Supporting Information
|
|
- Ὀρέστης Βασιλειάδης
- 7 χρόνια πριν
- Προβολές:
Transcript
1 Supporting Information New Prodigiosin Derivatives obtained by Mutasynthesis in Pseudomonas putida Andreas S. Klein, Andreas Domröse, Patrick Bongen, Hannah U.C. Brass, Thomas Classen, Anita Loeschcke, Thomas Drepper, Luca Laraia, Sonja Sievers, Karl Erich Jaeger and Jörg Pietruszka* A. S. Klein, M.Sc.; Dr. P. Bongen; H. Brass, M.Sc.; Prof. Dr. J. Pietruszka Institute of Bioorganic Chemistry, Heinrich Heine University Düsseldorf located at Forschungszentrum Jülich Stetternicher Forst, Building 15.8, Jülich (Germany) E mail: j.pietruszka@fz juelich.de; Website: duesseldorf.de A. Domröse, M.Sc.; Dr. A. Loeschcke; Dr. T. Drepper; Prof. Dr. K. E. Jaeger Institute of Molecular Enzyme Technology, Heinrich Heine University Düsseldorf located at Forschungszentrum Jülich Stetternicher Forst, Building 15.8, Jülich (Germany) Dr. L. Laraia Department of Chemical Biology, Max Planck Institute of Molecular Physiology, Dortmund (Germany) Otto Hahn Str. 11, Dortmund (Germany) Dr. S. Sievers Compound Management and Screening Center (COMAS), Max Planck Institute of Molecular Physiology Otto Hahn Str. 11, Dortmund (Germany) Prof. Dr. J. Pietruszka; Dr. T. Classen; Prof. Dr. K. E. Jaeger Insitute of Bio and Geosciences (IBG 1) Forschungszentrum Jülich Jülich (Germany)
2 Table of Contents General methods for biological procedures Construction of P. putida pig r2 ΔpigD mutant strain Mutasynthesis experiments Expression of the pigc gene General methods for chemical synthesis procedures Experimental procedures for the preparation of compounds Compound characterization NMR Spectra of synthesized compounds LC MS traces of prodiginines produced by precursor directed biosynthesis Effective precursor concentration and DMSO toxicity LC MS traces of prodiginines produced by mutasynthesis NMR Spectra of prodiginines (mutasynthesis: preparative scale) LC MS traces of prodiginines produced by in vitro biotransformation with PigC Extinction coefficients of prodiginines EC 50 values Vector maps References S1 S2 S3 S3 S4 S6 S11 S20 S43 S44 S45 S52 S58 S65 S66 S67 S68
3 S1. General methods for biological procedures Table S 1 List of primers used in this study # name 5ꞌ 3ꞌ sequence 1 AD44seqGApigCfwd ACGCTCGTCGTTTGGTATGG 2 AD48inpigC AGCAACCAGGCGTTTAAG 3 AD49aadAfwd CATATCGCGCGCGTCTGATTATGGAGCAGCAACGATG 4 AD50aadArev GTCGCGCGATCGCTTATTTGCCGACTACCTTGG 5 AD61seqaadAfwd AGTCCATCCACAGGCACAAC 6 AD62seqaadAfwd2 AATGTACGGCCAGCAACGTC 7 AD79aadAStart AAAGCTCGCCGCGTTGTTTC 8 AD80aadAStop AAATCGCGCCGAAGGATGTC 9 AD81pigC1 GTATGGCGTGATGGCCGAAC 10 AD82pigE1 TGAAGATCGAGCCGGGTTGC 11 ga_pigc_fw GTGCCGCGCGGCAGCCACATATGATGAATCCTACCCTGGTGGTT 12 ga_pigc_rv AGTGGTGGTGGTGGTGGTGCCTCGAGCTAGCCATCGGCACGTTC S1
4 S2. Construction of P. putida pig r2 ΔpigD mutant strain Figure S 1 HPLC analysis of chemical synthesized MBC (5), cultivation media and cell extract of P. putida pig r2 ΔpigD. Column: Chiralpak IA (250 x 4.6 mm, 5 µm); Flow: 0.5 ml min 1 ; Detection: 365 nm; Solvent: Heptane:2 propanol (80:20). t R = 14.7 min. S2
5 S3. Mutasynthesis experiments Figure S 2 Mutasynthesis pretest: Feeding of MAP (6a) to the prodigiosin (1a) producing strain P. putida pig r2 in ethanol [6% (v/v)]. Supplementation of 3 mm MAP resulted in 52% higher production of prodigiosin. S4. Expression of the pigc gene Figure S 3 SDS PAGE of pigc gene expression. Conditions: Gel (NuPAGE 4 12% Bis TRIS Gel, Invitrogen) with colloidal Coomassie stain. M marker Roti Mark ; 1 whole cells; 2 cell free supernatant after ultra sonication; 3 supernatant of the cell free lysate after ultracentrifugation, 4 membrane fraction after ultracentrifugation. MW of PigC calculated = 99.3 kda. S3
6 S5. General methods for chemical synthesis procedures Reagents and solvents: All chemical reagents were purchased from Sigma Aldrich, Steinheim, Germany, Alfa Aesar, Karlsruhe, Germany or TCI Europe, Zwijndrecht, Belgium. Petroleum ether (PE), ethyl acetate (EtOAc), diethyl ether and dichloromethane were distilled prior to use. All other chemicals and solvents were used as purchased without further purification. Reaction handling: All reactions under inert atmosphere were carried out in oven dried glassware under an atmosphere of nitrogen using standard Schlenk techniques and magnetic stirring. Reactions were monitored by thin layer chromatography (TLC) on pre coated plastic sheets (Polygram SIL G/UV254, Macherey Nagel, Düren, Germany) with detection by UVlight at 245 nm or via oxidative staining; plates were soaked with KMnO 4 stain (1.5 g KMnO 4, 10 g K 2 CO 3 and 1.25 ml 10% (v/v) NaOH in 200 ml water) or p anisaldehyde stain (3 ml p anisaldehyde and 6 ml conc. H 2 SO 4 in 300 ml AcOH) and dried with a hot air blow dryer. Solvent removal was performed at 40 C in vacuo. Preparative column chromatography was performed using silica gel 60 (particle size mm, mesh). Mass spectrometry: GC MS analysis was performed on a HP 6890 series gas chromatograph (Hewlett Packard) equipped with a HP 6890 series injector and a split injection system, fitted with a HP 5 ms column (30 m x 0.25 mm, 0.25 μm, Agilent Technologies) and coupled with a mass selective detector 5973 mass spectrometer. The temperatures of the injector and the detector were fixed at 250 C and 230 C, respectively. Helium was used as the carrier gas at 0.57 bar. Mass spectra were collected in the electron impact mode at 70 ev. The column temperature was initially 60 C for 1 min, then raised to 185 C at a rate of 15 C min 1, subsequently raised to 280 C at a rate of 120 C min 1 and maintained at that temperature for 5 min. NMR spectroscopy: 1 H and 13 C NMR spectra were recorded on an Advance/DRX 600 nuclear magnetic resonance spectrometer (Bruker, Billerica, USA) at ambient temperature in CDCl 3 at 600 and 151 MHz, respectively. The chemical shifts are given in ppm relative to tetramethylsilane [ 1 H: δ(sime 4 ) = 0.00 ppm] as an internal standard or relative to the solvent [ 13 C: δ(cdcl 3 ) = ppm]. Signals were assigned by means of H COSY, HSQC and HMBCexperiments; splitting patterns are given as singlet (s), doublet (d), triplet (t), doublet of doublet (dd), multiplet (m) and broad singlet (brs) plus coupling constants (J) are reported in Hz. IR spectroscopy: IR data were recorded on a SpectrumOne instrument (PerkinElmer, Waltham, USA) as thin film. Absorbance frequencies are reported in cm 1. LC MS (achiral stationary phase): Analytes were separated and analyzed using a LC MS Agilent 1100 series equipped with a diode array and API electrospray mass detector. Substances were separated by the reversed phase stationary phase Atlantis T3 3 µm (3.00* mm). Water + 0.1% formic acid (v/v) and methanol + 0.1% formic acid (v/v) S4
7 were used as eluents for the following gradient program: 0.00 min: 90:10 water + 0.1% formic acid (v/v) : methanol + 0.1% formic acid (v/v), 4.00 min: 40:60 water + 0.1% formic acid (v/v) : methanol + 0.1% formic acid (v/v), 6.00 min: 100% methanol + 0.1% formic acid (v/v). The program was stopped after min. Flow rate was set to 0.6 ml/min. The column temperature was kept at 30 C. Detection wavelengths were 510 nm, 520 nm, 530 nm, 540 nm, 3D field (190 nm 800 nm). 10 µl of sample were injected. MS detection mode was set to positive mode with a range of m/z = Substances were identified by their UV absorption spectra and their mass to charge ratio (m/z). Names are in accordance with the IUPAC nomenclature. S5
8 S6. Experimental procedures for the preparation of compounds Table S 2 List of monopyrroles used in this study. # monopyrrole R 1 R 2 procedure overall yield [%] 1 6b methyl H C c methyl methyl A d methyl n propyl A e methyl n butyl A a methyl n pentyl A f methyl n hexyl A g methyl n octyl A h methyl n decyl A i methyl n dodecyl A j H ethyl B k H n propyl B l H n pentyl B m H n hexyl B n H n octyl B o H n undecyl B p ethyl n pentyl A q n butyl n propyl A r n pentyl n butyl A s n hexyl n pentyl A t methyl 2 propenyl A u methyl 4 pentenyl A [a] 45 [b] [a] starting material 7 octen 2 one (16) was previously synthesized from 6 heptenoic acid. [b] overall yield is given for the synthesis starting from 6 heptenoic acid. S6
9 Procedure A for the synthesis of pyrroles (6a, c i, p u) General procedure for the synthesis of oximes (11) A mixture of the ketone (10, 16) (23.4 mmol), grounded hydroxylamine hydrochloride (2.44 g, 35.1 mmol) and pyridine (1.5 ml, 18.6 mmol) in ethanol (20 ml) was refluxed for 2 h. The completion of the reaction was monitored by TLC using a KMnO 4 solution for staining. The reaction was extracted with EtOAc (3 x 25 ml) and the organic phase was washed several times with 1 N HCl and water. The light yellow brown organic phase was dried over MgSO 4 and the solvent was evaporated providing the oximes (11) in quantitative yields. The oximes were used without further purification in the following experiment. General procedure for the synthesis of 2,3 alkylpyrroles (6a, c i, p u) 2,3 alkylpyrrole (6a, c i, p u) were synthesized using a modified procedure of Domröse, Klein et al. (2015). 1 A mixture of the oxime (11) (10 mmol), potassium hydroxide (50 mmol), DMSO (20 ml) and water (7.5 mmol) was heated at C in a three neck round bottom flask fitted with a reflux condenser under nitrogen atmosphere. A solution of 1,2 dichloroethane (35 mmol) in DMSO (3 ml) was added dropwise over a period of 2 h. A secondary amount of potassium hydroxide (50 mmol) was added carefully after 1 h of 1,2 dichloroethane addition. After stirring for an additional 2 h the reaction was poured into ice water and extracted with diethyl ether (3 x 20 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. Chromatography on silica gel with PE:dichloromethane (90:10) + TEA (1% v/v) providing 2,3 alkylpyrroles (6a, c i, p u) as a light yellow oil or solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. Procedure B for the synthesis of pyrroles (6j o) N Tosylpyrrole (12) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask. To a solution of sodium hydride (1.431 g, 60 mmol) in dry THF (16 ml) was added carefully pyrrole (2.07 ml, 30 mmol) within 10 min at 0 C. The reaction mixture was stirred for 30 min at room temperature followed by the addition of dissolved tosyl chloride (5.683 g, 30 mmol) in THF (8 ml). The reaction mixture was stirred for 3 h at room temperature. Afterwards it was quenched with the addition of water at 0 C and extracted with dichloromethane (3 x 30 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound 12 (6.127 g, 28 mmol, 93%) as a white grey solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. S7
10 General procedure for the synthesis 3 acyl N tosylpyrroles (13) 3 Acyl N tosylpyrroles (13) were synthesized using modified procedures of Katritzky et al. (2003) 2 and Huffmann et al. (2008). 3 The reaction was performed in a Schlenk flask under an inert atmosphere of dry nitrogen. To a suspension of anhydrous AlCl 3 (1.808 g, mmol) in 15 ml of dry dichloromethane at room temperature was added slowly the acyl chloride (9.04 mmol). The resulting solution was stirred for 20 min; then a solution of N tosylpyrrole (12) (1 g, 4.52 mmol) in 10 ml of dichloromethane was added slowly at 0 C. The mixture was stirred at room temperature for 3 h. The reaction mixture was quenched with ice water and the product was extracted with dichloromethane (3 x 15 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. The 3 acyl N tosylpyrroles (13) were used without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. General procedure for the synthesis of 3 acylpyrroles (14) 3 Acylpyrroles were synthesized using a modified procedure of Kakushima et al. (1983). 4 A solution of the 3 acyl N tosylpyrrole (13) (3 mmol) in 1.4 dioxane (10 ml) and 5 N NaOH (10 ml) was heated at 80 C for 1.5 h in a round bottom flask under an inert atmosphere of dry nitrogen. The reaction mixture was extracted with dichloromethane (3 x 10 ml) followed by an extraction with ethyl acetate (1 x 10 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. The 3 acylpyrroles (14) were used without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. General procedure for the synthesis of 3 alkylpyrroles (6j o) 3 Alklpyrroles (6j o) were synthesized using a modified procedure of He et al. (2011). 5 The reaction was performed in a Schlenk flask fitted with a reflux condenser under an inert atmosphere of dry nitrogen. LiAlH 4 (190 mg, 5 mmol) was added slowly to a solution of the 3 acylpyrrole (14) (2.5 mmol) in dry THF (10 ml) at 0 C. Thereafter the reaction mixture was refluxed for 1.5 h followed by a second addition of LiAlH 4 (190 mg, 5 mmol) at 0 C. The reaction mixture was again refluxed for 1.5 h and quenched with a saturated solution of sodium sulfate at 0 C. The reaction mixture was extracted with dichloromethane (3 x 30 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. Chromatography on silica gel with PE:dichloromethane (75:25) + TEA (1% v/v) providing 3 alkylpyrroles (6j o) as a light yellow S8
11 oil or solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. Synthesis of 2 Methylpyrrole (6b) (procedure C ) 1H Pyrrole 2 carbaldehyde (15) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask fitted with a reflux condenser. POCl 3 (1.02 ml, 11 mmol) is slowly added to N,N dimethylformamide (847 µl, 11 mmol) at 0 C and the reaction mixture is warmed to room temperature after 10 min. The resulting Vilsmeier reagent is diluted with 1,2 dichloroethane (5 ml) and again cooled to 0 C after 10 min. Pyrrole (707 µl, 10 mmol) is dissolved in 1,2 dichloroethane (4 ml) and the mixture is slowly added to the Vilsmeier reagent over 25 min. Thereafter the reaction was refluxed for 20 min at 85 C and is subsequently cooled to room temperature. Sodium acetate (7.4 g, mmol), dissolved in 15 ml of water, is slowly added to the reaction mixture during 15 min followed by refluxing for 30 min at 85 C. Afterwards the reaction mixture is cooled to room temperature and extracted with diethyl ether (3 x 15 ml). The combined organic layers were washed with a saturated solution of NaHCO 3, dried over MgSO 4 and the solvent was removed under reduced pressure. The crude product was purified by flash chromatography on silica gel with PE:EtOAc (80:20) + TEA (1% v/v) providing compound 15 (901 mg, 9.5 mmol, 95%) as a brown oil, which solidified on standing. 2 Methylpyrrole (6b) was synthesized using the general procedure for the synthesis of 3 alkylpyrroles (6j o). The crude product was purified by flash chromatography on silica gel with PE:dichloromethane (75:25) + TEA (1% v/v) providing compound 6b (667 mg, 8.2 mmol, 49%) as a light yellow oil. Synthesis of 7 octen 2 one (16) N Methoxy N methylhept 6 enamide (17) was synthesized under an inert atmosphere of dry nitrogen in a Schlenk flask. The synthesis of the Weinreb Nahm amide based on a Steglich esterification. To a solution of 6 heptenoic acid (2.0 ml, 14.8 mmol) in dichloromethane (50 ml) was added N,O dimethylhydroxylamine hydrochloride (2.160 g, 22.1 mmol), N (3 dimethylaminopropyl) N ethylcarbodiimide hydrochloride (4.245 g, 22.1 mmol) and 4 (dimethylamino)pyridine (2.705 g, 22.1 mmol). The reaction mixture was stirred for 22 h at room temperature. The reaction was quenched with a saturated solution of NaCl and extracted with dichloromethane (3 x 30 ml). The combined organic layers were first washed with 1 N HCl and subsequently with a saturated solution of NaHCO 3. The organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound (17) as a light yellow oil in quantitative yields. The product was used S9
12 without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. 7 Octen 2 one (16) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask. To a solution of N methoxy N methylhept 6 enamide (17) (1.0 g, 5.8 mmol) in dry THF (30 ml) was slowly added methylmagnesium bromide (3 M in diethyl ether, 5.84 ml, 5.8 mmol) within 15 min at 0 C. The reaction mixture was stirred for 1.5 h at 0 C and quenched with a saturated solution of NH 4 Cl and extracted with ethyl acetate (3 x 20 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound (16) as a light yellow oil in quantitative yields. The product was used without further purification for the synthesis of 2 methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) applying procedure A. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. S10
13 S7. Compound characterization 2,3 Dimethyl 1H pyrrole (6c) Pyrrole 6c was obtained by procedure A as a light yellow oil (507 mg, 5.3 mmol, 47%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.02 (s, 3H, 1 H), 2.17 (s, 3H, 1 H), 5.98 (t, 3 J 4,5 = 2.9 Hz, 4 J 4,1 = 2.9 Hz, 1H, 4 H), 6.57 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 4), (C 3), (C 5), (C 2); IR (atr film): ῦ [cm 1 ] = 3374; 2921; 2866; 1590; 1465; 1386; 1279; 1246; 1169; 1102; 1058; 954; 898; 831; 707; MS (EI, 70 ev): m/z = 95 [(M) + ], 94, 80, 67, 53 The 1 H NMR data is in accordance to literature. 6 2 Methyl 3 propyl 1H pyrrole (6d) Pyrrole 6d was obtained by procedure A as a light yellow oil (1.27 g, 10.3 mmol, 59%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.94 (t, 3 J 3,2 = 7.3 Hz, 3H, 3 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.36 (t, 3 J 1,2 = 7.6 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 3 ), (C 2 ), (C 1 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3380; 2957; 2927; 2871; 1713; 1584; 1464; 1377; 1277; 1106; 1068; 956; 904; 832; 801; 709; MS (EI, 70 ev): m/z = 123 [(M) + ], 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 8 H 14 N (M + H) + = found = Butyl 2 methyl 1H pyrrole (6e) Pyrrole 6e was obtained by procedure A as a light yellow oil (813 mg, 5.9 mmol, 48%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.92 (t, 3 J 4,3 = 7.4 Hz, 3H, 4 H), (m, 2H, 3 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.38 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.7 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 4 ), (C 3 ), (C 1 ), (C 2 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2926; 2857; 1585; 1465; 1378; 1274; 1247; 1106; 1065; 955; 902; 832; 709; 666; MS (EI, 70 ev): m/z = 137 [(M) + ], 122, 120, 108, 106,.94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 9 H 16 N (M + H) + = found = S11
14 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Pyrrole 6a was obtained by procedure A as a light yellow oil (1,13 g, 7,47 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 6.9 Hz, 2H, 5 H), (m, 4H, 3, 4 H), 1.53 (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.7 Hz, 4 J 4,1 = 2.6 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 5 ), (C 4 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3381; 2957; 2856; 1464; 1378; 1108; 901; 832; 711; 667; MS (EI, 70 ev): m/z = 151 [(M) + ], 94, 80, 67 The NMR, IR and MS data are in accordance to literature. 7 3 Hexyl 2 methyl 1H pyrrole (6f) Pyrrole 6f was obtained by procedure A as a light yellow oil (771 mg, 4.7 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 6,5 = 6.3 Hz, 3H, 6 H), (m, 6H, 3, 4, 5 H), (m, 2H, 2 H), 2.17 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.68 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 6 ), 22.73, (C 1 ), 29.29, (C 2 ), 31.86, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2924; 2854; 1585; 1465; 1378; 1245; 1108; 1065; 954; 902; 832; 709; 667; MS (EI, 70 ev): m/z = 165 [(M) + ], 136, 122, 106, 94, 80, 53; HRMS (ESI FTMS, positive ion): calculated for C 11 H 20 N (M + H) + = found = Methyl 3 octyl 1H pyrrole (6g) Pyrrole 6g was obtained by procedure A as a light yellow oil (1.03 g, 5.3 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 8,7 = 6.9 Hz, 3H, 8 H), (m, 10H, 3, 4, 5, 6, 7 H), (m, 3H, 2 H), 2.18 (s, 3H, 1 H), (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 8 ), 22.71, (C 1 ), 29.37, 29.59, 29.62, (C 2 ), 31.96, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2923; 2854; 1720; 1464; 1378; 1279; 1109; 1076; 955; 901; 832; 709; S12
15 671; MS (EI, 70 ev): m/z = 193 [(M) + ], 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 13 H 24 N (M + H) + = found = Decyl 2 methyl 1H pyrrole (6h) Pyrrole 6h was obtained by procedure A as a light yellow solid (754 mg, 3.4 mmol, 36%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 10,9 = 6.8 Hz, 3H, 10 H), (m, 14H, 3, 4,5, 6, 7, 8 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 10 ), 22.71, (C 1 ), 29.38, 29.62, 29.68, 29.71, 31.37, 31.93, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2922; 2853; 1465; 1378; 1246; 1110; 953; 901; 832; 709; 670; MS (EI, 70 ev): m/z = 221 [(M) + ], 206, 192, 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = Dodecyl 2 methyl 1H pyrrole (6i) Pyrrole 6i was obtained by procedure A as a light yellow solid (1.06 g, 4.2 mmol, 41%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 12,11 = 6.9 Hz, 3H, 12 H), (m, 18H, 3, 4, 5, 6, 7, 8, 9, 10, 11 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 12 ), 22.71, (C 1 ), 29.38, 29.63, 29.67, 29.72, (C 2 ), 31.95, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2922; 2853; 1465; 1378; 1246; 1110; 901; 831; 710; 670; MS (EI, 70 ev): m/z = 249 [(M) + ], 234, 220, 206, 192, 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 17 H 32 N (M + H) + = found = S13
16 2 Ethyl 3 pentyl 1H pyrrole (6p) Pyrrole 6p was obtained by procedure A as a light yellow oil (121 mg, 0.7 mmol, 7%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 7.0 Hz, 3H, 5 H), 1.19 (t, 3 J 2,1 = 7.6 Hz, 3H, 2 H), (m, 4H, 3, 4 H), (m, 2H, 2 H), 2.39 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.58 (q, 3 J 1,2 = 7.6 Hz, 2H, 1 H), 6.02 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.74 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 2 ), (C 1 ), (C 3 ), (C 1 ), (C 2 ), (C 4 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3386; 2960; 2926; 2855; 1684; 1465; 1377; 1326; 1110; 1064; 1010; 956; 900; 831; 713; MS (EI, 70 ev): m/z = 165 [(M) + ], 150, 136, 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 11 H 20 N (M + H) + = found = Butyl 3 propyl 1H pyrrole (6q) Pyrrole 6q was obtained by procedure A as a light yellow oil (248 mg, 1.5 mmol, 14%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.92 (t, 3 J 3,2 = 7.4 Hz, 3H, 3 H), 0.94 (t, 3 J 4,3 = 7.3 Hz, 3H, 4 H), (m, 2H, 3 H), (m, 4H, 2, 2 H), 2.36 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.54 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.72 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 3 ), (C 4 ), (C 3 ), (C 2 ), (C 1 ), (C 1 ), (C 2 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3386; 2956; 2929; 2872; 2159; 1696; 1579; 1457; 1403; 1378; 1251; 1111; 1074; 1018; 905; 831; 803; 709; MS (EI, 70 ev): m/z = 165 [(M) + ], 136, 122, 106, 94, 80, 67, 53 The 1 H NMR and 13 C NMR data are in accordance to literature. 8 3 Butyl 2 pentyl 1H pyrrole (6r) Pyrrole 6r was obtained by procedure A as a light yellow oil (456 mg, 2.4 mmol, 27%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 4,3 = 6.8 Hz, 3H, 4 H), 0.92 (t, 3 J 5,4 = 7.4 Hz, 3H, 5 H), (m, 6H, 3, 4, 3 H), (m, 4H, 2, 2 H), 2.39 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.53 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.71 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 4 ), (C 5 ), (C 3 ), (C 4 ), (C 1 ), (C 1 ), (C 2 ), (C 3 ), (C 2 ), S14
17 (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3387; 2957; 2926; 2857; 1459; 1378; 1246; 1112; 1078; 1031; 960; 903; 832; 708; MS (EI, 70 ev): m/z = 193 [(M) + ], 150, 136, 94, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 13 H 24 N (M + H) + = found = Hexyl 3 pentyl 1H pyrrole (6s) Pyrrole 6s was obtained by procedure A as a light yellow oil (781 mg, 3.5 mmol, 35%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 6H, 6, 5 H), (m, 10H, 3, 4, 5, 3, 4 H), (m, 4H, 2, 2 H), 2.38 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), 2.53 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.71 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 6 ), 22.64, 22.66, (C 1 ), (C 1 ), 29.18, 30.24, 31.25, 31.71, 31.89, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3385; 2956; 2925; 2855; 1460; 1378; 1113; 1075; 901; 831; 708; MS (EI, 70 ev): m/z = 221 [(M) + ], 206, 192, 178, 164, 150, 136, 120, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = Tosyl 1H pyrrole (12) Pyrrole 12 was obtained by procedure B as a white grey solid (6.127 g, 28 mmol, 93%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.40 (s, 3H, 7 H), 6.28 (dd, 3 J 3,2/3,4/4,3/4,5 = 2.3 Hz, 2H, 3, 4 H), 7.15 (dd, 3 J 2,3/2,4/5,3/5,4 = 2.3 Hz, 2H, 2, 5 H), 7.28 (d, 3 J 3,2 /5,6 = 8.3 Hz, 2H, 3, 5 H), 7.74 (d, 3 J 2,3 /6,5 = 8.3 Hz, 2H, 2, 6 H); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 7 ), (C 3, 4), (C 2, 5), (C 2, 6 ), (C 3, 5 ), (C 1 ), (C 4 ); IR (atr film): ῦ [cm 1 ] = 3142; 1596; 1538; 1494; 1459; 1401; 1360; 1309; 1292; 1182; 1169; 1078; 1058; 1034; 1016; 935; 812; 797; 755; 717; 702; 671; MS (EI, 70 ev): m/z = 221 [(M) + ], 155, 91, 65 The 1 H NMR, 13 C NMR, IR and MS data are in accordance to literature. 9 S15
18 3 Ethyl 1H pyrrole (6j) Pyrrole 6j was obtained by procedure B as a light yellow oil (123 mg, 1.3 mmol, 57%). 1 H NMR (600 MHz, CDCl 3 ): δ = 1.21 (t, 3 J 2,1 = 7.6 Hz, 3H, 2 H), 2.53 (q, 3 J 1,2 = 7.6 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.98 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 2 ), (C 1 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3402; 2962; 2928; 2858; 1718; 1462; 1379; 1279; 1127; 1068; 965; 930; 888; 837; 762; 704; 665; MS (EI, 70 ev): m/z = 95 [(M) + ], 80, 53 The 1 H NMR data is in accordance to literature Propyl 1H pyrrole (6k) Pyrrole 6k was obtained by procedure B as a light yellow oil (161 mg, 1.5 mmol, 66%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.95 (t, 3 J 3,2 = 7.3 Hz, 3H, 3 H), (m, 2H, 2 H), 2.46 (t, 3 J 1,2 = 7.6 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 3 ), (C 2 ), (C 1 ), (C 4), (C 2), (C 5), 124,49 (C 3); IR (atrfilm): ῦ [cm 1 ] = 3395; 2958; 2928; 2872; 1684; 1485; 1457; 1378; 1263; 1138; 1062; 961; 888; 839; 767; 710; MS (EI, 70 ev): m/z = 109 [(M) + ], 94, 80, 67, 53 The 13 C NMR data is in accordance to literature Pentyl 1H pyrrole (6l) Pyrrole 6l was obtained by procedure B as a light yellow oil (233 mg, 1.7 mmol, 40%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 6.2 Hz, 3H, 11 H), (m, 4H, 3, 4 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 4 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3396; 2957; 2925; 2856; 1710; 1485; 1466; 1379; 1290; 1138; 1061; 960; 920; 887; 841; 766; 707; MS (EI, 70 ev): m/z = 137 [(M) + ], 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 9 H 16 N (M + H) + = found = The 13 C NMR data is in accordance to literature. 11 S16
19 3 Hexyl 1H pyrrole (6m) Pyrrole 6m was obtained by procedure B as a light yellow oil (96 mg, 0.6 mmol, 67%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 6,5 = 6.9 Hz, 3H, 6 H), (m, 6H, 3, 4, 5 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 5 ), (C 1 ), (C 3 ), (C 2 ), (C 4 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3396; 2957; 2924; 2855; 1485; 1466; 1378; 1138; 1061; 955; 887; 840; 771; 707; MS (EI, 70 ev): m/z = 151 [(M) + ], 136, 122, 108, 94, 80, 67, 53 The 13 C NMR data is in accordance to literature Octyl 1H pyrrole (6n) Pyrrole 6n was obtained by procedure B as a light yellow solid (235 mg, 1.3 mmol, 58%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 8,7 = 6.8 Hz, 3H, 8 H), (m, 10H, 3, 4, 5, 6, 7 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 8 ), (C 7 ), (C 1 ), 29.35, 29.55, 29.59, (C 2 ), (C 6 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3394; 2956; 2923; 2854; 1465; 1378; 1062; 958; 887; 839; 767; 708; MS (EI, 70 ev): m/z = 179 [(M) + ], 150, 136, 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 12 H 22 N (M + H) + = found = Undecyl 1H pyrrole (6o) Pyrrole 6o was obtained by procedure B as a light yellow solid (120 mg, 0.5 mmol, 46%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 11,10 = 6.9 Hz, 3H, 11 H), (m, 16H, 3, 4, 5, 6, 7, 8, 9, 10 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 11 ), 22.71, (C 1 ), 29.37, 29.58, S17
20 29.60, 29.67, 29.69, 29.72, (C 2 ), 31.94, (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3393; 2922; 2853; 1466; 1378; 1138; 1062; 957; 887; 838; 768; 708; MS (EI, 70 ev): m/z = 221 [(M) + ], 192, 178, 164, 150, 136, 122, 108, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = H Pyrrole 2 carbaldehyde (15) Pyrrole 15 was obtained by procedure C as a white solid (901 mg, 9.5 mmol, 95%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 1H, 4 H), (m, 1H, 3 H), (m, 1H, 5 H), 9.52 (s, 1H, 1 H), (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 4), (C 3), (C 5), (C 2), (C 1 ); IR (atr film): ῦ [cm 1 ] = 3266; 2983; 2831; 1726; 1623; 1551; 1439; 1402; 1351; 1310; 1251; 1133; 1091; 1035; 965; 880; 847; 745; MS (EI, 70 ev): m/z = 95 [(M) + ], 66 The 1 H NMR and 13 C NMR data are in accordance to literature Methyl 1H pyrrole (6b) Pyrrole 6b was obtained by procedure C as a light yellow oil (667 mg, 8.2 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.28 (s, 3H, 1 H), (m, 1H, 4 H), (m, 1H, 3 H), (m, 1H, 5 H), 7.86 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 4), (C 3), (C 5), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 3098; 2918; 1717; 1572; 1460; 1413; 1381; 1270; 1234; 1118; 1095; 1026; 978; 951; 885; 781; 706; MS (EI, 70 ev): m/z = 81 [(M) + ], 80, 53 The 1 H NMR and 13 C NMR data are in accordance to literature. 8 3 Allyl 2 methyl 1H pyrrole (6t) Pyrrole 6t was obtained by procedure A as a light yellow oil (440 mg, 3.6 mmol, 21%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.18 (s, 3H, 1 H), (d, 3 J 1,2 = 6.4 Hz, 2H, 1 H), 4.97 (d, 3 J 3,2 = 10.1 Hz, 1H, 3 H a ), 5.03 (dd, 3 J 3,2 = 17.1 Hz, 2 J 3a,3b = 1.8 Hz,1H, 3 H b ), 5.93 (ddt, 3 J 2,3b = 16.6 Hz, 3 J 2,3a = 10.0 Hz, 3 J 2,1 = 6.5 Hz, 1H, 2 H), 6.00 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.74 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 4), (C 3 ), (C 5), (C 3), (C 2), (C 2 ); IR (atr film): S18
21 ῦ [cm 1 ] = 3379; 3077; 2977; 2912; 1638; 1585; 1464; 1432; 1275; 1250; 1107; 993; 956; 910; 834; 771; 708; 672; MS (EI, 70 ev): m/z = 121 [(M) + ], 106, 94, 80, 53 The 1 H NMR and 13 C NMR data are in accordance to literature Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Pyrrole 6u was obtained by procedure A as a light yellow oil (470 mg, 3.2 mmol, 45%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 2H, 2 H), (m, 2H, 3 H), 2.18 (s, 3H, 1 H), 2.40 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), 4.95 (dd, 3 J 5,4 = 10.2 Hz, 2 J 5a,5b = 1.8Hz, 1H, 5 H a ), 5.02 (dd, 3 J 5,4 = 17.2 Hz, 2 J 5a,5b = 1.8Hz, 1H, 5 H b ), 5.85 (ddt, 3 J 4,5b = 17.0 Hz, 3 J 4,5a = 10.2 Hz, 3 J 4,3 = 6.6 Hz, 1H, 4 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 5 ), (C 5), (C 3), (C 2), (C 4 ); IR (atr film): ῦ [cm 1 ] = 3380; 3077; 2977; 2927; 2855; 1708; 1640; 1586; 1442; 1246; 1108; 991; 907; 832; 710; MS (EI, 70 ev): m/z = 149 [(M) + ], 134, 121, 107, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 10 H 16 N (M + H) + = found = S19
22 S8. NMR Spectra of synthesized compounds 2,3 Dimethyl 1H pyrrole (6c) Figure S 4 S20
23 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 5 S21
24 3 Butyl 2 methyl 1H pyrrole (6d) Figure S 6 S22
25 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 7 S23
26 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 8 S24
27 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 9 S25
28 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 10 S26
29 3 Dodecyl 2 methyl 1H pyrrole (6i) Figure S 11 S27
30 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 12 S28
31 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 13 S29
32 3 Butyl 2 pentyl 1H pyrrole (6r) Figure S 14 S30
33 2 Hexyl 3 pentyl 1H pyrrole (6s) Figure S 15 S31
34 1 Tosyl 1H pyrrole (12) Figure S 16 S32
35 3 Ethyl 1H pyrrole (6j) Figure S 17 S33
36 3 Propyl 1H pyrrole (6k) Figure S 18 S34
37 3 Pentyl 1H pyrrole (6l) Figure S 19 S35
38 3 Hexyl 1H pyrrole (6m) Figure S 20 S36
39 3 Octyl 1H pyrrole (6n) Figure S 21 S37
40 3 Undecyl 1H pyrrole (6o) Figure S 22 S38
41 1H Pyrrole 2 carbaldehyde (15) Figure S 23 S39
42 2 Methyl 1H pyrrole (6b) Figure S 24 S40
43 3 Allyl 2 methyl 1H pyrrole (6t) Figure S 25 S41
44 2 Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Figure S 26 S42
45 S9. LC MS traces of prodiginines produced by precursor directed biosynthesis Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 27 Prodiginine 1e and prodigiosin (1a) Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 28 Prodigiosin (1a) and prodiginine 1f S43
46 S10. Effective precursor concentration and DMSO toxicity Figure S 29 Prodigiosin (1a) titer of P. putida pig r2 ΔpigD supplemented with different concentrations of MAP (6a). Prodigiosin production was observed by means of photometric absorption of ethanolic extracts at 535 nm. Figure S 30 Dose response analysis of P. putida pig r2 ΔpigD exposed to DMSO. The toxicity was investigated by measuring the biomass after 15 h of cultivation. Effective concentrations are: EC 20 = 6.5%; EC 50 = 4.5%; EC 80 = 3.1%. S44
47 S11. LC MS traces of prodiginines produced by mutasynthesis Precursor: 2,3 Dimethyl 1H pyrrole (6c) Figure S 31 Prodiginine 1c Precursor: 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 32 Prodiginine 1d S45
48 Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 33 Prodiginine 1e Precursor: 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 34 Prodigiosin (1a) S46
49 Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 35 Prodiginine 1f Precursor: 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 36 Prodiginine 1g S47
50 Precursor: 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 37 Prodiginine 1h Precursor: 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 38 Prodiginine 1q S48
51 Precursor: 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 39 Prodiginine 1p Precursor: 3 Pentyl 1H pyrrole (6l) Figure S 40 Prodiginine 1l S49
52 Precursor: 3 Hexyl 1H pyrrole (6m) Figure S 41 Prodiginine 1m Precursor: 3 Octyl 1H pyrrole (6n) Figure S 42 Prodiginine 1n S50
53 Precursor: 3 Allyl 2 methyl 1H pyrrole (6t) Figure S 43 Prodiginine 1t Precursor: 2 Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Figure S 44 Prodiginine 1u S51
54 S12. NMR Spectra of prodiginines (mutasynthesis: preparative scale) Prodigiosin (1a) Figure S 45 S52
55 Prodiginine 1u Figure S 46 1 H NMR: Signals at 1.25 ppm and 0.89 ppm are assigned to polyurethane. S53
56 Prodiginine 1d Figure S 47 S54
57 Prodiginine 1g Figure S 48 S55
58 Prodigiosin (1a) HCl Prodigiosin (1a) was obtained by mutasynthesis in preparative scale as a dark red solid (17.2 mgl 1, 53.2 µmol, 11%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.90 (t, 3 J 11,10 = 6.9 Hz, 3H, 11 H), (m, 4H, 9 H, 10 H), (m, 2H, 7 H), 2.39 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 3.99 (s, 3H, 7 H), 6.07 (d, 4 J 4,1 = 1.7 Hz, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), 6.91 (ddd, 3 J 3,4 = 4.0 Hz, 4 J 3,5 = 2.4 Hz, 5 J 3,1 = 1.2 Hz, 1H, 3 H), 6.94 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 11 ), (C 10 ), (C 7 ), (C 8 ), (C 9 ), (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 4 ), (C 3 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3150, 3102, 3071, 2955, 2922, 2855, 1628, 1605, 1578, 1545, 1508, 1449, 1412, 1387, 1356, 1339, 1329, 1261, 1252, 1200, 1138, 1082, 1067, 1043, 1026, 997, 989, 959, 891, 835, 808, 785, 777, 745, 737, 718, 698, 648, 623; HRMS (ESI FTMS, positive ion): calculated for C 20 H 26 N 3 O (M + H) + = found = The analytical data is in accordance to literature. 1 Prodiginine 1u, 4 methoxy 5 ((5 methyl 4 (pent 4 en 1 yl) 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrole HCl Prodiginine 1u was obtained by mutasynthesis in preparative scale as a dark red solid (19.8 mgl 1, 61.6 µmol, 12%). 1 H NMR (600 MHz, CDCl 3 ): δ = 1.65 (tt, 3 J 8,9 /8,7 = 7.5 Hz, 2H, 8 H), 2.10 (dd, 3 J 9,10 /9,8 = 7.2 Hz, 2H, 9 H), 2.42 (t, 3 J 7,8 = 7.7 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 4.01 (s, 3H, 7 H), 4.99 (dd, 3 J 11 a,10 = 10.3 Hz, 2 J 11 a,11 b = 1.8 Hz, 1H, 11 a H), 5.03 (dd, 3 J 11 b,10 = 17.1 Hz, 2 J 11 b,11 a = 1.8 Hz, 1H, 11 b H), 5.82 (ddt, 3 J 10,11 b = 17.0 Hz, 3 J 10,11 a = 10.2 Hz, 3 J 10,9 a = 6.6 Hz, 1H, 10 H), 6.08 (d, 4 J 4,1 = 1.9 Hz, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 7 ), (C 8 ), (C 9 ), (C 7 ), (C 4 ), (C 4), (C 11 ), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 3 ), (C 4 ), (C 10 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 2958; 2928; 2858; 1728; 1631; 1605; 1577; 1545; 1514; 1464; 1377; 1277; 1123; 1071; 1041; 989; 961; 743; HRMS (ESI FTMS, positive ion): calculated for C 20 H 24 N 3 O (M + H) + = found = S56
59 Prodiginine 1d, 4 Methoxy 5 ((5 methyl 4 propyl 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrolee HCl Prodiginine 1d was obtained by mutasynthesis in preparative scale as a dark red solid (10.5 mgl 1, 35.5 µmol, 7%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.94 (t, 3 J 9,8 = 7.3 Hz, 3H, 9 H), (m, 2H, 8 H), 2.38 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.55 (s, 3H, 6 H), 4.00 (s, 3H, 7 H), 6.08 (d, 4 J 4,1 = 1.9 Hz, 1H, 4 H), (m, 1H, 4 H), 6.68 (d, 4 J 4,1 = 2.6 Hz, 1H, 4 H), 6.92 (ddd, 3 J 3,4 = =3.7 Hz, 4 J 3,5 = 2.4 Hz, 5 J 3,1 = 1.2 Hz, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 9 ), (C 8 ), (C 7 ), (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 3 ), (C 4 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3157, 3100, 2959, 2926, 1724, 1635, 1607, 1575, 1542, 1513, 1451, 1416, 1338, 1279, 1263, 1250, 1157, 1135, 1083, 1067, 1043, 987, 960, 901, 881, 838, 816, 783, , 697, 665; HRMS (ESI FTMS, positive ion): calculated for C 18 H 22 N 3 O (M + H) + = found = Prodiginine 1g, 4 methoxy 5 ((5 methyl 4 octyl 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrole HCl Prodiginine 1g was obtained by mutasynthesis in preparative scale as a dark red solid (3.8 mgl 1, 10.4 µmol, 2%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 14,13 = 6.9 Hz, 3H, 14 H), (m, 10H, 9, 10, 11, 12, 13 H), (m, 2H, 8 H), 2.39 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 4.00 (s, 3H, 7 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 14 ), 22.67, (C 7 ), 29.27, 29.29, 29.44, (C 8 ), 31.88, (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 4 ), (C 3 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3162, 3100, 2955, 2921, 2852, 1635, 1607, 1577, 1544, 1512, 1456, 1413, 1387, 1354, 1328, 1279, 1264, 1251, 1144, 1135, 1107, 1066, 1043, 1000, 988, 958, 887, 838, 813, 745, 718, 697; HRMS (ESI FTMS, positive ion): calculated for C 23 H 32 N 3 O (M + H) + = found = S57
60 S13. LC MS traces of prodiginines produced by in vitro biotransformation with PigC Precursor: 2,3 Dimethyl 1H pyrrole (6c) Figure S 49 Prodiginine 1c Precursor: 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 50 Prodiginine 1d S58
61 Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 51 Prodiginine 1e Precursor: 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 52 Prodigiosin (1a) S59
62 Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 53 Prodiginine 1f Precursor: 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 54 Prodiginine 1g S60
63 Precursor: 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 55 Prodiginine 1h Precursor: 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 56 Prodiginine 1q S61
64 Precursor: 3 Butyl 2 pentyl 1H pyrrole (6r) Figure S 57 Prodiginine 1r Precursor: 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 58 Prodiginine 1p S62
65 Precursor: 3 Pentyl 1H pyrrole (6l) Figure S 59 Prodiginine 1l Precursor: 3 Hexyl 1H pyrrole (6m) Figure S 60 Prodiginine 1m S63
66 Precursor: 3 Octyl 1H pyrrole (6n) Figure S 61 Prodiginine 1n Precursor: 2 Methyl 1H pyrrole (6b) Figure S 62 Prodiginine 1b S64
67 S14. Extinction coefficients of prodiginines Figure S 63 Determination of extinction coefficients at 535 nm in acidified ethanol (4% v/v of 1 N HCl): ε 535 (1d) = 125,776 ± 6,450 M 1 cm 1 and ε 535 (1g) = 189,904 ± 2,950 M 1 cm 1. Approximation for ε 535 (1c) = 90,943 M 1 cm 1 ε 535 (1e) = 132,946 M 1 cm 1, ε 535 (1f) = 160,948 M 1 cm 1, ε 535 (1h) = 216,952 M 1 cm 1. For prodigiosin (1a) the previously reported molar extinction coefficient ε 535 (1a) = 139,800 ± 5,100 M 1 cm 1 was used. S65
68 S15. EC 50 values Table S 3 EC 50 values of tested compounds. compound EC 50 [nm] SD 1a d g q u Obatoclax mesylate (9) S66
69 S16. Vector maps S67
70 S17. References [1] Domröse, A., Klein, A. S., Hage Hülsmann, J., Thies, S., Svensson, V., Classen, T., Pietruszka, J., Jaeger, K. E., Drepper, T., and Loeschcke, A. (2015) Efficient recombinant production of prodigiosin in Pseudomonas putida, Front. Microbiol. 6, 972. [2] Katritzky, A. R., Ledoux, S., and Nair, S. K. (2003) Benzannulation of 3 substituted pyrroles to indoles, J. Org. Chem. 68, [3] Huffman, J. W., Smith, V. J., and Padgett, L. W. (2008) Acylation of N p toluenesulfonylpyrrole under Friedel Crafts conditions: evidence for organoaluminum intermediates, Tetrahedron 64, [4] Kakushima, M., Hamel, P., Frenette, R., and Rokach, J. (1983) Regioselective synthesis of Acylpyrroles, J. Org. Chem. 48, [5] He, Y., Lin, M., Li, Z., Liang, X., Li, G., and Antilla, J. C. (2011) Direct synthesis of chiral 1,2,3,4 tetrahydropyrrolo[1,2 a]pyrazines via a catalytic asymmetric intramolecular aza Friedel Crafts reaction, Org. Lett. 13, [6] Poirel, A., De Nicola, A., Retailleau, P., and Ziessel, R. (2012) Oxidative coupling of 1,7,8 unsubstituted BODIPYs: synthesis and electrochemical and spectroscopic properties, J. Org. Chem. 77, [7] Williamson, N. R., Simonsen, H. T., Ahmed, R. A. A., Goldet, G., Slater, H., Woodley, L., Leeper, F. J., and Salmond, G. P. C. (2005) Biosynthesis of the red antibiotic, prodigiosin, in Serratia: identification of a novel 2 methyl 3 n amyl pyrrole (MAP) assembly pathway, definition of the terminal condensing enzyme, and implications for undecylprodigiosin biosynthesis in Streptomyces, Mol. Microbiol. 56, [8] Trofimov, B. A., Mikhaleva, A. b. I., Ivanov, A. V., Shcherbakova, V. S., and Ushakov, I. A. (2015) Expedient one pot synthesis of pyrroles from ketones, hydroxylamine, and 1,2 dichloroethane, Tetrahedron 71, [9] Schmidt, B., Krehl, S., and Jablowski, E. (2012) Assisted tandem catalytic RCM aromatization in the synthesis of pyrroles and furans, Org. Biomol. Chem. 10, [10] Hodgson, D. M., Bebbington, M. W. P., and Willis, P. (2003) Development of two processes for the synthesis of bridged azabicyclic systems: intermolecular radical addition homoallylic rearrangements leading to 2 azanorborn 5 enes and neophyl type radical rearrangements to 2 azabenzonorbornanes, Org. Biomol. Chem. 1, [11] Garrido, D. O. A., Buldain, G., Ojea, M. I., and Frydman, B. (1988) Synthesis of 2 alkylputrescines from 3 alkylpyrroles, J. Org. Chem. 53, [12] Law, K. R., and McErlean, C. S. (2013) Extending the Stetter reaction with 1,6 acceptors, Chem. Eur. J. 19, [13] Vasil'tsov, A. M., Mikhaleva, A. I., Nesterenko, R. N., and Sigalov, M. V. (1992) Alkenylation by 5 hexen 2 one oxime: Prototropic isomerization under Trofimov reaction conditions, Chem. Heterocycl. Compd. 28, S68
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Highly enantioselective cascade synthesis of spiropyrazolones. Supporting Information. NMR spectra and HPLC traces
Highly enantioselective cascade synthesis of spiropyrazolones Alex Zea a, Andrea-Nekane R. Alba a, Andrea Mazzanti b, Albert Moyano a and Ramon Rios a,c * Supporting Information NMR spectra and HPLC traces
Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
Supporting Information. Experimental section
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information Experimental section General. Proton nuclear magnetic resonance ( 1
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Supporting Information
Supporting Information Copper/Silver Cocatalyzed Oxidative Coupling of Vinylarenes with ICH 2 CF 3 or ICH 2 CHF 2 Leading to β-cf 3 /CHF 2 -Substituted Ketones Niannian Yi, Hao Zhang, Chonghui Xu, Wei
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Supporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran
1 Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran Munawar Hussain, a Rasheed Ahmad Khera, a Nguyen Thai Hung, a Peter Langer* a,b a Institut für Chemie, Universität Rostock,
Supporting information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting information Copper-catalysed intramolecular O-arylation: a simple
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Facile construction of the functionalized 4H-chromene via tandem. benzylation and cyclization. Jinmin Fan and Zhiyong Wang*
Facile construction of the functionalized 4H-chromene via tandem benzylation and cyclization Jinmin Fan and Zhiyong Wang* Hefei National Laboratory for Physical Science at Microscale, Joint- Lab of Green
Supporting information
Electronic upplementary Material (EI) for New Journal of Chemistry. This journal is The Royal ociety of Chemistry and the Centre National de la Recherche cientifique 7 upporting information Lipase catalyzed,-addition
Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines
Direct Palladium-Catalyzed Arylations of Aryl Bromides with 2/9-Substituted Pyrimido[5,4-b]indolizines Min Jiang, Ting Li, Linghua Meng, Chunhao Yang,* Yuyuan Xie*, and Jian Ding State Key Laboratory of
Supplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
Room Temperature Highly Diastereoselective Zn-Mediated. Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled
Supporting Information for: Room Temperature Highly Diastereoselective Zn-Mediated Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled Stereoselectivity Reversal
Supporting Information
Supporting Information Montmorillonite KSF-Catalyzed One-pot, Three-component, Aza-Diels- Alder Reactions of Methylenecyclopropanes With Arylaldehydes and Aromatic Amines Li-Xiong Shao and Min Shi* General
First DMAP-mediated direct conversion of Morita Baylis. Hillman alcohols into γ-ketoallylphosphonates: Synthesis of
Supporting Information File 1 for First DMAP-mediated direct conversion of Morita Baylis Hillman alcohols into γ-ketoallylphosphonates: Synthesis of γ-aminoallylphosphonates Marwa Ayadi 1,2, Haitham Elleuch
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Vilsmeier Haack reagent-promoted formyloxylation of α-chloro-narylacetamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 205 Vilsmeier aack reagent-promoted formyloxylation of α-chloro-arylacetamides by formamide Jiann-Jyh
Hiyama Cross-Coupling of Chloro-, Fluoroand Methoxy- pyridyl trimethylsilanes : Room-temperature Novel Access to Functional Bi(het)aryl
Hiyama Cross-Coupling of Chloro-, Fluoroand Methoxy- pyridyl trimethylsilanes : Room-temperature Novel Access to Functional Bi(het)aryl Philippe Pierrat, Philippe Gros* and Yves Fort Synthèse Organométallique
Supporting Information for
Supporting Information for An atom-economic route to densely functionalized thiophenes via base-catalyzed rearrangement of 5-propargyl-2H-thiopyran-4(3H)-ones Chunlin Tang a, Jian Qin b, Xingqi Li *a a
Supporting Information for Iron-catalyzed decarboxylative alkenylation of cycloalkanes with arylvinylic carboxylic acids via a radical process
Supporting Information for Iron-catalyzed decarboxylative alkenylation of cycloalkanes with arylvinylic carboxylic acids via a radical process Jincan Zhao 1, Hong Fang 1, Jianlin Han* 1,2 and Yi Pan* 1
Aminofluorination of Fluorinated Alkenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Synthesis of ɑ CF 3 and ɑ CF 2 H Amines via Aminofluorination of Fluorinated Alkenes Ling Yang,
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Supporting Information
Supporting Information Ceric Ammonium Nitrate (CAN) catalyzed efficient one-pot three component aza-diels-alder reactions for a facile synthesis of tetrahydropyranoquinoline derivatives Ravinder Goud Puligoundla
Efficient and Simple Zinc mediated Synthesis of 3 Amidoindoles
Electronic Supplementary Material (ESI) for rganic and Biomolecular Chemistry SUPPRTIG IFRMATI Efficient and Simple Zinc mediated Synthesis of 3 Amidoindoles Anahit Pews-Davtyan and Matthias Beller* Leibniz-Institut
Supporting Information. Synthesis and biological evaluation of 2,3-Bis(het)aryl-4-azaindoles Derivatives as protein kinases inhibitors
Supporting Information Synthesis and biological evaluation of 2,3-Bis(het)aryl-4-azaindoles Derivatives as protein kinases inhibitors Frédéric Pin, a Frédéric Buron, a Fabienne Saab, a Lionel Colliandre,
Supporting Information
Supporting Information Wiley-VC 007 9 Weinheim, Germany ew ear Infrared Dyes and Fluorophores Based on Diketopyrrolopyrroles Dipl.-Chem. Georg M. Fischer, Dipl.-Chem. Andreas P. Ehlers, Prof. Dr. Andreas
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Synthesis of 3-omosubstituted Pyrroles via Palladium- Catalyzed Intermolecular Oxidative Cyclization
Synthesis and evaluation of novel aza-caged Garcinia xanthones
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry Synthesis and evaluation of novel aza-caged Garcinia xanthones Xiaojin Zhang, a,1 Xiang Li, a,1 Haopeng Sun, * b Zhengyu Jiang,
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
The Free Internet Journal for Organic Chemistry
The Free Internet Journal for Organic Chemistry Paper Archive for Organic Chemistry Arkivoc 2018, part iii, S1-S6 Synthesis of dihydropyranones and dihydropyrano[2,3- d][1,3]dioxine-diones by cyclization
Supporting Information. Table of Contents. II. Experimental procedures. II. Copies of 1H and 13C NMR spectra for all compounds
Electronic upplementary Material (EI) for rganic & Biomolecular Chemistry. This journal is The Royal ociety of Chemistry 2017 Laboratoire de Méthodologie et ynthèse de Produit aturels. Université du Québec
Supporting Information. Experimental section
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information Experimental section General. Anhydrous solvents were transferred by
Iodine-catalyzed synthesis of sulfur-bridged enaminones and chromones via double C(sp 2 )-H thiolation
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2017 Iodine-catalyzed synthesis of sulfur-bridged enaminones and chromones via
Electronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry Electronic Supplementary Information (ESI) For Iron-Catalysed xidative Amidation of Alcohols with Amines Silvia Gaspa, a Andrea
Oxyhalogenation of thiols and disulfides into sulfonyl chlorides/ bromides in water using oxone-kx(x= Cl or Br)
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2014 Oxyhalogenation of thiols and disulfides into sulfonyl chlorides/ bromides in water using
Tributylphosphine-Catalyzed Cycloaddition of Aziridines with Carbon Disulfide and Isothiocyanate
upporting Information Tributylphosphine-Catalyzed Cycloaddition of Aziridines with Carbon Disulfide and Isothiocyanate Jing-Yu Wu, Zhi-Bin Luo, Li-Xin Dai and Xue-Long Hou* a tate Key Laboratory of Organometallic
Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A. new Entry to N-Carbamate Protected Arylamines
Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A new Entry to N-Carbamate Protected Arylamines Bing Zhou,* Juanjuan Du, Yaxi Yang,* Huijin Feng, Yuanchao Li Shanghai Institute of Materia Medica,
The N,S-Bidentate Ligand Assisted Pd-Catalyzed C(sp 2 )-H. Carbonylation using Langlois Reagent as CO Source. Supporting Information.
Electronic upplementary Material (EI) for rganic & Biomolecular Chemistry. This journal is The Royal ociety of Chemistry 2018 The,-Bidentate Ligand Assisted Pd-Catalyzed C(sp 2 )-H Carbonylation using
ESI for. A simple and efficient protocol for the palladium-catalyzed. ligand-free Suzuki reaction at room temperature in aqueous DMF.
ESI for A simple and efficient protocol for the palladium-catalyzed ligand-free Suzuki reaction at room temperature in aqueous DMF Chun Liu,* Qijian i, Fanying Bao and Jieshan Qiu State Key Laboratory
Ferric(III) Chloride Catalyzed Halogenation Reaction of Alcohols and Carboxylic Acids using - Dichlorodiphenylmethane
Supporting Information Ferric(III) Chloride Catalyzed Halogenation Reaction of Alcohols and Carboxylic Acids using - Dichlorodiphenylmethane Chang-Hee Lee,, Soo-Min Lee,, Byul-Hana Min, Dong-Su Kim, Chul-Ho
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 1 A Facile Way to Synthesize 2H-Chromenes: Reconsideration of the Reaction Mechanism between Salicylic Aldehyde and
Kishore Natte, Jianbin Chen, Helfried Neumann, Matthias Beller, and Xiao-Feng Wu*
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 204 Kishore Natte, Jianbin Chen, Helfried Neumann, Matthias Beller, and Xiao-Feng
Phosphorus Oxychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions
Supplementary Information for Phosphorus xychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions u Chen,* a,b Xunfu Xu, a Liu Liu, a Guo Tang,* a
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Supporting Information
S1 Supporting Information Synthesis of 2-Arylated Hydroxytyrosol Derivatives via Suzuki-Myaura Cross-Coupling Roberta Bernini, a Sandro Cacchi, b* Giancarlo Fabrizi, b* Eleonora Filisti b a Dipartimento
Supporting Information
Electronic upplementary Material (EI) for Green Chemistry. This journal is The Royal ociety of Chemistry 204 upporting Information ynthesis of sulfonamides via I 2 -mediated reaction of sodium sulfinates
Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes
1 Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes Gonzalo Blay, Isabel Fernández, Alícia Marco-Aleixandre, and José R. Pedro Departament de Química Orgànica, Facultat de Química,
Fluorinative Ring-opening of Cyclopropanes by Hypervalent Iodine Reagents. An Efficient Method for 1,3- Oxyfluorination and 1,3-Difluorination
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2016 Supporting Information Fluorinative Ring-opening of Cyclopropanes by Hypervalent Iodine
Experimental procedure
Supporting Information for Direct electrophilic N-trifluoromethylthiolation of amines with trifluoromethanesulfenamide Sébastien Alazet 1,2, Kevin Ollivier 1 and Thierry Billard* 1,2 Address: 1 Institute
Copper-mediated radical cross-coupling reaction of 2,2-dichloro-1,1,1-trifluoroethane (HCFC-123) with phenols or thiophenols. Support Information
Copper-mediated radical cross-coupling reaction of 2,2-dichloro-1,1,1-trifluoroethane (HCFC-123) with phenols or thiophenols Dr. Xiao un Tang and Prof. Qing un Chen* Key Laboratory of Organofluorine Chemistry,
Catalyst-free transformation of levulinic acid into pyrrolidinones with formic acid
Catalyst-free transformation of levulinic acid into pyrrolidinones with formic acid Yawen Wei, a Chao Wang,* a Xue Jiang, a Dong Xue, a Zhao-Tie Liu, a and Jianliang Xiao* a,b a Key Laboratory of Applied
Supplementary Data. Engineering, Nanjing University, Nanjing , P. R. China;
Supplementary Data Synthesis, Chemo-selective Properties of Substituted 9-Aryl-9H-fluorenes from Triarylcarbinols and Enantiomerical Kinetics of Chiral 9-Methoxy-11-(naphthalen-1-yl)-11H-benzo[a]fluorene
Rhodium-Catalyzed Oxidative Decarbonylative Heck-type Coupling of Aromatic Aldehydes with Terminal Alkenes
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Rhodium-Catalyzed Oxidative Decarbonylative Heck-type
Supplement: Intramolecular N to N acyl migration in conformationally mobile 1 -acyl-1- systems promoted by debenzylation conditions (HCOONH 4
Cent. Eur. J. Chem. 9(5) 2011 S164-S175 DI: 10.2478/s11532-011-0082-y Central European Journal of Chemistry Supplement: Intramolecular to acyl migration in conformationally mobile 1 -acyl-1- benzyl-3,4
Peptidomimetics as Protein Arginine Deiminase 4 (PAD4) Inhibitors
Peptidomimetics as Protein Arginine Deiminase 4 (PAD4) Inhibitors Andrea Trabocchi a, icolino Pala b, Ilga Krimmelbein c, Gloria Menchi a, Antonio Guarna a, Mario Sechi b, Tobias Dreker c, Andrea Scozzafava
Sequential catalysis for the production of sterically hindered amines: Ruthenium(II)-catalyzed C-H bond activation and hydrosilylation of imines
Electronic Supporting Information Sequential catalysis for the production of sterically hindered amines: Ruthenium(II)-catalyzed C- bond activation and hydrosilylation of imines Bin Li, Charles B. Bheeter,
Supporting Information. for. Angew. Chem. Int. Ed. Z Wiley-VCH 2003
Supporting Information for Angew. Chem. Int. Ed. Z51171 Wiley-VCH 2003 69451 Weinheim, Germany 1 Tin-Free Radical Allylation of B- Alkylcatecholboranes Arnaud-Pierre Schaffner and Philippe Renaud* University
Supporting Information for Fe-Catalyzed Reductive Coupling of Unactivated Alkenes with. β-nitroalkenes. Contents. 1. General Information S2
Supporting Information for Fe-Catalyzed Reductive Coupling of Unactivated Alkenes with β-nitroalkenes Jing Zheng, Dahai Wang, and Sunliang Cui* College of Pharmaceutical Sciences, Zhejiang University,
Supporting Information. Consecutive hydrazino-ugi-azide reactions: synthesis of acylhydrazines bearing 1,5- disubstituted tetrazoles
Supporting Information for Consecutive hydrazino-ugi-azide reactions: synthesis of acylhydrazines bearing 1,5- disubstituted tetrazoles Angélica de Fátima S. Barreto*, Veronica Alves dos Santos, and Carlos
Supporting Information
Supporting Information An Approach to 3,6-Disubstituted 2,5-Dioxybenzoquinones via Two Sequential Suzuki Couplings. Three-step Synthesis of Leucomelone Xianwen Gan, Wei Jiang, Wei Wang,,,* Lihong Hu,,*
Supporting Information
Supporting Information Transition-metal-free Ring Expansion Reactions of Indene-1,3-dione: Synthesis of Functionalized Benzoannulated Seven-Membered Ring Compounds Qiyi Yao, Lingkai Kong, Mengdan Wang,
Supporting Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Modular Synthesis of Propargylamine Modified Cyclodextrins by a Gold(III)-catalyzed Three Component
SUPPORTING INFORMATION. Transition Metal-Free Arylations of In-Situ Generated Sulfenates with Diaryliodonium Salts
S1 SUPPORTING INFORMATION Transition Metal-Free Arylations of In-Situ Generated Sulfenates with Diaryliodonium Salts Hao Yu, Zhen Li, and Carsten Bolm* Institute of Organic Chemistry, RWTH Aachen University
Chiral Brønsted Acid Catalyzed Enantioselective Intermolecular Allylic Aminations. Minyang Zhuang and Haifeng Du*
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Chiral Brønsted Acid Catalyzed Enantioselective Intermolecular Allylic
Supporting Information For: Rhodium-Catalyzed Hydrofunctionalization: Enantioselective Coupling of Indolines and 1,3-Dienes
Supporting Information For: Rhodium-Catalyzed Hydrofunctionalization: Enantioselective Coupling of Indolines and 1,3-Dienes Xiao-Hui Yang and Vy M. Dong* dongv@uci.edu Department of Chemistry, University
Supporting Information
Supporting Information Wiley-VCH 2014 69451 Weinheim, Germany Copper-Catalyzed Coupling of Oxime Acetates with Sodium Sulfinates: An Efficient Synthesis of Sulfone Derivatives** Xiaodong Tang, Liangbin
A straightforward metal-free synthesis of 2-substituted thiazolines in air
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2015 Supporting Information for A straightforward metal-free synthesis of 2-substituted thiazolines
Supporting Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information A Convenient and Efficient Synthesis of Glycals by Zinc Nanoparticles
Supporting Information
Supporting Information Metal-catalyzed Stereoselective and Protecting-group-free Synthesis of 1,2-cis-Glycosides Using 4,6-Dimethoxy-1,3,5-triazin-2-yl Glycosides as Glycosyl Donors Tomonari Tanaka,* 1
Synthesis of novel 1,2,3-triazolyl derivatives of pregnane, androstane and D-homoandrostane. Tandem Click reaction/cu-catalyzed D-homo rearrangement
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information Synthesis of novel 1,2,3-triazolyl derivatives of
Chiral Phosphoric Acid Catalyzed Asymmetric Synthesis of 2-Substituted 2,3-Dihydro-4-Quinolones by Protecting Group-Free Approach
Chiral Phosphoric Acid Catalyzed Asymmetric Synthesis of 2-Substituted 2,3-Dihydro-4-Quinolones by Protecting Group-Free Approach Kodai Saito, Yuka Moriya, and Takahiko Akiyama* Department of Chemistry,
Supporting Information for Synthesis of Fused N-Heterocycles via Tandem C-H Activation
This journal is The Royal Society of Chemistry 212 Supporting Information for Synthesis of Fused -Heterocycles via Tandem C-H Activation Ge Meng, Hong-Ying iu, Gui-Rong Qu, John S. Fossey, Jian-Ping Li,*
Supplementary Figure S1. Single X-ray structure 3a at probability ellipsoids of 20%.
Supplementary Figure S1. Single X-ray structure 3a at probability ellipsoids of 20%. S1 Supplementary Figure S2. Single X-ray structure 5a at probability ellipsoids of 20%. S2 H 15 Ph Ac Ac I AcH Ph Ac
Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions
This journal is The Royal Society of Chemistry 213 Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions Wenjing Cui, a Bao Zhaorigetu,* a Meilin Jia, a and Wulan
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting Information 1. General experimental methods (S2). 2. Table 1: Initial studies (S2-S4).
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Silver or Cerium-Promoted Free Radical Cascade Difunctionalization
First Total Synthesis of Antimitotic Compound, (+)-Phomopsidin
First Total Synthesis of Antimitotic Compound, (+)-Phomopsidin Takahiro Suzuki, a Kenji Usui, a Yoshiharu Miyake, a Michio Namikoshi, b and Masahisa Nakada a, * a Department of Chemistry, School of Science
Palladium-Catalyzed C H Monoalkoxylation of α,β-unsaturated Carbonyl Compounds
Supporting Information Palladium-Catalyzed C H Monoalkoxylation of α,β-unsaturated Carbonyl Compounds Yasunari Monguchi,* Kouki Kunishima, Tomohiro Hattori, Tohru Takahashi, Yuko Shishido, Yoshinari Sawama,
Supporting Information. Microwave-assisted construction of triazole-linked amino acid - glucoside conjugates as novel PTP1B inhibitors
Supporting Information Microwave-assisted construction of triazole-linked amino acid - glucoside conjugates as novel PTP1B inhibitors Xiao-Peng He, abd Cui Li, d Xiao-Ping Jin, b Zhuo Song, b Hai-Lin Zhang,
Eco-friendly synthesis of diverse and valuable 2-pyridones by catalyst- and solvent-free thermal multicomponent domino reaction
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2015 SUPPRTIG IFRMATI Eco-friendly synthesis of diverse and valuable 2-pyridones by catalyst-
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone.
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone. Won-Suk Kim, Hyung-Jin Kim and Cheon-Gyu Cho Department of Chemistry, Hanyang University, Seoul 133-791, Korea Experimental Section
gem-dichloroalkenes for the Construction of 3-Arylchromones
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Pd(OAc)2/S=PPh3 Accelerated Activation of gem-dichloroalkenes for the Construction of 3-Arylchromones
Supplementary!Information!
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015! Synthesis)and)characterisation)of)an)open1cage) fullerene)encapsulating)hydrogen)fluoride! Supplementary!Information!
Electronic Supplementary Information
Electronic Supplementary Information NbCl 3 -catalyzed [2+2+2] intermolecular cycloaddition of alkynes and alkenes to 1,3-cyclohexadiene derivatives Yasushi Obora,* Keisuke Takeshita and Yasutaka Ishii*
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 6945 Weinheim, 2007 A New Method for Constructing Quaternary Carbon Centres: Tandem Rhodium-Catalysed,4-Addition/Intramolecular Cyclization.
Copper-Catalyzed Direct Acyloxylation of C(sp 2 ) H Bonds. in Aromatic Amides
Supporting Information for Copper-Catalyzed Direct Acyloxylation of C(sp 2 ) H Bonds in Aromatic Amides Feifan Wang, Qiyan Hu, Chao Shu, Zhiyang Lin, Dewen Min, Tianchao Shi and Wu Zhang* Key Laboratory
KOtBu-Mediated Stereoselective Addition of Quinazolines to. Alkynes under Mild Conditions
KOtBu-Mediated Stereoselective Addition of Quinazolines to Alkynes under Mild Conditions Dan Zhao, Qi Shen, Yu-Ren Zhou, and Jian-Xin Li* State Key lab of Analytical Chemistry for Life Science, School
Supporting Information
Electronic Supplementary Material (ESI) for rganic Chemistry Frontiers. This journal is the Partner rganisations 2018 Palladium-catalyzed direct approach to α-cf 3 aryl ketones from arylboronic acids Bo
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Silver-Catalyzed Asymmetric Synthesis of 2,3-Dihydrobenzofurans: A New Chiral Synthesis of Pterocarpans Leticia Jiménez-González, Sergio
Supporting Information for: Intramolecular Hydrogen Bonding-Assisted Cyclocondensation of. 1,2,3-Triazole Synthesis
Supporting Information for: Intramolecular Hydrogen Bonding-Assisted Cyclocondensation of α-diazoketones with Various Amines: A Strategy for Catalytic Wolff 1,2,3-Triazole Synthesis Zikun Wang, a Xihe