Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats
|
|
- Καλλιόπη Ακρίδας
- 5 χρόνια πριν
- Προβολές:
Transcript
1 744 Chinese Journal of Pathophysiology IL-19 * interleukin-19 IL-19 experimental autoimmune myocarditis EAM EAM 6 IL PCR atrial natriuretic peptide ANP brain natriuretic peptide BNP IL-18 IL-1β IL-12p35 IFN-γ IL-19 ANP BNP IL R A doi /j. issn Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats CHANG He 12 ZHAO Fa-yun 1 WANG Yan 12 LI Gang 2 ZHANG Le 2 ZOU Jun 1 1 Xiamen University Medical CollegeXiamen China 2 Xiamen Heart CenterXiamen China. zoujun@ xmu. edu. cn ABSTRACTAIM To evaluate the effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis EAM in rats. METHODS Cardiac myosin was emulsified with equal volume of complete Freund s adjuvant. The animal model of EAM was established by injecting with the preparation in both footpads of the Lewis rats. The rats were intravenously injected with the plasmid encoding IL-19-IgG on day 6. Echocardiography was performed before the rats were sacrificed on day 17. The effect of IL-19-IgG plasmid injection was evaluated by measuring the heart weight /body weightmyocarditis arearelative expression levels of atrial natriuretic peptide ANP and brain natriuretic peptide BNP in the hearts. The mrna expression levels of related cytokines including IL-18IL-1βIL-12p35 and IFN-γ were detected. RESULTS The rats in model group showed significant myocardial damage and a decrease in the left ventricular functions. The rats in the treatment group injected with IL-19-IgG plasmid showed an improvement of the cardiac functions. The ratio of heart weight /body weightthe area of myocarditis and the mrna levels of ANP and BNP were significantly lower in IL-19-IgG treatment group than those in model group. The mrna levels of IL-18IL-1βIL- 12p35 and IFN-γ were also significantly decreased in IL-19-IgG treatment group. CONCLUSION Intravenous injection of plasmid encoding IL-19-IgG effectively prevents the development of the left ventricular remodeling and myocardial damage in EAM rats. KEY WORDSInterleukin-19 Autoimmune myocarditis * No No ZQN-ZD-37 No. 2012J01415 Tel zoujun@ xmu. edu. cn 1
2 745 Master Mix FermantasKod Plus 10 Kod Plus buffer Not I Swa I E. coli JM109 1 TaKaRaDEPC Solarbio T B SYBR qpcr Mix Toyobo TaKaRa experimental autoimmune myocarditis EAM 2 Th1 /Th2 EAM 2. 1 pcaggs-igg Fc 19 interleukin-19 IL-19 pcaggs-il-19-igg Fc Kod Plus DNA Toyobo IL-19 2 IL-20R1 / IL-20R2 IL-20 IL-24 PCR Not I Swa I IL-10 2 IL-10 E. coli JM 109 IL-10 B h PCR DC T PCR IL-19 IL-19 Omega IL-1β IL-6 2 g /L IL-8 CCL5 CXCL EAM 3 Th1 Th mol /L KCl 10 g /L Th1 Th2 IL g /L 4 IL-19 EAM 0. 2 ml EAM + SP-IgG EAM + IL-19-IgG IL IL-19 μg 400 μl pcaggs-sp-igg Fc pcaggs-il-19-igg 80 ml /kg 15 s 24 h 3 6 RNA cd- NA cdna 0. 5 μl 20 μl PCR 1 8 Lewis 180 ~ 200 g cdna 5 μl 1 μl 2% 120 V 20 SCXK min IL-19 SP mrna BeckmanC PCR Bio-Rad % 3 ml /kg PCR ABI Cell Biosciences MHz M complete Freund s adjuvant left ventricular CFADifcoTrizol Invitrogen Revert Aid First Strand cdna Kit Dream Taq Green PCR Oxoid OmegaThunderbird pcaccs-sp-igg Fc 1 EAM cdna pcacggs-igg Fc Taq DNA Fermantas 1 GE Vivid7 end-diastolic internal diameter LVEDd left ventricular end-systolic internal diameterlv-
3 746 EDs interventricular septal thicknessnatriuretic peptide ANP brain natriuretic IVS left ventricular posterior wall thickness LVPW left ventricular fractional shortening LVFS ejection frac- tions EF RNA 2 μg cdna -3- glyceraldehyde-3-phosphate dehydrogenasegap- 5 mm DH 20 μl PCR ABI 10% 7500 PCR HE 0 ~ 4 min s 60 1 min s 0 1 < 5% min s s ANP BNP 5% ~ 10% 3 10% ~ IL-18 IL-1β IL-12p35 IFN-γ 20% 4 > 20% Real-time PCR atrial 1 Table 1. peptide BNP mrna Trizol RNA DEPC RNA A 260 /A ~ 2. 0 TaKaRa 1 IL-19 The primers for real-time PCR Name Sense primer Anti-sense primer IL ttcatttaaatggtgttcgttctctgctcagtt-3 5 -gcatcgcggccgccagacgtttcctgatgattcct -3 SP 5 -ttcatttaaatgccttcaccatgaagtccag-3 5 -gcatcgcggccgctgtctccaacagcatttcctta -3 ANP 5 -atggatttcaagaacctgctaga-3 5 -gctccaatcctgtcaatcctac-3 BNP 5 -gatgattctgctcctgcttttc-3 5 -gccatttcctctgacttttctc-3 IFN-γ 5 -gaaagacaaccaggccatcag-3 5 -tcatgaatgcatccttttttgc-3 IL-1β 5 -gctagtgtgtgatgttcccattag-3 5 -cttttccatcttcttctttgggta-3 IL-12p agacatcacacgggacaaaac cacagggtcatcatcaaagaag-3 IL atcagaccactttggcagactt cttccatccttcacagataggg-3 GAPDH 5 -atcaccatcttccaggagcga agccttctccatggtggtgga-3 3 ± mean ± SD SPSS P < IL-19 EAM 24 h RT-PCR Figure 1. EAM SP IL-19 SP-IgG IL IgG 1 2 The mrna expression of SP and IL-19 in the liver tissues of the rats with experimental autoimmune myocarditis EAM determined by RT-PCR. SP-IgG IL-19-IgG 17 HE IgG EAM + SP-IgG 3 EAM + SP-IgG 3 EAM + IL-19-IgG 17 2 EAM + SP- EAM + SP-IgG LVEDd LVESd IgG EAM + IL-19- LVPWIVS LVEF LVFS
4 747 EAM + SP-IgG EAM + IL-19- IgG LVPW IVS LVEF LVFS 2 4 ANP BNP 17 RNA cdna PCR ANP BNP Figure 2. The histopathological images of the hearts with experimental autoimmune myocarditis EAM. EAM + SP-IgG ANP BNP EAM + IL-19-Ig 2 EAM EAM + SP-IgG ANP BNP Figure 3. The heart weight /body weight A and myocarditis area B in the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < ** P < vs EAM + SP-IgG. 3 2 Table 2. Evaluation of the heart functions in the rats with experimental autoimmune myocarditis EAM by echocardiography Mean ± SD. n = 6 Cardiac function Normal EAM + SP-IgG EAM + IL-19-IgG LVEDd mm ± ± ± LVESd mm ± ± ± LVPW mm ± ± ± * IVS mm ± ± ± * LVEF % ± ± ± * LVFS % ± ± ± * * P < vs EAM + SP-IgG. 4 EAM + IL-19-IgG EAM + SP-IgG Liu 6 Zhang 8 IL-18 IL-1β IL-12p35 IFN-γ EAM + IL-19-IgG EAM + SP-IgG IL-18 IL-1β IL-12p35 IFNγ 5 EAM + IL- 19-IgG PCAGGS Ig-Fc IL-19 IL-19 EAM IL-19
5 748 Figure 4. 4 The relative mrna expression of ANP A and BNP B in the rat myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < ** P < vs EAM + SP-IgG. ANP BNP mrna Figure 5. 5 The relative mrna expression of IL-18 IL-1β IL-12p35 and IFN-γ in the myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. IL-18 IL-1β IL-12p35 IFN-γ * P < ** P < vs EAM + SP-IgG. IL-19 IL-18 IL-1β IL-12p35 Th1 /Th2 IFN-γ IL-19 IL-10 IL-10 IL-10 EAM 9 EAM EAM IL-1 IL-19-IgG IL-19-IgG EAM / B NK ANP BNP mrna IL-19 2 IL-1α
6 749 IL-1β 2Sabat RWallace EEndesfelder Set al. IL-19 and IL- IL-1α IL-1β 20 two novel cytokines with importance in inflammatory diseases J. Expert Opin Ther Targets EAM 14 IL-1β 3Hsing CHChiu CJChang LYet al. IL-19 is involved IL-1β ILin the pathogenesis of endotoxic shock J. Shock DC IL-12 Th1 4Azuma YTNakajima HTakeuchi T. IL-19 as a potential Th0 Th1 IFN-γ therapeutic in autoimmune and inflammatory diseases J. Th2 10 IL-18 IFN-γ Curr Pharm Des IL-19 IL-1 Th1 IL-18 IL-12 T NK 6Liu FSong YLiu D. Hydrodynamics-based transfection IFN-γ Th1 Th1 in animals by systemic administration of plasmid DNA J. IFN-γ EAM Gene Ther EAM IL Lewis Th J. Th Zhang GBudker VWolff JA. High levels of foreign IL-19 gene expression in hepatocytes after tail vein injections of naked plasmid DNAJ. Hum Gene Ther IL-19 Azuma IL-19 - / - DSS 9Oral HBKotenko SVYilmaz Met al. Regulation of T cells and cytokines by the interleukin-10 IL-10 -family cytokines IL-19IL-20IL-22IL-24 and IL-26 J. Eur IL-19 J Immunol Afanasyeva MWang YKaya Zet al. Interleukin-12 receptor / STAT4 signaling is required for the development of IL-19 MAPK autoimmune myocarditis in mice by an interferon-gammaindependent pathwayj. Circulation IL-19 IL-19 mrna IL-19 11Azuma YTMatsuo YKuwamura Met al. Interleukin- CD4 + T Th2 19 protects mice from innate-mediated colonic inflammation J. Inflamm Bowel Dis IL-19 IL-10 IL-19 T IFN-γ IL-4 IL Canto EGarcia Planella EZamora-Atenza Cet al. Interleukin-19 impairment in active Crohn s disease patients IL-19 J. PLoS One e IL-6 TNF-α 13Cuneo AAHerrick DAutieri MV. IL-19 reduces VSMC IL-19 2 IL-20R1 /IL-20R2 activation by regulation of mrna regulatory factor HuR IL-19 and reduction of mrna stability J. J Mol Cell Cardiol IL IL-19 14Jordan WJEskdale JBoniotto Met al. Human IL-19 regulates immunity through auto-induction of IL-19 and 15 production of IL-10J. Eur J Immunol Gallagher G. Interleukin-19 multiple roles in immune 1Leuschner FKatus HAKaya Z. Autoimmune myocarditis pastpresent and future J. J Autoimmun J regulation and diseasej. Cytokine Growth Factor Rev
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
Effect of shengjiang powder on protection of myocardial injury in patients with sepsis
2016 20 24 Journal of Clinical Medicine in Practice 7 200437 60 2 7 NYHA I ctni BNP LVEF E /A 2 ctni BNP P < 0. 05 P < 0. 05 2 LVEF E /A NYHA P < 0. 05 R 631 A 1672-2353 2016 24-007-04 DOI 10. 7619 /jcmp.
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ
Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ OVEREXPRESSION OF SMAD7 PROTECTS LIVER FROM TGF-B/SMAD-MEDIATED FIBROGENESIS Γ. Γερμανίδης(1), Ν. Αργέντου(2), Ε.
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine... 3 1.1 Psychoneuroimmunology (PNI) and Systems Biology...
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Relationship between Connective Tissue Diseases and Thyroid Diseases
CHINESE JOURNAL OF ALLERGY & CLINICAL IMMUNOLOGY # * 272129 connective tissue diseasectd 2009 1 2013 4 CTD CTD CTD CTD 780 438 56. 2% 195 25. 0% 85 10. 9% 44 5. 6% SSc 18 2. 3% 286 36. 7% 8. 7% P < 0.
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Effect of extract method on pharmacokinetics of baicalin and berberine in dogs
7. J. 54-66. 2009 305 351-353. 12Yu LBridgers APolli Jet al. Vitamin E-TPGS increases ab- 8. sorption flux of an HIV protease inhibitor by enhancing its solubility and permeability J. J Pharm J. 2007234
74. 93% ± 2. 15% vs % ± 2. 54% P < A ConA. A doi /j. issn
Chinese Journal of Pathophysiology 2010 26 9 1695-1699 1695 1000-4718 2010 09-1695 - 05 T Kv1. 3 * 1 2 2 3 2 1 2 361000 3 350108 AS T Kv Kv1. 3 AS T T Kv1. 3 mrna 1 AS T T 74. 93% ± 2. 15% vs 67. 80% ±
ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr
* TGF-β1 215600 diabetic nephropathies DN 24 urine protein quantitation in 24 hours 24hUTP serum creatinine Scr -β1 transforming growth factor-β1 TGFβ1 STZ DN SD 10 10 10 8 24hUTP Scr HE ELISA TGF-β1 24hUTP
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Simon et al. Supplemental Data Page 1
Simon et al. Supplemental Data Page 1 Supplemental Data Acute hemodynamic effects of inhaled sodium nitrite in pulmonary hypertension associated with heart failure with preserved ejection fraction Short
< (0.999) Graft (0.698) (0.483) <0.001 (0.698) (<0.001) (<0.001) 3 months (0.999) (0.483) (<0.001) 6 months (<0.
Supplementary table 1. Correlation of endothelial cell density among graft, 3, 6, and 12 months after Descemet s automated stripping endothelial keratoplasty. Graft 3 months 6 months 12 months Graft
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ
ΠΑΝΕΛΛΗΝΙΑ ΣΕΜΙΝΑΡΙΑ ΟΜΑΔΩΝ ΕΡΓΑΣΙΑΣ 2015 ΟΜΑΔΑ ΕΡΓΑΣΙΑΣ ΚΑΡΔΙΑΚΗΣ ΑΝΕΠΑΡΚΕΙΑΣ Από τη βασική έρευνα στην κλινική πράξη ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ Ξυδώνας Σωτήριος, MD, FESC Καρδιολογικό Τµήµα, Γ.Ν.Α. «Ο
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue. Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) Dopaminergic Markers TH CTG GCC ATT GAT GTA CTG GA ACA CAC ATG GGA
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Christopher Stephen Inchley, 2015
Christopher Stephen Inchley, 2015 Series of dissertations submitted to the Faculty of Medicine, University of Oslo No. 2009 ISBN 978-82-8264-990-2 All rights reserved. No part of this publication may be
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Chapter 1. Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes
Chapter 1 Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes 1 1 1 1 CHAPTER SUMMARY FINGOLIMOD ATTENUATES CERAMIDE PRODUCTION
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
α α Pneumocystis jirovecii
α α Key words α α Pneumocystis jirovecii I α Table 1. Biologics currently approved in Japan for autoimmune inflammatory diseases (as of Dec, 2016) Classification Preparations that target cytokines or cytokine
Παιδιατρική ΒΟΡΕΙΟΥ ΕΛΛΑΔΟΣ, 23, 3. Γ Παιδιατρική Κλινική, Αριστοτέλειο Πανεπιστήμιο, Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης, 2
162 Σύγκριση της επίδρασης της Μοντελουκάστης και των Εισπνεομένων Στεροειδών στο Εκπνεόμενο Μονοξείδιο του Αζώτου (eno) και την αναπνευστική λειτουργία σε ασθματικά παιδιά Ε. Χατζηαγόρου 1, Β. Αβραμίδου
SUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Supplementary Figure 1
NSC N2d N5d TNFRSFa TNFRSFb RIPK RelA Madd I-TRAF/TANK GAPDH γ-actin Supplementary Figure A 2 hrs Day : Cell seeding Day 9: +ng/ml TNF-α Day 9: Fixation B Merge Nestin PH-3 Hoechst Acute TNF-α Control
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Heart failure: Therapy in 2012 ΓΕΏΡΓΙΟΣ Κ ΕΥΘΥΜΙΑΔΗΣ ΚΑΡΔΙΟΛΟΓΟΣ
Heart failure: Therapy in 2012 ΓΕΏΡΓΙΟΣ Κ ΕΥΘΥΜΙΑΔΗΣ ΚΑΡΔΙΟΛΟΓΟΣ Καρδιακή Ανεπάρκεια Σύνδροµο που χαρακτηρίζεται από Δοµική ή λειτουργική διαταραχή της καρδιάς Αδυναµία επαρκούς παροχής στους ιστούς Παρά
ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ
5 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ ΕΛΛΗΝΙΚΗΣ ΕΤΑΙΡΕΙΑΣ ΑΙΜΑΦΑΙΡΕΣΗΣ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ Θωμάς Τσαγανός, MD, PhD Πανεπιστημιακός Υπότροφος Δ Παθολογική Κλινική Πανεπιστημιακό Γενικό Νοσοκομείο
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
PNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc
Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης
DOI: /j.cnki.cjcpe APD RVOT I NCX tail RVOT RVOT RVOT RVOT APD RVOT RVOT RVOT RVOT APD RVOT
DOI:10.13333/j.cnki.cjcpe.2011.06.032 2011 25 6 527 * 1 1 1 2 1 1 1 1 1 RVOT I NCX tail RVOT RV RVOT I NCX tail I NCX tail RVOT APD RV RVOT APD RVOT I NCX tail RV P < 0. 05 RVOT APD APD RVOT I NCX tail
ADI TS2 A
471 1 1 1 2 1. 5500042. 610041 TS2 A 1004-8456201005-0471-05 Impact of Antibiotics Residues in Animal-Derived Foods on Intestinal Microflora and the Microbiological SUN Xiao-hongWANG Hai-xiangCHEN JuanZHANG
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
DC-CIK. Tca8113, [ ] (2011) CIK, Tca8113. Tca8113 DC CIK DC-CIK ; t (P=0.0132); , SAS Tca8113
China Journal of Oral and Maxillofacial Surgery Vol.9 No.6 November,2011 467 [ ]1672-3244(2011)06-0467-05 DC-CIK 1 2 1 1 (1. 200011; 2. 200031) [ ] : (DC) (CIK) : DC, CIK, DC CIK DC-CIK ; Tca8113 A B C;
ΑΝΕΠΑΡΚΕΙΑ ΑΟΡΤΗΣ ΚΑΙ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΑΡΙΣΤΕΡΑΣ ΚΟΙΛΙΑΣ
ΑΝΕΠΑΡΚΕΙΑ ΑΟΡΤΗΣ ΚΑΙ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΑΡΙΣΤΕΡΑΣ ΚΟΙΛΙΑΣ Αλέξανδρος Στεφανίδης Καρδιολόγος Α Καρδιολογικό τμήμα, Γ.Ν.Νίκαιας Παρουσίαση περιστατικού Ανδρας 60 ετών, εισάγεται λόγω ΟΠΟ. Ιστορικό ΑΥ, υπερλιπιδαιμίας
2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών
26 2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών Β. Δραγουμάνος 1, Δ. Αθανασόπουλος 2, Ε. Φουστέρης 1, Δ. Αναστασόπουλος 2, Π. Φουρλεμάδης
ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα
ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ, ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΔ ΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ & ΔΙΑΙΤΟΛΟΓΙΑΣ ΠΑΡΕΜΒΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΔΙΑΤΡΟΦΙΚΗΣ ΑΓΩΓΗΣ ΣΤΟΝ ΔΗΜΟ ΚΑΒΑΛΑΣ Πτυχιακή
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
The effect of curcumin on the stability of Aβ. dimers
The effect of curcumin on the stability of Aβ dimers Li Na Zhao, See-Wing Chiu, Jérôme Benoit, Lock Yue Chew,, and Yuguang Mu, School of Physical and Mathematical Sciences, Nanyang Technological University,
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Οι επιδόσεις Ελλήνων στο Mini Mental State Examination με βάση την ηλικία και τη νοητική κατάσταση από την παιδική στην τρίτη ηλικία.
CLINICAL TRIALS ΚΛΙΝΙΚΕΣ ΜΕΛΕΤΕΣ 25 Οι επιδόσεις Ελλήνων στο Mini Mental State Examination με βάση την ηλικία και τη νοητική κατάσταση από την παιδική στην τρίτη ηλικία. Τσάνταλη, Ε. 1,2,3, Οικονομίδης,
The influence of various blood purification methods on intradialytic hypotension in maintenance dialysis
2017 11 48 6 43 528000 MHD IDH 30 HD HDF HP + HD 10 24 β 2 - β 2 -MG N B NT-proBNP ALB 1HDF + HD HP + HD P < 0. 05 2 HDF β 2 -MG P < 0. 05 24 HP + HD HDF β 2 -MG P < 0. 05 HP + HD P < 0. 05 24 HD NT-proBNP
# Effect of PPAR-α agonist on adipokines expression in rats fed with high-fat diet LI yan#, HUANG bin, CHENG hua, LIANG zhen, LIU shan-ying
PPAR-α # 510120 PPAR-α SD SD 6 4 RT-PCR?? mrna FFA TG HOME-IR FFA 2.37±0.60 1.59±0.30 1.33±0.34 mmol/l p
PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE
2624 54 plasma exchange PE hemoperfusion HP continuous venovenous hemofiltration CVVH 54 PE CVVH PE+HP HP+CVVH HP+CVVH+PE 183 exceed normal limit absolute value ENLAV prothrombin time PT PE total bilirubin
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
ΑΘΛΗΤΙΣΜΟΣ και ΥΠΕΡΤΑΣΗ
ΑΘΛΗΤΙΣΜΟΣ και ΥΠΕΡΤΑΣΗ Εύα Καρπάνου Υπερτασικό Ιατρείο ΩΚΚ Ιωάννινα 28/2/2015 Tuesday, March 10, 15 ΑΘΛΗΤΙΣΜΟΣ και ΥΠΕΡΤΑΣΗ Εύα Καρπάνου Υπερτασικό Ιατρείο ΩΚΚ Ιωάννινα 28/2/2015 Tuesday, March 10, 15
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
Cinnamaldehyde Prevents Endothelial Dysfunction Induced by High Glucose by Activating Nrf2
www.karger.com/cpb 315 Accepted: Wang et al.: March Cinnamaldehyde 11, 2015 Prevents Endothelial Dysfunction 1421-9778/15/0361-0315$39.50/0 Under High Glucose Original Paper This is an Open Access article
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Supporting Information
Supporting Information rigin of the Regio- and Stereoselectivity of Allylic Substitution of rganocopper Reagents Naohiko Yoshikai, Song-Lin Zhang, and Eiichi Nakamura* Department of Chemistry, The University
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
Απεικονιστική εκτίμηση της Δεξιάς Κοιλίας. Κων/νος Φαρσαλινός Ωνάσειο Καρδιοχειρουργικό Κέντρο
Απεικονιστική εκτίμηση της Δεξιάς Κοιλίας Κων/νος Φαρσαλινός Ωνάσειο Καρδιοχειρουργικό Κέντρο Για πολλά χρόνια είχε παραμεληθεί Σημαντικός προγνωστικός δείκτης της κλινικής έκβασης Για πολλά χρόνια είχε
Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ Νικόλας Χριστοδούλου Λευκωσία, 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ
ΚΕΡΚΙΔΙΚΗ ΚΑΙ ΜΗΡΙΑΙΑ ΠΡΟΣΠΕΛΑΣΗ ΣΕ ΣΤΕΦΑΝΙΟΓΡΑΦΙΕΣ ΚΑΙ ΑΓΓΕΙΟΠΛΑΣΤΙΚΕΣ. ΜΙΑ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ
ΚΕΡΚΙΔΙΚΗ ΚΑΙ ΜΗΡΙΑΙΑ ΠΡΟΣΠΕΛΑΣΗ ΣΕ ΣΤΕΦΑΝΙΟΓΡΑΦΙΕΣ ΚΑΙ ΑΓΓΕΙΟΠΛΑΣΤΙΚΕΣ. ΜΙΑ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ Μαυρόγιαννη Γεωργία 1, Καραντζούλα Ευαγγελία 2, Τουλιά Γεωργία 3, Κυριακόπουλος Βασίλης 4, Καδδά Όλγα 5 EΡΕΥΝΑ
Biapenem BIPM Lot No g mg
MexAB-OprM 1 1 1 1 16 4 9 16 5 11 BIPM imipenemcilastatinipmcs MEPM 3 MexAB-OprM BIPM IPMCS MEPM MexAB-OprM MexCD-OprJ BIPM MEPM IPMCS BIPM IPMCS MEPM 10 5 order CFUlung BIPMIPM CS MEPM 10 6 order CFUlung
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
ATR12181 , , AT1 : R : A : (2007) ATR SHR ( 10 mg kg - 1 d - 1 ) , AT1R c2fos c2jun,
1226 CN 3421206ΠR, ISSN 100922501 E2mail :ccpt96 @21cn. com 2007 Nov ;12 (11) :1226-1230 ATR12181,,,,,, 430022, : I (AT1) ATR12181 (SHR) : AT1 ATR12181 SHR WISTAR, SHR ( 10 mg kg - 1 d - 1 ),,ELISA ( ESRD),RT2PCR
Modulation of immunol-properties by chito-oligosaccharide
2 191 doi 10. 3969 /j. issn. 1000-484X. 2013. 02. 017 1 2 266003 R392. 12 A 1000-484X 2013 02-0191-06 3-7 COS HPLC FITC FITC-COS Toll 4 TLR4 TNF-α IgG IgM HPLC COS 3-7 FITC-COS COS TLR4 1 FITC-COS COS
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
Παρουσίαση ερευνητικού έργου
Παρουσίαση ερευνητικού έργου Πανεπιστημιακό Νοσοκομείο Ιωαννίνων B Καρδιολογική Κλινική Study of peripheral circulation in patients with Heart Failure 11/2/2016 Μπεχλιούλης Άρης, MD, PhD Kαρδιολόγος, Επιστημονικός
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Motion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
(Fenneropenaeus chinensis)
3 1 2 1 1 2 (1. 266071 2. 266003) (Fenneropenaeus chinensis) MCP-KP 3 C 16.38e -2.58t 0.32e -0.1t C 18.7e -2.57t 0.26e -0.12t C 15.08e 1.49t +0.65e -0.09t 15.74e 10.38t (t (1/2)α ) 0.269,0.270 0.465 h
Παρουσίαση περιστατικού: Φαρμακευτική πολυπεκτομή με μακροχρόνια λήψη μοντελουκάστης.
Ε Ν Δ Ι Α Φ Ε Ρ Ο Υ ΣΑ Π Ε Ρ Ι Π Τ Ω ΣΗ / C A S E R E P O RT Παρουσίαση περιστατικού: Φαρμακευτική πολυπεκτομή με μακροχρόνια λήψη μοντελουκάστης. Nasal polyposis near total remission after long term treatment
1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW
2014 6 33 6 779 * 1 1 2 3 1 2 1. 100050 2. 277500 3. 100050 DSC HPLC 99. 5 ± 0. 4 % k 2 P 0. 95 GBW09587 R978. 7 R927. 1 A 1004-0781 2014 06-0779 - 06 Purity Determination and Uncertainty Evaluation of
VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...
Table of Content CHAPTER-1... 1 1 INTRODUCTION... 1 CHAPTER-2... 4 2 REVIEW OF LITERATURE... 4 2.1 History of Filariasis... 4 2.1.1 Discovery of Symptoms (1588-1592)... 4 2.1.2 Discovery of Microfilariae
Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι
Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι Ιωάννης Ε. Κουτρουμπάκης Καθηγητής Γαστρεντερολογίας Ιατρικής Σχολής Πανεπιστημίου Κρήτης Δήλωση σύγκρουσης συμφερόντων Οι παρουσιάσεις
Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog
J. Jpn. Soc. Soil Phys. No. +*-, p.-3.1,**0 ** * *** Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog Toshiki FUJIMOTO*, Ippei IIYAMA*, Mai SAKAI*, Osamu
GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF
2003123 (6) Basic Medical Sciences and Clinics 625 : 100126325 ( 2003) 0620625205 GDNF 3,,,,, (, 050000) : ( GDNF) (DRGn), MTT 1 g/ L 10 g/ L 50 g/ L 100 g/ L GDNF : GDNF GDNF : ; ; :R32912 :A (glial cell
Πρώιμη και όψιμη ΙΦΝΕ: διαφορετικός φαινότυπος, διαφορετικά μονοπάτια στη φλεγμονή; Γ. Μπάμιας
Πρώιμη και όψιμη ΙΦΝΕ: διαφορετικός φαινότυπος, διαφορετικά μονοπάτια στη φλεγμονή; Γ. Μπάμιας Βασικά ερωτήματα Πως καθορίζονται η «πρώιμη» και η «όψιμη» ΙΦΝΕ? Πως καθορίζεται ο φαινότυπος της ΙΦΝΕ? Πως
Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA
2016 12 12 Ankylosing Spondylitis AS human leukocyte antigen HLA- AS NSAIDs NSAIDs B27 100% NSAIDs NSAIDs 90% NSAID ~ AS 0.25% 2~3 1 100% 1 AS CFDA FDA EMA 14 AS NSAIDs 2 CFDA non-ster- AS 1 oidal anti-inflammatory
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
microrna126 GATA mg /kg 800 November 2013 Vol. 35 No. 11 Chinese Traditional Patent Medicine 10% 5% GATA-3 40 BALB /c GATA-3 TH2 NA126
Psychopharmacology 1985 85 367-370. 1 2 Porsoh R Le pichon M Jalfre M. 6 000 mg /kg 800 48 7 Bunney W Davis J. 5-8 J. 1 Steru L Chemlat R Thicrry B et al. The tail suspension test A new method for screening
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%