FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP

Σχετικά έγγραφα
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

- A. A Biphenol A BPA BPA BPA LLE 5 SPE Electrospinning Kang. Packed-fiber solid-phase extraction PFSPE 1 ml

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

30s 56 60s 72 60s dntp cm s s s 23

SFO-DLLME 12 DLLME DLLME SFO-DLLME. 1 L NaCl 1 mol /L H 3 PO 4

FENXI HUAXUE Chinese Journal of Analytical Chemistry. LC-MS n Thermo Christ

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

Preparation of Hydroxyapatite Coatings on Enamel by Electrochemical Technique

1010 C 73 H 108 O 12. FENXI HUAXUE Chinese Journal of Analytical Chemistry 399 ~ HPLC. PDA 282 nm PP 1010 Weibull PP PP.

) ; GSP ) ;PXD g, 100 ml

Analysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis

Separation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection

, DYY-8B, ; : Centrifuge 11 R. min

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon

CorV CVAC. CorV TU317. 1

The Exploitation and Utilization of Magnesium Resources in Salt Lakes

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.

Evaluation on precision of occurrence measurement based on theory of errors

Preparation of superfine aluminum hydroxide by ion-exchange membrane electrolysis

Supplementary Information

ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Study of Ne w Chemiluminescence Technique Recognition of Sodium Azide by External Reference Method

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Investigation on Fast Determination of Trace N2Nitrosamines Assisted by Microwave Radiation

ZnO-Bi 2 O 3 Bi 2 O 3

ER-Tree (Extended R*-Tree)

Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Research on explaining porosity in carbonate reservoir by capture cross section method

Potentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Electronic Supplementary Information

Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR

N 2. Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites and Molecular Sieves

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

(bpy) 2 + , ECL, (polarization fluoroimmunometry) [8 ],HPLC [9 ] (CZE) [10 ] 2. 1 Ru(bpy) 3 Cl 2 6H 2 O Aldrich, ;

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Supplementary material

Application of Mohr-Coulomb yield criterion in geo-technical engineering

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Electronic Supplementary Information (ESI)

HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1

TABLE OF CONTENTS Page

CdSe Hg? CdTe. Cu 2 + CdTe DNA. CdS / CdS /DNA NPs 10. CdSe /D-Pen /L-Cys Eeinburgh AFS-230E. D % Avocado Research Chemicals L- 98%

Syntheses of a Series of Lactato Cobalt Complexes and Their Interaction with Bovine Serum Albumin

Arsenic removal from high-arsenic dust by NaOH-Na 2 S alkaline leaching

Capillary Gel Electrophoresis for Ligase Detection Reaction Products

PNS mg kg - 1. Rb 1

100102; 2. Fe Cu Hg. Rapid multi-elemental analysis on four precious Tibetan medicines based on LIBS technique

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Identification of Fish Species using DNA Method

Supporting Information

Matrix solid-phase dispersion MSPD 6 Solid phase extraction SPE 8. Accelerated solvent extraction ASE 3 9 Solid phase microextraction SPME 10

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

5%~20% ( :

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Recent advances in coal to chemicals technology developed by SINOPEC

Advance in Nanorealgar Studies

Supporting Information

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

16 1 Vol. 16 No ELECTROCHEMISTRY Feb MnO 6 Bir-Co5% Bir-Co10% Bir-Co15% Bir-Co20%. 3 3 Li mol L - 1 MgCl 2.

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Protective and regeneration-promoting effects of Ruyi Zhenbao Pill on nerve injury in zebrafish

and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

(paeonia lactiflora pall),,

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

(FENXI HUAXUE) Chinese Journal of Analytical Chemistry. Boosting

Οδηγίες χρήσης Elucigene TRP

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Geological characteristics and genesis of Huanggoushan and Banmiaozi gold deposits in Laoling metallogenic belt of southern Jilin

Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών

Supporting Information

Motion analysis and simulation of a stratospheric airship

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography

Transcript:

38 2010 12 FENXI HUAXUE Chinese Journal of Analytical Chemistry 12 1708 ~ 1713 DOI 10. 3724 /SP. J. 1096. 2010. 01708 1 1 2 2 1 1 1 1 2 * 1 2 1 210096 2 412008 Single nucleoitide polymorphism SNP PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps PCR DNA 24 MTHFR C677T 1 SNP 1 2 3 4 5 6 7 ~ 9 10 ~ 13 Lien 12 DNA SNP Nakagawa 13 DNA ALDH2 SNP 14 15 MTHFR C677T Cy3 Cy5 2010-02-25 2010-06-05 Nos. 60801007 60927001 60971045 863 No. 2007AA022007 - Nos. 2007CB936104 2010CB933903 No. 2010471007 No. 2009ZX10004-311 No. 1001009C No. 08B018 No. 09JJ4044 09JJ3017 * E-mail nyhe1958@ 163. com

12 1709 2 2. 1 PTC 220 PCR MJ Research GenePix 4100A Axon Nano-Plotter Gesim 1 MTHFR C677T Table 1 Oligonucleotide sequence 1 Name Type Sequence 5'-3' C677T-F Primer TGAAGGAGAAGGTGTCTGCGGGA Biotin-C677T-R Biotin-labeled primer Biotin- T 15 AGGACGGTGCGGTGAGAGTG C677T-CC Cy3 labeled probes Cy3-CGGGAGCCGATTT Taq DNA Taq DNA C677T-TT Cy5 labeled probes Cy5-CGGGAGTCGATTT polymerase 5U /μl dntp Thermo Fisher Sigma-Aldrich NH 4 Fe SO 4 2 12H 2 O 99. 0% NH 4 Fe SO 4 2 12H 2 O 99. 0% NaOH 95% AuCl 3 HCl 4H 2 O 3-Mercaptopropyltriethoxysilane MPTES Sigma-Aldrich - 36 nm 4. 0 g /L PBS ph 7. 4 24 EDTA DNA QIAGEN 2. 2 2. 2. 1 3D PCR SA-GMNPs ssdna-gmnps HoW CC Cy3 HoM TT Cy5 Cy3 Cy5 2. 2. 2 - Gold coated magnetic nanoparticles GMNPs 16 1 mg 200 μg 0. 1 mol /L PBS ph 7. 4 1 ml 0. 1 mol /L PBS 2 4 g /L PBS 2. 2. 3 PCR DNA 14 15 PCR 95 dsdna-gmnps ssdna- GMNPs - DNA DNA ssdna C677T PCR SNP PCR MTHFR C677T 30 μl 10 PCR 3 μl 25 mmol /L Mg 2 + 2 μl 10 mmol /L dntp 0. 6 μl PCR 1 ml 1. 25 U Taq DNA 5 U /L DNA 80 ng PCR 94 5 min 94 30 s 62 30 s 72 30 s 35 72 7 min 2. 2. 4 100 μg - 0. 5 μl 10 μmol /L 5'-Biotin-TGAAGGAGAAGGTGTCTGCGGGA-Cy3 5'-Biotin-

1710 38 TGAAGGAGAAGGTGTCTGCGGGA-Cy5 15 min ddh 2 O 5 μl ddh 2 O 0. 05 μl ss-dna SA-GMNPs 3 SSC ddh 2 O 2 3 min 100 2. 2. 5 1 SNP MTHFR C677T 38 13 PCR 10 μmol /L 677CC 677TT 6. 5 μl 22 μl 30 μl 38 1 h 3 SSC ddh 2 O 3 100 2. 2. 6 Cy3 Cy5 4100A Axon USA Cy3 550 nm 570 nm Cy5 649 nm 670 Cy3 Cy5 Genepix 6. 0 Origin 7. 0 3 3. 1 SNP SNP 3 I = log Signal Cy3 + Cy5 G = Signal Cy3 /Signal Cy3 + Cy5 1000 I > 3 I G 1 G 0 G 0. 5 3 1 G < 0. 2 HoM 0. 35 < G < 0. 65 He G > 0. 8 HoW I G 3. 2 1 SNP Fig. 1 Quality detection standard of single nucleotide polymorphism SNP genotyping results 2A 2B 8%

12 1711 3. 3 3. 3. 1 DNA PCR 10 μmol /L 1 μl 10 5 2. 5 1 0. 02 μmol /L 3 MTHFR C677T PCR PCR 3b 1 1 2 Fig. 2 Immobility assay of magnetic bead array 1 4 A. Fluorescence images before and after washing B. Relative fluorescence intensities before and after washing. Cy3 8249. 23 Cy5 894. 36 9. 22 PCR 1 4 3 Fig. 3 DNA Effect of primer proportion on SNP genotyping after asymmetry PCR 3. 3. 2 DNA PCR PCR PCR - PCR PCR 10 40 μmol /L 2. 5 10 μmol /L DNA 4 4 5 S1 ~ S5 S'1 ~ S'5 50% PCR 10 40 μmol /L 3. 4 SNP SNP 24 C677T 5A C677T 24 2 3 5B 24 I G SNP I > 3 24

1712 38 C677T 24 13 3 8 G > 0. 8 13 PCR Cy3 677CC 677CC 3 G < 0. 2 3 PCR Cy5 677TT 677TT 8 G = 0. 35 ~ 0. 65 Cy3 677CC Cy5 677TT 677CT 4 DNA Fig. 4 Effect of primer concentration on SNP genotyping 95 PCR of five samples after asymmetry PCR A. Preparation of scanning results B. Comparation of relative PCR DNA fluorescence intensities. 5 C677T 24 Fig. 5 Results of SNP detection of 24 samples based on bead array and dual-color hybridization assayed for C677T locus. A Fluorescence images of microarray B All spots were measured for Cy3 and Cy5 fluorescence intensities to generate a scatter plot PCR References 1 Fan J B Chee M S Gunderson K L. Nat. Rev. Genet.. 2006 7 8 632 ~ 644 2 Pastinen T Raitio M Lindroos K Tainola P Peltonen L Syv nen A C. Genome Res. 2000 10 7 1031 ~ 1042 3 ZHANG Xiao-Yan ZUO Ming-Xue ZHANG Zhan-Jun WANG Zhong LI Yao. China Biotechnology 2005 25 11 52 ~ 56 4 Schena M Heller R A Theriault T P Konrad K Lachenmeier E Davis R W. Trends Biotechnology 1998 16 7 301 ~ 306 5 Dieh F Beckmann B Kellner N Hauser N C Diehl S Hoheisel J D. Nucleic Acids Res. 2002 30 16 e79

12 1713 6 WANG Feng-Hua LIU Jun TONG Chun-Yi WANG Qi-Ming TANG Dong-Ying YI Long WANG Ling-Ling LIU Xuan-Ming. Chinese J. Anal. Chem. 2010 38 5 617 ~ 621 7 Saiyed Z M Bochiwal C Gorasia H Telang S D Ramchand C N. Analytic Biochemistry 2006 356 2 306 ~ 308 8 ZHANG Zhi-Chao YUAN Cui WAN Qian-Hong. Chinese J. Anal. Chem. 2007 35 1 31 ~ 36 9 LIU Ya-Ling JIA Li XING Da. Chinese J. Anal. Chem. 2007 35 8 1225 ~ 1232 10 Zhou H J Xing D Zhu D B Zhou X M. Talanta 2009 78 4-5 1253 ~ 1258 11 Yoshino T Tanaka T Takeyama H Matsunaga T. Biosensors and Bioelectronics 2003 18 5-6 661 ~ 666 12 Lien K Y Liu C J Lin Y C Kuo P L Lee G B. Microfluid Nanofluid 2009 6 4 539 ~ 555 13 Nakagawa T Hashimoto R Maruyama K Tanaka T Takeyama H Matsunaga T. Biotechnol. Bioeng. 2006 94 5 862 ~ 868 14 Li S Liu H N Wang Z F Hou P Guo Y F He Q G He N Y. Anal. Biochem. 2006 359 2 277 ~ 279 15 Liu H N Li S Wang Z F Ji M J Nie L B He N Y. Journal of Biotechnology 2007 131 3 217 ~ 222 16 Takuya K Satoshi S Yoshiteru M Yohei O Takashi N Kenji O Takao A Y. J. Magn. Magn. Mater. 2005 293 1 106 ~ 110 Single Nucleotide Polymorphism Genotyping Based on Magnetic Bead Array and Dual-color Hybridization LIU Hong-Na 1 LI Song 1 2 LIU Li-Shang 2 TIAN Lan 1 JIA Ying-Ying 1 LI Zhi-Yang 2 DENG Yan 1 2 HE Nong-Yue * 1 2 1 State Key Laboratory of Bioelectronics Southeast University Nanjing 210096 2 Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology Hunan University of Technology Zhuzhou 412008 Abstract An approach to fabricate magnetic bead array using gold coated magnetic nanoparticles was developed. Single strand DNAs ssdna obtained using asymmetry PCR were captured on gold coated magnetic nanoparticles SA-GMNPs modified with streptavidin. The GMNPs-ssDNA mixtures were spotted onto a clean glass slide adhered with a magnet to fabricate a bead array and then interrogated by hybridization with a pair of dual-color probes to determine single nucleotide polymorphism SNP. The genotype of each sample can be simultaneously identified on the surface of GMNPs by scanning the microarray. The amplification factors were optimized to obtain ssdna directly by use of polymerase chain reaction PCR. In this method the genotyping results were obtained from 24 different samples analyzed for C677T loci. The method described here is simple and easily to be automated which is suitable for molecular diagnostics and forensic analysis. Keywords Magnetic bead array Asymmetry polymerase chain reaction Dual-color hybridization Single nucleotide polymorphism type Received 25 February 2010 accepted 5 June 2010