EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια"

Transcript

1 EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου

2 Όνομα: Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης Επαναληπτικό Διαγώνισμα ΚΕΦΑΛΑΙΑ 1,2,4,9 Ημερομηνία: Διδάσκων καθηγητής : Βαθμός % ή /20 Παρατηρήσεις: ΘΕΜΑ Α Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη φράση η οποία συμπληρώνει σωστά την πρόταση. Α1. Ο όρος αποικία αναφέρεται: Α. σε μία ομάδα πανομοιότυπων πολυκύτταρων οργανισμών Β. σε ένα οποιοδήποτε σύνολο μικροοργανισμών Γ. σε ένα σύνολο μικροοργανισμών διαφορετικών στελεχών Δ. σε μια ομάδα μικροοργανισμών κλώνων ενός αρχικού κυττάρου που αναπτύσσονται σε στερεή καλλιέργεια. Α2. Στο πείραμά τους ο Avery και οι συνεργάτες του: Α. διαχωρίστηκαν τα συστατικά των αδρών βακτηρίων σε υδατάνθρακες, πρωτεϊνες, λιπίδια, RNA και DNA. B. διαπίστωσαν ότι το συστατικό που προκάλεσε το μετασχηματιμό των λείων στελεχών σε αδρά ήταν το DNA. Γ. ανάμειξαν νεκρά λεία βακτήρια με ζωντανά αδρά και με το μείγμα μόλυναν ποντικούς που αυτοί πέθαναν. Δ. διαπίστωσαν ότι το βιολογικό μακρομόριο που μετασχημάτισε τα αδρά ζωντανά στελέχη πνευμονιόκοκκου σε στελέχη που ήταν ικανά να προκαλέσουν πνευμονία στα ποντίκια, ήταν το DNA. Α3. Το DNA απαντάται συνδεδεμένο με το RNA με ομοιοπολικό δεσμό: Α. κατά τη μεταγραφή

3 Β. κατά τη μετάφραση Γ. κατά την υβριδοποίηση Δ. κατά την αντιγραφή Α4. Σε ένα υγρό θρεπτικό υλικό που περιέχει σε ίσες συγκεντρώσεις γλυκόζη και λακτόζη και αυτές είναι οι μοναδικές πηγές άνθρακα που περιέχει, το E.Coli: Α. εκφράζει συνεχώς Β. αφού η συγκέντρωση της γλυκόζης μειωθεί αρκετά, εκφράζει το οπερόνιο. Γ. αφού εξαντληθεί η λακτόζη, ο επαγωγέας συνδέεται με τον καταστολέα Δ. δεν εκφράζει το ρυθμιστικό γονίδιο αν δεν εκφραστεί πρώτα το οπερόνιο Α5. Ποιο από τα παρακάτω μπορεί να επιτευχθεί με επιλεκτικες διασταυρώσεις των ζώων: Α. η αύξηση της παραγωγής της ινσουλίνης τους Β. η παραγωγή της ανθρώπινης α 1 -αντιθρυψίνης Γ. η παραγωγή της ανθρώπινης αυξητικής ορμόνης Δ. η παραγωγή της ανθρώπινης ινσουλίνης Α6. Ο πίνακας αφορά στις cdna και τις γονιδιωματικές βιβλιοθήκες. Να συμπληρώσετε με (+) τις στήλες ανάλογα με τα χαρακτηριστικά τους ή εάν επιτελούνται οι διαδικασίες που αναγράφονται κατά την κατασκευή των βιβλιοθηκών. Απομόνωση ολικού RNA Απομόνωση DNA Αντίστροφη μεταγραφή Αντιγραφή Αποδιάταξη RNA- DNA Αποδιάταξη δίκλωνων DNA Περιλαμβάνονται υποκινητές Μεγαλύτερος αριθμός κλώνων Υβδιδοποίηδη με ανιχνευτή Προσθήκη αντιβιοτικού Δεν περιέχονται εσώνια Μέσω αυτής είναι δυνατή η μελέτη του όλου γονιδιώματος των οργανισμών Μέσω αυτής είναι δυνατή η παραγωγή πρωτεϊνών του δότη στα κύτταρα-ξενιστές cdna Γονιδιωματική (μονάδες 10) ΘΕΜΑ Β Β1. Στο γονιδίωμα ενός βακτηρίου υπάρχουν δύο οπερόνια. Το ένα οπερόνιο αποτελείται από δύο (2) δομικά γονίδια και το άλλο από τρία (3) δομικά γονίδια. Το καθένα από τα οπερόνια έχει το δικό του ρυθμιστικό γονίδιο. α) Πόσα γονίδια υπάρχουν συνολικά στα δύο οπερόνια; β) Πόσα mrna παράγονται από το κάθε οπερόνιο; γ) Πόσες πρωτεϊνες κωδικοποιούνται από το κάθε οπερόνιο; (μονάδες 12)

4 Β2. Η αλληλουχία 5 ΑΑGCTT 3 (και η συμπληρωματική της) υπάρχει μόνο μία φορά στο πλασμίδιο Ti στο εσωτερικό του γονιδίου που προκαλεί εξογκώματα στα φυτά. Η αλληλουχία αυτή αναγνωρίζεται από την περιοριστική ενδονουκλεάση HindIII και τέμνεται μεταξύ Α και Α. Η παρακάτω αλληλουχία αποτελεί τμήμα του γενετικού υλικού του Bacillus thuringiensis που πριέχει το γονίδιο για την παραγωγή της εντομοτοξίνης: 5 GCGCGAAGCTTGCGGATGGGGCACGCGAGGCCTCATTAGAAATAAGCTTCACAC 3 3 CGCGCTTCGAACGCC TACCCCG TGCGCTCCGGAGTAATCTTTATTCGAAGTGTG 5 α. Να εξηγήσετε με ποια διαδικασία είναι δυνατή η παραγωγή της εντομοτοξίνης από φυτικά κύτταρα σόγιας με τη βοήθεια της συγκεκριμένης περιοριστικής ενδονουκλεάσης και του πλασμιδίου Ti. (Μονάδες 7) β. Ποια είναι η αλληλουχία αμινοξέων της εντομοτοξίνης που θα παραχθεί στα κύτταρα της σόγιας; ΘΕΜΑ Γ Γ1. Το πλασμίδιο που απεικονίζεται στο σχήμα χρησιμοποιείται ως φορέας κλωνοποίησης με τη χρήση μίας περιοριστικής ενδονουκλεάσης. Στο σχήμα απεικονίζονται επίσης δύο γονίδια ανθεκτικότητας σε αντιβιοτικά που φέρει το πλασμίδιο, οι υποκινητές τους, η θέση έναρξης αντιγραφής του και οι θέσεις που τέμνουν το πλασμίδιο οι περιοριστικές ενδονουκλεάσες Ν και Ζ. Αντλώντας πληροφορίες από το σχήμα, να εξηγήσετε ποια περιοριστική ενδονουκλεάση (Ν ή Ζ) είναι κατάλληλη για την κατασκευή του ανασυνδυασμένου πλασμιδίου. Επίσης, να εξηγήσετε τον τρόπο με τον οποίο επιλέγονται τα βακτήρια που μετασχηματίζονται με το εν λόγω πλασμίδιο από εκείνα που δεν δέχθηκαν πλασμίδιο. (μονάδες 12,5) Γ2. Στο ακόλουθο σχήμα απεικονίζεται τμήμα DNA που περιέχει υποκινητή και γονίδιο, σε ένα σημείο του οποίου υπάρχει θέση έναρξης αντιγραφής, όπως απεικονίζεται στο σχήμα. α. Να σημειώσετε την κωδική αλυσίδα του γονιδίου β. Ποια από τις δύο αλυσίδες [(α) ή (β)] του γονιδίου αντιγράφεται με συνεχή τρόπο; (α) θέση έναρξης 3 Υ Γονίδιο (β) (μονάδες 12,5)

5 ΘΕΜΑ Δ Το μόριο που απεικονίζονται στο σχήμα είναι το trna που μεταφέρει το αμινοξύ τρυπτοφάνη (trp). Δ1.. Το trna αυτό κωδικοποιείται από το γονίδιο: (α)... ATCTGCATGTTCTCGGGGACGTAATGGAATTGAAGC... (β)... TAGAGCTACAAGAGCCCCTGCATTACCTTAACTTCG... Αντικωδικόνιο i) Να προσδιορίσετε τα 5 και 3 άκρα του μορίου του trna και να αιτιολογήσετε την απάντησή σας. ii) Να εξηγήσετε ποια από τις δύο αλυσίδες (α ή β) είναι η μη κωδική αλυσίδα του γονιδίου και να σημειώσετε τα 5 και 3 άκρα των δύο αλυσίδων. Δ2. Η ακόλουθη αλληλουχία αποτελεί τμήμα γονιδίου προκαρυωτικού κυττάρου που μεταγράφεται σε mrna και μεταφράζεται σε πεπτιδική αλυσίδα. αλυσίδα 1:... GAAGTGCGTATTCCACGTAAATGT... αλυσίδα 2:... CTTCACGCATAAGGTGCATTTACA... Κατά τη μετάφραση του τμήματος mrna, που παράγεται από τη μεταγραφή του τμήματος DNA, συμμετέχει το συγκεκριμένο trna. i) Να εξηγήσετε ποια από τις δύο αλυσίδες (1 ή 2) είναι η μη κωδική του γονιδίου και να σημειώσεται τα 5 και 3 άκρα των δύο αλυσίδων. ii) Ποια είναι η αλληλουχία των αμινοξέων που προκύπτει από τη μεταγραφή και μετάφραση του συγκεκριμένου τμήματος και πόσοι πεπτιδικοί δεσμοί σχηματίζονται κατά τη σύνθεσή του; (Μονάδες 7) Καλή επιτυχία!!!

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ & ΣΠΟΥ ΩΝ ΟΙΚΟΝΟΜΙΑΣ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΛΑ Β ) ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ Να γράψετε

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5 Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις διαγωνίσματος στο Κεφάλαιο 4 ο ΘΕΜΑ Α Α1. β Α2. β Α3. γ Α4. β Α5. β ΘΕΜΑ B B1. Ο κλώνος είναι μια ομάδα πανομοιότυπων μορίων, κυττάρων, ή οργανισμών. B2. Η υβριδοποίηση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΚΥΡΙΑΚΗ 27/03/2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α I Β IV Γ VI

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα

Διαβάστε περισσότερα

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων Πανελλαδικές Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο μάθημα: Βιολογία Προσανατολισμού Θετικών Σπουδών Παρασκευή, 16 Ιουνίου 2017 Ενδεικτικές απαντήσεις θεμάτων Θέμα Α Α1. α) 3 CAT 5 β) 3 TAC 5

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν ΘΕΜΑ Α Α1-δ Α2-δ Α3-β

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 o Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ

ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΗΜΕΡΟΜΗΝΙΑ: 05/02/1017 ΘΕΜΑ 1 ο Α1. Τα βακτήρια του γένους Mycobacterium: α. είναι προκαρυωτικοί οργανισμοί. Α2. Η προσαρμογή των μικροοργανισμών

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: 16 / 06 / 2017 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1: δ Α2:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Ημερομηνία: Σάββατο 14 Απριλίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Σάββατο 14 Απριλίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ ΕΩΣ 2/4/18-14/4/18 ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Σάββατο 14 Απριλίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 16 Ιουνίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Λυκείων Γενικών ΘΕΜΑ Α Α.1 δ Α.2 δ Α.3 β Α.4 γ Α.5 α ΘΕΜΑ B B.1 I. A II. E III. ΣΤ IV.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Β2. Η εικόνα αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς οργανισμούς το mrna αρχίζει να μεταφράζεται σε πρωτεΐνη πριν ακόμη

ΑΠΑΝΤΗΣΕΙΣ. Β2. Η εικόνα αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς οργανισμούς το mrna αρχίζει να μεταφράζεται σε πρωτεΐνη πριν ακόμη ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΚΑΙ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 207 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α. δ Α2. δ Α3. β Α4. γ Α5.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ ΘΕΜΑ Α Α1: δ Α2: δ Α3: β Α4: γ Α5: α ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII - Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Αυτό

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις Α

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ 1 Ο 1. Ένζυμο το οποίο δεν συμμετέχει στην κατασκευή cdna βιβλιοθήκης είναι η: α. DNA δεσμάση β. DNA ελικάση

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Μονάδες 7 Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό ή σε ευκαρυωτικό κύτταρο; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) Μονάδες 5

Μονάδες 7 Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό ή σε ευκαρυωτικό κύτταρο; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Δ Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 7 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ 16/06/2017 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία:

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ

ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ 16/06/2017 ΕΠΙΜΕΛΕΙΑ: ΑΝΔΡΙΑΝΗ ΠΑΡΑΧΗ ΘΕΜΑ Α A1. Δ Α2. Δ Α3. Β Α4. Γ Α5.Α ΘΕΜΑ Β Β1) I A II E III Σ IV Β V Ζ VI Γ VII Δ Β2) ε προκαρυωτικό γιατί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2107 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2107 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Β Β1. Ι: κωδική αλυσίδα (Δ) ΙΙ: μεταγραφόμενη αλυσίδα (Γ) ΙΙΙ: αμινομάδα (ΣΤ) ΙV: mrna (Β) V: RNA πολυμεράση (Ζ) VI: φωσφορική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. I, Β. IV, Γ. VI, Δ. VII, Ε. ΙΙ, ΣΤ. III, Ζ. V Β2. Αντιστοιχεί σε προκαρυωτικό οργανισμό. Στους προκαρυωτικούς

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1. Α. 2. Β. 3. Α. 4. Β. 5. Δ. ΘΕΜΑ Β I. Βιβλίο σελ. 15 17 (ή 19 21 στη νέα έκδοση) .

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6)

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6) ΑΡΧΗ lησ ΣΕΛΙΔΑΣ Γ' ΗΜΕΡΉΣΙΩΝ & Δ' ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β.

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I A. φωσφορική ομάδα II III IV V VI VII Ε. υδροξύλιο ΣΤ. αμινομάδα Β. mrna Ζ. RNA πολυμεράση Γ. μεταγραφόμενη

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ B B1. I Α II Ε III

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΛΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2017

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2017 ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2017 Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι. Φωσφορική οµάδα ΙΙ. Υδροξύλιο ΙΙΙ. Αµινοµάδα ΙV. mrna V. RNA πολυµεράση VI. µεταγραφόµενη αλυσίδα VII. Κωδική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 Σ ε λ ί δ α 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΠΙΜΕΛΕΙΑ: ΛΑΜΠΡΙΝΗ ΓΑΒΡΙΗΛ ΘΕΜΑ Α Α1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2017

Πανελλαδικές εξετάσεις 2017 Πανελλαδικές εξετάσεις 2017 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Θέμα Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α Θέμα Β Β1 I: Α, ΙΙ: E, III: ΣΤ, ΙV: B, V:Z, VI: Γ, VII: Δ Η έννοια πυρηνική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ Α. 1. δ 2. δ 3. β 4. γ 5. α ΘΕΜΑ Β Β1. Α I Β IV Γ VI Δ VII Ε II ΣΤ III Ζ V Η -

ΘΕΜΑ Α. 1. δ 2. δ 3. β 4. γ 5. α ΘΕΜΑ Β Β1. Α I Β IV Γ VI Δ VII Ε II ΣΤ III Ζ V Η - ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2017 ΛΥΣΕΙΣ ΘΕΜΑΤΩΝ ΕΠΙΜΕΛΕΙΑ: Π. ΚΡΥΣΤΑΛΛΙΔΗΣ 1. δ 2. δ 3. β 4. γ 5. α ΘΕΜΑ Α Β1. Α I Β IV Γ VI Δ VII Ε II ΣΤ III Ζ V Η - ΘΕΜΑ Β Β2. Η εικόνα αντιστοιχεί

Διαβάστε περισσότερα