svari Real-time RT-PCR RSV

Transcript

1 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time Real-time RSV subgroup RSV HMPV F Real-time genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV HMPV PCR PCR svari Real-time RSV subgroup HMPV RNA VeroE6 RSV subgroup A subgroup B 2 HMPV genotype A2 genotype B High Pure Viral RNA Kit Roche RNA Super Script Invitrogen cdna Real-time TaqMan MGB RSV F 1 HMPV F 2 Real-time RS F F PCR TA PCR TOPO TA Cloning Kit for Sequencing Invitrogen pcr4-topo vector Big Dye Terminator v1.1 Cycle Sequencing Kit ABI Plasmid Mini Kit Qiagen Spe UV260nm OD PCR BLAST RSV

2 subgroup A AB RSV subgroup B HQ HMPV genotype A2 GQ3651 HMPV genotype B2 HM Real-time 1 tube μl 22.5μL Real-time PCR Q uantitect Probe PCR Master Mix Qiagen 100μ M 10μM TaqMan MGB RNase-free 2.5μL cdna ABI 70 Real-time PCR system A BI DNA polymerase TE buffer copies/2.5μl copies/2.5μl 10 cdna ABI Sequence Detection System Software ver. 1.4 cdna Real-time Conventional RSV N 1 HMPV F 2 PCR RSV subgroup A subgroup B HMPV genotype A2 genotype B2 10 Real-time copies/tube copies/tube PCR X Y PCR Ct 1 RSV subgroup A R 2 =0.999 Slope: RSV subgroup B R 2 =0.999 Slope: HMPV genotype A2 R 2 =0.999 Slope: HMPV genotype B2 R 2 =0.999 Slope: RSV HMPV copies/tube RSV HMPV RNA cdna 10 Real-time RSV subgroup A 9.9 copies/tube Ct.34 RSV subgroup B 1.4 copies/tube Ct.98 HMPV genotype A copies/tube Ct HMPV genotype B2 2.8 copies/tube Ct 38. PCR RNA cdna Real-time Conventional RSV N Conventional Real-time Real-time RSV subgroup HMPV F Conventional Real-time Real-time 19 genotype A2 17 genotype B1 2 Real-time RSV F HMPV F TaqMan MGB RSV subgroup A B sense antisense subgroup A B TaqMan MGB 1 tube RSV subgroup copies/tube RSV RSV Real-time N Conventional Real-time subgroup RSV

3 HMPV genotype A1 A2 sense 1 genotype B1 B2 sense 1 genotype antisense 1 genotype A genotype B TaqMan MGB 1 tube RSV copies/tube HMPV HMPV Real-time F Conventional genotype A2 B1 TaqMan RSV HMPV Real-time Conventional PCR PCR RSV HMPV svari RSV HMPV Real-time 56 1 RSV HMPV RSV Real-time 1 tube RSV subgroup 23

4 1 RSV Real-time Conventional TaqMan MGB PCR Assay Primer or Probe Sequence (5 3 )* a Gene position (Polarity* b ) Location RSVf-F1 CARCAAAGTTAYTCTATCATGTC F (+) * e Real-time RSVf-R1 GATCCTGCATTRTCACARTACCA F (-) * e RSVfA-TPf2* c VIC- TGTAGTACAATTRCCACT -MGB-NFQ F (+) * e RSVfB-TPf* d FAM- TGTRCAGCTRCCTATC -MGB-NFQ F (+) * f Conventional RSV AB-F GTCTTACAGCCGTGATTAGG N (+) * e RSV AB-R GGGCTTTCTTTGGTTACTTC N (-) * e RSV A-F GATGTTACGGTGGGGAGTCT N (+) * e RSV A-R GTACACTGTAGTTAATCACA N (-) * e RSV B-F AATGCTAAGATGGGGAGTTC N (+) * f RSV B-R GAAATTGAGTTAATGACAGC N (-) 89-70* f * a Mix bases in degenerated primers and probe are as follows: Y, C or T; R, G or A. * b (+), Sense; (-), antisense. * c The MGB probe is labeled with VIC reporter dye at the 5 end, and with minor groove binder (MGB) and a nonfluorescent quencher * d The MGB probe is labeled with FAM reporter dye at the 5 end, and with minor groove binder (MGB) and a nonfluorescent quencher * e Location is relative to the genome of RSV subgroup A strain A2 (accession number M11486). * f Location is relative to the genome of RSV subgroup B strain 93 (accession number AY50). 2 HMPV Real-time Conventional TaqMan MGB PCR Assay Primer or Probe Sequence (5 3 )* a Gene position (Polarity* b ) Location hmpv-3s ATGGCYGTYAGCTTCAGTCA F (+) * d Real-time hmpv-4s GATGGCTGTCAGYTTCAGTC F (+) 36-36* d hmpv-3as TGYCCTGCAGATGTYGGCATGT F (-) * d hmpva-tpr* c FAN-ATTCCAGCRTTGTCTGA-MGB-NFQ F (-) * d hmpvb-tpr* c FAM-ATCCCTGCATTGTCTGA-MGB-NFQ F (-) * e Conventional hmpv-1f CTTTGGACTTAATGACAGATG F (+) * d hmpv-1r GTCTTCCTGTGCTAACTTTG F (-) * d hmpv-2f CATGCCGACCTCTGCAGGAC F (+) * d hmpv-2r ATGTTGCAYTCYYTTGATTG F (-) * d * a Mix bases in degenerated primers and probe are as follows: Y, C or T; R, G or A. * b (+), Sense; (-), antisense. * c The MGB probe is labeled with FAM reporter dye at the 5 end, and with minor groove binder (MGB) and a nonfluorescent quencher * d Location is relative to the genome of HMPV genotype A1 strain NL/1/00 (accession number AF371337). * e Location is relative to the genome of HMPV genotype B2 strain NL/1/94 (accession number AY4362).

5 RSV subgroup A Slope: (PCR efficiency: 96.1%) RSV subgroup B Slope: (PCR efficiency: 93.4%) HMPV genotype A2 Slope: (PCR efficiency: 94.5%) HMPV genotype B2 Slope: (PCR efficiency: 96.1%) 10 1 RSV HMPV 10 Real-time 3 Real-time Conventional RSV RSV Conventional Real-time Positive Negative Total Positive Negative Total Real-time Conventional HMPV HMPV Conventional Real-time Positive Negative Total Positive 1 21 Negative Total Positive 0 Negative Total Positive Negative Total