ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ"

Transcript

1 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό βιβλίο, σελ. 34, 35: Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Αυτό πρακτικά σημαίνει ότι το mrna από οποιονδήποτε οργανισμό μπορεί να μεταφραστεί σε εκχυλίσματα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη. Β2. Η σωστή σειρά είναι: Β3. Σχολικό βιβλίο, σελ : Τα αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά. Η πιο ενδιαφέρουσα εφαρμογή τους αφορά τη θεραπεία του καρκίνου. Τα καρκινικά κύτταρα έχουν στην εξωτερική επιφάνεια τους μεγάλη ποικιλία αντιγόνων που δεν υπάρχουν στα φυσιολογικά κύτταρα του οργανισμού, και ονομάζονται καρκινικά αντιγόνα. Έτσι μπορούν να κατασκευαστούν μονοκλωνικά αντισώματα εναντίον αυτών των αντιγόνων. Τα μονοκλωνικά αντισώματα είναι πολύ ειδικά μόνο για τα καρκινικά κύτταρα και μπορούν να «γίνουν μεταφορείς» ισχυρών αντικαρκινικών φαρμάκων. Όταν εισαχθούν στον οργανισμό, βρίσκουν και προσβάλλουν τους καρκίνους-στόχους. Τα αντικαρκινικά φάρμακα, που είναι συνδεδεμένα με τα αντισώματα, δρουν κατευθείαν στα καρκινικά κύτταρα και τα καταστρέφουν. Επιτρέπουν έτσι τη θεραπεία με αποφυγή της

2 2 χειρουργικής επέμβασης και των δυσάρεστων επιπτώσεων της χημειοθεραπείας. Β4. Σχολικό βιβλίο, σελ. 131: Ένας τρόπος βελτίωσης της φυτικής και ζωικής παραγωγής είναι οι ελεγχόμενες από τον άνθρωπο διασταυρώσεις φυτών και ζώων. Για το σκοπό αυτό πραγματοποιείται επιλογή φυτών και ζώων που έχουν συγκεκριμένα χαρακτηριστικά, όπως φυτά με μεγάλο μέγεθος καρπών, με ανθεκτικότητα σε ακραίες περιβαλλοντικές συνθήκες ή ζώα που παράγουν μεγάλη ποσότητα κρέατος. Οι οργανισμοί αυτοί διασταυρώνονται με σκοπό τη δημιουργία απογόνων με επιθυμητά χαρακτηριστικά. Αυτός ο τρόπος βελτίωσης της παραγωγής είναι χρονοβόρος και επίπονος, επειδή απαιτούνται συνεχείς διασταυρώσεις. Επιπλέον οι απόγονοι που προκύπτουν φέρουν συνήθως ορισμένους μόνο από τους επιθυμητούς χαρακτήρες μαζί με άλλες μη επιθυμητές ιδιότητες. ΘΕΜΑ Γ Γ1. Σχολικό βιβλίο, σελ. 108: Ο ρυθμός ανάπτυξης ενός πληθυσμού μικροοργανισμών, δηλαδή ο ρυθμός με τον οποίο διαιρούνται τα κύτταρά του, καθορίζεται από το χρόνο διπλασιασμού. Κάθε είδος μικροοργανισμού έχει χαρακτηριστικό χρόνο διπλασιασμού. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και κατά συνέπεια το ρυθμό ανάπτυξης των μικροοργανισμών είναι η διαθεσιμότητα θρεπτικών συστατικών, το ph, το Ο 2 και η θερμοκρασία. Γ2. Για την ανάπτυξη του μικροοργανισμού E. coli, απαραίτητη πηγή αζώτου είναι τα αμμωνιακά ή τα νιτρικά ιόντα και απαραίτητη πηγή άνθρακα οι υδατάνθρακες, όπως η γλυκόζη, η λακτόζη. Γ3. Καμπύλη Ι: Βιοαντιδραστήρας Α Καμπύλη ΙΙ: Βιοαντιδραστήρας Β Η Escherichia coli αναπτύσσεται άριστα σε θερμοκρασία 37 C. Επομένως στον βιοαντιδραστήρα Α έχουμε την άριστη θερμοκρασία ανάπτυξης του μικροοργανισμού στην καλλιέργεια, άρα ο ρυθμός ανάπτυξης του πληθυσμού είναι μεγαλύτερος σε σχέση με το ρυθμό ανάπτυξης του πληθυσμού στον βιοαντιδραστήρα Β, όπου έχουμε θερμοκρασία 20 ο C. Γ4. Οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα συνήθως κατά τη διάρκεια της εκθετικής και της στατικής φάσης ανάπτυξής τους.

3 3 Στην καμπύλη Ι η εκθετική φάση διαρκεί από τη 2 η μέχρι την 6 η ώρα και η στατική φάση διαρκεί από την 6 η μέχρι την 12 η ώρα της καλλιέργειας. Συνεπώς, η χρονική περίοδος κατά την οποία παράγονται χρήσιμα προϊόντα στον βιοαντιδραστήρα Α είναι από την 2 η μέχρι την 12 η ώρα της καλλιέργειας. ΘΕΜΑ Δ Δ1. Το πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης πρέπει να έχει τη συγκεκριμένη αλληλουχία που αναγνωρίζει και κόβει μια περιοριστική ενδονουκλεάση μόνο μια φορά. Έτσι το πλασμίδιο μετατρέπεται σε γραμμικό μόριο DNA με μονόκλωνα άκρα το οποίο ξαναγίνεται δίκλωνο με τη μεσολάβηση της DNA δεσμάσης, όταν αναμιγνύεται με το κομμάτι DNA του οργανισμού δότη που έχει προκύψει από τη δράση της ίδιας περιοριστικής ενδονουκλεάσης επειδή αυτά έχουν συμπληρωματικά άκρα. Επομένως, η κατάλληλη περιοριστική ενδονουκλεάση για το συγκεκριμένο πλασμίδιο είναι η δ, απορρίπτοντας την γ γιατί κόβει το DNA μέσα περιοχή του υποκινητή ενώ οι α και β κόβουν το πλασμίδιο σε δύο διαφορετικά σημεία. Δ2. Σχολικό βιβλίο, σελ. 59: Συνήθως χρησιμοποιούνται ως ξενιστές, βακτήρια που δεν έχουν πλασμίδια και επομένως είναι ευαίσθητα σε αντιβιοτικά. Για να μπει ένα πλασμίδιο μέσα στο βακτήριο, τα τοιχώματα του βακτηρίου γίνονται παροδικά διαπερατά σε μακρομόρια, μετά από κατάλληλη κατεργασία (μετασχηματισμός). Η επιλογή των μετασχηματισμένων βακτηρίων δηλαδή αυτών που δέχτηκαν κάποιο πλασμίδιο στηρίζεται στην ικανότητα ανάπτυξής τους παρουσία αντιβιοτικού, επειδή το πλασμίδιο περιέχει ένα γονίδιο που προσδίδει στα βακτήρια-ξενιστές ανθεκτικότητα στο συγκεκριμένο αντιβιοτικό. Σε θρεπτικό υλικό καλλιέργειας όπου έχουμε προσθέσει το αντιβιοτικό αμπικιλίνη ή στρεπτομυκίνη, αναπτύσσονται μόνο τα μετασχηματισμένα βακτήρια, δηλαδή αυτά που φέρουν το συγκεκριμένο πλασμίδιο, ανασυνδυασμένο ή μη, δημιουργώντας κλώνο βακτηρίων. Όσα βακτήρια δεν μετασχηματίστηκαν είναι ευαίσθητα στην παρουσία του αντιβιοτικού και συνεπώς δεν πολλαπλασιάζονται.

4 Δ3. Αλυσίδα Ι κωδική 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 κωδικόνιο λήξης 4 κωδικόνιο έναρξης Αλυσίδα ΙΙ μη κωδική 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3 Στην αλυσίδα Ι, με προσανατολισμό 5 3 εντοπίζω το κωδικόνιο έναρξης ATG και με βήμα τριπλέτας, συνεχή και μη επικαλυπτόμενα το κωδικόνιο λήξης ΤΑΑ. Άρα η αλυσίδα αυτή είναι η κωδική. Η αλυσίδα ΙΙ, η μη κωδική, είναι συμπληρωματική και αντιπαράλληλη ως την αλυσίδα Ι, την κωδική του γονιδίου. Η μεταγραφή γίνεται με προσανατολισμό 5 3. Το mrna είναι συμπληρωματικό και αντιπαράλληλο με τη μη κωδική αλυσίδα του γονιδίου, τη μεταγραφόμενη αλυσίδα του γονιδίου. Στο mrna που σχηματίζεται με προσανατολισμό 5 3 εντοπίζω κωδικόνιο έναρξης και με βήμα τριπλέτας, συνεχή και μη επικαλυπτόμενα, κωδικόνιο λήξης. Έτσι λοιπόν το mrna που προκύπτει είναι: mrna: 3 GCCAAUAUUAAAUGAGCATGCCGUAGGAATATTCGG 5 Δ4. Η αλληλουχία μήκους έξι ζευγών βάσεων που αναγνωρίζει η περιοριστική ενδονουκλεάση είναι: 3 AATATT 5 5 TTATAA 3 η οποία εντοπίζεται και στις πλευρές (άκρων) του γονιδίου. Δ5. Ένα γονίδιο για να εκφραστεί πρέπει να φέρει κατά σειρά την περιοχή του υποκινητή, πάνω στην οποία προσδένεται η RNA πολυμεράση για να ξεκινήσει η μεταγραφή του γονιδίου, το κωδικόνιο έναρξης, το κωδικόνιο λήξης και την αλληλουχία λήξης της μεταγραφής. Με τη δράση της περιοριστικής ενδονουκλεάσης προκύπτουν τα ίδια μονόκλωνα άκρα με αζευγάρωτες βάσεις: 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3

5 i) Οι βακτηριακοί κλώνοι παράγουν το ολιγοπεπτίδιο: 5 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3 ΑΛΛΗΛΟΥΧΙΑ ΛΗΞΗΣ ΜΕΤΑΓΡΑΦΗΣ ΥΠΟΚΙΝΗΤΗΣ Στην περίπτωση αυτή, στην κωδική αλυσίδα του γονιδίου μετά την περιοχή του υποκινητή υπάρχει κωδικόνιο έναρξης και με βήμα τριπλέτας κωδικόνιο λήξης, άρα μπορεί να γίνει μεταγραφή και μετάφραση του παραπάνω τμήματος DNA. ii) Οι βακτηριακοί κλώνοι δεν παράγουν το ολιγοπεπτίδιο: 3 CCGAATATTCCTACGGCATGCTCATTTAATATTGGC 5 5 GGCTTATAAGGATGCCGTACGAGTAAATTATAACCG 3 ΑΛΛΗΛΟΥΧΙΑ ΛΗΞΗΣ ΜΕΤΑΓΡΑΦΗΣ ΥΠΟΚΙΝΗΤΗΣ

6 6 Στην περίπτωση αυτή, στην κωδική αλυσίδα του γονιδίου μετά την περιοχή του υποκινητή δεν υπάρχει κωδικόνιο έναρξης, άρα δεν μπορεί να γίνει μεταγραφή και μετάφραση του παραπάνω τμήματος DNA. ΚΟΤΡΟΠΟΥΛΟΣ ΔΗΜΗΤΡΙΟΣ ΒΙΟΛΟΓΟΣ SCIENCE PRESS

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Μ. Τετάρτη 8 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες Α1 - γ, Α2 - δ, Α3 - α, Α4 - β, Α5 - α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Παθογόνα

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμο καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ:

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΕΝΑ ΠΕΙΡΑΜΑ ΜΕ ΑΓΝΩΣΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΤΗΝ ΥΓΕΙΑ, ΤΟ ΠΕΡΙΒΑΛΛΟΝ, ΤΗΝ ΚΟΙΝΩΝΙΑ ΝΙΚΟΛΑΣ ΠΡΙΜΗΚΥΡΙΟΣ, ΓΕΩΠΟΝΟΣ, Δρ. ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΦΥΤΩΝ ΓΕΝΕΤΙΚΑ

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος Ετσι αρχισε η Ζωη? To δεντρο της Ζωης Και τι µας νοιαζει αν υπαρχουν µικροοργανισµοι η οχι? H ανυπολόγιστη αξία της Mικροβιολογίας για τη Βιολογια Το

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ. Κεφάλαιο Πρώτο Το γενετικό υλικό

ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ. Κεφάλαιο Πρώτο Το γενετικό υλικό ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο Πρώτο Το γενετικό υλικό Με βάση ποιο πείραμα αποδείχθηκε ότι το DNA είναι το γενετικό υλικό; Πότε ήρθε η οριστική επιβεβαίωση ότι το DNA

Διαβάστε περισσότερα

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία!

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! Διαγώνισμα ΒΙΟΛΟΓΙΑΣ Γενικής Παιδείας ΗΜΕΡΟΜΗΝΙΑ 15/3/2015 Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! ΘΕΜΑ Α Να αντιγράψετε

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ν γράψετε στο τετράδιό σς τον ριθμό κθεμιάς πό τις πρκάτω ημιτελείς προτάσεις Α1 έως Α5 κι δίπλ το γράμμ που

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου;

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου; ΒΙΟΛΟΓΙΑ 1,Να αντιστοιχίσετε της όρους της αριστερής στήλης με τις προτάσεις της δεξιάς στήλης: α. κυτταρική μεμβράνη 1. πολλαπλασιάζονται με εκβλάστηση β. αμοιβάδα 2.κέντρα παραγωγής ενέργειας γ. μιτοχόνδρια

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ Βιολογία ΘΕΜΑ 1 Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 20/5/2015 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ Ι (ΜΑΘΗΜΑ 2ο) 1 ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ γονίδιο πρωτεϊνη Ηλεκτροφόρηση πρωτεϊνών 2 ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ Ηλεκτροφόρηση πρωτεϊνών θέσεις για

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα