repeat (ISSR) amplification. Euphytica 129(1): Baldoni, L., Tosti, N., Ricciolini, C., Belaj, A., Arcioni, S., Pannelli, G., Germana, M. A., Mulas, M. and Porceddu, A Genetic structure of wild and cultivated olives in the central Mediterranean basin. Annals of Botany 98(5): Botstein, D., White, R. L., Skolnick, M. and Davis, R. W Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32(3): Clarke, J. B., Sargent, D. J., Boskovic, R. I., Belaj, A. and Tobutt, K. R A cherry map from the inter-specific cross Prunus avium 'Napoleon' x P. nipponica 124

125 based on microsatellite, gene-specific and isoenzyme markers. Tree Genetics & Genomes 5(1): Clarke, J. B. and Tobutt, K. R Development and characterization of polymorphic microsatellites from Prunus avium 'Napoleon'. Molecular Ecology Notes 3(4): Dirlewanger, E., Cosson, P., Tavaud, M., Aranzana, J., Poizat, C., Zanetto, A., Arus, P. and Laigret, F Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). Theor Appl Genet 105(1): Falush, D., Stephens, M. and Pritchard, J. K Inference of Population Structure Using Multilocus Genotype Data: Linked Loci and Correlated Allele Frequencies. Genetics 164(4): Ganopoulos, I. V., Avramidou, E., Fasoula, D. A., Diamantidis, G. and Aravanopoulos, F. A Assessing inter- and intra-cultivar variation in Greek Prunus avium by SSR markers. Plant Genetic Resources-Characterization and Utilization 8(3): Gerlach, H. K. and Stosser, R Patterns of random amplified polymorphic DNAs for sweet cherry (Prunus avium L.) cultivar identification. Journal of Applied Botany-Angewandte Botanik 71(5-6): Goulao, L. and Oliveira, C. M Molecular characterisation of cultivars of apple (Malus x domestica Borkh.) using microsatellite (SSR and ISSR) markers. Euphytica 122(1): Gulsen, O. and Roose, M. L Lemons: diversity and relationships with selected Citrus genotypes as measured with nuclear genome markers. Journal of the American Society for Horticultural Science 126(3): Hedrick, U. P The cherries of New York. J B Lyon, Albany, NY. IPGRI Cherry descriptors. International Plant Genetic Resources Institute, Rome, Italy,33 pp. Joshi, S. P., Gupta, V. S., Aggarwal, R. K., Ranjekar, P. K. and Brar, D. S Genetic diversity and phylogenetic relationship as revealed by inter simple sequence repeat (ISSR) polymorphism in the genus Oryza. Theoretical and Applied Genetics 100(8): Kar, P. K., Srivastava, P. P., Awasthi, A. K. and Urs, S. R Genetic variability and association of ISSR markers with some biochemical traits in mulberry (Morus spp.) genetic resources available in India. Tree Genetics & Genomes 4(1): Koukourojiannis, V Οη ηάζεηο ζηελ παξαγσγή θαη εκπνξία ησλ θεξαζηψλ. Γεσξγία-Κηελνηξνθία (Greek) 2: Marchese, A., Tobutt, K. R., Raimondo, A., Motisi, A., Boskovic, R. I., Clarke, J. and Caruso, T Morphological characteristics, microsatellite fingerprinting and determination of incompatibility genotypes of Sicilian sweet cherry cultivars. Journal of Horticultural Science & Biotechnology 82(1): Marinoni, D., Akkak, A., Bounous, G., Edwards, K. J. and Botta, R Development and characterization of microsatellite markers in Castanea sativa (Mill.). Molecular Breeding 11(2): Marshall, R. E Cherries and cherry products. In: Economic crops, Vol. 5., Interscience, New York. Nei, M Analysis of Gene Diversity in Subdivided Populations. Proceedings of the National Academy of Sciences 70(No 12):

126 Paetkau, D., Calvert, W., Stirling, I. and Strobeck, C Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology 4(3): Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S. and Rafalski, A The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2(3): Prevost, A. and Wilkinson, M. J A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theoretical and Applied Genetics 98(1): Pritchard, J., Stephens, M. and Donnelly, P Inference of population structure using multilocus genotype data. Genetics 155(2): Roubos, K., Moustakas, M. and Aravanopoulos, F. A. Molecular identification of Greek olive (Olea europaea) cultivars based on microsatellite loci. Genet Mol Res 9: Schueler, S., Tusch, A., Schuster, M. and Ziegenhagen, B Characterization of microsatellites in wild and sweet cherry (Prunus avium L.)--markers for individual identification and reproductive processes. Genome 46(1): Struss, D., Ahmad, R., Southwick, S. M. and Boritzki, M Analysis of sweet cherry (Prunus avium L.) cultivars using SSR and AFLP markers. Journal of the American Society for Horticultural Science 128(6): Struss, D., Boritzki, M., Karle, R. and Iezzoni, A. F Microsatellite markers differentiate eight Giessen cherry rootstocks. Hortscience 37(1): UPOV Guidelines for the conduct of test for dis- tintness, homogeinity and stability of the cherry. International Union for the Protection of New Varieties of Plants, Genova, Italy.15 pp. Vaughan, S. P. and Russell, K Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 4(3): Webster, A. D The Taxonomic classification of sweet and sour cherries and a brief history of their cultivation. Cherries (Edited by Webster AD and NE Looney) Cab International, Wallingford OX 10 8DE, UK: Wolfe, A. D ISSR techniques for evolutionary biology. Pages Molecular Evolution: Producing the Biochemical Data, Part B. Wunsch, A. and Hormaza, J. I Molecular characterisation of sweet cherry (Prunus avium L.) genotypes using peach [Prunus persica (L.) Batsch] SSR sequences. Heredity 89(1): Wunsch, A. and Hormaza, J. I Cloning and characterization of genomic DNA sequences of four self-incompatibility alleles in sweet cherry (Prunus avium L.). Theor Appl Genet 108(2): Yeh, F., Boyle, T., Rongcai, Y., Ye, Z. and Xian, J Popgene version Microsoft window-based Freeware for population Genetic Analysis. 126

127 Κεθάιαην 6: Πξνζδηνξηζκόο ησλ απηναζπκβίβαζησλ γελνηύπσλ ζε 21 θαιιηεξγνύκελεο πνηθηιίεο θεξαζηάο ζηελ Διιάδα θαη νη επηπηώζεηο ζηελ θαιιηέξγεηα ηνπ θεξαζεώλα 6.1 Δηζαγσγή Πξνθεηκέλνπ λα δεκηνπξγεζεί κηα απνηειεζκαηηθή θαη πςειήο απφδνζεο θαιιηέξγεηα είλαη ζεκαληηθφ λα γλσξίδνπκε ηηο ζρέζεηο ζπκβαηφηεηαο ηνπ επηιεγκέλνπ γελεηηθνχ πιηθνχ (π.ρ επηθνληαζηήο θαη πνηθηιία). Μνινλφηη, ηα βηνινγηθά ραξαθηεξηζηηθά φπσο ν ξπζκφο αλάπηπμεο ηνπ γπξενζσιήλα θαη ε απνδνηηθφηεηα ηεο επηθνλίαζεο κπνξνχλ λα ρξεζηκνπνηεζνχλ γηα ηνλ θαζνξηζκφ ησλ νκάδσλ αζπκβαηφηεηαο θαη ησλ S- γελνηχπσλ, ε εμάξηεζή ηνπο απφ ην πεξηβάιινλ θαη ηηο θαιιηεξγεηηθέο ζπλζήθεο κπνξεί λα νδεγήζεη ζε ςεπδή ή κπεξδεκέλα απνηειέζκαηα. Δπηπιένλ, απηέο νη ζπκβαηηθέο κέζνδνη γηα ηελ εχξεζε ησλ S-γελνηχπσλ είλαη ρξνλνβφξεο απαηηψληαο πνιιά έηε κέρξη ην θπηφ λα θηάζεη ζηελ ειηθία αλζνθνξίαο. Απηά ηα εκπφδηα μεπεξάζηεθαλ κε ηελ αλάπηπμε ησλ λέσλ πξνζεγγίζεσλ ζπκπεξηιακβαλνκέλσλ ησλ πνιπκνξθηζκψλ ησλ πξσηετλψλ θαη ησλ αιιεινπρηψλ ηνπ DNA. Απηέο νη κέζνδνη είλαη γξήγνξεο, θζελέο, θαη κπνξνχλ λα εθαξκνζηνχλ αλεμάξηεηα απφ ην ζηάδην αλάπηπμεο ηνπ θπηνχ (Yamane θαη Tao 2009). Γηα παξάδεηγκα ε θισλνπνίεζε θαη ν ραξαθηεξηζκφο ηεο αιιεινπρίαο ησλ S-Rnαζων γνληδίσλ ζηελ θαιιηεξγνχκελε θεξαζηά (Tao θ.ά. 1999a; Tao θ.ά. 1999b) επέηξεςε ηελ αλάπηπμε κεζφδσλ πνπ βαζίδνληαη ζηελ PCR γηα ηελ γελνηχπηζε ησλ S- αιιεινκφξθσλ ζηελ θεξαζηά. Οη Tao θ.ά. (1999c), αλέπηπμαλ επίζεο κία κέζνδν γελνηχπεζεο ησλ S- αιιεινκφξθσλ πνπ βαζίδεηαη ζηε ρξήζε δχν δεπγψλ εθθηλεηψλ πνπ έρνπλ ζρεδηαζηεί πάλσ ζηηο ζπληεξεκέλεο πεξηνρέο ηεο αιιεινπρίαο ησλ S-Rnαζων γνληδίσλ ζηελ θαιιηεξγνχκελε θεξαζηά. Οη αιιεινπρίεο ησλ S-RNase γνληδίσλ έρνπλ δχν ηληξφληα πνηθίινπ κήθνπο γηα θάζε S-αιιειφκνξθν. πλεπψο, ε PCR ρξεζηκνπνηψληαο απηνχο ηνπο εθθηλεηέο επηηξέπεη ηελ δηαθνξνπνίεζε ησλ δηαθφξσλ S-αιιεινκφξθσλ αλάινγα κε ην κέγεζνο ησλ πνιιαπιαζηαζκέλσλ ζξαπζκάησλ. Αξγφηεξα θισλνπνηήζεθαλ θαη άιια γνλίδηα S-RNάζες θαη αλαπηχρζεθαλ θαη άιιεο κέζνδνη PCR βαζηδφκελεο ζε εθθηλεηέο πνπ δεκηνπξγήζεθαλ πάλσ ζε ζπληεξεκέλεο αιιεινπρίεο (Wiersma θ.ά. 2001) ή εθθηλεηέο εμεηδηθεπκέλνπο γηα ζπγθεθξηκέλα αιιειφκνξθα (Sonneveld θ.ά. 2001; 127

128 Sonneveld θ.ά. 2006; Sonneveld θ.ά. 2003) ή αθφκα θαη PCR αθνινπζνχκελε απφ RFLP αλάιπζε (Yamane θ.ά. 2000). Σα RFLP πξνθίι έρνπλ επίζεο ρξεζηκνπνηεζεί γηα λα εληνπίζνπλ αιιειφκνξθα απηναζπκβίβαζηνπ ζε δηαθνξεηηθνχο γελνηχπνπο θεξαζηάο (Hauck θ.ά. 2002). Σελ ηαπηνπνίεζε ηνπ S-αιιειφκνξθνπ ηεο γχξεο (SFB) (Yamane θ.ά. 2003), αθνινχζεζε ε θισλνπνίεζε θαη ν ραξαθηεξηζκφο 12 SFB αιιειφκνξθσλ ζηελ θεξαζηά (Vaughan θ.ά. 2006; Yamane θ.ά. 2003). Η γλψζε ησλ αιιεινπρηψλ θαη ησλ δνκψλ απηψλ ησλ αιιεινκφξθσλ επέηξεςε ηελ αλάπηπμε λέσλ κεζφδσλ PCRγελνηχπεζεο πνπ βαζίδνληαη ζε ζεη εθθηλεηψλ εμεηδηθεπκέλσλ γηα ζπγθεθξηκέλα αιιειφκνξθα (Ikeda θ.ά. 2005), πνπ δεκηνπξγήζεθαλ ζε ζπληεξεκέλεο πεξηνρέο ηεο αιιεινπρίαο θαη δηαθξίλνπλ ηα SFB αιιειφκνξθα ζχκθσλα κε ηνπο πνιπκνξθηζκνχο ζε κέγεζνο (bp) (Vaughan θ.ά. 2006), θαζψο θαη ηελ αλάπηπμε ηεο dot-blot αλάιπζεο ρξεζηκνπνηψληαο ηνπο πνιπκνξθηζκνχο ηεο SFB αιιεινπρίαο (Kitashiba θ.ά. 2008). Η εηζαγσγή ησλ κνξηαθψλ κεζφδσλ ζηελ γελνηχπεζε ησλ S-αιιεινκφξθσλ ζηελ θεξαζηά έρεη νδεγήζεη ζε ηαρεία επηβεβαίσζε ησλ νκάδσλ αζπκβαηφηεηαο ησλ S- αιιεινκφξθσλ πνιιψλ δηαθνξεηηθψλ πνηθηιηψλ φπσο αλαθέξζεθε πξνεγνπκέλσο. Δπίζεο νδήγεζε ζηνλ πξνζδηνξηζκφ ησλ S-γελνηχπσλ ησλ λέσλ πνηθηιηψλ, θαη ζηνλ πξνζδηνξηζκφ ησλ λέσλ πηζαλψλ S-αιιεινκφξθσλ κέζσ ησλ ζπζρεηίζεσλ κε ηα λέα πξντφληα ηεο PCR ( De Cuyper θ.ά. 2005; Sonneveld θ.ά. 2003; Tao θ.ά. 1999c; Zhou θ.ά. 2002). Η γελνηχπεζε ησλ S-αιιεινκφξθσλ έρεη γίλεη επίζεο έλα ρξήζηκν εξγαιείν γηα γελεηηθέο κειέηεο ζε ζπιινγέο γελεηηθνχ πιηθνχ (Gisbert θ.ά. 2008; Marchese θ.ά. 2007; Schuster θ.ά. 2007) θαζψο θαη ζε πιεζπζκνχο αγξηνθεξαζηάο (De Cuyper θ.ά. 2005; Κεθάιαην 4; Jarni θ.ά. 2012; Mariette θ.ά. 2010; Schueler θ.ά. 2006; Szikriszt θ.ά. 2013). Πεξηζζφηεξεο απφ 20 πνηθηιίεο θεξαζηάο θαιιηεξγνχληαη ζηελ Διιάδα (ζχλνιν = εθηάξηα, FAO 2012). Μεξηθέο είλαη κείδνλνο ζεκαζίαο θαη θαιιηεξγνχληαη εθηεηακέλα, ελψ άιιεο θαιιηεξγνχληαη ζπάληα ή ρξεζηκνπνηνχληαη θπξίσο σο δφηεο γχξεο. ιεο απηέο νη πνηθηιίεο δελ αλζίδνπλ ηαπηφρξνλα γη απηφ δηαθξίλνληαη ζε ηξεηο ππννκάδεο αλάινγα κε ηελ πεξίνδν αλζνθνξίαο ηνπο: πξψηκεο άλζεζεο (αλζίδνπλ απφ ηελ ηειεπηαία εβδνκάδα ηνπ Μαξηίνπ έσο ηελ πξψηε εβδνκάδα ηνπ Απξηιίνπ), κέζεο άλζεζεο (αλζίδνπλ ηελ δεχηεξε θαη ηξίηε εβδνκάδα ηνπ Απξηιίνπ), θαη φςηκεο άλζεζεο (αλζίδνπλ ηελ ηειεπηαία εβδνκάδα ηνπ Απξηιίνπ θαη πξψηε εβδνκάδα ηνπ Μαΐνπ). Ωο εθ ηνχηνπ, νη ζπλδπαζκνί ησλ πνηθηιηψλ θαζνξίδνληαη φρη κφλν απφ ηε γελεηηθή ζπκβαηφηεηά ηνπο, αιιά θαη απφ ηελ πεξίνδν αλζνθνξίαο ηνπο. 128

129 Μέρξη ζήκεξα, ρξεζηκνπνηψληαο δηαθνξεηηθέο κεζφδνπο, έρνπλ αλαθεξζεί έσο 16 δηαθνξεηηθά S-αιιειφκνξθα θαη 29 νκάδεο αζπκβαηφηεηαο ζηελ θαιιηεξγνχκελε θεξαζηά (Schuster θ.ά. 2007). Ωζηφζν, ππάξρνπλ πνιχ ιίγα ζηνηρεία ζρεηηθά κε ηε ζχλζεζε ησλ S- αιιεινκφξθσλ ζηηο ειιεληθέο παξαδνζηαθέο πνηθηιίεο θεξαζηάο. ηελ παξνχζα κειέηε, νη S-γελφηππνη απφ 19 πνηθηιίεο θεξαζηάο απφ ηελ ζπιινγή ηεο Διιεληθήο ηξάπεδαο γελεηηθνχ πιηθνχ αλαιχζεθαλ κε PCR ρξεζηκνπνηψληαο κεζφδνπο γελνηχπεζεο κε εθθηλεηέο ζρεδηαζκέλνπο ζε ζπληεξεκέλεο αιιεινπρίεο θαη θαζνξίζηεθαλ ηα επίπεδα ηεο ζπκβαηφηεηαο ζε θάζε κία απφ ηηο ηξεηο νκάδεο άλζεζεο. Γηα ηηο αλαιχζεηο απηέο ρξεζηκνπνηήζεθαλ παιαηέο θαη λέεο πνηθηιίεο, πνπ θαιιηεξγνχληαη ζε ηνπηθφ επίπεδν, θαζψο επίζεο θαη πνηθηιίεο πνπ ρξεζηκνπνηνχληαη γηα βειηησηηθνχο ζθνπνχο. 6.2 Απνηειέζκαηα θαη ζπδήηεζε Καηαλνκή ησλ S-RNase αιιεινκόξθσλ κεηαμύ ησλ ειιεληθώλ παξαδνζηαθώλ θαιιηεξγνύκελσλ πνηθηιηώλ θεξαζηάο Οη 21 γελνηππεκέλεο πνηθηιίεο παξνπζηάδνληαη ζηνλ Πίλαθα 6.1. Γχν πνηθηιίεο εμ απηψλ ε Burlat θαη ε Van είραλ αλαιπζεί θαη ζε άιιεο κειέηεο (Sonneveld θ.ά. 2006; Sonneveld θ.ά. 2003; Wiersma θ.ά. 2001) ελψ νη ππφινηπεο 19 πνηθηιίεο γελνηππήζεθαλ γηα πξψηε θνξά ζε απηή ηε κειέηε. ηελ Δηθφλα 6.1 απεηθνλίδεηαη ε θαηαλνκή ησλ S- RNase αιιεινκφξθσλ κεηαμχ ησλ 21 πνηθηιηψλ θεξαζηάο. Οθηψ απφ ηα S-RNase αιιειφκνξθα ηα S 1, S 2, S 3, S 4, S 5, S 9, S 13 θαη S 30 βξέζεθαλ κεηαμχ ησλ 21 πνηθηιίσλ. Σέζζεξα απφ απηά ηα νθηψ αιιειφκνξθα εκθαλίζηεθαλ εθηελψο ζε ζπρλφηεηεο: S 4 :39%, S 3 :29%, S 9 :10%, θαη S 1 :7%. πλεπψο, απηά ηα ηέζζεξα αιιειφκνξθα αληηζηνηρνχζαλ ζην 85% ησλ απινηχπσλ. Η πςειή ζπρλφηεηα εκθάληζεο κφλν απηψλ ησλ ηεζζάξσλ απιφηππσλ ζπλεπάγεηαη φηη πνιινί απφ απηνχο ηνπο ζπλδπαζκνχο πνηθηιηψλ ήηαλ εκηζπκβαηνί, ή πιήξσο αζπκβίβαζηνη φπσο παξνπζηάδνληαη ζηνλ Πίλαθα

130 Δηθόλα 6.1: πρλόηεηα εκθάληζεο (%) ησλ S-αιιεινκόξθσλ ησλ ειιεληθώλ πνηθηιηώλ (καύξεο ζηήιεο) ζε ζύγθξηζε κε απηέο ησλ Boskovic and Σνbutt (2001) (γθξί ζηήιεο) θαη εθείλεο ησλ De Cuyper et al. (2005) (άζπξεο ζηήιεο). Η ζπρλφηεηα εκθάληζεο ησλ S-αιιεινκφξθσλ ζηηο ειιεληθέο παξαδνζηαθέο πνηθηιίεο ηεο θαιιηεξγνχκελεο θεξαζηάο ζπγθξίζεθε κε απηήλ ησλ S-αιιεινκφξθσλ πνπ βξέζεθαλ ζε 67 πνηθηιίεο απφ ηνπο (Boskovic θαη Tobutt 2001) θαη κε εθείλεο πνπ βξέζεθαλ ζε 65 βειγηθνχο πιεζπζκνχο άγξηαο θεξαζηάο πνπ πξνέξρνληαη απφ δαζηθέο εθηάζεηο απφ ηνπο (De Cuyper θ.ά. 2005). Η απνπζία ησλ αιιεινκφξθσλ S 6 θαη S 7 ζην ειιεληθφ γελεηηθφ πιηθφ είλαη ζεκαληηθή ζπγθξηηηθά κε ηα δεδνκέλα απφ ηνπο Boskovic θαη Tobutt (2001) θαζψο θα