2. ANALYSIS OF FTO AND ALKBH5 GENE EXPRESSION BY QUANTITATIVE REAL-TIME PCR MIQE checklist of qpcr Item to check Experimental design
|
|
- Γαλήνη Κωνσταντόπουλος
- 8 χρόνια πριν
- Προβολές:
Transcript
1 Supplemental Material Decreased N 6 -methyladenosine in peripheral blood RNA from Diabetic Patients Is Associated with FTO Expression Rather than ALKBH5 Fan Shen, 1,2, Wei Huang, 2, Jing-Tao Huang, 1 Jun Xiong, 2 Ying Yang, 1 Ke Wu, 3 Gui-Fang Jia, 4 Yu-Qi Feng, 2,* Bi-Feng Yuan, 2,* Song-Mei Liu 1,* 1 Center for Gene Diagnosis, Zhongnan Hospital of Wuhan University, Donghu Road 169#, Wuhan, , P.R. China 2 Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), Department of Chemistry, Wuhan University, Wuhan , P. R. China 3 Center for Animal Experiment/ABSL-3 Laboratory, Wuhan University, Wuhan, , PR China 4 Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing, , P. R. China Running Title: Content of N 6 -methyladenosine is correlated with T2DM These authors contributed equally to this work. *To whom correspondence should be addressed. Tel ; fax address: Song-Mei Liu, smliu@whu.edu.cn; Bi-Feng Yuan, bfyuan@whu.edu.cn; Yu-Qi Feng, yqfeng@whu.edu.cn. 1. ENZYMATIC HYDROLYSIS OF RNA RNA (100 ng) was first denatured by heating at 95ºC for 5 min and then chilling on ice for 2 min. After adding 1/10 volume of S1 nuclease buffer (30 mm CH 3 COONa, ph 4.6, 280 mm NaCl, 1mM ZnSO 4 ) and 150 units of S1 nuclease, the mixture (20 μl) was then incubated at 37ºC for 16 h. To the solution was subsequently added 1/10 volume of alkaline phosphatase buffer (50 mm Tris-HCl, 10 mm MgCl 2, ph 9.0), units of venom phosphodiesterase I and 15 units of alkaline phosphatase. And then the incubation was continued at 37ºC for an additional 4 h followed by extraction with equal volume chloroform twice. The resulting aqueous layer was collected and lyophilized to dryness and then reconstituted in 100 μl water. The obtained 30 μl samples were then subjected to liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis. 2. ANALYSIS OF FTO AND ALKBH5 GENE EXPRESSION BY QUANTITATIVE REAL-TIME PCR MIQE checklist of qpcr Item to check Experimental design 1
2 Human: T2DM patients (n=88) and control subjects (n=92) Animal: STZ induced diabetic rats (n=7) and normal Sprague-Dawley rats (n=8) Sample 1mL of whole blood sample with EDTA anticoagulation Nucleic acid extraction A commercially available TIANamp Blood RNA Kit (Tiangen, Beijing, China). Reverse transcription An amount of 8 ul of RNA was treated by a commercially available FastQuant RT Kit (with gdnase) (Tiangen, Beijing, China) according to the manufacturer s protocol. qpcr target information For human samples: Location of amplicon in mrna: ALKBH5: ; FTO: ; β-actin: ; GAPDH: Amplicon length: ALKBH5:123bp; FTO: 129bp; β-actin: 122bp; GAPDH: 151bp. For rat samples: Location of amplicon in mrna: ALKBH5: ; FTO: ; β-actin: ; GAPDH: Amplicon length: ALKBH5: 186bp; FTO: 190bp; β-actin: 143bp; GAPDH: 137bp qpcr oligonucleotides Please see Supplemental Table 2 qpcr protocol Complete reaction conditions: After predenaturation a 95ºC for 5 min, DNA fragments were amplified for 40 cycles: denaturation at 95ºC for 10s, annealing at 60ºC for 30s. Reaction volume and amount of cdna/dna: qpcr was performed on a CFX96 Touch Real-Time PCR Detection System (BioRad, CA, USA). qpcr mixture of 10 μl included 5.0 μl (2 ) of itaq Universal Supermixes (BioRad, CA, USA), 50 nm of each forward and reverse primers, 1 μl cdna template and 3.0 μl double-distilled H 2 O. qpcr validation For SYBR Green I, Cq of the NTC: Cq values of NTCs > 35.0 was set as no significance. Specificity (gel, sequence, melt, or digest): The amplification specificity was validated by both dissociation curve (Supplemental Figure 2
3 4) and agarose gel electrophoresis (Supplemental Figure 5). The qpcr products showed the single peak at 81.0ºC, 83.5ºC, 80.5ºC, and 84.0ºC for ALKBH5, FTO, β-actin and GAPDH, respectively. Calibration curves with slope and y intercept: The standard curves (Supplemental Figure 3) for ALKBH5, FTO, β-actin and GAPDH were linear in the range tested (R ). The Cq values of unknown samples fell within the linear range. The slopes of the standard curves for ALKBH5, FTO, β-actin and GAPDH were , , and 3.527, respectively; the amplification efficiencies were 93.2%, 92.2%, 90.6%, and 92.1%. Cq variation at LOD: CVs of each gene: ALKBH5=2.0%; FTO=2.5%; β-actin=2.6%; GAPDH=0.8%. LOD: ALKBH5, (copy); FTO, (copy); β-actin, (copy); GAPDH, (copy). Data analysis qpcr analysis program (source, version): CFX96 Manager Software (BioRad, CA, USA). Method of Cq determination: Cq Results for NTCs: All Cq values of NTCs were > 35.0 Justification of number and choice of reference genes: β-actin and GAPDH. Description of normalization method: multiple reference genes (β-actin and GAPDH) normalization. Number and concordance of biological replicates: Total sample: n=180; CVs of each gene: Normal group: ALKBH5=6.49%, FTO=5.15%, β-actin=10.02% and GAPDH=5.67%. T2DM group: ALKBH5=9.57%, FTO=7.79%, β-actin=16.41% and GAPDH=9.82%. Number and stage (reverse transcription or qpcr) of technical replicates: N=3 Repeatability (intraassay variation): N=3 for each sample; the ΔCq between replicates were less than 0.5; CVs of each gene: ALKBH5<2.31%, FTO<2.12%, β-actin<2.95% and GAPDH<1.82%. Statistical methods for results significance: Statistical significance was set at p < Software (source, version): SPSS 17.0 (SPSS Inc., Chicago, USA). 3
4 Supplemental Table 1. m 6 A contents in 180 RNA samples derived from 88 T2DM patients and 92 control subjects. Sample Group a Gender b Age m 6 A/rA (%) ALHBH5 c FTO d (year) D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±
5 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±0.071 D ± ± ± D ± ± ±0.078 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±
6 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ±
7 C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ±
8 C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± a Group: 1, Control subjects; 2, T2DM. b Gender: 1, Male; 2, Female. c Relative mrna expression level of ALKBH5 gene. d Relative mrna expression level of FTO gene. 8
9 Supplemental Table 2. Primers used for qpcr. Primers were designed to target the location of exon/intron junction to avoid the amplification of contaminated DNA. Genes ALKBH5 (human) FTO (human) GAPDH (human) β-actin (human) ALKBH5 (Rat) FTO (Rat) GAPDH (Rat) β-actin (Rat) Primers (5 3 ) Forward: AGGGGAAGCGTGACTGTGC Reverse: GGGTGCATCTAATCTTGTCTTCC Forward: CTTCACCAAGGAGACTGCTATTTC Reverse: CAAGGTTCCTGTTGAGCACTCTG Forward: TCTATAAATTGAGCCCGCAGC Reverse: CCAATACGACCAAATCCGTTG Forward: CCAGCTCCTCCCTGGAGAAG Reverse: ACAGGACTCCATGCCCAGG Forward: CAGTGGGTATGCTGCTGATG Reverse: GGGTCTCTGGTGTTTCCTGA Forward: GGCTGTGGAAGAAGATGGAG Reverse: TGCTGTGCTGGTAGAGTTCG Forward: TTCCAGTATGACTCTACCCACGGCA Reverse: GCACCAGCATCACCCCATTTG Forward: AGGGTGTGATGGTGGGTATGGGT Reverse: GTGGTGCCAAATCTTCTCCATATCG Amplicon Length 123 bp 129 bp 151 bp 122 bp 186 bp 190 bp 137 bp 143 bp 9
10 Supplemental Table 3. Primers used for HRM and DNA sequencing. FTO SNPs Primers (5 3 ) rs HRM Forward: AGGCAGGTGGATCTGAAA Reverse: TCCTAGTCACGTGTCTTGG DNA Forward: AGCTGGACCTGAACAAGG sequencing Reverse: AAGGCACAATAAGAGGAGAT Amplicon Length 49 bp 301 bp rs HRM Forward: CATCTGTAAGTCTGGTATATCTAACTAAT Reverse: CATGCTACACAGTCTAAGATGAAAG DNA Forward: AGGAGAAGCCTGATTGTTCC sequencing Reverse: TCTGGGTTTGCTCTTCCATAA 65 bp 311 bp rs HRM Forward: TTGCCCACTGTGGCAAT Reverse: AGTCCATCTCTACAGTTTACCTAAG DNA Forward: CCCAGACAAGTGCCCGTAT sequencing Reverse: GAGGTGCCATTCCTCAAT 67 bp 425 bp rs DNA Forward: CGCTGCTATGGTTCTACAGTTC 491 bp sequencing Reverse: GCCCAAGGATGGTGTTTCTA 10
11 Supplemental Table 4. Linearity, LOD and LOQ of m 6 A by LC-ESI-MS/MS. Analyte Linear range (m 6 A/rA, %) Slope Regression line Intercept R 2 LOD (fmol) LOQ (fmol) m 6 A ± ±
12 Supplemental Table 5. The preparation of the quality control (QC) samples with the synthesized m 6 A-containing oligonucleotides. Methylation level m 6 A/A (%) Molar ratio (%) RNA standard 1 RNA Standard RNA standard 1 (10-mer RNA) RNA standard 2 (15-mer RNA) 5 -AUCUAUAUGC UAAUAC(m 6 A)GAGAAAUC-3 12
13 Supplemental Table 6. Accuracy and precision for the detection of m 6 A. Nominal [m 6 A]/[A]% QC samples Day 1 n=3 Measured mean [m 6 A]/[A]% RSD a (%) RE b (%) Day 2 n=3 Measured mean [m 6 A]/[A]% RSD (%) RE (%) Day 3 n=3 Measured mean [m 6 A]/[A]% RSD (%) RE (%) a Relative standard deviation. b Relative error. QC, quality control. 13
14 Supplemental Table 7. Risk estimation based on the distributions of genotype and allele frequency of FTO SNPs Model Genotype Controls n (%) T2DMs n (%) OR a (95% CI) P AIC BIC rs Codominant CC 60 (75.0) 60 (68.2) 1.00 CT 17 (21.2) 26 (29.6) 1.53 ( ) TT 3 (3.8) 2 (2.3) 0.64 ( ) Dominant CC 60 (75.0) 60 (68.2) 1.00 CT+TT 20 (25.0) 28 (31.8) 1.40 ( ) Recessive CC+CT 77 (96.2) 86 (97.7) 1.00 TT 3 (3.8) 2 (2.3) 0.58 ( ) Overdominant CC+TT 63 (78.8) 62 (70.5) 1.00 CT 17 (21.2) 26 (29.6) 1.56 ( ) Addictive 1.21 ( ) Allele C 137 (85.6) 146 (83.0) 1.00 T 23 (14.4) 30 (17.0) 1.22( ) 0.56 rs Codominant AA 63 (78.8) 66 (75.9) 1.00 AG 14 (17.5) 17 (19.5) 1.16 ( ) GG 3 (3.8) 4 (4.6) 1.26 ( ) Dominant AA 63 (78.8) 66 (75.9) 1.00 AG+GG 17 (21.2) 21 (24.1) 1.18 ( ) Recessive AA+AG 77 (96.20) 83 (95.4) 1.00 GG 3 (3.8) 4 (4.6) 1.23 ( ) Overdominant AA+GG 66 (82.5) 70 (80.5) 1.00 AG 14 (17.5) 17 (19.5) 1.14 ( ) Addictive 1.14 ( ) Allele A 140 (87.5) 149 (85.6) 1.00 G 20 (12.5) 25 (14.4) 1.17( ) 0.63 rs Codominant CC 65 (81.2) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.48 ( ) AA 2 (2.5) 0 (0) 0.00 (0.00-NA) Dominant CC 65 (81.2) 68 (77.3) 1.00 AC+AA 15 (18.8) 20 (22.7) 1.27 ( ) Recessive CC+AC 78 (97.5) 88 (100) 1.00 AA 2 (2.5) 0 (0) 0.00 (0.00-NA) Overdominant CC+AA 67 (83.8) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.52 ( ) Addictive 1.07 ( ) Allele C 143 (89.4) 156 (88.6)
15 A 17 (10.6) 20 (11.4) 1.08( ) rs Codominant TT 64 (80.0) 66 (75.0) 1.00 AT 15 (18.8) 22 (25.0) 1.42 ( ) AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Dominant TT 64 (80.0) 66 (78.8) 1.00 AT+AA 16 (20.0) 22 (75.0) 1.33 ( ) Recessive TT+AT 79 (98.8) 88 (100.0) AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Overdominant TT+AA 65 (81.2) 66 (75.0) AT 15 (18.8) 22 (75.0) 1.44 ( ) Addictive 1.22 ( ) Allele A 143 (89.4) 154 (87.5) T 17 (10.6) 22 (12.5) 1.20( ) T2DM, Type 2 diabetes mellitus; OR, odds ratio; CI, confidence interval; AIC, Akaike Information Criterion; BIC, Bayesian Information Criterion. NA, not available a Adjusted for age and gender. 15
16 Supplemental Figure 1. Oxidative demethylation of m 6 A to adenosine in RNA by FTO or ALKBH5 in the presence of Fe(II) and α-kg. 16
17 Supplemental Figure 2. The MRM chromatograms of nucleosides. (A) Standard nucleosides. (B) 20 ng RNA from human peripheral blood. Shown in inset is the enlargement chromatogram of m 6 A. Experimental conditions: separation column, Hisep C18-T column; temperature, 35 C; flow rate, 0.2 ml/min; mobile phase, a mixture of formic acid in water (0.1%, v/v, solvent A) and a mixture of 0.1% formic acid in methanol (v/v, solvent B); gradient elution, 5 min 5% B, 10 min 5-30% B, 5 min 30-50% B, 3 min 50% B-5% B and 17 min 5% B. 17
18 Supplemental Figure 3. The genotyping results of high-resolution melting and DNA sequencing for the common four SNPs in FTO gene. (A) Three genotypes of rs , rs and rs by high-resolution melting. (B)-(E) Three genotypes of rs , rs , rs and rs by DNA sequencing. 18
19 Supplemental Figure 4. The standard curves, amplification plots and melting peaks of qpcr for ALKBH5, FTO, β-actin and GAPDH. ALKBH5 19
20 FTO 20
21 β-actin 21
22 GAPDH 22
23 Supplemental Figure 5. Gel electrophoresis of qpcr products for ALKBH5, FTO, β-actin and GAPDH. 23
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Supporting Information. Experimental section
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information Experimental section General. Proton nuclear magnetic resonance ( 1
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS
Electronic Supplementary Material (ESI) for Journal of Analytical Atomic Spectrometry. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTAL INFORMATION Fully Automated Total Metals and Chromium
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Supporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene
Supporting information Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene M. N. Chan 1, J. D. Surratt 2,*, A. W. H. Chan 2,**, K. Schilling 2, J.
Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Ε Κ Θ Ε Σ Η Δ Ο Κ Ι Μ Ω Ν
Αριθμός έκθεζης δοκιμών / Test report number Σειριακός αριθμός οργάνοσ / Instrument serial No T Πελάηης / Customer TOTAL Q Επγαζηήπια Διακπιβώζεων A.E. Κοπγιαλενίος 20, Τ.Κ. 11526 Αθήνα 20 Korgialeniou
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Phosphorus Oxychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions
Supplementary Information for Phosphorus xychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions u Chen,* a,b Xunfu Xu, a Liu Liu, a Guo Tang,* a
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
An experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2015 An experimental and theoretical study of the gas phase kinetics of atomic chlorine
A new ent-kaurane diterpene from Euphorbia stracheyi Boiss
SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory
Supplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
Supporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING Η εταιρία Macrogen χρησιμοποιεί την τελευταία λέξη της τεχνολογίας για την καλύτερη δυνατή παροχή Υπηρεσιών Sequencing. Μέσα από την 10ετη της εμπειρία, συγκέντρωσε
Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Does anemia contribute to end-organ dysfunction in ICU patients Statistical Analysis
Does anemia contribute to end-organ dysfunction in ICU patients Statistical Analysis Xue Han, MPH and Matt Shotwell, PhD Department of Biostatistics Vanderbilt University School of Medicine March 14, 2014
SFO-DLLME 12 DLLME DLLME SFO-DLLME. 1 L NaCl 1 mol /L H 3 PO 4
38 2010 10 FENXI UAXUE Chinese Journal of Analytical Chemistry 10 1400 ~ 1404 DOI 10. 3724 /P. J. 1096. 2010. 01400 - - * 442700 442000 - FO-DLLME - 3 24 1-200 μl 300 μl 1. 2 g NaCl 1 mol /L 3 PO 4 200
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Highly enantioselective cascade synthesis of spiropyrazolones. Supporting Information. NMR spectra and HPLC traces
Highly enantioselective cascade synthesis of spiropyrazolones Alex Zea a, Andrea-Nekane R. Alba a, Andrea Mazzanti b, Albert Moyano a and Ramon Rios a,c * Supporting Information NMR spectra and HPLC traces
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
Single-site association results for 136 SCARB1 genotyped variants with HDL-C.
Table S9. Single-site association results for 136 SCARB1 genotyped variants with HDL-C. SNP Name a SNP ID b Chr12 Position c Location Amino Acid Change RegDB Score d MA, MAF Genotype Genotype Count Adjusted
Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
Analysis of hydrophilic components in water. extract from Polygonum multiflorum using. micellar electrokinetic chromatography
Analysis of hydrophilic components in water extract from Polygonum multiflorum using micellar electrokinetic chromatography By Lao Ka Meng Master of Science 2013 Institute of Chinese Medical Sciences University
ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ
ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ ΕΛΕΝΑ ΦΛΟΚΑ Επίκουρος Καθηγήτρια Τµήµα Φυσικής, Τοµέας Φυσικής Περιβάλλοντος- Μετεωρολογίας ΓΕΝΙΚΟΙ ΟΡΙΣΜΟΙ Πληθυσµός Σύνολο ατόµων ή αντικειµένων στα οποία αναφέρονται
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Electronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Cyclopentadienyl iron dicarbonyl (CpFe(CO) 2 ) derivatives
Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics
Supporting Information (SI) Heterobimetallic Pd-Sn Catalysis: Michael Addition Reaction with C-, N-, -, S- Nucleophiles and In-situ Diagnostics Debjit Das, a Sanjay Pratihar a,b and Sujit Roy c * a rganometallics
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Supplementary figures
A Supplementary figures a) DMT.BG2 0.87 0.87 0.72 20 40 60 80 100 DMT.EG2 0.93 0.85 20 40 60 80 EMT.MG3 0.85 0 20 40 60 80 20 40 60 80 100 20 40 60 80 100 20 40 60 80 EMT.G6 DMT/EMT b) EG2 0.92 0.85 5
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΠΜΣ ΘΕΤΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΣΤΗΝ ΓΕΩΠΟΝΙΑ ΚΛΑΔΟΣ III: ΜΕΛΕΤΗ ΚΑΙ ΑΞΙΟΠΟΙΗΣΗ ΦΥΣΙΚΩΝ ΠΡΟΪΟΝΤΩΝ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ ΜΕΛΕΤΗ ΤΗΣ ΧΗΜΙΚΗΣ ΣΥΣΤΑΣΗΣ
ESI for. A simple and efficient protocol for the palladium-catalyzed. ligand-free Suzuki reaction at room temperature in aqueous DMF.
ESI for A simple and efficient protocol for the palladium-catalyzed ligand-free Suzuki reaction at room temperature in aqueous DMF Chun Liu,* Qijian i, Fanying Bao and Jieshan Qiu State Key Laboratory
Electronic Supplementary Information
Electronic Supplementary Information NbCl 3 -catalyzed [2+2+2] intermolecular cycloaddition of alkynes and alkenes to 1,3-cyclohexadiene derivatives Yasushi Obora,* Keisuke Takeshita and Yasutaka Ishii*
Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes
1 Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes Gonzalo Blay, Isabel Fernández, Alícia Marco-Aleixandre, and José R. Pedro Departament de Química Orgànica, Facultat de Química,
Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΩΝ ΠΡΟΪΟΝΤΩΝ ΟΞΕΙΔΩΣΗΣ ΤΗΣ ΧΟΛΗΣΤΕΡΟΛΗΣ ΣΤΑ ΚΥΠΡΙΑΚΑ ΤΡΟΦΙΜΑ ΜΕ ΤΗ ΧΡΗΣΗ ΝΕΩΝ ΒΕΛΤΙΩΜΕΝΩΝ ΑΝΑΛΥΤΙΚΩΝ ΤΕΧΝΙΚΩΝ
ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΩΝ ΠΡΟΪΟΝΤΩΝ ΟΞΕΙΔΩΣΗΣ ΤΗΣ ΧΟΛΗΣΤΕΡΟΛΗΣ ΣΤΑ ΚΥΠΡΙΑΚΑ ΤΡΟΦΙΜΑ ΜΕ ΤΗ ΧΡΗΣΗ ΝΕΩΝ ΒΕΛΤΙΩΜΕΝΩΝ ΑΝΑΛΥΤΙΚΩΝ ΤΕΧΝΙΚΩΝ ΧΡΙΣΤΙΑΝΑ Α. ΓΕΩΡΓΙΟΥ ΜΑΪΟΣ 2015 Εξεταστική Επιτροπή: ΔΙΔΑΚΤΟΡΙΚΗ
MSWD = 1.06, probability = 0.39
MSWD Institute of Geophysics and Planetary Physics Incremental Heating 36Ar(a) 37Ar(ca) 38Ar(cl) 39Ar(k) 40Ar(r) Age (Ma) 40Ar(r) (%) 1B15835D 670 C 4 0.000001 0.078288 0.000010 0.001470 0.010633 9.19
. K HPLC. 2 ~ 50 μg / ml r ~ mg / kg 15
HPLC 527 2 ECONOMOU A FIELDEN P R. Applications potentialities and limitations of adsorptive stripping analysis on mercury film electrodesj. Trends Anal Chem 1997 16 5 286-292. 3 OL IVEIRA M FSACZK A AOKUMURA
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Supporting Information
Supporting Information Molecular Cage Impregnated Palladium Nanoparticles: Efficient, Additive-Free Heterogeneous Catalysts for Cyanation of Aryl Halides. Bijnaneswar Mondal, Koushik Acharyya, Prodip Howlader
; +302 ; +313; +320,.
1.,,*+, - +./ +/2 +, -. ; +, - +* cm : Key words: snow-water content, surface soil, snow type, water permeability, water retention +,**. +,,**/.. +30- +302 ; +302 ; +313; +320,. + *+, *2// + -.*, **. **+.,
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
S
MSWD Institute of Geophysics and Planetary Physics Incremental Heating 36Ar(a) 37Ar(ca) 38Ar(cl) 39Ar(k) 40Ar(r) Age (Ma) 40Ar(r) (%) 1B16079D 600 C 4 0.000034 0.033821 0.000003 0.001780 0.001016 0.72
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Table of Contents 1 Supplementary Data MCD
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting Information for Magnetic circular dichroism and density functional theory
Supplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
Supporting Information
Supporting Information Copper/Silver Cocatalyzed Oxidative Coupling of Vinylarenes with ICH 2 CF 3 or ICH 2 CHF 2 Leading to β-cf 3 /CHF 2 -Substituted Ketones Niannian Yi, Hao Zhang, Chonghui Xu, Wei
Technical Information T-9100 SI. Suva. refrigerants. Thermodynamic Properties of. Suva Refrigerant [R-410A (50/50)]
d Suva refrigerants Technical Information T-9100SI Thermodynamic Properties of Suva 9100 Refrigerant [R-410A (50/50)] Thermodynamic Properties of Suva 9100 Refrigerant SI Units New tables of the thermodynamic
DuPont Suva 95 Refrigerant
Technical Information T-95 ENG DuPont Suva refrigerants Thermodynamic Properties of DuPont Suva 95 Refrigerant (R-508B) The DuPont Oval Logo, The miracles of science, and Suva, are trademarks or registered
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Szabolcs Sofalvi, M.S., D-ABFT-FT Cleveland, Ohio
Statistical Tools for SWGTOX Method Validation of 11 Benzodiazepines in Whole Blood by SPE and GC/MS Szabolcs Sofalvi, M.S., D-ABFT-FT Cleveland, Ohio Disclaimer Neither I nor any member of my immediate
SUPPORTING INFORMATION
SUPPRTING INFRMATIN Per(-guanidino--deoxy)cyclodextrins: Synthesis, characterisation and binding behaviour toward selected small molecules and DNA. Nikolaos Mourtzis, a Kyriaki Eliadou, a Chrysie Aggelidou,
chlorostibine Iou-Sheng Ke and François P. Gabbai Department of Chemistry, Texas A&M University, College Station, TX
σ-donor/acceptor confused ligands: The case of a chlorostibine Iou-Sheng Ke and François P. Gabbai Department of Chemistry, Texas A&M University, College Station, TX 77843-3255. *To whom correspondence
The effect of curcumin on the stability of Aβ. dimers
The effect of curcumin on the stability of Aβ dimers Li Na Zhao, See-Wing Chiu, Jérôme Benoit, Lock Yue Chew,, and Yuguang Mu, School of Physical and Mathematical Sciences, Nanyang Technological University,
Lowara SPECIFICATIONS
SH Series Centrifugal pumps entirely made of AISI 36 stainless steel according to EN 733 (ex DIN 24255). Designed to pump hot, cold and moderately aggressive liquids. Available versions: SHE Close-coupled
UDZ Swirl diffuser. Product facts. Quick-selection. Swirl diffuser UDZ. Product code example:
UDZ Swirl diffuser Swirl diffuser UDZ, which is intended for installation in a ventilation duct, can be used in premises with a large volume, for example factory premises, storage areas, superstores, halls,
Supporting Information for
Supporting Information for An atom-economic route to densely functionalized thiophenes via base-catalyzed rearrangement of 5-propargyl-2H-thiopyran-4(3H)-ones Chunlin Tang a, Jian Qin b, Xingqi Li *a a
Διδακτορική Διατριβή
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Διδακτορική Διατριβή Η ΕΠΙΔΡΑΣΗ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΑΡΕΜΒΑΣΗΣ ΥΠΟΒΟΗΘΟΥΜΕΝΗΣ ΑΠΟ ΥΠΟΛΟΓΙΣΤΗ ΣΤΗΝ ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΚΑΙ ΣΤΗΝ ΑΥΤΟΦΡΟΝΤΙΔΑ ΑΣΘΕΝΩΝ ΜΕ ΚΑΡΔΙΑΚΗ
Design and Solid Phase Synthesis of New DOTA Conjugated (+)-Biotin Dimers Planned to Develop Molecular Weight-Tuned Avidin Oligomers
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2015 Supplementary Information Design and Solid Phase Synthesis of New DTA Conjugated
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
DuPont Suva. DuPont. Thermodynamic Properties of. Refrigerant (R-410A) Technical Information. refrigerants T-410A ENG
Technical Information T-410A ENG DuPont Suva refrigerants Thermodynamic Properties of DuPont Suva 410A Refrigerant (R-410A) The DuPont Oval Logo, The miracles of science, and Suva, are trademarks or registered
Bulletin 1489 UL489 Circuit Breakers
Bulletin 489 UL489 Circuit Breakers Tech Data 489-A Standard AC Circuit Breaker 489-D DC Circuit Breaker 489-A, AC Circuit Breakers 489-D, DC Circuit Breakers Bulletin 489-A Industrial Circuit Breaker
Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions
This journal is The Royal Society of Chemistry 213 Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions Wenjing Cui, a Bao Zhaorigetu,* a Meilin Jia, a and Wulan
Supplementary information:
Supplementary information: Monitoring changes of docosahexaenoic acid-containing lipids during the recovery process of traumatic brain injury in rat using mass spectrometry imaging Shuai Guo 1, Dan Zhou
Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes
SUPPORTING INFORMATION Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes Eric J. Uzelac, Casey B. McCausland, and Seth C. Rasmussen*
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Synthesis of 3-omosubstituted Pyrroles via Palladium- Catalyzed Intermolecular Oxidative Cyclization
Electronic Supplementary Information
Electronic Supplementary Information Cucurbit[7]uril host-guest complexes of the histamine H 2 -receptor antagonist ranitidine Ruibing Wang and Donal H. Macartney* Department of Chemistry, Queen s University,
Statistics 104: Quantitative Methods for Economics Formula and Theorem Review
Harvard College Statistics 104: Quantitative Methods for Economics Formula and Theorem Review Tommy MacWilliam, 13 tmacwilliam@college.harvard.edu March 10, 2011 Contents 1 Introduction to Data 5 1.1 Sample
SUPPORTING INFORMATION
SUPPORTING INFORMATION Heronamides A C, new polyketide macrolactams from an Australian marine-derived Streptomyces sp. A biosynthetic case for synchronized tandem electrocyclization. Ritesh Raju, Andrew
April 2013 Chinese Journal of Chromatography 380 ~ A
2013 4 Vol. 31 No. 4 April 2013 Chinese Journal of Chromatography 380 ~ 385 DOI 10. 3724 /SP. J. 1123. 2012. 10037-1 2 2 2 3* 1. 361005 2. 362006 3. 361005 - UHPLC-MS /MS BS EN 14362-1 2012 ISO 17234-1
Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography
2010 10 October 2010 ROCK AND MINERAL ANALYSIS Vol. 29 No. 5 503 ~ 507 0254 5357 2010 05 0503 05-1 2 3 1 1 1. 100037 2. 710021 3. 100083 13 Carb Rtx - OPP2-0. 67 ~ 1. 50 ng /ml 0. 67 ~ 600 ng /ml 0. 999
1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
Consolidated Drained
Consolidated Drained q, 8 6 Max. Shear c' =.185 φ' =.8 tan φ' =.69 Deviator, 8 6 6 8 1 1 p', 5 1 15 5 Axial, Symbol Sample ID Depth Test Number Height, in Diameter, in Moisture Content (from Cuttings),
Daewoo Technopark A-403, Dodang-dong, Wonmi-gu, Bucheon-city, Gyeonggido, Korea LM-80 Test Report
LM-80 Test Report Approved Method: Measuring Lumen Maintenance of LED Light Sources Project Number: KILT1212-U00216 Date: September 17 th, 2013 Requested by: Dongbu LED Co., Ltd 90-1, Bongmyeong-Ri, Namsa-Myeon,
Παιδιατρική ΒΟΡΕΙΟΥ ΕΛΛΑΔΟΣ, 23, 3. Γ Παιδιατρική Κλινική, Αριστοτέλειο Πανεπιστήμιο, Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης, 2
162 Σύγκριση της επίδρασης της Μοντελουκάστης και των Εισπνεομένων Στεροειδών στο Εκπνεόμενο Μονοξείδιο του Αζώτου (eno) και την αναπνευστική λειτουργία σε ασθματικά παιδιά Ε. Χατζηαγόρου 1, Β. Αβραμίδου
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Supporting Information
Supporting Information rigin of the Regio- and Stereoselectivity of Allylic Substitution of rganocopper Reagents Naohiko Yoshikai, Song-Lin Zhang, and Eiichi Nakamura* Department of Chemistry, The University