Psychopharmacology 1985 85 367-370. 1 2 Porsoh R Le pichon M Jalfre M. 6 000 mg /kg 800 48 7 Bunney W Davis J. 5-8 J. 1 Steru L Chemlat R Thicrry B et al. The tail suspension test A new method for screening antidepressants in mice J. Depression a new method animal model sensitive to antidepressant treatments J. Nature 1977 266 730-732. 3 Khalifa A E. Hypericum perforatum as a nootropic drug enhancement of retrieval memory of a passive avoidance conditioning paradigm in mice J. J Ethnopharmacol 2001 76 49-571. 4 Pawlowski L & Mazela Psychopharmacology 1986 88 240-246. 5. 1994 651-659. M. 2. 6 Nowak G Szewczyk B Wieronska J et al. Antidepressant-like effects of acute and chronic treatment with zinc in forced swim test and olfactory bulbectomy model in rats J. Brain Res Bull 2003 61 159-164. Norepinephrine in depressive reactions J. Arch Gen Psychiatry 1965 13 483-494. 1990 1 1-4. 9 Janne G Eldbjorg F Robert M et al. Extracellular levels of serotonin and GABA in the hippocampus after chronic mild stress in rats A microdialysis study in an animal model of depression J. Behav Brain Res 2007 181 42-51. microrna126 GATA-3 * 200071 microrna126 GATA-3 10% 5% BALB /c 40 BALB /c 10 4 microrna126 GATA-3 mrna microrna126 GATA-3 micror- NA126 GATA-3 TH2 microrna126 GATA-3 R285. 5 doi 10. 3969 /j. issn. 1001-1528. 2013. 11. 04 A 1001-1528 2013 11-2324-05 2012-02-27 81173302 ZYSNXD-CC-HPGC-JD-005 1985 * 1952 2324
Role of Pingchuan Recipe on microrna126 and GATA-3 expression in lung tissue of mice with asthma LIU Fei YU Jian-er * BAI Li Shanghai Municipal Hospital of Traditional Chinese Medicine Affiliated to Shanghai University of TCM Shanghai 200071 China ABSTRACT AIM To study the intervention role of Pingchuan Recipe Ephedrae Herba Armeniacae Semen amarum Perillae Fructus Persicae Semen Raphani Semen Scutellariae Radix etc. on microrna126 and GATA3 expression in mice s lung tissue of asthma model and the improvement in airway inflammation. METHODS Injection of 10% ovalbumin and inhalation of 5% ovalbumin were used to establish the BALB / c mouse bronchial asthma model. Forty male BALB /c mice were randomly divided into control group model group dexamethasone group and Pingchuan Recipe group each with ten mice. For four weeks of treatment the pathological changes of the lung tissue of mice were observed with an optical microscope. MicroRNA126 GATA3 mrna expression levels in lung tissue were determined by polymerase chain reaction. RESULTS Pingchuan Recipe group could effectively reduce the level of microrna126 reach the negative regulation of GATA-3 expression and lessen the symptoms of mice with bronchial asthma equivalent to dexamethasone. CONCLUSION MicroRNA126 may be an access to reduction in GATA-3 and inhibition in the over-expression of TH2 to improve airway inflammation. KEY WORDS bronchial asthma Pingchuan Recipe microrna126 GATA-3 GATA3 1 Th1 Th2 Th2 T 1 1. 1 BALB /c 40 4 ~ 6 18 ~ 22 g - SCXK2008-0016 2-4 110302 20120418 IL-4 IFN-γ 5 Th2 GATA- 1. 2 DEPC 3 6 DEPC microrna126 microrna 22 RNA 7 RNA AR c DNA 8 Fermentas Trizol Invitrogen Real-tiome PCR Mix ABI USA microrna T Mus musculus Th1 Th2 Joerg Mattes 9 microrna 126 Mir126 microrna GACAG- microrna126 8 CACATTATTACTTTTGG CGCATTATTACT- 1 GATA3 Th2 CACGGTAC TACGCGCTGTGACACT- 2325
TCAAACTC GATA-3 GATA-3 150 bp 5' GTTCCTCCGACCCCTTC- TAC3' 5' TTCAGTGGTTGGAATGCAGA3' FAM CGCAGGAGCAGTATCATGAA-TAMA- RA β-actin 180 bp 5' GTCGTAC- CACTGGCATTGTG3' 5' TCTCAGCTGTGGTG- GTGAAG3' FAM CCACACTGTGC- CCATCTATG-TAMARA LSD Peasern XW 80A 3 K10CD FLUKO 3. 1 F6 /10 Sigma 3K15 Real-time ABI ABI 7500 1. 3 40 BALB /c 4 10 22 50% ~ 70% 3. 2 1 1. 4 10 g 1g 100 ml 10% 50 ml /kg 2 2 24 h 5% 20 min 1 /d 1 1. 5 3. 3 GATA-3 microrna126 1 /d 1 2 3 10 1 13 30min 2 11 30min 95% V 60 / 95-60 24 h 5. 33 g /ml db = da KB /KA 20 ml / kg d 30kg 20 0. 075 mg /ml 1. 6 4 4% Fig. 1 Polymerase Chain Reaction microrna126 Ga- Ta3mRNA 2 SPSS 18. 0 x ± s LSD HE by HE staining light microscopy 400 2326 1 HE 400 Pathological changes in lung tissue observed
GATA-3 microrna126 4 P < 0. 05 4. 1 Danit Ariel 11 microrna GATA-3 microrna126 P < 0. 05 GATA- 3 microrna126 P > 0. 05 * P < 0. 05 # P < 0. Δ P < 0. 05 microrna126 2 GATA-3 m RNA PCR PU. 1 GATA-3 Fig. 2 Kinetic curves of GATA-3 mrna Gene PCR amplification Th2 9 GA- TA-3 microrna126 0. 01 < 0. 001 n 40 ** 0. 01 microrna 1 GATA-3 microrna126 micror- x ± s NA126 21 Tab. 1 Comparison of GATA-3 and microrna126 in lung tissue x ± s 9q34. 3 7 5 12 Adam Collison 13 / GATA-3 microrna126 microrna126 HDM 10 0. 72 ± 0. 44 1. 50 ± 0. 36 10 2. 29 ± 0. 57 * 11. 34 ± 2. 69 * 10 1. 15 ± 0. 32 # 1. 46 ± 0. 32 # 6 10 1. 54 ± 0. 55 * # 1. 61 ± 0. 67 # microrna126 14 4. 2 microrna126 GATA-3 RT-PCR PCR T- bet GATA-3 T-bet GATA-3 TH1 /TH2 15 GATA-3 GATA-3 microrna126 4. 3 16 3 mirna-126 PCR Fig. 3 Kinetic curves of mirna-126 Gene PCR amplification 3. 4 GATA-3 microrna126 GATA-3 microrna126 2 2 GATA-3 microrna126 Tab. 2 Correlation analysis of GATA-3 and microrna126 GATA-3 Pearson microrna126 0. 570 ** 4. 4 microrna126 2327
7 Wang Jiawang Li Kunyu Hellermann G et al. Regulating the regulators microrna and asthma J. World Allergy Or- gan J 2011 4 6 94-103. GATA-3 micror- NA126 GATA-3 microrna126 1. M. 2012 12 1 49-52. 2010 270. 2. J. 2011 52 13 1154-1163. 3. 13 Adam Collison Cristan Herbert Jessica S Siegle et al. Altered expression of microrna in the airway wall in chronic asth- 30 J. 2008 4 1 14-16. ma mir-126 as a potential therapeutic target J. BMC Pulmonary Med 2011 11 29 4. J. 1471-2466. 2006 40 11 40-41. 5. γ 4 J. 2012 10 7 807-813. 6. TH1 /TH2 J. T-bet /GATA-3 2005 31 3 189-191. J. 2012 30 5 974-977. 8 Thomas X Joseph D Ting Wen et al. MicroRNA signature in patients with eosinophilic esophagitis reversibility with glucocorticoids and assessment as disease biomarkers J. J Allergy Clin Immunol 2012 129 1064-1075. 9 Mattesa J Collisona A Planka M et al. Antagonism of microrna-126 suppresses the effector function of TH2 cells and the development of allergic airways disease J. Proc Natl Acad Sci USA 2009 106 44 18704-18709. 10. M. 2. 2006 38. 11 Danit Ariel Daya Upadhyay. The role and regulation of micrornas in asthma J. Curr Opin Allergy Clin Immunol 12 Ishizaki T Tamiya T Taniguchi K et al. mir126 positively regulates mast cell proliferation and cytokine production through suppressing spred1 J. Genes Cells 2011 16 803-814. 14. 2006 26 6 494-497. 15. T-bet / GATA3 Th1 /Th2 J. 16. M. 2012 191-192. 2328