630.443 164..., 1960-. ( ),. -, - (, ),, - [1, 2].,,, -, - [1, 3, 4]., - -, -,. -., -,,.. - (Pinus sylvestris L.) (P. pallasiana Lamb.), -. (,, ) 7 : ( ), - ( ),, -, - ( ). - 3 5. - (Pinus sylvestris) (P. pallasiana) 360. 2 6, 7 12 15 25. ( -
..,,.). -. -. - 3 14. [2, 5, 6]. -. -,., ( ) 70., - 13000 / 40. 70 % -, 50 [1, 7 9]., - -., Dothistroma pini EFI-α- - DPtef-F (5` ATTTTTCGCTGCTCGTCACT 3`) DPtef-R (5` CAATGTGAGATGTTCGTCGTG 3`), Dothistroma septosporum - β-tubulin Dstub2-F (5`CGAACATGGACTGAGCAAAAC 3`) DStub2-R (5` GCACGGCTCTTTCAAATGAC 3`) [9]. 20. Applied Biosystems GeneAmp PCR System 2700. - 95 C 5, 35 - : 95 C 30, 60-30, 72 30. 72 7 [9]. 1 %, SB 100 V 60, -. - (, ), - (, - ). (, ) COST FP 1102 DIAROD. 2011 2013. Microsoft Excel 2007 Statistica 6.0. - P = 0,05. 165
-. 2014.. 207. -, ( 80 % ),,. 10, : Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina (Lagerb.) M. Morelet, Lophodermium seditiosum Minter Staley, Phomopsis sp., Sphaeropsis sapinea (Fr.) Dyko & B. Sutton ( Diplodia pinea (Desm.) J. Kickx), Sclerophoma pithyophila (Corda) Hohn, Cyclaneusma minus (Butin) Di Cosmo (. 1). S. pithyophila 20,8 %, G. abietina ( 14,2 %), Alternaria sp. ( 13,9 %), S. sapinea 10,6 % (. 1)., - S. pithyophila, -., -, -, [5, 6]., 38,3 % - 10,6 % 166 1,, % - Alternaria sp. 22,5 1,7 17,5 Fusarium sp. 11,7 2,5 3,3 Gremmeniella abietina (Lagerb.) M. Morelet 37,5 4,2 0,8 Lophodermium seditiosum Minter, Staley 3,3 0,0 10,0 Phomopsis sp. 5,8 0,0 0,0 Sclerophoma pithyophila (Corda) Hohn. 10,0 30,0 22,5 Sphaeropsis sapinea (Fr.) Dyko & B. Sutton 4,2 10,0 17,5 Alternaria sp. 43,3 0,0 5,0 Cyclaneusma minus (Butin) Di Cosmo 0,0 0,0 10,0 Dothistroma pini Hulbary 22,5 60,8 57,5 Fusarium sp. 9,2 0,8 1,7 Fusicoccum sp. 0,0 55,8 61,7 Sclerophoma pithyophila (Corda) Hohn. 43,3 17,5 34,2 Sphaeropsis sapinea (Fr.) Dyko & B. Sutton 20,0 51,7 43,3
.. S. sapinea,, - -. -. -, [7, 10, 11]. ( ), Gremmeniella abietina. - 37,5 %, (4,2 0,8 % ). Fusarium Alternaria, -. -, -.,., Lophodermium seditiosum., - 3,3 %. - - [1, 3, 4, 6]. Dothistroma sp. (46,9 %), Fusicoccum sp. (39,2 %), S. sapinea (38,3 %) S. pithyophila (31,7 %) (. 1)., -, -,., -., -,, 1 3. Dothistroma sp., [2, 6, 8, 9, 12]. Dothistroma septosporum ( Mycosphaerella pini) Dothistroma pini ( ). 80,.,,,, -, - 167
-. 2014.. 207 (, Dothistroma needle blight redband needle blight).,, [2, 8, 9, 12]. 100, - 2005 [2, 12]., - [8, 9, 12]., - D. pini. D. septosporum (. 1)., ositive ( - ), negative ( ).,, (55,8 61,7 %? ), Fusicoccum sp. ( ). -, Cyclaneusma minus ( 10 % )., -. S. sapinea S. pithyophila Dothistroma pini 82, 61 34 %, -,. Fusicoccum sp. 20 14 % (, ).,, Dothistroma sp.,, D. pini. 1. Dothistroma pini ( ) Dothistroma septosporum ( ) 1 % 168
.., - [6, 9, 11]..,, 10 : Alternaria sp., D. pini., Fusarium sp., Fusicoccum sp., G. abietina, L. seditiosum, Phomopsis sp. S. sapinea, S. pithyophila, C. minus c., G. abietina, S. pithyophila.. D. pini, S. sapinea S. pithyophila. - Fusicoccum sp. -., 86 % -, D. pini. 1..., є.. // ( ). 2011. 9.. 57 62. 2...,.. Dothistroma septosporum //. 2006.. 110.. 226 229 3...,.. Pinus sylvestris L. P. sibirica Du Tour // - :. 3-.,, 23 29 2011,. :. 2011.. 38 39. 4... //. 2009.. XXVI, 1.. 105 109. 5...,.. - //. :. 2006.. 42 59. 6. Singlair W.A., Lyon H.H. Diseases of trees and shrubs. N. Y.: Cornell university Press, Sage House, 2005. 660 p. 7..., є.. - // - :...-.. 90-........:. 2011.. 40 41. 8. Barnes I., Crous P.W., Wingfield B.D., Wingfield M.J. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. // Studies in Mycology, 2004, vol. 50,. 551 565. 9. Ioos R., Fabre B., Saurat C., Fourrier C., Frey P., Marçais B. Development, comparison, and validation of real-time and conventional PCR tools for the detection of the fungal pathogens causing brown spot and red band needle blights of pine. Phytopathology, 2008, vol. 100, pp. 105 114. 10. є..,..,.. - //. - 169
-. 2014.. 207,... є (10 13 2012.).. 1..:. 2012..257 259 12. Burgess T., Wingfield M.J., Wingfield B.W. Simple sequence repeat markers distinguish among morphotypes of Sphaeropsis sapinea. // Applied and Environmental Microbiology, 2001, vol. 67, pp. 354 362. 11. Barnes I., Kirisits T., Akulov A.Yu., Chhetri D.B., Wingfield B.D., Bulgakov T.S., Wingfield M.J. New host and country records of the Dothistroma needle blight pathogens from Europe and Asia. // Forest Pathology. 2008, vol. 38,. 178 195... - // -. 2014.. 207.. 164 170. (Pinus sylvestris) (P. pallasiana), -. -,. - -. 10 - (Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina, Lophodermium seditiosum, Phomopsis sp. Sphaeropsis sapinea, Sclerophoma pithyophila, Cyclaneusma minus). :, Sphaeropsis, Dothistroma, Cyclaneusma, Fusicoccum,. Davydenko E.V. Fungal pathogens of pine plantations of south Ukraine. Izvestia Sankt-Peterburgskoj Lesotehniceskoj Akademii, 2014, is. 207, pp. 164 170 (in Russian with English summary). The aim of the study was to reveal the complex of fungal pathogens associated with needle of Scots pine (Pinus sylvestris) and Crimean pine (P. pallasiana) in three regions of south Ukraine. The samples of symptomatic needles in pine plantations were collected. The material was used to identify the complex of fungal pathogens with microscopic and PCR based methods. In total, 10 fungal pathogens have been identified using microscopic and molecular methods for pine plantations of Zaporozhye, Nikolayev, and Kherson regions. The following fungal pathogens Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina, Lophodermium seditiosum, Phomopsis sp. Sphaeropsis sapinea, Sclerophoma pithyophila, Cyclaneusma minus were detected with different frequencies. K e y w o r d s : forest disease, Sphaeropsis, Dothistroma, Cyclaneusma, Fusicoccum, pine plantations.,, -.... SPIN- : 1289-8697. 61024,.,. 86,.,. -mail: davidenkokv@mail.ru DAVYDENKO Ekateryna V., PhD (Agriculture), Ukrainian honored with «Znak Poshany» Research Institute of Forestry and Forest Melioration named after G.N. Vysotsky. SPIN- : 1289-8697. 61024. Pushkinska str. 86. Kharkov. Ukraine. -mail: davidenkokv@mail.ru 170