Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ απαντήσεις, 60 λυµένες ασκήσεις πιθανά θέµατα προαγωγικών εξετάσεων, απαντήσεις ερωτήσεων ασκήσεων ασκήσεων-προβληµάτων σχολικού βιβλίου,, καθώς και πίνακα αµινοξέων.) ΘΕΜΑ 1 ο Να βρεθεί ο αριθµός µορίων νερού που αφαιρούνται όταν ενωθούν: α) 50 αµινοξέα, β) 100 αµινοξέα γ) 200 αµινοξέα. Η ένωση δύο αµινοξέων έχει ως εξής: Τα αµινοξέα ενώνονται µε τη δηµιουργία πεπτιδικού δεσµού µε ταυτόχρονη αφαίρεση ενός µορίου νερού, αντίδραση η οποία λέγεται αντίδραση συµπύκνωσης. Έτσι σχηµατίζεται το διπεπτίδιο. Κατόπιν στο διπεπτίδιο ενώνεται τρίτο αµινοξύ κατά τον ίδιο τρόπο, µε ταυτόχρονη αποµάκρυνση και δεύτερου µορίου νερού. Αυτό επαναλαµβάνεται συνέχεια. Έτσι για να δηµιουργηθεί µια πολυπεπτιδική αλυσίδα, που συγκροτείται από x αµινοξέα, θα πρέπει να αφαιρεθούν x-1 µόρια νερού. Άρα θα έχουµε: α) για τη δηµιουργία 50 αµινοξέων αποµάκρυνση 50-1 =49 µορίων νερού. β) για τη δηµιουργία 100 αµινοξέων αποµάκρυνση =99 µορίων νερού. γ) για τη δηµιουργία 200 αµινοξέων αποµάκρυνση =199 µορίων νερού. ΘΕΜΑ 2 ο Πως οργανώνονται τα µόρια της πρωτεϊνης που συγκροτούν µία αλυσίδα πρωτεϊνών; - 1 -

2 Πρωτοταγής δοµή: τα αµινοξέα εµφανίζονται µε ιδιαίτερη σειρά στην πολυπεπτιδική αλυσίδα ( η λεγόµενη αλληλουχία των αµινοξέων ) ευτεροταγής δοµή: εµφανίζεται η πολυπεπτιδική αλυσίδα αναδιπλωµένη εµφανίζοντας πτυχώσεις ή έλικες Τριτοταγής δοµή: εµφανίζεται η πολυπεπτιδική αλυσίδα αναδιπλωµένη χωροταξικά, έχοντας σταθερή µορφή ΘΕΜΑ 3 ο Ποια είναι τα χαρακτηριστικά ταξινόµησης των αµινοξέων και ποιες οι οµάδες που τα συγκροτούν, ανάλογα µε τη µορφή τους; 1. Η ΜΟΡΦΟΛΟΓΙΑ: ιακρίνουµε τις ινώδεις και τις σφαιρικές 2. Η ΣΥΝΘΕΣΗ: ιακρίνουµε τις απλές και τις σύνθετες 3. Η ΛΕΙΤΟΥΡΓΙΑ ιακρίνουµε τις δοµικές και τις λειτουργικές - 2 -

3 ΘΕΜΑ 4 ο Να γράψετε τις διαφορές µεταξύ δυο πρωτεϊνών ΑΠΑΝΤΗΣΗ 1. ιαφορετικό είδος αµινοξέων 2. ιαφορετικός αριθµός αµινοξέων 3. διαφορετική πρωτοταγής, δευτεροταγής, τριτοταγής δοµή 4. διαφορετικός αριθµός πολυπεπτιδικών αλυσίδων 5. διαφορετική λειτουργία 6. διαφορετική σύσταση ΘΕΜΑ 5 ο Πρωτεΐνη φέρει Μ.Β.= και έχει 4 πολυπεπτιδικές αλυσίδες, που είναι ανά δύο ταυτόσηµες. Μια από αυτές έχει Μ.Β.= και το µέσο Μ.Β. των ασύνδετων αµινοξέων=200. Ποιος είναι ο αριθµός των αµινοξέων; ΑΠΑΝΤΗΣΗ : Οι 2 πολυπεπτιδικές, αφού είναι ανά δύο ταυτόσηµες φέρουν µοριακό βάρος Μ.Β.= = Επειδή Μ.Β.πρωτεΐνης=36000, το δεύτερο ζευγάρι ταυτόσηµων αλυσίδων φέρει µοριακό βάρος = 16000, δηλαδή η κάθε αλυσίδα του συγκεκριµένου ζευγαριού φέρει µοριακό βάρος 16000/2 = 8000 Τα αµινοξέα συνδέονται µε πεπτιδικό δεσµό, µε ταυτόχρονη αφαίρεση ενός µορίου νερού και δηµιουργείται διπεπτίδιο το οποίο όταν συνδεθεί µε τρίτο αµινοξύ οµοίως, αποµακρύνεται δεύτερο µόριο νερού. Αρα, για να δηµιουργηθεί µια πολυπεπτιδική αλυσίδα x αµινοξέων, αποµακρύνονται x-1 µόρια νερού. Eποµένως το µοριακό βάρος µιας πολυπεπτιδικής αλυσίδας, x αµινοξέων, µε µέσο µοριακό βάρος y είναι: Μ.Β. = x y - (x-1) 18 Θέσαµε: Μ.Β.: το µοριακό βάρος της αλυσίδας x: o αριθµός των αµινοξέων y: το µέσο µοριακό βάρος των αµινοξέων - 3 -

4 M.B.νερού=18. Αρα: = x (x-1) l = 200x 18x x =9982 x= 9982:82 x 55 και = x' (x-1) = 200x'- 18x' x' = 7982 x' 44 ΘΕΜΑ 6 ο Πρωτεΐνη φέρει Μ.Β.= και έχει 4 πολυπεπτιδικές αλυσίδες, που είναι ανά δύο ταυτόσηµες. Μια από αυτές έχει Μ.Β.= και το µέσο Μ.Β. των αµινοξέων=200. Ποιος είναι ο αριθµός των αµινοξέων; ΑΠΑΝΤΗΣΗ : Οι 2 πολυπεπτιδικές, αφού είναι ανά δύο ταυτόσηµες φέρουν µοριακό βάρος Μ.Β.= = Επειδή Μ.Β.πρωτεΐνης=36000, το δεύτερο ζευγάρι ταυτόσηµων αλυσίδων φέρει µοριακό βάρος = 16000, δηλαδή η κάθε αλυσίδα του συγκεκριµένου ζευγαριού φέρει µοριακό βάρος 16000/2 = 8000 Στην περίπτωση αυτή τα αµινοξέα είναι ενωµένα µε την πολυπεπτιδική αλυσίδα και έχουν αποµακρυνθεί τα µόρια νερού. Eποµένως το µοριακό βάρος µιας πολυπεπτιδικής αλυσίδας, x αµινοξέων, µε µέσο µοριακό βάρος y είναι: Εποµένως: Μ.Β. =x y µε : Μ.Β.: µοριακό βάρος πολυπεπτιδικής αλυσίδας x: ο αριθµός των αµινοξέων - 4 -

5 µ: το µέσο Μ.Β. αµινοξέων [ 10000=x 200 x=10000:200 x=50 x=50 ] και [ 8000=x 200 x =8000:200 x=40 x=40 ] ΘΕΜΑ 7 ο Θεωρούµε 10 διαφορετικά αµινοξέα µέσου µοριακού βάρους 200, που ίσως δε τα χρειαστούµε όλα. Να βρεθεί ο αριθµός των πρωτεϊνών µονής αλυσίδας που έχουν µοριακό βάρος και δηµιουργούνται από τα ανωτέρω αµινοξέα ΑΠΑΝΤΗΣΗ : Αν το αµινοξύ είναι ασύνδετο: Μ.Β. = x y - (x-1) 1) µε Μ.Β.:µοριακό βάρος πολυπεπτιδικής αλυσίδας x: αριθµός αµινοξέων πολυπεπτιδικής αλυσίδας y: µέσο Μ.Β αµινοξέων 18: Μ.Β.νερού. Eποµένως: 30000=x 200-(x-1) =200x-18x =182x 29982=182x x=29982:182 x 165 Άρα οι πρωτεϊνες που σχηµατίζονται είναι: κ x = Αν το αµινοξύ είναι ενωµένο: Μ.Β =x y Εποµένως 30000=x 200 χ=30000:200 x= Άρα οι πρωτεϊνες που σχηµατίζονται είναι: λ ν = 10 ΘΕΜΑ 8 ο Μια πρωτεΐνη διπλής αλυσίδας έχει Μ.Β= Για τις δύο αλυσίδες ισχύει Μ.Β 1 =5 Μ.Β 2. Αν Μ.Βαµινοξέος(1) (1)=200 να βρεθούν: - 5 -

6 α)το πλήθος των αµινοξέων καθεµιάς αλυσίδας β)το πλήθος των µορίων του νερού ΑΠΑΝΤΗΣΗ : α) ηµιουργούµε τις σχέσεις: Μ.Β 1 = 5 Μ.Β 2 ❶ και Μ.Β 1 +Μ.Β 2 =36000 ❷ Άρα έχουµε από τις ❶ και ❷ : 5Μ.Β 2 +Μ.Β 2 = Μ.Β 2 =36000 Μ.Β 2 =6000 και Μ.Β 1 =30000 Αν το αµινοξύ είναι ασύνδετο: Μ.Β. =x y - (x-1) 18 µε Μ.Β.: µοριακό βάρος της πολυπεπτιδικής αλυσίδας x: αριθµός αµινοξέων πολυπεπτιδικής αλυσίδας y: µέσο Μ.Β. αµινοξέων 18: Μ.Β.νερού. Άρα: 6000=x 200-(x-1) =200x-18x =182x x=5982:182 x 33 και 30000= x 200-(x-1) =200x-18x =182x x=29982:182 x 165 Αν το αµινοξύ είναι ενωµένο: Μ.Β =x y Άρα: - 6 -

7 6000=x 200 x=6000:200 x= =x 200 x=30000:200 x=150 β) Αµινοξύ ασύνδετο: x-1=33-1=32 Άρα =196 µόρια νερού x-1=165-1=164 Αµινοξύ ενωµένο: x-1=30-1=29 Άρα =178 µόρια νερού x-1=150-1=149 ΘΕΜΑ 9 ο Πρωτεΐνη φέρει Μ.Β= και είναι διπλής αλυσίδας µε τη πρώτη να έχει Μ.Β=40000 και η δεύτερη Το πλήθος των αλυσίδων είναι 9 και το µέσο µοριακό βάρος των αµινοξέων 100.Να βρεθούν: α) το πλήθος των αλυσίδων β) το πληθος των αµινοξέων καθεµιάς αλυσίδας. γ) το πλήθος των µορίων του νερού. ΑΠΑΝΤΗΣΗ : α) Θεωρούµε α αλυσίδες µε Μ.Β 1 = και β αλυσίδες µε Μ.Β 2 = Εποµένως έχουµε τις σχέσεις: α +β =16 ❶ και 40000α+80000β = ❷ Λύνουµε την πρώτη ως προς α, οπότε: α=9-β και αντικαθιστούµε στη δεύτερη: 40000(9-β)+80000β= β+80000β= β=40000 β=1 Άρα α=9-1=8-7 -

8 β) Αµινοξύ ασύνδετο Μ.Β. =x y - (x-1) 1) µε Μ.Β.: µοριακό βάρος της πολυπεπτιδικής αλυσίδας x: αριθµός αµινοξέων πολυπεπτιδικής αλυσίδας y: µέσο Μ.Β. αµινοξέων 18: Μ.Β.νερού =x 100-(x-1) =100x-18x =82x x=39982:82 x 488 και 80000= x 100-(x-1) =100x-18x =82x x=79982:82 x 975 Αν το αµινοξύ είναι ενωµένο: Μ.Β =x y Άρα: 40000=x 100 x=40000:100 x= =x 100 x=80000:100 x=800 γ) Αµινοξύ ασύνδετο: x-1=488-1=487 και επειδή οι αλυσίδες είναι 8, θα έχουµε: 487 8=3896 ΚΑΙ x-1=975-1=974 και επειδή η αλυσίδα είναι µια, παραµένει 974, δηλαδή συνολικά: =4870 µόρια νερού - 8 -

9 Αµινοξύ ενωµένο: x-1=400-1=399, οπότε 399 8=3192 x-1=800-1=799, οπότε 799 1=799 οπότε =3991µόρια νερού ΘΕΜΑ 10 ο Πως σχηµατίζονται τα νουκλεοτίδια; Τα νουκλεοτίδια σχηµατίζονται από την ένωση µιας πεντόζης, µιας οργανικής αζωτούχας βάσης και ενός µορίου φωσφορικού οξέος. ιακρίνονται σε: Ριβονουκλεοτίδια: περιέχουν την πεντόζη ριβόζη εσοξυριβονουκλεοτίδια ουκλεοτίδια: περιέχουν τη πεντόζη δεσοξυριβόζη Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι οι εξής: DNA: Αδενίνη (Α), θυµίνη (Τ), γουανίνη (G), κυτοσίνη (C) RNA: Αδενίνη (Α), ουρακίλη (U) γουανίνη (G), κυτοσίνη (C) ΘΕΜΑ 11 ο Να βρεθεί ο αριθµός των µορίων νερού που αποµακρύνονται για να δηµιουργηθεί µια πολυνουκλεοτική αλυσίδα, αποτελούµενη από 90 νουκλεοτίδια, αγνοώντας τα µόρια του νερού που χρειάζονται για τον σχηµατισµό των νουκλεοτιδίων Για να ενωθούν δύο νουκλεοτίδια ενός µορίου φωσφορικού οξέος πραγµατοποιείται η αντίδραση συµπύκνωσης. Σε αυτή τα δύο νουκλεοτίδια ενώνονται µε οµοιοπολικό δεσµό και αποµακρύνεται ένα µόριο νερού. ηµιουργείται έτσι ένα - 9 -

10 δινουκλεοτίδιο το οποίο αν ενωθεί µε ένα ακόµη νουκλεοτίδιο αποµακρύνεται και δεύτερο µόριο νερού. Άρα για ένα πολυνουκλεοτίδιο, που συγκροτείται από x νουκλεοτίδια αποµακρύνονται x-1 µόρια νερού. ηλαδή x-1 = 90 1 =89 µόρια νερού. ΘΕΜΑ 12 ο Να γραφούν οι διαφορές µεταξύ του DΝΑ και του RΝΑ To DNA είναι δίκλωνο, δηλαδή συγκροτείται από δύο κλώνους ( δύο πολυνουκλεοτιδικές αλυσίδες ), ενώ το RNA είναι µονόκλωνο Το DNA συγκροτείται από τα δεσοξυριβονουκλεοτίδια, δηλαδή νουκλεοτίδια που περιέχουν τη δεσοξυριβόζη, ενώ το RNA από τα ριβονουκλεοτίδια, δηλαδή νουκλεοτίδια που περιέχουν τη ριβόζη. Το DNA περιέχει τις αζωτούχες βάσεις αδενίνη-θυµίνη, γουανίνη-κυτοσίνη κυτοσίνη, ενώ το RNA τις αζωτούχες βάσεις αδενίνη-ουρακίλη, γουανίνη-κυτοσίνη κυτοσίνη. Το DNA αποτελεί το γενετικό υλικό του κυττάρου και χαρακτηρίζεται ως ο βασικός µεταφορέας των γενετικών πληροφοριών. Επίσης µπορεί να µεταβιβάζει τις γενετικές πληροφορίες από γενιά σε γενιά, να ασκεί έλεγχο στην κυτταρική δραστηριότητα και να συντελεί τα µέγιστα στη διαµόρφωση µεγάλης ποικιλότητας ως αφορά τον τοµέα της γενετικής. Το RNA συναντάται σε τρεις µορφές: 1. Το m-rna που αποτελεί τον µεταφορέα της γενετικής πληροφορίας στα ριβοσώµατα 2. Το t-rna, που αποτελεί τον µεταφορέα των αµινοξέων στα ριβοσώµατα 3. Το r-rna, που αποτελεί τον δοµικό λίθο των ριβοσωµάτων Επίσης το RNA συναντάται ως γενετικό υλικό ορισµένων ιών Το DNA συναντάται στα µιτοχόνδρια, στους χλωροπλάστες και στον πυρήνα, ενώ το RNA εκτός από τα παραπάνω και στο κυτταρόπλασµα

11 ΘΕΜΑ 12 ο Να βρεθεί ο αριθµός των µορίων νερού που πρέπει να αποµακρυνθούν για να δηµιουργηθει το µόριο ενός νουκλεϊκού οξέος που αποτελείται από 150 νουκλεοτίδια; Για να δηµιουργηθεί ένα νουκλεοτίδιο αποµακρύνονται δύο µόρια νερού, από τα οποία το ένα ενώνεται µε το ζάχαρο και το άλλο µε το φωσφορικό οξύ. Αυτό σηµαίνει ότι για να δηµιουργηθούν 120 νουκλεοτίδια αποµακρύνθηκαν 2 150=300 µόρια νερού. Εφόσον γνωρίζουµε ότι και οι δύο απολήξεις της νουκλεοτιδικής αλυσίδας καταλαµβάνονται από φώσφορο είναι αναγκαίο να αποσπαστεί ενός ακόµη µόριο νερού, όταν ενωθεί η µια απόληξη µε µόριο φωσφορικού οξέος, γιατί η άλλη το έχει κάνει ήδη. Εξετάζουµε τις ακόλουθες περιπτώσεις: Αν το µόριο του νουκλεϊκού οξέος είναι µονόκλωνο θα έχουµε: Τα 150 νουκλεοτίδια θα δώσουν 150-1=149 φωσφοδιεστερικούς δεσµούς, οπότε αποµακρύνονται 149 µόρια νερού κατά την σύνδεση των νουκλεοτιδίων. Άρα στο σύνολό τους: =450 µόρια νερού Αν το µόριο του νουκλεϊκού οξέος είναι δίκλωνο θα έχουµε: Συναντάµε συνολικά 150 νουκλεοτίδια οπότε σε κάθε κλώνο συναντάµε 150:2=75 νουκλεοτίδια και εποµένως σε κάθε κλώνο σχηµατίζονται 75-1=74 φωσφοδιεστερικοί δεσµοί. Αυτό σηµαίνει ότι αποµακρύνθηκαν 74 2=148 µόρια νερού. Αρα στο σύνολό τους: =450 µόρια νερού

12 ΘΕΜΑ 13 0 Τµήµα από DNA περιέχει 300 ζευγάρια βάσεων έχοντας 135 ως γουανίνες. Να βρεθεί ο αριθµός των θυµινών στο τµήµα αυτό. Όπως είναι γνωστό η γουανίνη (G) είναι συµπληρωµατική µε τη κυτοσίνη (C) οπότε επειδή περιέχονται 135 γουανίνες θα περιέχονται επίσης 135 µόρια κυτοσίνες. Επειδή στην άσκηση έχουµε 300 ζευγάρια βάσεων, δηλαδή 2 300= 600 αζωτούχες βάσεις στο σύνολό του, το ζευγάρι αδενίνης θυµίνης θα ισούται µε: = 330 Επειδή η θυµίνη (Τ) είναι συµπληρωµατική µε τη αδενίνη (Α) προκύπτει ότι οι θυµίνες είναι ίσες µε τις αδενίνες. Άρα οι θυµίνες είναι: 330/2=165. Οµοίως είναι και οι αδενίνες. ΘΕΜΑ 14 ο Τµήµα του DNA αποκολλήθηκε και βρέθηκαν ότι οι αζωτούχες βάσεις του είναι Το 35% αυτών είναι θυµίνη. Να βρεθούν: α) ο αριθµός των άλλων βάσεων β) οι δεσµοί υδρογόνου σε αυτό το τµήµα α) Η θυµίνη (Τ) είναι συµπληρωµατική µε τη αδενίνη (Α), οπότε η θυµίνη είναι 35% και ταυτόχρονα περιέχεται και 35% αδενίνη. Άρα το ζευγάρι αδενίνης θυµίνης είναι 35%+35%=70% οπότε το υπόλοιπο 100% - 70%=30% ανήκει στο ζευγάρι στη γουανίνη κυτοσίνη. Στις 100 βάσεις (αζωτούχες) υπάρχουν 35 αδενίνες Στις >> >> >> x; x=( )/100=28000 αδενίνες. Οµοίως και θυµίνες. Άρα το ζευγάρι γουανίνη κυτοσίνη είναι: =

13 Άρα περιέχονται γουανίνες και κυτοσίνες. β) Θεωρούµε κ το αριθµητικό αποτέλεσµα της πρόσθεσης αδενίνης-θυµίνης στο ένα κλώνο, που ισούται µε το πλήθος της θυµίνης ή της αδενίνης στο DNA και λ το αριθµητικό αποτέλεσµα της πρόσθεσης γουανίνης-κυτοσίνης στον άλλο κλώνο, που ισούται µε το πλήθος της γουανίνης ή κυτοσίνης στο DNA. Επειδή ανάµεσα στη αδενίνη και τη θυµίνη σχηµατίζονται 2 δεσµοί υδρογόνου και ανάµεσα στη γουανίνη και στη κυτοσίνη 3, θα έχουµε: 2 κ+3 κ+3 β=2 β= = =92000 δεσµούς υδρογόνου ΘΕΜΑ 15 ο Τι είναι η ενδοκύττωση; Η διαδικασία που περιλαµβάνει τα ακόλουθα στάδια: α) η ουσία περικλείεται στο εσωτερικό µιας εγκόλπωσης, που δηµιουργείται από προεκβολές του κυτταροπλάσµατος, τα ψευδοπόδια. β) Τα άκρα των ψευδοποδίων ενώνονται, περικλείοντας την εισαγόµενη ουσία. γ) Η πλασµατική µεµβάνη περισφίγγεται και αποκόπτεται οπότε δηµιουργείται ένα κυστίδιο που αφήνεται ελεύθερο στο κυτταροπλασµα. ΘΕΜΑ 16 ο Κοµµάτι DNA συγκροτείται από νουκλεοτίδια. Θεωρώντας µέσο (Μ.Β.)αµινοξέων=150, να βρεθεί ο αριθµός των πρωτεϊνών µε Μ.Β. = που κωδικοποιεί το συγκεκριµένο κοµµάτι

14 Εξετάζουµε τις περιπτώσεις: 1 η Περίπτωση: Συµµετέχουν και τα µόρια νερού που αποµακρύνονται µε τη συµπύκνωση των αµινοξέων Θα έχουµε: (Μ.Β.)πρωτεΐνης = α (α-1 ) 18 ) =150α 90000=150α-18α+18 18α α= α=89982 α=89982:132 α=89982:132 α 682 (Θεωρήσαµε α τα αµινοξέα). Εποµένως καθεµιά πρωτεΐνη συγκροτείται από 682 αµινοξέα. Καθένα αµινοξύ υφίσταται κωδικοποιηση από µια τριάδα νουκλεοτιδίων του m-rnα το λεγόµενο κωδικόνιο. Εποµένως τα 682 αµινοξέα χρειάζονται = 2046 νουκλεοτίδια. Επίσης χρειάζονται 3 νουκλεοτίδια για την έναρξη δηµιουργώντας το λεγόµενο κωδικόνιο έναρξης και 3 νουκλεοτίδια για να δηµιουργηθεί η πρωτεϊνη αποτελώντας το λεγόµενο κωδικόνιο ιο λήξης. Εποµένως για να κωδικοποιηθεί µια πρωτεΐνη χρειάζονται: = 2052 νουκλεοτίδια Έχοντας νουκλεοτίδια του δίκλωνου DNA, υφίστανται µεταγραφή :2 = νουκλεοτίδια και συµµετέχουν στον µεταγραφόµενο κλώνο.. Τα νουκλεοτίδια κωδικοποιούν : πρωτεΐνες. 2 η περίπτωση: ( εν συµµετέχουν και τα µόρια νερού που αποµακρύνονται µε τη συµπύκνωση των αµινοξέων ) Θα έχουµε: (Μ.Β.)πρωτεΐνης=α = 150α α=90000:150 α=90000:150 α=600 α=600 Εποµένως η πρωτεΐνη συγκροτείται από 600 αµινοξέα, οπότε για να κωδικοποιηθεί χρειάζονται:600 :600 3 = 1800 νουκλεοτίδια. Άρα τα νουκλεοτίδια του µεταγραφόµενου κλώνου του DΝΑ κωδικοποιουν / πρωτεΐνες

15 ΘΕΜΑ 17 ο Μια αλυσίδα πολλών πεπτιδίων αποτελείται από 128 πεπτιδικούς δεσµούς. Για να γίνει αυτό απαιτούνται 1100 δεσµοί υδρογόνου. Να βρείτε τον αριθµό των αζωτούχων βάσεων. Για την ένωση δύο αµινοξέων πραγµατοποιείται αφαίρεση ενός µορίου νερού, οπότε για την ένωση x αµινοξέων αφαιρούνται x-1 µόρια νερού και σχηµατίζονται x-1 πεπτιδικοί δεσµοί. Εποµένως: x-1=128 x=128+1 =128+1 x=129 = νουκλεοτίδια κωδικοποιούν ένα αµινοξύ, οπότε το m-rna απαιτεί (3 129)+3=387+3=390 νουκλεοτίδια. Άρα και το DNA που µεταγράφεται φέρει 390 νουκλεοτίδια και επειδή είναι δίκλωνο θα έχει 390 2=780 νουκλεοτίδια. Αν κ είναι το πλήθος της πρόσθεσης του ζευγαριού αδενίνηςθυµίνης στο κλώνο και λ το πλήθος της πρόσθεσης γουανίνηςκυτοσίνης στο κλώνο, θα έχουµε: κ + λ = 390 ❶ Γνωρίζοντας ότι ανάµεσα στην αδενίνη και τη θυµίνη σχηµατίζονται δύο δεσµοί υδρογόνου και ανάµεσα στη γουανίνη και τη κυτοσίνη τρεις, θα έχουµε : 2κ+3λ = 1200 ❷ Λύνουµε την πρώτη ως προς κ και έχουµε: κ=390-λ και αντικαθιστούµε στη δεύτερη. οπότε: 2(390-λ)+3λ= λ+3λ=1100 λ= λ=320 λ=320. Εποµένως: κ= κ=70 κ=70 Εποµένως υπάρχουν 70 νουκλεοτίδια µε θυµίνη, 70 νουκλεοτίδια µε αδενίνη, 320 µε γουανίνη και 320 µε κυτοσίνη

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΕΡΩΤΗΣΕΙΣ ΤΟΥ ΣXOΛΙΚΟΥ ΒΙΒΛΙΟΥ 1. Τοποθετήστε, στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα.

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του;

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; Β-Α γιατί το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του άρα θα γράφεται

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.Ποια χηµικά στοιχεία συµµετέχουν στην σύνθεση των µορίων των οργανισµών σε σηµαντικό βαθµό; (σελ.18) 2. Γιατί είναι σηµαντικά τα ιχνοστοιχεία;(σελ.18)

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα