22 3 2006 5 Chinese Journal of Biotechnology Vol. 22 No. 3 May 2006 sirna nm232h1 Analysis of The Relationship Bet ween Nm232H1 Gene and Human Chronic Myeloblastic Leukemia Using SiRNA, 3 3,, CHEN Yu2Xia, ZHANG Mei2Ying, XIONG Sheng 3, QIAN Chui2Wen and WANG Yi2Fei 3, 510632 Jinan Biomedicine Research & Development Basement, Jinan University, Guangzhou 510632, China nm232h1 sirnas, nm232h1 sirna, 3 sirna sirna lipofectamine2000 K562 24h RT2 PCR nm232h1 mrna ; 48h nm232h1 MTT 24h 48h 72h sirna K562 3 sirna,sinm526 K562 nm232h1, sinm526 K562 nm232h1 K562, K562 nm232h1 nm232h1, sirna,, K562 R392111 A 100023061 (2006) 0320403205 Abstract To investigate the relationship between nm232h1 gene and human chronic myeloblastic leukemia we designed sirnas which target nm232h1 gene. According to the principles of designing sirna, we selected three sirnas and transfected them into K562 cells by lipofectamine2000. The expression levels of nm232h1 mrna were detected by reverse transcriptase polymerase chain reaction after transfection for 24 hours. The expression levels of nm232h1 protein were assayed by immunocytochemical method after transfection for 48 hours. And after transfection for 24 48 and 72 hours, cell proliferation was determined by MTT method. Among the three sirnas, sinm526 can effectively inhibit the expression of nm232h1 on mrna and protein levels. The growth of K562 cells was suppressed after transfection of sinm526. These results suggest that low expression level of nm232h1 in K562 cells inhibited cell proliferation, namely reduced malignant degree of them. Therefore nm232h1 gene might be a potential target of leukemia treatment. Key words nm232h1 gene, sirna, human chronic myeloblastic leukemia, K562 cell line nm232h1 nm23, [1-3 NDPK2A nm232h1, ] [4 ] [5 ] Received : November 30, 2005 ; Accepted : February 17, 2006. This work was supported by the grant from The National Natural Science Foundation of China (No. 30400071 and 30371661) The Science and Technology Cooperation Project of China and Australia (No. 2004243) and The Programs for Industry Development of Guangdong Province (No. 2005A10904001). 3 Corresponding author. Tel : 86220285222706 ;Fax : 862202852227062309 ; E2mail : twangyf @jnu. edu. cn (No. 30400071 30371661) ( 2004243 ) (No. 2005A10904001)
404 Chinese Journal of Biotechnology 2006,Vol122,No13, nm232h1 11212 : K562 2 10 5 ΠmL [6 ], 12, 1mL 24h, lipofectamine2000 d 2 GFP,nm232H1 d 2 GFP sigfp (Negative [7,8 ] ; control), sinm80 sinm497 sinm526,nm232h1 37 5 % CO 2 [9, ] 5h, 30 % nm232h1, 1640 015mL 24h, nm232h1 sirna,,rt2pcr nm232h1 K562, nm232h1 K562 ;48h, NDPK2A 1 : 111 (1 ) RNA : Trizol RNA, K562, BECKMAN DU 640 d2gfp, nm23, ( IGg) ; TRIzol (2) : PCR RNA lipofectamine TM 2000 Invitrogen ; sirna 6 L oligodt 1 L,70 5min ; Invitrogen ; RevertAid TM M2MuLV 5 RT 4 L, 215mmolΠL dntps Fermentas ;2 Taq PCR Master Mix 8 L,37 5min, M2MuLV ; PCR 1 L, 20 L 42 60min,70 10min ; SP9001,4 RT - 20 ;Opti2MEM (3) PCR : RT (cdna) 2 L, 2 Taq Gibco ;MTT Sigma PCR Master Mix 10 L, (20 molπl) 1 L, 112 3dH 2 O 20 L, PTC2200 PCR 11211 sirna : sirna, PCR :94 1min ; 94 sirna : mrna 40s,56 40s,72 40s, 30 ; AA 21 23nt, 72 4min PCR 1 % 75nt ; G C 30 % 60 % ;, SynGene GeneGenius 5, 5 4nt GC nm232h1 2actin 3 4nt GC ; GGG,, nm232h1π 2actin sirna ; BLAST 2 PCR Table 2 Primer sequences used for the PCR amplification Construct sinm80 sinm497 sinm526 Negative control sigfp 1 sirna Table 1 Related sirna sequences sirna sequence 5 2GAA CCA UGG CCA ACU GUG ATT23 5 2UCA CAG UUG GCC AUG GUU CTT23 5 2CUG GUA GAU UAC ACG AGC UTT23 5 2AGC UCG UGU AAU CUA CCA GTT23 5 2CUG GAU CUA UGA AUG ACA GTT23 5 2CUG UCA UUC AUA GAU CCA GTT23 5 2UUC UCC GAA CGU GUC ACG UTT23 5 2ACG UGA CAC GUU CGG AGA ATT23 5 2GAA GCA GCA CGA CUU CUU CTT23 5 2GAA GAA GUC GUG CUG CUU CTT23 11213 RT2PCR nm232h1 Construct nm232h1(186bp) 2actin(545bp) Primer sequence 5 2TTAATCAGATGGTCGGGGAT23 5 2GATCTATGAATGACAGGAGG23 5 2GTGGGGCGCCCCAGGCACCA23 5 2CTTCCTTAATGTCACGCACGATTTC23 11214 NDPK2A : SP9001 :,PBS 3 PBS,,4 10min,PBS 3, 3 %H 2 O 2 5min,,PBS 5min
:sirna nm232h1 405, 15min,, 0172 ( P > 0105) 0131 ( P < 0105 ), nm23,,4 sinm80 sinm497 sinm526 1 % PBS,3min 3,37 20 % 66 %, 3 sirna sinm526 K526 1h PBS,3min 3 DAB nm232h1,, 11215 MTT sirna K562 : K562 2 10 5 ΠmL 96, 100 L sinm526 Negative control ; 24h MTT MTT : MTT (5mgΠmL) 20 LΠ, 4,37 4h, 1 RT2PCR K562 nm232h1 mrna 1000rΠmin 5min, 100 L 15 %SDS Fig11 Expression of nm232h1 mrna in K562 cells 10 L,, BIO2RAD 550 detected by RT2PCR 570nm A ( 630nm) 1 : DL2000 markers ; 2 : transfected with sinm80 ; 3 : transfected with sinm497 ; 4 : transfected with sinm526 ; 5 : transfected with Negative : ( %) = A - A A - A 100 % 11216 : 212 NDPK2A, SPSS, (one2way ANOVA) 2,, 2, sinm526 K562 211 RT2PCR nm232h1 NDPK2A 213 sinm526 K562 1,nm232H1 21311 sinm526 : 186bp ; 2actin 545bp sinm526 24h K562, 3 (Negative control) lipofectamine 2000, K562, K562 nm232h1π 2actin,, ; sinm526 0190 0191 0189, sinm80 sinm497 sinm526 K562 nm232h1π 2actin 0189 ( P > 0105) control ; 6 : control (added lipofectamine 2000) ; 7 : untreated., sinm526, K562, 2 K562 NDPK2A ( 200) Fig12 Expression of NDPK2A protein in K562 cells detected by immunocytochemistry( 200) A :untreated ; B :transfected with Negative control ; C. transfected with sinm526.
406 Chinese Journal of Biotechnology 2006,Vol122,No13 3 K562 ( 100) Fig13 Morphological change of K562 cells observed by inverted microscope( 100) A :untreated ; B :transfected with Negative control ; C. transfected with sinm526. 21312 sinm526 :MTT, 4, sinm526 K562 bcrπabl,, 24h 48h 72h [15 ] bcr2abl mrna ( P < sirna, psilencer110 U6 0105), pbcr6 K562 48h 72h ( P > 0105) 24h 48h 72h bcr2abl mrna sirna 1617 % 2611 % 2010 % K562 sirna sirna, 4 MTT sinm526 K562 3 sirna,3 sirna Fig14 Inhibitory effect of sinm526 on the growth of K562 sinm80 sinm497, cells measured with MTT colorimetric assay 3 sirna, http :ΠΠwww. wi. mit. eduπresπres. html, sirna 20 blast, antisense 5 8 sirna ; 14 sinm526 nm232h1,, sirna nm232h1 sirna, 21 23,, RNA, Negative control,, lipofectamine 2000 nm232h1π 2actin,,, sirna nm23, NDPK, [10-12 ], 9,22 (Nucleoside diphosphate,ndp) bcrπabl, (Nucleoside triphosphate, NTP) [13 ] Scherr [14 ] NTP Roymans bcrπabl sirna [16 ] NDPK RacΠRho
:sirna nm232h1 407 NDPK Tiam1, Tiam1 GDP, Src Tiam1, GTPΠGDP, RacΠRho, sinm526 K562,,,, sirna nm232h1,ndpk2a, GTPΠ GDP,, K562, NDPK, NDPK, nm232h1, RNA nm232h1 [17 ] nm232h1, nm232h1 nm232h1 nm232h1 [18 ] sirna,,sirna,,, mrna sirna, sirna,,, REFERENCES( ) [ 1 ] Cipollini G, Berti A, Fiore L et al. Down2regulation of the nm232 H1 gene inhibits cell proliferation. Int J Cancer, 1997, 73 (2) : 297-302 [ 2 ] Caligo MA, Cipollini G, Fiore L et al. nm23 gene expression correlates with cell growth rate and is S2phase dependent. Cancer, 1995, 60 (6) : 837-842 Int J [ 3 ] Postel EH. Multiple biochemical activities of NM23ΠNDP kinase in gene regulation. J Bioenerg Biomembr, 2003, 35(1) :31-40 [ 4 ] Lombardi D, Mileo AM. Protein interactions provide new insight into Nm23Πnucleoside diphosphate kinase functions. Biomembr, 2003, 35(1) :67-71 J Bioenerg [ 5 ] Rosengard AM, Krutzsch HC, Shearn A et al. Reduced Nm23ΠAwd protein in tumour metastasis and aberrant Drosophila development. Nature, 1989, 342 (6246) : 177-180 [ 6 ] Amendola R, Martinez R, Negroni A et al. DR2nm23 expression affects neuroblastoma cell differentiation, integrin expression, and adhesion characteristics. Med Pediatr Oncol, 2001, 36(1) :93-96 [ 7 ] Dela Rosa A, Williams RL, Steeg PS. nm23πnucleoside diphosphate kinase : toward a structural and biochemical understanding of its biological functions. BioEssays, 1995, 17 (1) : 53-62 [ 8 ] Li XL,Wang YF. Recent advances in NM23 gene and the metastasis of breast carcinoma. Chinese Journal of Pathophysiology,2003, 19 (3) :418-422 [ 9 ] Niitsu N, Okabe2Kado J, Nakayama M et al. Plasma levels of the differentiation inhibitory factor nm232h1 protein and their clinical implications in acute myelogenous leukemia. Blood, 2000, 96 (3) : 1080-1086 [10] Yague E, Higgins CF, Raguz S. Complere reversal of multi drug resistance by stable expression of small interfering RNAs targeting MDR1. 2004, 11(14) :1170-1174 [11] Tseng CP, Huang CL, Huang CH et al. Disabled22 small interfering RNA modulates cellular adhesive function and MAPK activity during megakaryocytic differentiation of K562 cells. Lett, 2003, 541 (13) :21-27 FEBS [12] Cioca DP, Aoki Y, Kiyosawa K ( 2003) RNA interference is a functional pathway with therapeutic potential in human myeloid leukemia cell lines. Cancer Gene Ther, 2003, 10 (2) : 125-133 [13] Hu HY,Zhang H, He DM. Recent advamces of sirna in malignant blood diseases. Foreign Sciences. Section of Pathophysiology and clinical Medicine,2004, 24(5) :413-416 [14] Scherr M, Battmer K, Winkler T et al. Specific inhibition of bcrπ abl gene expression by small interfering RNA. Blood, 2003, 101 (4) :1566-1569 [15] Chen BB,Fan HH,Lin GW et al. Experimental study of k562 cell apoptosis induced by sirna. Chin J Hematol, 2004, 25 (12) :717 [16] Roymans D, Willems R, Van Blockstaele DR et al. Nucleoside diphosphate kinase ( NDPKΠNM23 ) and the waltz with multiple partners: possible consequences in tumor metastasis. Clin Exp Metastasis, 2002, 19(6) : 465-476 [17] Yuan Y,Wang YF,Zhang MY et al. Relationship between nm23- H1 gene expression and proliferation of HL-60 cells. Journal of Jinan University (Medicine Edition), 2004, 25 (4) :400-407 [18] Aoki Y, Cioca D, Oidaira H et al. RNA interference may be more potent than antisense RNA in human cancer cell lines. Pharmacol Physiol, 2003, 30 :96-102 Clin Exp