Journal of Ardabil University of Medical Sciences Vol., No., Spring, Pages 59-68 Molecular Detection of Inducible Clindamycin Resistance among Staphylococcal Strains Isolated from Hospital Patients Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 Abdollahi SH, Ramazanzadeh R *, Delami Khiabani Z, Kalantar E, Menbari SH Department of Microbiology, Islamic Azad University, Zanjan Branch, Zanjan, Iran Cellular & Molecular Research Center and Department of Microbiology, School of Medicine, Kurdistan University of Medical Sciences, Sanandaj, Iran Department of Microbiology, School of Medicine, Kurdistan University of Medical Sciences, Sanandaj, Iran * Corresponding Author. Tel: +9894444 Fax: +98876664674 E-mail: atrop_t5@yahoo.com Received: 4 November Accepted: 6 December ABSTRACT Background & Objectives: Macrolide, lincosamide and streptogramin B (MLS B ) antimicrobial agents are used in the treatment of staphylococcal infections. They prevent the microbial protein synthesis system through binding to SrRNA. The aim of this study was to apply molecular methods to detect inducible clindamycin resistance genes among staphylococcal strains isolated from clinical specimens. Methods: Two hundred staphylococcus strains were isolated from nose and throat swabs of patients in Toohid and Besat hospitals in Sanandaj. Antimicrobial susceptibilities of isolates were determined using disc diffusion method, agar screen test and D-Test. A multiplex PCR was performed using primers specific for erm (A, B, C, TR) genes. Results: Out of isolates, 8.5 % were and % were MRCNS (methicillin resistant coagulase negative staphylococci). Of 8 erythromycin resistant isolates, were coagulase negative and were S. aureus. Among the coagulase negative staphylococci (CONS) isolates,.6% expressed the MLSB-inducible phenotypes. Using PCR, the frequency of different genes in the collection of isolates were as follows: erma; 5.4 %, erm B; 5.4 %, and erm C;.%. The ermtr gene was negative in all isolates. Among the S. aureus isolates, 9.8% expressed the MLSB-nducible phenotype. Using PCR, these isolates harbored erm A (.%), ermb (.%), ermc (.%) and ermtr (.%). Conclusion: This is the first study to show the rate of inducible clindamycin clinical isolates of staphylococci harboring erm genes in Sananadaj. It also demonstrated the frequency of erm genes was higher among CONS isolates than S. aureus. This data suggested the transfer of resistance gene from nonpathogenic to pathogenic strains is likely to happen. Therefore, screening and control of these resistance genes is recommended at clinical laboratories. Keywords: S. aureus; Clindamycin; D-Test
9 6 Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 *.. - E-mail: atrop_t5@yahoo.com 876664674 : 94444 :. * ( MLS B ) B :. SrRNA.. :.. D-Test Screen Agar. multiplex PCR erm (A, B, C, TR) ) 8. % MRCNS %8/5 :. ( % 5/4 ermb % 5/4 erma %/6 imls B (CONS) imls B. % ermtr %/ ermc. %/ ermtr ermc ermb erma %9/ 8 erm : S. aureus CONS erm.. D-Test : 9/9/6 :. SrRNA 9/8/5 :. B MLS B Macrolides, Lincosamides and StreptograminB
Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 6 mrna imls B. Invitro.[5-6] msra MS M Invitro MLS B B. D-Test... PCR multiplex.[7-8] PCR.......[-] - -. (MLS B ) B.[-] MLSB.[-] (erythromycin ribosome erm methylase) SrRNA B. MLS B ermf ermc ermb erma erm (imls B ) (cmls B ).[4] MLS B cmls B mrna Constitutive Resistance Inducible Resistance B
Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 9 5 oc.[] ( ) 8 D-Test :. : CL. D : E DNA DNA Cinna Pure DNA. erm Multiplex PCR erm. Multiplex PCR DFS Master Mix Kit,PCR (NH 4 ) SO 4 dntp MgCl Taq. Tween- TrisHCl :, MgCl mm, Master Mix.5 µl PCR DNA template µl,.5 pmol.distilled water : erm Multiplex µl 6. DNase.[9] Kirby-Bauer (Clinical and Laboratory. (5 µg).[] (5 µg) CLSI Standards Institute) (µg). 4% NaCl. 6 mg/l oxacillin 4 8 5 C..[] erm erm CLSI D - Test /5.. 5-6 mm (ER 5 µl) (CL µl) ( ).
Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 6 S. aureus 9 ( MSSA %6/5 %8/5).( 4 MSCNS % MRCNS %) CNS 8. (%4) 8 D-Test %/75) imls B (%) 4 ( / 8 ) % /5 ( / 8 ) MRCNS % 5 ( / 8 ) imls B.(MSCNS 87/5. ) %6/5 imls B (cmls B ) ) %5 64 % (MS.( ). erma CNS erm ermc ( / ) % 5/4 ermb ( / ) % ermtr ( / ) % ermb ( / ) % / % 5/4 /.() erma ermtr ( / ) % / ermc ( / ) % /.() ( / ) % / 4... C 94 Primary denaturation C Annealing Denaturation 94 ºC 7 ºC 5 7 C Extension 5 Final Extension cycle. PCR PCR /5.[] /6 /5 TAE (/5x) 4 cc ( ). PCR 4 Loading Buffer 5 %/5 PCR. (BIORON) mg / ml.( ) PCR DNA Ladder bp (BIORON).[5] Gelxone ) SPSS Excel.[] (χ Methicillin-Resistant S. aureus Methicillin-Sensitive S. aureus Methicillin-Resistant Coagulase-Negative Staphylococci 4 Methicillin-Sensitive Coagulase-Negative Staphylococci
9 64 Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 erm multiplex PCR. 8 7. 6 ) Gene erma ermb ermc ermtr (. 9 5 4. cmls B [7] erm. Primer: sequence erma/trsb: TCA GGA AAA GGA CAT TTT ACC ermaab: ATA TAG TGG TGG TAC TTT TTT GAG C ermbab: CGA TAT TCT CGA TTG ACC C ermbsb: GGT AAA GGG CAT TTA ACG AC ermcab: TAGCAAACCCGTATTCCACG ermcsb: CTTGTTGATCACGATAATTTCC ermtrab: AAA ATA TGC TCG TGG CAC erma/trsb: TCA GGA AAA GGA CAT TTT ACC CNS S. aureus MLS B. (n = 8) imls B MS (n = ) Size 8 bp 8 bp 495 bp 86 bp MSSA MRCNS MSCNS 7 4 D D + 46 4 8 7 5 6 44 64(%/8) 5(%/56) (% /54) (% /54) 95 6/54) (% (95 +5 = ) phenotype HD phenotype S *
65... Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 Genes erm(a) erm(b) erm(c) erm(tr) PCR (-) MRCNS (n=4) (% 4/ 69) (% 4/ 69) (% /) (% /56 ) 8 erm (A, B, C, TR) MSCNS (n=8) (%/7) total CNS (n=) (%/7) (%/7) (% /8) (% /8) 5 erm. D-test S.aureus 4 (n= 55) %64 (n=74) (n=8) %6 %. ).( (n=99) % 7 D-Test [] 6) 85 (n=) % 6 (% (n=64) % (n=) %5/5. ) %7 /7.( D-Test (n=8) (%7/5) % 87/5. imlsb (n=5) (% 5/4) (% 5/4) (% /) (%5/4) MSSA (n=7). total S. aureus (n=) (%/) (%/) (% /) (% /) total staphylococci (n=8) 5 (% /5) 5 (% /5) 4 (%) (%) (% )..[]. % 4 (8/8) % imlsb.[-4] [5 7].[8 9] 4 CNS (%7/5) S. aureus [9] (%6/5).[ 7] 5 Fasih Gadepalli Fiebelkorn Jorgensenet 4 Pal
Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 9 (. multiplex PCR. ermb erma 78. msra ermc % /6 MLS B %57/8 CNS MS B % /6 MLS B % 78/ PCR. % 6/4 erma % 8/9 ermc erma. msra %/5 ermb % 6/5 ermc %5 erma % 7/5 ( / 5 ) MS B ( / 5 ) % % 5/4 ( / ) % erma.[7] CONS ermc % 8/4 MLS B. 5/4 ermb % ermtr ( / ) % /6 MLS B ( / ) % 6/98 ( / ) / ermc. ermc ermb ermc erma ermtr ermc ermb erma. CONS. D-test 66 MLS B multiplex real time PCR 65. (% 84/9) 5. (%64/) 7 5 %9/ (cmls B ) % 49/ %/5 M (imls B ) erma. 6 (% 7/7) 85 ermc.[] (%6/6) 5 (% /5) erm(a) (% /5) (% 5/4) MRCNS (%4/69) erm(b) 5 4 (%) (%5/4) MRCNS (%4/69) erm(c) (%) (% /) MRCNS (%/) erm(tr). (%5/4) 78). 4 Cemgul Zerrin Aktas CNS
67... Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9. D-Test. References - Shantala GB, Adithi SS, Rahul RK, Nagarathnamma T. Detection of inducible Clindamycin resistance in clinical isolates of Staphylococcus aureus by the Disc Diffusion Induction Test. J Clinical and Diagnostic Research. Feb; 5(): 5-7. - Mohanasoundaram KM. The Prevalence Of Inducible Clindamycin Resistance Among Gram Positive Cocci From Various Clinical Specimens. J Clinical and Diagnostic Research. Feb; 5(): 8-4. - Fasih N, Irfan S, Zafar A, Khan E, Hasan R. Inducible clindamycin resistance due to expression of erm genes in Staphylococcus aureus: Report from a Tertiary Care Hospital Karachi, Pakistan. J Pak Med Assoc. Sep; 6(9): 75-75. 4- Shrestha B, Pokhrel BM, Mohapatra TM. Phenotypic characterization of nosocomial isolates of Staphylococcus aureus with reference to. J Infect Dev Ctries. 9; (7): 554-56. 5- Adaleti R, Nakipoglu Y, Ceran N, Tasdemir C, Kaya F, Tasdemir S. Prevalence of phenotypic resistance of Staphylococcus aureus isolates to macrolide, lincosamide, streptogramin B, ketolid and linezolid antibiotics in Turkey. Braz J Infect Dis. ; 4(): -4. 6- Eksi F, Gayyurhan ED, Bayram A, Karsligil T. Determination of antimicrobial susceptibility patterns and inducible clindamycin resistance in Staphylococcus aureus strains recovered from southeastern Turkey. J Microbiology, Immunology and Infection. ; 44: 57-6. 7- Aktas Z, Aridogan A, Kayacan CB, Aydin D. Resistance to Macrolide, Lincosamide and Streptogramin antibiotics in Staphylococci isolated in Istanbul, Turkey. The Journal of Microbiology. 7 Aug; 45(4): 86-9. 8- Christine D, Raney PM, Morrel AK, Williams PP, Linda K, Jevitt L, et al. Testing for Induction of Clindamycin Resistance in Erythromycin-Resistant Isolates of Staphylococcus aureus. J clinical microbiology. 5 Apr; 4(4): 76 7. 9- Pal N, Sharma B, Sharma R, Vyas L. Detection of inducible clindamycin resistance among Staphylococcal isolates from different clinical specimens in western India. Department of Microbiology, Jaipur, India. Aug; 56(): 8-85. - Franklin R, Matthew A, Karen B, Michael N, George M, Dwight J, et al. Performance Standards for Antimicrobial Susceptibility Testing;Twentieth Informational Supplement, (), : 6-75 - John Burpo F. A critical review of PCR primer design algorithms and crosshybridization case study. Biochemistry. Aug; 8: -. - Gadepalli R. Inducible clindamycin resistance in clinical isolates of Staphylococcus aureus. Indian J Med Res. 6 April; (4): 57-57. - Fiebelkorn KR, Crawford SA, McElmeel ML, Jorgensen JH. Practical Disk Diffusion Method for Detection of Inducible Clindamycin Resistance in Staphylococcus aureus and Coagulase-Negative Staphylococci. J Clinical Microbiology. Oct ; 4(): 474 4744. 4- Jorgensen JH, Crawford SA, McElmeel ML, Fiebelkorn KR. Detection of Inducible Clindamycin Resistance of Staphylococci in Conjunction with Performance of Automated Broth Susceptibility Testing. J Clinical Microbiology. 4 April; 4(4): 8 8. 5- Ciraj AM, Vinod P, Sreejith G, Rajani K. Inducible clindamycin resistance among clinical isolates of staphylococci. Indian J Pathology and Microbiology. 9 March; 5(): 49-5.
9 68 Downloaded from jarums.arums.ac.ir at 9: IRST on Sunday January th 9 6- Goyal R, Singh NP, Manchanda V, Mathur M. Detection of clindamycin susceptibility in macrolide resistant phenotypes of Staphylococcus aureus. Indian J Med Microbiol, 4 Oct-Dec, (4): 5-54. 7- Matthew VN, Cai Y, Kong F, Zeng X, Gilbert GL. Influence of Disk Separation Distance on Accuracy of the Disk Approximation Test for Detection of Inducible Clindamycin Resistance in Staphylococcus spp. J clinical microbiology. 6 Nov; 44(): 47-476. 8- Rahbar M, Hajia M. Inducible clindamycin resistance in Staphylococcus aureus: a cross-sectional report. Pak J Biol Sci. 7 Jan; (): 89-9. 9- Delialioglu N, Aslan G, Ozturk C, Baki V, Sen S, Emekdas G. Inducible Clindamycin Resistance in Staphylococci Isolated from Clinical Samples. Jpn. J Infect Dis. 5 Apr; 58(): 4-6. - Cemgul H, Kilic A, Guclu AU, Bedir O, Orhon M, Basustaoglu C. Macrolide-lincosamidesterptogramin B resistant phenotypes and genotypes for methicillin resistant staphylocccus aureus in turkey, from to 6. J microbiology. 8 Sep; 57(4): 7-.