Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό βιβλίο, σελ. 34, 35: Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Αυτό πρακτικά σημαίνει ότι το mrna από οποιονδήποτε οργανισμό μπορεί να μεταφραστεί σε εκχυλίσματα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη. Β2. Η σωστή σειρά είναι: Β3. Σχολικό βιβλίο, σελ : Τα αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά. Η πιο ενδιαφέρουσα εφαρμογή τους αφορά τη θεραπεία του καρκίνου. Τα καρκινικά κύτταρα έχουν στην εξωτερική επιφάνεια τους μεγάλη ποικιλία αντιγόνων που δεν υπάρχουν στα φυσιολογικά κύτταρα του οργανισμού, και ονομάζονται καρκινικά αντιγόνα. Έτσι μπορούν να κατασκευαστούν μονοκλωνικά αντισώματα εναντίον αυτών των αντιγόνων. Τα μονοκλωνικά αντισώματα είναι πολύ ειδικά μόνο για τα καρκινικά κύτταρα και μπορούν να «γίνουν μεταφορείς» ισχυρών αντικαρκινικών φαρμάκων. Όταν εισαχθούν στον οργανισμό, βρίσκουν και προσβάλλουν τους καρκίνους-στόχους. Τα αντικαρκινικά φάρμακα, που είναι συνδεδεμένα με τα αντισώματα, δρουν κατευθείαν στα καρκινικά κύτταρα και τα καταστρέφουν. Επιτρέπουν έτσι τη θεραπεία με αποφυγή της

2 2 χειρουργικής επέμβασης και των δυσάρεστων επιπτώσεων της χημειοθεραπείας. Β4. Σχολικό βιβλίο, σελ. 131: Ένας τρόπος βελτίωσης της φυτικής και ζωικής παραγωγής είναι οι ελεγχόμενες από τον άνθρωπο διασταυρώσεις φυτών και ζώων. Για το σκοπό αυτό πραγματοποιείται επιλογή φυτών και ζώων που έχουν συγκεκριμένα χαρακτηριστικά, όπως φυτά με μεγάλο μέγεθος καρπών, με ανθεκτικότητα σε ακραίες περιβαλλοντικές συνθήκες ή ζώα που παράγουν μεγάλη ποσότητα κρέατος. Οι οργανισμοί αυτοί διασταυρώνονται με σκοπό τη δημιουργία απογόνων με επιθυμητά χαρακτηριστικά. Αυτός ο τρόπος βελτίωσης της παραγωγής είναι χρονοβόρος και επίπονος, επειδή απαιτούνται συνεχείς διασταυρώσεις. Επιπλέον οι απόγονοι που προκύπτουν φέρουν συνήθως ορισμένους μόνο από τους επιθυμητούς χαρακτήρες μαζί με άλλες μη επιθυμητές ιδιότητες. ΘΕΜΑ Γ Γ1. Σχολικό βιβλίο, σελ. 108: Ο ρυθμός ανάπτυξης ενός πληθυσμού μικροοργανισμών, δηλαδή ο ρυθμός με τον οποίο διαιρούνται τα κύτταρά του, καθορίζεται από το χρόνο διπλασιασμού. Κάθε είδος μικροοργανισμού έχει χαρακτηριστικό χρόνο διπλασιασμού. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και κατά συνέπεια το ρυθμό ανάπτυξης των μικροοργανισμών είναι η διαθεσιμότητα θρεπτικών συστατικών, το ph, το Ο 2 και η θερμοκρασία. Γ2. Για την ανάπτυξη του μικροοργανισμού E. coli, απαραίτητη πηγή αζώτου είναι τα αμμωνιακά ή τα νιτρικά ιόντα και απαραίτητη πηγή άνθρακα οι υδατάνθρακες, όπως η γλυκόζη, η λακτόζη. Γ3. Καμπύλη Ι: Βιοαντιδραστήρας Α Καμπύλη ΙΙ: Βιοαντιδραστήρας Β Η Escherichia coli αναπτύσσεται άριστα σε θερμοκρασία 37 C. Επομένως στον βιοαντιδραστήρα Α έχουμε την άριστη θερμοκρασία ανάπτυξης του μικροοργανισμού στην καλλιέργεια, άρα ο ρυθμός ανάπτυξης του πληθυσμού είναι μεγαλύτερος σε σχέση με το ρυθμό ανάπτυξης του πληθυσμού στον βιοαντιδραστήρα Β, όπου έχουμε θερμοκρασία 20 ο C. Γ4. Οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα συνήθως κατά τη διάρκεια της εκθετικής και της στατικής φάσης ανάπτυξής τους.

3 3 Στην καμπύλη Ι η εκθετική φάση διαρκεί από τη 2 η μέχρι την 6 η ώρα και η στατική φάση διαρκεί από την 6 η μέχρι την 12 η ώρα της καλλιέργειας. Συνεπώς, η χρονική περίοδος κατά την οποία παράγονται χρήσιμα προϊόντα στον βιοαντιδραστήρα Α είναι από την 2 η μέχρι την 12 η ώρα της καλλιέργειας. ΘΕΜΑ Δ Δ1. Το πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης πρέπει να έχει τη συγκεκριμένη αλληλουχία που αναγνωρίζει και κόβει μια περιοριστική ενδονουκλεάση μόνο μια φορά. Έτσι το πλασμίδιο μετατρέπεται σε γραμμικό μόριο DNA με μονόκλωνα άκρα το οποίο ξαναγίνεται δίκλωνο με τη μεσολάβηση της DNA δεσμάσης, όταν αναμιγνύεται με το κομμάτι DNA του οργανισμού δότη που έχει προκύψει από τη δράση της ίδιας περιοριστικής ενδονουκλεάσης επειδή αυτά έχουν συμπληρωματικά άκρα. Επομένως, η κατάλληλη περιοριστική ενδονουκλεάση για το συγκεκριμένο πλασμίδιο είναι η δ, απορρίπτοντας την γ γιατί κόβει το DNA μέσα περιοχή του υποκινητή ενώ οι α και β κόβουν το πλασμίδιο σε δύο διαφορετικά σημεία. Δ2. Σχολικό βιβλίο, σελ. 59: Συνήθως χρησιμοποιούνται ως ξενιστές, βακτήρια που δεν έχουν πλασμίδια και επομένως είναι ευαίσθητα σε αντιβιοτικά. Για να μπει ένα πλασμίδιο μέσα στο βακτήριο, τα τοιχώματα του βακτηρίου γίνονται παροδικά διαπερατά σε μακρομόρια, μετά από κατάλληλη κατεργασία (μετασχηματισμός). Η επιλογή των μετασχηματισμένων βακτηρίων δηλαδή αυτών που δέχτηκαν κάποιο πλασμίδιο στηρίζεται στην ικανότητα ανάπτυξής τους παρουσία αντιβιοτικού, επειδή το πλασμίδιο περιέχει ένα γονίδιο που προσδίδει στα βακτήρια-ξενιστές ανθεκτικότητα στο συγκεκριμένο αντιβιοτικό. Σε θρεπτικό υλικό καλλιέργειας όπου έχουμε προσθέσει το αντιβιοτικό αμπικιλίνη ή στρεπτομυκίνη, αναπτύσσονται μόνο τα μετασχηματισμένα βακτήρια, δηλαδή αυτά που φέρουν το συγκεκριμένο πλασμίδιο, ανασυνδυασμένο ή μη, δημιουργώντας κλώνο βακτηρίων. Όσα βακτήρια δεν μετασχηματίστηκαν είναι ευαίσθητα στην παρουσία του αντιβιοτικού και συνεπώς δεν πολλαπλασιάζονται.

4 Δ3. Αλυσίδα Ι κωδική 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 κωδικόνιο λήξης 4 κωδικόνιο έναρξης Αλυσίδα ΙΙ μη κωδική 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3 Στην αλυσίδα Ι, με προσανατολισμό 5 3 εντοπίζω το κωδικόνιο έναρξης ATG και με βήμα τριπλέτας, συνεχή και μη επικαλυπτόμενα το κωδικόνιο λήξης ΤΑΑ. Άρα η αλυσίδα αυτή είναι η κωδική. Η αλυσίδα ΙΙ, η μη κωδική, είναι συμπληρωματική και αντιπαράλληλη ως την αλυσίδα Ι, την κωδική του γονιδίου. Η μεταγραφή γίνεται με προσανατολισμό 5 3. Το mrna είναι συμπληρωματικό και αντιπαράλληλο με τη μη κωδική αλυσίδα του γονιδίου, τη μεταγραφόμενη αλυσίδα του γονιδίου. Στο mrna που σχηματίζεται με προσανατολισμό 5 3 εντοπίζω κωδικόνιο έναρξης και με βήμα τριπλέτας, συνεχή και μη επικαλυπτόμενα, κωδικόνιο λήξης. Έτσι λοιπόν το mrna που προκύπτει είναι: mrna: 3 GCCAAUAUUAAAUGAGCATGCCGUAGGAATATTCGG 5 Δ4. Η αλληλουχία μήκους έξι ζευγών βάσεων που αναγνωρίζει η περιοριστική ενδονουκλεάση είναι: 3 AATATT 5 5 TTATAA 3 η οποία εντοπίζεται και στις πλευρές (άκρων) του γονιδίου. Δ5. Ένα γονίδιο για να εκφραστεί πρέπει να φέρει κατά σειρά την περιοχή του υποκινητή, πάνω στην οποία προσδένεται η RNA πολυμεράση για να ξεκινήσει η μεταγραφή του γονιδίου, το κωδικόνιο έναρξης, το κωδικόνιο λήξης και την αλληλουχία λήξης της μεταγραφής. Με τη δράση της περιοριστικής ενδονουκλεάσης προκύπτουν τα ίδια μονόκλωνα άκρα με αζευγάρωτες βάσεις: 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3

5 i) Οι βακτηριακοί κλώνοι παράγουν το ολιγοπεπτίδιο: 5 3 GCCAATATTAAATGAGCATGCCGTAGGAATATTCGG 5 5 CGGTTATAATTTACTCGTACGGCATCCTTATAAGCC 3 ΑΛΛΗΛΟΥΧΙΑ ΛΗΞΗΣ ΜΕΤΑΓΡΑΦΗΣ ΥΠΟΚΙΝΗΤΗΣ Στην περίπτωση αυτή, στην κωδική αλυσίδα του γονιδίου μετά την περιοχή του υποκινητή υπάρχει κωδικόνιο έναρξης και με βήμα τριπλέτας κωδικόνιο λήξης, άρα μπορεί να γίνει μεταγραφή και μετάφραση του παραπάνω τμήματος DNA. ii) Οι βακτηριακοί κλώνοι δεν παράγουν το ολιγοπεπτίδιο: 3 CCGAATATTCCTACGGCATGCTCATTTAATATTGGC 5 5 GGCTTATAAGGATGCCGTACGAGTAAATTATAACCG 3 ΑΛΛΗΛΟΥΧΙΑ ΛΗΞΗΣ ΜΕΤΑΓΡΑΦΗΣ ΥΠΟΚΙΝΗΤΗΣ

6 6 Στην περίπτωση αυτή, στην κωδική αλυσίδα του γονιδίου μετά την περιοχή του υποκινητή δεν υπάρχει κωδικόνιο έναρξης, άρα δεν μπορεί να γίνει μεταγραφή και μετάφραση του παραπάνω τμήματος DNA. ΚΟΤΡΟΠΟΥΛΟΣ ΔΗΜΗΤΡΙΟΣ ΒΙΟΛΟΓΟΣ SCIENCE PRESS



Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β.

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I A. φωσφορική ομάδα II III IV V VI VII Ε. υδροξύλιο ΣΤ. αμινομάδα Β. mrna Ζ. RNA πολυμεράση Γ. μεταγραφόμενη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ :


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Β κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Ο γενετικός κώδικας είναι µη επικαλυπτόµενος, δηλαδή:

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα


Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων Πανελλαδικές Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο μάθημα: Βιολογία Προσανατολισμού Θετικών Σπουδών Παρασκευή, 16 Ιουνίου 2017 Ενδεικτικές απαντήσεις θεμάτων Θέμα Α Α1. α) 3 CAT 5 β) 3 TAC 5

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017

Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017 Σελίδα1 Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I Α, II Ε, III ΣΤ, IV Β, V Ζ, VI Γ, VII Δ (7 μον.) Β2. Πρόκειται για προκαρυωτικό κύτταρο,

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΚΥΡΙΑΚΗ 27/03/2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2 ΚΕΦΑΛΑΙΟ 4 ο ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DN... 2 ΚΕΦΑΛΑΙΟ 4 ο I. Τεχνολογία του ανασυνδυασµένου DN Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. I, Β. IV, Γ. VI, Δ. VII, Ε. ΙΙ, ΣΤ. III, Ζ. V Β2. Αντιστοιχεί σε προκαρυωτικό οργανισμό. Στους προκαρυωτικούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1. Γ. Α2. Β. Α3. Γ. Α4. Α. Α5. Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Βιβλίο σελ. 65

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΘΕΜΑ 1 ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 ο 1. Σελ. 109 σχολ. Βιβλίου: Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα



Διαβάστε περισσότερα