Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats

Transcript

1 744 Chinese Journal of Pathophysiology IL-19 * interleukin-19 IL-19 experimental autoimmune myocarditis EAM EAM 6 IL PCR atrial natriuretic peptide ANP brain natriuretic peptide BNP IL-18 IL-1β IL-12p35 IFN-γ IL-19 ANP BNP IL R A doi /j. issn Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats CHANG He 12 ZHAO Fa-yun 1 WANG Yan 12 LI Gang 2 ZHANG Le 2 ZOU Jun 1 1 Xiamen University Medical CollegeXiamen China 2 Xiamen Heart CenterXiamen China. zoujun@ xmu. edu. cn ABSTRACTAIM To evaluate the effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis EAM in rats. METHODS Cardiac myosin was emulsified with equal volume of complete Freund s adjuvant. The animal model of EAM was established by injecting with the preparation in both footpads of the Lewis rats. The rats were intravenously injected with the plasmid encoding IL-19-IgG on day 6. Echocardiography was performed before the rats were sacrificed on day 17. The effect of IL-19-IgG plasmid injection was evaluated by measuring the heart weight /body weightmyocarditis arearelative expression levels of atrial natriuretic peptide ANP and brain natriuretic peptide BNP in the hearts. The mrna expression levels of related cytokines including IL-18IL-1βIL-12p35 and IFN-γ were detected. RESULTS The rats in model group showed significant myocardial damage and a decrease in the left ventricular functions. The rats in the treatment group injected with IL-19-IgG plasmid showed an improvement of the cardiac functions. The ratio of heart weight /body weightthe area of myocarditis and the mrna levels of ANP and BNP were significantly lower in IL-19-IgG treatment group than those in model group. The mrna levels of IL-18IL-1βIL- 12p35 and IFN-γ were also significantly decreased in IL-19-IgG treatment group. CONCLUSION Intravenous injection of plasmid encoding IL-19-IgG effectively prevents the development of the left ventricular remodeling and myocardial damage in EAM rats. KEY WORDSInterleukin-19 Autoimmune myocarditis * No No ZQN-ZD-37 No. 2012J01415 Tel zoujun@ xmu. edu. cn 1

2 745 Master Mix FermantasKod Plus 10 Kod Plus buffer Not I Swa I E. coli JM109 1 TaKaRaDEPC Solarbio T B SYBR qpcr Mix Toyobo TaKaRa experimental autoimmune myocarditis EAM 2 Th1 /Th2 EAM 2. 1 pcaggs-igg Fc 19 interleukin-19 IL-19 pcaggs-il-19-igg Fc Kod Plus DNA Toyobo IL-19 2 IL-20R1 / IL-20R2 IL-20 IL-24 PCR Not I Swa I IL-10 2 IL-10 E. coli JM 109 IL-10 B h PCR DC T PCR IL-19 IL-19 Omega IL-1β IL-6 2 g /L IL-8 CCL5 CXCL EAM 3 Th1 Th mol /L KCl 10 g /L Th1 Th2 IL g /L 4 IL-19 EAM 0. 2 ml EAM + SP-IgG EAM + IL-19-IgG IL IL-19 μg 400 μl pcaggs-sp-igg Fc pcaggs-il-19-igg 80 ml /kg 15 s 24 h 3 6 RNA cd- NA cdna 0. 5 μl 20 μl PCR 1 8 Lewis 180 ~ 200 g cdna 5 μl 1 μl 2% 120 V 20 SCXK min IL-19 SP mrna BeckmanC PCR Bio-Rad % 3 ml /kg PCR ABI Cell Biosciences MHz M complete Freund s adjuvant left ventricular CFADifcoTrizol Invitrogen Revert Aid First Strand cdna Kit Dream Taq Green PCR Oxoid OmegaThunderbird pcaccs-sp-igg Fc 1 EAM cdna pcacggs-igg Fc Taq DNA Fermantas 1 GE Vivid7 end-diastolic internal diameter LVEDd left ventricular end-systolic internal diameterlv-

3 746 EDs interventricular septal thicknessnatriuretic peptide ANP brain natriuretic IVS left ventricular posterior wall thickness LVPW left ventricular fractional shortening LVFS ejection frac- tions EF RNA 2 μg cdna -3- glyceraldehyde-3-phosphate dehydrogenasegap- 5 mm DH 20 μl PCR ABI 10% 7500 PCR HE 0 ~ 4 min s 60 1 min s 0 1 < 5% min s s ANP BNP 5% ~ 10% 3 10% ~ IL-18 IL-1β IL-12p35 IFN-γ 20% 4 > 20% Real-time PCR atrial 1 Table 1. peptide BNP mrna Trizol RNA DEPC RNA A 260 /A ~ 2. 0 TaKaRa 1 IL-19 The primers for real-time PCR Name Sense primer Anti-sense primer IL ttcatttaaatggtgttcgttctctgctcagtt-3 5 -gcatcgcggccgccagacgtttcctgatgattcct -3 SP 5 -ttcatttaaatgccttcaccatgaagtccag-3 5 -gcatcgcggccgctgtctccaacagcatttcctta -3 ANP 5 -atggatttcaagaacctgctaga-3 5 -gctccaatcctgtcaatcctac-3 BNP 5 -gatgattctgctcctgcttttc-3 5 -gccatttcctctgacttttctc-3 IFN-γ 5 -gaaagacaaccaggccatcag-3 5 -tcatgaatgcatccttttttgc-3 IL-1β 5 -gctagtgtgtgatgttcccattag-3 5 -cttttccatcttcttctttgggta-3 IL-12p agacatcacacgggacaaaac cacagggtcatcatcaaagaag-3 IL atcagaccactttggcagactt cttccatccttcacagataggg-3 GAPDH 5 -atcaccatcttccaggagcga agccttctccatggtggtgga-3 3 ± mean ± SD SPSS P < IL-19 EAM 24 h RT-PCR Figure 1. EAM SP IL-19 SP-IgG IL IgG 1 2 The mrna expression of SP and IL-19 in the liver tissues of the rats with experimental autoimmune myocarditis EAM determined by RT-PCR. SP-IgG IL-19-IgG 17 HE IgG EAM + SP-IgG 3 EAM + SP-IgG 3 EAM + IL-19-IgG 17 2 EAM + SP- EAM + SP-IgG LVEDd LVESd IgG EAM + IL-19- LVPWIVS LVEF LVFS

4 747 EAM + SP-IgG EAM + IL-19- IgG LVPW IVS LVEF LVFS 2 4 ANP BNP 17 RNA cdna PCR ANP BNP Figure 2. The histopathological images of the hearts with experimental autoimmune myocarditis EAM. EAM + SP-IgG ANP BNP EAM + IL-19-Ig 2 EAM EAM + SP-IgG ANP BNP Figure 3. The heart weight /body weight A and myocarditis area B in the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < ** P < vs EAM + SP-IgG. 3 2 Table 2. Evaluation of the heart functions in the rats with experimental autoimmune myocarditis EAM by echocardiography Mean ± SD. n = 6 Cardiac function Normal EAM + SP-IgG EAM + IL-19-IgG LVEDd mm ± ± ± LVESd mm ± ± ± LVPW mm ± ± ± * IVS mm ± ± ± * LVEF % ± ± ± * LVFS % ± ± ± * * P < vs EAM + SP-IgG. 4 EAM + IL-19-IgG EAM + SP-IgG Liu 6 Zhang 8 IL-18 IL-1β IL-12p35 IFN-γ EAM + IL-19-IgG EAM + SP-IgG IL-18 IL-1β IL-12p35 IFNγ 5 EAM + IL- 19-IgG PCAGGS Ig-Fc IL-19 IL-19 EAM IL-19

5 748 Figure 4. 4 The relative mrna expression of ANP A and BNP B in the rat myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < ** P < vs EAM + SP-IgG. ANP BNP mrna Figure 5. 5 The relative mrna expression of IL-18 IL-1β IL-12p35 and IFN-γ in the myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. IL-18 IL-1β IL-12p35 IFN-γ * P < ** P < vs EAM + SP-IgG. IL-19 IL-18 IL-1β IL-12p35 Th1 /Th2 IFN-γ IL-19 IL-10 IL-10 IL-10 EAM 9 EAM EAM IL-1 IL-19-IgG IL-19-IgG EAM / B NK ANP BNP mrna IL-19 2 IL-1α

6 749 IL-1β 2Sabat RWallace EEndesfelder Set al. IL-19 and IL- IL-1α IL-1β 20 two novel cytokines with importance in inflammatory diseases J. Expert Opin Ther Targets EAM 14 IL-1β 3Hsing CHChiu CJChang LYet al. IL-19 is involved IL-1β ILin the pathogenesis of endotoxic shock J. Shock DC IL-12 Th1 4Azuma YTNakajima HTakeuchi T. IL-19 as a potential Th0 Th1 IFN-γ therapeutic in autoimmune and inflammatory diseases J. Th2 10 IL-18 IFN-γ Curr Pharm Des IL-19 IL-1 Th1 IL-18 IL-12 T NK 6Liu FSong YLiu D. Hydrodynamics-based transfection IFN-γ Th1 Th1 in animals by systemic administration of plasmid DNA J. IFN-γ EAM Gene Ther EAM IL Lewis Th J. Th Zhang GBudker VWolff JA. High levels of foreign IL-19 gene expression in hepatocytes after tail vein injections of naked plasmid DNAJ. Hum Gene Ther IL-19 Azuma IL-19 - / - DSS 9Oral HBKotenko SVYilmaz Met al. Regulation of T cells and cytokines by the interleukin-10 IL-10 -family cytokines IL-19IL-20IL-22IL-24 and IL-26 J. Eur IL-19 J Immunol Afanasyeva MWang YKaya Zet al. Interleukin-12 receptor / STAT4 signaling is required for the development of IL-19 MAPK autoimmune myocarditis in mice by an interferon-gammaindependent pathwayj. Circulation IL-19 IL-19 mrna IL-19 11Azuma YTMatsuo YKuwamura Met al. Interleukin- CD4 + T Th2 19 protects mice from innate-mediated colonic inflammation J. Inflamm Bowel Dis IL-19 IL-10 IL-19 T IFN-γ IL-4 IL Canto EGarcia Planella EZamora-Atenza Cet al. Interleukin-19 impairment in active Crohn s disease patients IL-19 J. PLoS One e IL-6 TNF-α 13Cuneo AAHerrick DAutieri MV. IL-19 reduces VSMC IL-19 2 IL-20R1 /IL-20R2 activation by regulation of mrna regulatory factor HuR IL-19 and reduction of mrna stability J. J Mol Cell Cardiol IL IL-19 14Jordan WJEskdale JBoniotto Met al. Human IL-19 regulates immunity through auto-induction of IL-19 and 15 production of IL-10J. Eur J Immunol Gallagher G. Interleukin-19 multiple roles in immune 1Leuschner FKatus HAKaya Z. Autoimmune myocarditis pastpresent and future J. J Autoimmun J regulation and diseasej. Cytokine Growth Factor Rev