Supporting Information

Transcript

1 Supporting Information Structure-Activity and Structure-Property Relationship and Exploratory in vivo Evaluation of the Nanomolar Keap1-Nrf2 Protein-Protein Interaction Inhibitor Zheng-Yu Jiang, a,b Li-Li Xu, a,b Meng-Chen Lu, a,b Zhi-Yun Chen, a,b Zhen-Wei Yuan, a,b Xiao-Li Xu, a,b,c Xiao-Ke Guo, a,b,c Xiao-Jin Zhang, a,b,d Hao-Peng Sun, a,b,c* Qi-Dong You a,b* a State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing , China b Jiang Su Key Laboratory of Drug Design and ptimization, China Pharmaceutical University, Nanjing , China c Department of Medicinal Chemistry, School of Pharmacy, China Pharmaceutical University, Nanjing , China d Department of rganic Chemistry, School of Science, China Pharmaceutical University, Nanjing , China 1

2 Table of contents: S1. Characterization of the other intermediates. p3-p9 S2. Binding mode comparison of 8 and 15. p10 S3. Detailed results of the ligand efficiency (LE), ligand efficiency dependent lipophilicity (LELP) and lipophilic efficiency (LipE). p11-p12 S4. Body weight of mice during the experiment. p13 S5. The comparison of in vivo effects between 8 and 18e. p14 S6. Primers used for qrt-pcr. p15 2

3 S1. Characterization of the other intermediates N,N'-(1,4-phenylene)bis(4-methylbenzenesulfonamide) (10b) 10b was synthesized according to the procedure of 10a, light pink powder, yield 74%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 9.99 (s, 2H) 7.52 (d, 4H, J=8.22 Hz) 7.28 (d, 4H, J=8.10 Hz) 6.88 (s, 4H) 2.32 (s, 6H); HRMS (ESI): found (C 20 H 24 N 3 4 S 2, [M+NH 4 ] +, requires ). N,N'-(2-methyl-1,4-phenylene)bis(4-methoxybenzenesulfonamide) (10C): 10c was synthesized according to the procedure of 10a, gray solid, yield 86%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 1H), 9.23 (s, 1H), 7.65 (d, 2H, J=8.82 Hz), 7.46 (d, 2H, J=8.82 Hz), (m, 4H), (m,3h), 3.81 (s, 3H), 3.80(s, 3H), 1.83 (s,3h); HRMS (ESI): found (C 21 H 22 N 2 Na 6 S 2, [M+Na] +, requires ). N,N'-(2,5-dimethyl-1,4-phenylene)bis(4-methoxybenzenesulfonamide) (10d): 10d was synthesized according to the procedure of 10a, white solid, yield 82%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 9.29 (s, 2H), 7.52 (d, 4H, J=8.91 Hz), 7.04 (d, 4H, J=8.94), 6.72 (s, 2H), 3.81 (s, 6H), 1.77 (s, 6H); HRMS (ESI): found (C 22 H 24 N 2 Na 6 S 2, [M+Na] +, requires ). N,N'-(2-methoxy-1,4-phenylene)bis(4-methoxybenzenesulfonamide) (10e): To a solution of 2-Methoxy-4-nitroaniline (1.68 g, 10 mmol) in THF was added Pd/C. The reaction mixture was stirred under hydrogen for 4h. The solution was filtered to remove the catalyst. The filtrate was concentrated under reduced pressure to give the light yellow oil. The crude product, 2-Methoxyl-1, 4-diaminobenzene, was used without further purification, and the 10e was synthesized according to the procedure of 10a, light brown solid, yield 58%;.m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 1H) 9.13 (s, 1H) 7.66 (d, 2H, J=8.85 Hz), 7.50 (d, 2H, J=8.82 Hz), (m, 5H), 6.58(s, 1H), 6.55(s, 1H), 3.80(s, 6H), 3.44 (s, 3H); HRMS (ESI): found (C 21 H 22 N 2 Na 7 S 2, [M+Na] +, requires ). Diethyl 2,2'-(1,4-phenylenebis(tosylazanediyl))diacetate (11b): 11b was synthesized according to the procedure of 11a, pink solid, yield 68%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 7.49 (d, 4H, J=8.19 Hz) 7.36 (d, 4H, J=8.16 Hz) 7.11 (s, 4H), 4.48 (s, 4H), 4.06 (q, 4H, J=7.08 Hz), 2.40 (s, 6H), 1.11(t, 6H, J=7.08 Hz); HRMS (ESI): found (C 28 H 32 N 2 Na 8 S 2, [M+Na] +, requires ). 3

4 Dimethyl 2,2'-((2-methyl-1,4-phenylene)bis(((4-methoxyphenyl) sulfonyl)azanediyl))diacetate (11c): To a solution of 10c (924 mg, 2 mmol) in DMF (5ml) was added K 2 C 3 (830 mg, 6 mmol) followed by methyl bromoacetate (765 mg, 5 mmol). After 3h stirring at room temperature, the reaction mixture was then diluted in 30 ml water and quenched with 2 M hydrochloric acid to ph 5. The crude product was obtained through filtration. Recrystallization from ethyl acetate/ n-hexane give the 11c, gray solid, yield 74%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 7.56 (d, 2H, J=8.88 Hz) 7.51 (d, 2H, J=8.91 Hz), (m, 5H), (m, 2H), 4.47 (s, 2H), 4.32 (s, 2H), 3.86 (s, 6H), 3.61 (s, 3H), 3.57(s, 3H), 2.14(s, 3H); HRMS (ESI): found (C 27 H 30 N 2 Na 10 S 2, [M+Na] +, requires ). Dimethyl 2,2'-((2,5-dimethyl-1,4-phenylene)bis(((4-methoxyphenyl) sulfonyl)azanediyl))diacetate (11d): 11d was synthesized according to the procedure of 11c, gray solid, yield 77%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), (m, 4H), (m, 4H), (m, 4H), 3.87(s, 3H), 3.80 (s, 3H), (m, 6H), 2.89 (s, 3H), 2.73 (s, 3H); HRMS (ESI): found (C 28 H 32 N 2 Na 10 S 2, [M+Na] +, requires ). Dimethyl 2,2'-((2-methoxy-1,4-phenylene)bis(((4-methoxyphenyl) sulfonyl)azanediyl))diacetate (11e): 11e was synthesized according to the procedure of 11c, gray solid, yield 58%; m.p.:83-85 C; 1 H NMR (300 MHz, DMS, δ) 7.61 (d, 2H, J=8.91Hz), 7.50 (d, 2H, J=8.91Hz), 7.29 (d, 1H, J=8.43Hz), (m,4h), (m, 1H), (m,1h), 4.52 (s, 2H), 4.30 (s, 2H), 3.85 (s, 6H), 3.64(s, 3H), 3.60(s, 3H), 3.18(s,3H); HRMS (ESI): found (C 27 H 34 N 3 11 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-fluorobenzenesulfonamide) (16b): 16b was synthesized according to the procedure of 16a, gray solid, yield 59%; C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (m, 2H), (m, 4H), (m, 6H) 7.04 (s, 2H); HRMS (ESI): found (C 22 H 20 F 2 N 3 4 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-chlorobenzenesulfonamide) (16c): 16c was synthesized according to the procedure of 16a, orange solid, yield 59%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 1H), (s, 1H), (m, 2H), (m, 8H), (m, 2H), 6.97 (s, 2H); HRMS (ESI): found (C 22 H 20 Cl 2 N 3 4 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-bromobenzenesulfonamide) (16d): 16d was synthesized according to the procedure of 16a, light brown solid, yield 76%; 4

5 m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (m, 2H), 7.69 (d, 4H, J=8.66 Hz), 7.53 (d, 4H, J=8.66 Hz), (m, 2H), 7.02 (s, 2H); HRMS (ESI): found (C 22 H 16 Br 2 N 2 Na 4 S 2, [M+Na] +, requires ). N,N'-((((4-(hydrosulfonylamino)naphthalen-1-yl)amino)sulfonyl)bis(4,1- phenylene))diacetamide (16e): 16e was synthesized according to the procedure of 16a, pink solid, yield 76%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (s, 2H), (m, 2H), (m, 4H), (m, 4H), (m, 2H), 7.00 (s, 2H), 2.07 (s, 6H); HRMS (ESI): found (C 26 H 28 N 5 6 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-(tert-butyl)benzenesulfonamide) (16f): 16f was synthesized according to the procedure of 16a, gray solid, yield 79%; m.p.: C m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (m, 2H), (m, 4H), (m, 4H), (m, 2H), 7.09 (s, 2H), (m, 18H); HRMS (ESI): found (C 30 H 34 N 2 Na 4 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(2,4,6-trimethylbenzenesulfonamide) (16g): 16g was synthesized according to the procedure of 16a, white solid, yield 64%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), 8.03 (dd, 2H, J=6.45,3.21 Hz), 7.44 (dd, 2H, J=6.49,3.15 Hz), 6.93 (s, 4H), 6.89 (s,2h), 2.32 (s,12h), 2.22 (s,6h); HRMS (ESI): found (C 30 H 34 N 2 Na 4 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,4-diyl)dibenzenesulfonamide (16h): 16h was synthesized according to the procedure of 16a, gray solid, yield 58%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), 7.90 (dd, 2H, J=6.51, 3.24 Hz), (m, 6H), (m, 4H), (m, 2H), 7.03 (s, 2H); HRMS (ESI): found (C 22 H 18 N 2 Na 4 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-(trifluoromethoxy) benzenesulfonamide) (16i): 16i was synthesized according to the procedure of 16a, light brown solid, yield 55%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (br, 2H), (m, 2H), 7.71 (d, 4H, J=8.85 Hz), 7.43 (d, 4H, J=8.34 Hz), (m, 2H), 7.05 (s, 2H); HRMS (ESI): found (C 24 H 20 F 6 N 3 6 S 2, [M+NH 4 ] +, requires ). 5

6 N,N'-(naphthalene-1,4-diyl)bis(naphthalene-2-sulfonamide) (16j): 16j was synthesized according to the procedure of 16a, white solid, yield 78%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), 8.24 (s, 2H), (m, 8H), (m, 6H), (m, 2H), 6.96 (s, 2H); HRMS (ESI): found (C 30 H 22 N 2 Na 4 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-(trifluoromethyl) benzenesulfonamide) (16k): 16k was synthesized according to the procedure of 16a, light pink solid, yield 47%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (m, 10H), 7.32 (dd, 2H, J=6.54, 3.18 Hz), 7.08 (s, 2H); HRMS (ESI): found (C 24 H 20 F 6 N 3 4 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(3-methoxybenzenesulfonamide) (16l): 16l was synthesized according to the procedure of 16a, gray solid, yield 61%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), 7.94 (dd, 2H, J=6.47, 3.18 Hz), (m, 4H), (m, 6H), 7.06 (s, 2H), 3.67 (s, 6H); HRMS (ESI): found (C 24 H 22 N 2 Na 6 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-cyanobenzenesulfonamide) (16m): 16g was synthesized according to the procedure of 16a, gray solid, yield 74%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (s, 2H), (m, 4H), (m, 2H), (m, 4H), (m, 2H), 7.05 (s, 2H); HRMS (ESI): found (C 24 H 20 N 5 4 S 2, [M+NH 4 ] +, requires ). N,N'-(naphthalene-1,4-diyl)bis(4-butoxybenzenesulfonamide) (16n): 16g was synthesized according to the procedure of 16a, gray solid, yield 74%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 9.87 (s, 2H), 7.99 (dd, 2H, J=6.48, 3.21 Hz), (m, 4H), 7.33 (dd, 2H, J=6.50, 3.27 Hz), (m, 5H), 6.83 (d, 1H, J=8.80 Hz), (m, 4H), (m, 4H), (m, 4H), (m, 6H); HRMS (ESI): found (C 30 H 34 N 2 Na 6 S 2, [M+Na] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis(((4-fluorophenyl)sulfonyl) azanediyl))diacetate (17b): 17b was synthesized according to the procedure of 17a, gray solid, yield 65%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H) (m, 4H) (m, 2H) (m, 6H), 7.15 (s, 1H), 6.97 (s, 1H), (m, 4H), (m, 4H) (m, 6H); HRMS (ESI): found (C 30 H 32 F 2 N 3 8 S 2, [M+NH 4 ] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis(((4-chlorophenyl)sulfonyl) 6

7 azanediyl))diacetate (17c): 17c was synthesized according to the procedure of 17a, brown solid, yield 48%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H) (m, 10H) 7.16 (s, 1H) 6.92 (s, 1H) (m, 4H), (m, 4H) (m, 6H); HRMS (ESI): found (C 30 H 28 Cl 2 N 2 Na 8 S 2, [M+Na] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis(((4-bromophenyl)sulfonyl) azanediyl))diacetate (17d): 17d was synthesized according to the procedure of 17a, light pink solid, yield 57%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), 7.84 (d, 2H, J=8.43), 7.75 (d, 2H, J=8.43), (m, 6H), 7.15 (s, 1H), 6.89 (s, 1H), (m, 4H), (m, 4H), (m, 6H) ; HRMS (ESI): found (C 30 H 29 Br 2 N 2 8 S 2, [M+H] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis(((4-acetamidophenyl) sulfonyl)azanediyl))diacetate (17e): 17e was synthesized according to the procedure of 17a, light brown solid, yield 42%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (d, 2H, J=9.45), (m, 1H), (m, 1H), 7.80 (d, 2H, J=8.73), 7.73(d, 2H, J=8.88), (m, 6H), 7.07 (s, 1H), 6.93(s, 1H), (m, 4H), (m, 4H), 2.15 (s, 3H), 2.09 (s, 3H), (m, 6H) ; HRMS (ESI): found (C 34 H 36 N 4 Na 10 S 2, [M+Na] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis(((4-(tert-butyl)phenyl)sulfonyl) azanediyl))diacetate (17f): 17f was synthesized according to the procedure of 17a, gray solid, yield 72%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), (m, 4H), (m, 4H), (m, 2H), 7.20 (s, 1H), 7.09 (s, 1H), (m, 4H), (m, 4H), (m, 18H), (m, 6H) ; HRMS (ESI): found (C 38 H 46 N 2Na 8 S 2, [M+Na] +, requires ). diethyl 2,2'-(naphthalene-1,4-diylbis((mesitylsulfonyl) azanediyl))diacetate (17g): 17g was synthesized according to the procedure of 17a, gray solid, yield 75%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) 7.87 (s, 2H) (m, 4H), (m, 4H), (m, 2H), (m, 2H), (m, 4H), (m, 18H), (m, 6H) ; HRMS (ESI): found (C 36 H 46 F 2 N 3 8 S 2, [M+NH 4 ] +, requires ). Diethyl 2,2'-(naphthalene-1,4-diylbis((phenylsulfonyl) azanediyl)) diacetate (17h): 17h was synthesized according to the procedure of 17a, light brown solid, yield 51%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), (m, 12H), 7.12 (s, 1H), 6.89 (s, 1H), (m, 4H), (m, 4H), (m, 6H) ; HRMS (ESI): found (C 30 H 34 N 3 8 S 2, [M+NH 4 ] +, requires ). 7

8 Dibenzyl 2,2'-(naphthalene-1,4-diylbis(((4-(trifluoromethoxy) phenyl)sulfonyl)azanediyl))diacetate (17i): 17i was synthesized according to the similar procedure of 17a, the ethyl bromoacetate was replaced by the Benzyl 2-bromoacetate, gray solid, yield 47%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), (m, 4H), (m, 4H), (m, 13H), 6.88 (s, 1H), (m, 4H), (m, 4H) ; HRMS (ESI): found (C 42 H 36 F 6 N 3 8 S 2, [M+NH 4 ] +, requires ). Diethyl 2,2'-(naphthalene-1,4-diylbis((naphthalen-2-ylsulfonyl) azanediyl))diacetate (17j): 17j was synthesized according to the procedure of 17a, gray solid, yield 69%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 3H), (m, 2H), (m, 5H), (m, 8H), 7.07 (s, 1H), 6.80 (s, 1H), (m, 4H), (m, 4H), (m, 6H) ; HRMS (ESI): found (C 38 H 38 N 3 8 S 2, [M+NH 4 ] +, requires ). F 3 C N S N S CF 3 Dibenzyl 2,2'-(naphthalene-1,4-diylbis(((4-(trifluoromethyl)phenyl) sulfonyl)azanediyl))diacetate (17k): 17k was synthesized according to the procedure of 17i, purified by column chromatography (silica gel; hexanes/etac; 4:1 to 2:1) to give the light yellow oil, yield 81%; 1 H NMR (300 MHz, DMS, δ) (m, 1H), (m, 1H), (m, 8H), (m, 2H), (m, 10H), 7.14 (s,1h), 6.80(s, 1H), (m, 4H), (m, 4H) ; HRMS (ESI): found (C 42 H 36 F 6 N 3 8 S 2, [M+NH 4 ] +, requires ). S N N S Dibenzyl 2,2'-(naphthalene-1,4-diylbis(((3-methoxyphenyl)sulfonyl) azanediyl))diacetate (17l): 17l was synthesized according to the procedure of 17i, purified by column chromatography (silica gel; hexanes/etac; 4:1 to 2:1) to give light yellow oil, yield 77%; 1 H NMR (300 MHz, DMS, δ) 8.10(s, 1H), 7.93(s, 1H), (m, 4H), (m, 14H), (m, 4H), (m, 4H), (m, 4H), 3.75(s, 3H), 3.59(s, 3H); HRMS (ESI): found (C 42 H 39 N 2 10 S 2, [M+H] +, requires ). Dimethyl 2,2'-(naphthalene-1,4-diylbis(((4-cyanophenyl)sulfonyl) azanediyl))diacetate (17m): 17m was synthesized according to the procedure of 11c, light pink solid, yield 61%; m.p.: C; 1 H NMR (300 MHz, DMS, δ) (m, 6H), (m, 4H), (m, 2H), 7.18 (s, 1H), 7.03(s, 1H), (m, 4H), 3.62(s, 3H), 3.56(s, 3H); HRMS (ESI): found (C 30 H 28 N 5 8 S 2, [M+NH 4 ] +, requires ). 8

9 Dibenzyl 2,2'-(naphthalene-1,4-diylbis(((4-butoxyphenyl)sulfonyl) azanediyl))diacetate (17n): 17n was synthesized according to the procedure of 17i, purified by column chromatography (silica gel; hexanes/etac; 8:1 to 2:1) to give the gray solid, yield 53%; m.p.: C; 1 H-NMR (300 MHz, DMS, δ) (m, 2H), (m, 4H), (m, 16H), (m, 2H), (m, 4H), (m, 4H), (m, 4H), (m, 4H), (m, 4H), (m, 6H) ; HRMS (ESI): found (C 48 H 50 N 2 Na 10 S 2, [M+Na] +, requires ). N,N'-(naphthalene-1,5-diyl)bis(4-methoxybenzenesulfonamide) (13): 13 was synthezied according to the procedures of 16a, grap solid, yield 73%; m.p.: C; 1 H-NMR (300 MHz, DMS) (s, 2H), 7.88 (d, 2H, J=8.49), 7.56 (d, 4H, J=8.61), (m, 2H), 7.07 (d, 2H, J=7.26), 6.98 (d, 4H, J=8.67), 3.76(s, 6H); HRMS (ESI): found (C 24 H 26 N 3 6 S 2, [M+NH 4 ] +, requires ). dimethyl 2,2'-(naphthalene-1,5-diylbis(((4-methoxyphenyl)sulfonyl) azanediyl))diacetate (14): 14 was synthezied according to the procedures of 17m, light brown solid, yield 66%; m.p.: C; 1 H-NMR (300 MHz, DMS) (m, 2H), (m, 4H), (m, 2H), (m, 6H), 4.55(s, 2H), 4.51 (s, 2H), 3.88(s, 3H), 3.86(s, 3H), 3.59 (s, 3H), 3.55(s, 3H); HRMS (ESI): found (C 30 H 30 N 2 Na 10 S 2, [M+Na] +, requires ). 9

10 S2. Binding mode comparison of 8 and 15. Figure S1. Binding mode comparison between 8 and 15. The hydrogen bonds were represented as green dashed lines and the electrostatic interactions were represented as yellow dashed lines. The carbon atoms of ligands and Keap1 residues were colored as cyan and purple respectively 10

11 S3. Detailed results of the ligand efficiency (LE), ligand efficiency dependent lipophilicity (LELP) and lipophilic efficiency (LipE). a Compd. R 1 IC 50 (nm) 95% CI MW the number of non-hydrogen atoms pic 50 LE LELP LipE 8 4-CH a 4-CH b 4-F c 4-Cl d 4-Br e 4-acetamido to f 4-C(CH 3 ) g 2,4,6-trimethyl h H i 4-CF

12 18j 5,6-C 4 H k 4-CF l 3-CH m 4-CN n 4-n-butyl a LE = 1.4pIC50/HAC (heavy atom count HAC); LipE = pic50-logp; LELP = logp/le 12

13 S4. Body weight of the mice during the experiment Figure S2. Body weight of C57BL/6 female mice in different groups (n = 10 mice per group) during the experiment. 13

14 S5. The comparison of in vivo effects between 8 and 18e. Figure S3. Quantification of various inflammatory cytokines including IL-6, Il-12, IL-17, TNF-α and IFN-γ in the blood serum of C57BL/6 female mice after 5h of LPS challenge. Dexamethasone (10 mg/kg) was used as positive control. 14

15 S6. Primers used for qrt-pcr Primers are shown as follows: Nrf2 Sense primer: AACCACCCTGAAAGCACGC Antisense primer: TGAAATGCCGGAGTCAGAATC H-1 Sense primer: ATGGCCTCCCTGTACCACATC Antisense primer: TGTTGCGCTCAATCTCCTCCT NQ-1 Sense primer: CGCAGACCTTGTGATATTCCAG Antisense primer: CGTTTCTTCCATCCTTCCAGG GCLM-1 Sense primer: TTGGAGTTGCACAGCTGGATTC Antisense primer: TGGTTTTACCTGTGCCCACTG 15