Supplemental Material Decreased N 6 -methyladenosine in peripheral blood RNA from Diabetic Patients Is Associated with FTO Expression Rather than ALKBH5 Fan Shen, 1,2, Wei Huang, 2, Jing-Tao Huang, 1 Jun Xiong, 2 Ying Yang, 1 Ke Wu, 3 Gui-Fang Jia, 4 Yu-Qi Feng, 2,* Bi-Feng Yuan, 2,* Song-Mei Liu 1,* 1 Center for Gene Diagnosis, Zhongnan Hospital of Wuhan University, Donghu Road 169#, Wuhan, 430071, P.R. China 2 Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), Department of Chemistry, Wuhan University, Wuhan 430072, P. R. China 3 Center for Animal Experiment/ABSL-3 Laboratory, Wuhan University, Wuhan, 430071, PR China 4 Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing, 100871, P. R. China Running Title: Content of N 6 -methyladenosine is correlated with T2DM These authors contributed equally to this work. *To whom correspondence should be addressed. Tel. +86-27-68755595; fax. +86-27-68755595. E-mail address: Song-Mei Liu, smliu@whu.edu.cn; Bi-Feng Yuan, bfyuan@whu.edu.cn; Yu-Qi Feng, yqfeng@whu.edu.cn. 1. ENZYMATIC HYDROLYSIS OF RNA RNA (100 ng) was first denatured by heating at 95ºC for 5 min and then chilling on ice for 2 min. After adding 1/10 volume of S1 nuclease buffer (30 mm CH 3 COONa, ph 4.6, 280 mm NaCl, 1mM ZnSO 4 ) and 150 units of S1 nuclease, the mixture (20 μl) was then incubated at 37ºC for 16 h. To the solution was subsequently added 1/10 volume of alkaline phosphatase buffer (50 mm Tris-HCl, 10 mm MgCl 2, ph 9.0), 0.002 units of venom phosphodiesterase I and 15 units of alkaline phosphatase. And then the incubation was continued at 37ºC for an additional 4 h followed by extraction with equal volume chloroform twice. The resulting aqueous layer was collected and lyophilized to dryness and then reconstituted in 100 μl water. The obtained 30 μl samples were then subjected to liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis. 2. ANALYSIS OF FTO AND ALKBH5 GENE EXPRESSION BY QUANTITATIVE REAL-TIME PCR MIQE checklist of qpcr Item to check Experimental design 1
Human: T2DM patients (n=88) and control subjects (n=92) Animal: STZ induced diabetic rats (n=7) and normal Sprague-Dawley rats (n=8) Sample 1mL of whole blood sample with EDTA anticoagulation Nucleic acid extraction A commercially available TIANamp Blood RNA Kit (Tiangen, Beijing, China). Reverse transcription An amount of 8 ul of RNA was treated by a commercially available FastQuant RT Kit (with gdnase) (Tiangen, Beijing, China) according to the manufacturer s protocol. qpcr target information For human samples: Location of amplicon in mrna: ALKBH5: 1439-1561; FTO: 1087-1215; β-actin: 779-900; GAPDH: 68-218. Amplicon length: ALKBH5:123bp; FTO: 129bp; β-actin: 122bp; GAPDH: 151bp. For rat samples: Location of amplicon in mrna: ALKBH5: 771-956; FTO: 1205-1394; β-actin: 200-342; GAPDH: 208-344. Amplicon length: ALKBH5: 186bp; FTO: 190bp; β-actin: 143bp; GAPDH: 137bp qpcr oligonucleotides Please see Supplemental Table 2 qpcr protocol Complete reaction conditions: After predenaturation a 95ºC for 5 min, DNA fragments were amplified for 40 cycles: denaturation at 95ºC for 10s, annealing at 60ºC for 30s. Reaction volume and amount of cdna/dna: qpcr was performed on a CFX96 Touch Real-Time PCR Detection System (BioRad, CA, USA). qpcr mixture of 10 μl included 5.0 μl (2 ) of itaq Universal Supermixes (BioRad, CA, USA), 50 nm of each forward and reverse primers, 1 μl cdna template and 3.0 μl double-distilled H 2 O. qpcr validation For SYBR Green I, Cq of the NTC: Cq values of NTCs > 35.0 was set as no significance. Specificity (gel, sequence, melt, or digest): The amplification specificity was validated by both dissociation curve (Supplemental Figure 2
4) and agarose gel electrophoresis (Supplemental Figure 5). The qpcr products showed the single peak at 81.0ºC, 83.5ºC, 80.5ºC, and 84.0ºC for ALKBH5, FTO, β-actin and GAPDH, respectively. Calibration curves with slope and y intercept: The standard curves (Supplemental Figure 3) for ALKBH5, FTO, β-actin and GAPDH were linear in the range tested (R 2 0.999). The Cq values of unknown samples fell within the linear range. The slopes of the standard curves for ALKBH5, FTO, β-actin and GAPDH were -3.495, -3.525, -3.571 and 3.527, respectively; the amplification efficiencies were 93.2%, 92.2%, 90.6%, and 92.1%. Cq variation at LOD: CVs of each gene: ALKBH5=2.0%; FTO=2.5%; β-actin=2.6%; GAPDH=0.8%. LOD: ALKBH5, 7.49 10 2 (copy); FTO, 6.08 10 2 (copy); β-actin, 5.61 10 2 (copy); GAPDH, 3.81 10 2 (copy). Data analysis qpcr analysis program (source, version): CFX96 Manager Software (BioRad, CA, USA). Method of Cq determination: Cq Results for NTCs: All Cq values of NTCs were > 35.0 Justification of number and choice of reference genes: β-actin and GAPDH. Description of normalization method: multiple reference genes (β-actin and GAPDH) normalization. Number and concordance of biological replicates: Total sample: n=180; CVs of each gene: Normal group: ALKBH5=6.49%, FTO=5.15%, β-actin=10.02% and GAPDH=5.67%. T2DM group: ALKBH5=9.57%, FTO=7.79%, β-actin=16.41% and GAPDH=9.82%. Number and stage (reverse transcription or qpcr) of technical replicates: N=3 Repeatability (intraassay variation): N=3 for each sample; the ΔCq between replicates were less than 0.5; CVs of each gene: ALKBH5<2.31%, FTO<2.12%, β-actin<2.95% and GAPDH<1.82%. Statistical methods for results significance: Statistical significance was set at p < 0.05. Software (source, version): SPSS 17.0 (SPSS Inc., Chicago, USA). 3
Supplemental Table 1. m 6 A contents in 180 RNA samples derived from 88 T2DM patients and 92 control subjects. Sample Group a Gender b Age m 6 A/rA (%) ALHBH5 c FTO d (year) D1 2 2 31 0.08 ± 0.005 0.977 ± 0.164 1.494± 0.042 D2 2 1 62 0.08 ± 0.007 2.011 ± 0.483 0.554 ± 0.142 D3 2 1 39 0.12 ± 0.001 1.733 ± 0.247 1.278 ± 0.270 D4 2 1 56 0.10 ± 0.002 0.969 ± 0.105 0.979 ± 0.207 D5 2 2 75 0.10 ± 0.005 0.717 ± 0.165 1.140 ± 0.118 D6 2 2 71 0.07 ± 0.0002 0.852 ± 0.041 0.560 ± 0.065 D7 2 2 38 0.13 ± 0.010 1.292 ± 0.132 1.125 ± 0.092 D8 2 1 55 0.11 ± 0.005 0.893 ± 0.107 1.204 ± 0.127 D9 2 2 55 0.09 ± 0.001 0.942 ± 0.045 1.264 ± 0.050 D10 2 1 36 0.14 ± 0.001 0.803 ± 0.071 0.838 ± 0.066 D11 2 1 43 0.13 ± 0.001 1.011 ± 0.023 1.061 ± 0.039 D12 2 1 48 0.15 ± 0.015 0.520 ± 0.024 0.910 ± 0.043 D13 2 1 73 0.13 ± 0.009 0.954 ± 0.097 1.437 ± 0.156 D14 2 2 64 0.12 ± 0.008 0.944 ± 0.148 1.144 ± 0.117 D15 2 2 40 0.12 ± 0.004 1.039 ± 0.212 1.212 ± 0.165 D16 2 2 76 0.13 ± 0.006 0.632 ± 0.032 0.687 ± 0.015 D17 2 2 27 0.12 ± 0.007 0.838 ± 0.051 1.227 ± 0.075 D18 2 1 18 0.11 ± 0.003 0.963 ± 0.034 1.276 ± 0.160 D19 2 1 45 0.12 ± 0.025 0.949 ± 0.037 1.418 ± 0.082 D20 2 1 52 0.11 ± 0.010 0.443 ± 0.054 1.335 ± 0.150 D21 2 2 69 0.13 ± 0.009 0.449 ± 0.025 0.969 ± 0.041 D22 2 1 44 0.11 ± 0.009 0.669 ± 0.138 0.947 ± 0.013 D23 2 2 62 0.11 ± 0.005 0.753 ± 0.063 0.867 ± 0.079 D24 2 1 62 0.12 ± 0.010 1.043 ± 0.059 0.756 ± 0.168 D25 2 1 36 0.11 ± 0.003 1.904 ± 0.383 2.246 ± 0.201 D26 2 1 61 0.10 ± 0.007 1.404 ± 0.115 1.481 ± 0.196 D27 2 2 77 0.08 ± 0.003 0.870 ± 0.060 1.614 ± 0.294 D28 2 1 49 0.12 ± 0.016 1.047 ±1.534 2.916 ± 0.844 D29 2 1 65 0.12 ± 0.009 1.151 ± 0.264 1.741 ± 0.357 D30 2 1 56 0.10 ± 0.005 2.989 ± 0.452 2.370 ± 0.435 D31 2 1 75 0.13 ± 0.010 2.856 ± 0.161 2.743 ± 0.148 D32 2 1 42 0.12 ± 0.003 2.300 ± 0.188 3.361 ± 0.130 D33 2 2 71 0.14 ± 0.010 2.439 ± 0.089 1.680 ± 0.222 D34 2 2 70 0.13 ± 0.013 0.512 ± 0.039 1.789 ± 0.073 D35 2 2 77 0.10 ± 0.005 0.667 ± 0.118 2.029 ± 0.381 D36 2 2 67 0.11 ± 0.015 1.567 ± 0.241 4.294 ± 1.108 D37 2 1 43 0.10 ± 0.010 1.535 ± 0.051 1.617 ± 0.063 D38 2 1 61 0.10 ± 0.005 0.566 ± 0.016 2.735 ± 0.043 4
D39 2 1 54 0.11 ± 0.012 0.400 ± 0.045 1.399 ± 0.221 D40 2 2 48 0.13 ± 0.004 0.626 ± 0.049 2.762 ± 0.126 D41 2 1 80 0.13 ± 0.002 0.593 ± 0.114 0.544 ± 0.014 D42 2 2 47 0.12 ± 0.013 1.130 ± 0.053 0.642 ± 0.061 D43 2 1 61 0.13 ± 0.013 0.806 ± 0.072 0.595 ±0.071 D44 2 1 73 0.12 ± 0.006 1.010 ± 0.146 0.333 ± 0.075 D45 2 1 55 0.12 ± 0.008 0.510 ± 0.039 1.039 ±0.078 D46 2 1 51 0.11 ± 0.010 0.370 ± 0.049 0.728 ± 0.035 D47 2 2 59 0.11 ± 0.006 0.986 ± 0.010 0.692 ± 0.020 D48 2 1 66 0.11 ± 0.006 0.619 ± 0.056 1.225 ± 0.249 D49 2 1 65 0.15 ± 0.004 0.867 ± 0.012 1.509 ± 0.054 D50 2 2 57 0.13 ± 0.011 0.469 ± 0.091 0.976 ± 0.039 D51 2 2 62 0.13 ± 0.007 0.469 ± 0.033 0.849 ± 0.068 D52 2 1 33 0.13 ± 0.002 0.616 ± 0.021 0.895 ± 0.022 D53 2 2 70 0.12 ± 0.014 0.460 ± 0.017 0.974 ± 0.067 D54 2 1 49 0.14 ± 0.019 0.513 ± 0.025 0.718 ± 0.079 D55 2 1 14 0.13 ± 0.006 0.364 ± 0.055 0.731 ± 0.051 D56 2 2 64 0.15 ± 0.010 0.520 ± 0.066 1.049 ± 0.218 D57 2 2 70 0.15 ± 0.001 0.487 ± 0.023 1.141 ± 0.057 D58 2 2 81 0.12 ± 0.006 0.675 ± 0.088 0.924 ± 0.042 D59 2 1 60 0.11 ± 0.015 0.381 ± 0.041 0.819 ± 0.036 D60 2 2 72 0.10 ± 0.018 0.707 ± 0.032 0.883 ± 0.064 D61 2 1 74 0.12 ± 0.002 0.348 ± 0.035 0.844 ± 0.117 D62 2 1 50 0.11 ± 0.010 0.501 ± 0.023 1.341 ± 0.075 D63 2 2 45 0.11 ± 0.004 0.653 ± 0.050 0.833 ± 0.057 D64 2 2 60 0.14 ± 0.0002 0.452 ± 0.036 0.531 ± 0.026 D65 2 1 43 0.13 ± 0.013 0.473 ± 0.025 0.607 ± 0.041 D66 2 1 56 0.12 ± 0.018 0.757 ± 0.059 0.998 ± 0.165 D67 2 1 46 0.12 ± 0.019 0.528 ± 0.075 1.025 ± 0.123 D68 2 1 60 0.13 ± 0.019 0.429 ± 0.016 0.754 ± 0.028 D69 2 1 54 0.11 ± 0.021 0.420 ± 0.009 0.767 ± 0.058 D70 2 1 59 0.12 ± 0.002 0.831 ± 0.161 1.608 ± 0.461 D71 2 1 40 0.12 ± 0.018 1.347 ± 0.702 0.875 ± 0.225 D72 2 2 66 0.12 ± 0.014 1.099 ± 0.208 3.776 ± 0.091 D73 2 1 88 0.13 ± 0.014 0.762 ± 0.093 1.681 ± 0.154 D74 2 1 70 0.07 ± 0.011 1.497 ±0.693 4.355 ± 0.886 D75 2 2 60 0.13 ± 0.012 0.446 ± 0.031 0.412 ± 0.038 D76 2 1 41 0.11 ± 0.009 1.719 ± 0.650 0.971 ± 0.200 D77 2 2 64 0.12 ± 0.007 1.071 ± 0.046 1.710 ± 0.156 D78 2 2 46 0.13 ± 0.015 0.827 ± 0.045 1.007 ± 0.043 D79 2 2 52 0.11 ± 0.018 0.916 ± 0.121 1.394 ± 0.060 D80 2 1 80 0.13 ± 0.007 0.787 ± 0.189 0.860 ± 0.162 D81 2 2 70 0.12 ± 0.045 0.691 ± 0.055 1.367 ± 0.128 5
D82 2 1 31 0.13 ± 0.016 0.795 ± 0.048 1.271 ± 0.064 D83 2 2 73 0.13 ± 0.015 0.560 ± 0.029 0.858 ± 0.050 D84 2 2 50 0.13 ± 0.027 0.633 ± 0.040 1.192 ± 0.078 D85 2 1 58 0.11 ± 0.009 0.834 ± 0.174 1.012 ± 0.088 D86 2 1 61 0.11 ± 0.005 1.174 ± 0.063 1.031 ± 0.073 D87 2 1 49 0.12 ± 0.016 1.276 ± 0.285 1.436 ± 0.066 D88 2 2 34 0.08 ± 0.007 0.632 ± 0.016 1.308 ± 0.056 C1 1 2 40 0.12 ± 0.004 0.893 ± 0.063 0.940 ± 0.058 C2 1 1 39 0.11 ± 0.0003 1.077 ± 0.084 1.261 ± 0.209 C3 1 1 78 0.12 ± 0.004 0.612 ± 0.179 1.078 ± 0.076 C4 1 1 45 0.17 ± 0.020 0.808 ± 0.055 1.168 ± 0.045 C5 1 1 37 0.15 ± 0.006 0.748 ± 0.048 0.942 ± 0.022 C6 1 2 32 0.15 ± 0.011 0.939 ± 0.087 1.327 ± 0.065 C7 1 1 32 0.24 ± 0.067 0.191 ± 0.019 0.487 ± 0.093 C8 1 1 73 0.13 ± 0.003 1.621 ± 0.340 2.134 ± 0.410 C9 1 1 38 0.12 ± 0.002 0.871 ± 0.084 1.150 ± 0.078 C10 1 2 50 0.15 ± 0.010 0.724 ± 0.036 0.810 ± 0.055 C11 1 1 56 0.14 ± 0.006 0.958 ± 0.049 0.636 ± 0.021 C12 1 1 50 0.14 ± 0.001 0.661 ± 0.090 0.778 ± 0.144 C13 1 2 54 0.18 ± 0.028 0.612 ± 0.142 1.322 ± 0.302 C14 1 2 50 0.15 ± 0.001 1.074 ± 0.084 1.490 ± 0.115 C15 1 2 47 0.16 ± 0.006 0.710 ± 0.097 0.793 ± 0.093 C16 1 2 63 0.18 ± 0.0003 0.155 ± 0.063 0.859 ± 0.309 C17 1 1 70 0.14 ± 0.018 0.438 ± 0.117 0.722 ± 0.081 C18 1 2 67 0.16 ± 0.010 0.774 ± 0.078 0.775 ± 0.085 C19 1 1 48 0.19 ± 0.016 0.726 ± 0.268 1.003 ± 0.369 C20 1 2 72 0.13 ± 0.017 0.822 ± 0.113 1.560 ± 0.204 C21 1 1 49 0.18 ± 0.030 0.720 ± 0.177 1.994 ± 0.292 C22 1 2 73 0.11 ± 0.001 0.397 ± 0.018 0.397 ± 0.049 C23 1 1 42 0.13 ± 0.012 0.444 ± 0.031 0.706 ± 0.141 C24 1 1 52 0.13 ± 0.004 0.683 ± 0.085 0.780 ± 0.203 C25 1 1 40 0.17 ± 0.014 0.615 ± 0.068 0.756 ± 0.075 C26 1 1 75 0.15 ± 0.014 0.865 ± 0.032 1.400 ± 0.066 C27 1 2 54 0.19 ± 0.021 0.444 ± 0.022 0.867 ± 0.027 C28 1 2 56 0.13 ± 0.004 0.362 ± 0.035 0.767 ± 0.126 C29 1 2 58 0.17 ± 0.032 0.955 ± 0.055 1.158 ± 0.068 C30 1 2 57 0.23 ± 0.054 1.486 ± 0.053 0.970 ± 0.036 C31 1 2 71 0.18 ± 0.000 1.808 ± 0.109 1.251 ± 0.101 C32 1 1 52 0.16 ± 0.014 2.001 ± 0.091 1.228 ± 0.039 C33 1 1 71 0.15 ± 0.028 1.586 ± 0.200 1.616 ± 0.128 C34 1 1 59 0.19 ± 0.002 1.072 ± 0.103 0.935 ± 0.069 C35 1 1 73 0.18 ± 0.003 1.292 ± 0.186 1.003 ± 0.178 C36 1 1 43 0.14 ± 0.006 1.163 ± 0.084 0.924 ± 0.071 6
C37 1 2 43 0.14 ± 0.008 1.325 ± 0.030 1.175 ± 0.086 C38 1 1 51 0.16 ± 0.005 1.135 ± 0.042 0.818 ± 0.007 C39 1 1 57 0.20 ± 0.067 1.551 ± 0.104 1.098 ± 0.083 C40 1 1 52 0.14 ± 0.026 1.260 ± 0.160 1.138 ± 0.047 C41 1 1 54 0.21 ± 0.035 1.206 ± 0.061 0.893 ± 0.057 C42 1 1 52 0.28 ± 0.001 1.355 ± 0.047 1.025 ± 0.129 C43 1 1 62 0.15 ± 0.024 1.173 ± 0.010 1.179 ± 0.047 C44 1 1 55 0.15 ± 0.020 1.511 ± 0.041 0.860 ± 0.019 C45 1 1 42 0.16 ± 0.022 1.539 ± 0.185 1.101 ± 0.135 C46 1 1 61 0.20 ± 0.005 1.133 ± 0.030 0.882 ± 0.018 C47 1 1 51 0.16 ± 0.023 1.452 ± 0.087 1.448 ± 0.087 C48 1 2 69 0.16 ± 0.015 1.309 ± 0.130 1.535 ± 0.113 C49 1 1 60 0.13 ± 0.001 1.241 ± 0.079 1.137 ± 0.070 C50 1 1 57 0.12 ± 0.015 1.662 ± 0.113 1.224 ± 0.086 C51 1 1 55 0.15 ± 0.032 1.570 ± 0.190 1.581 ± 0.048 C52 1 1 60 0.13 ± 0.027 0.932 ± 0.082 1.093 ± 0.156 C53 1 1 62 0.16 ± 0.004 1.471 ± 0.146 1.061 ± 0.097 C54 1 2 77 0.17 ± 0.015 1.517 ± 0.116 1.385 ± 0.068 C55 1 1 65 0.15 ± 0.022 1.215 ± 0.041 0.703 ± 0.035 C56 1 2 71 0.15 ± 0.026 1.017 ± 0.043 1.058 ± 0.087 C57 1 2 79 0.22 ± 0.018 1.695 ± 0.308 0.791 ± 0.079 C58 1 2 64 0.20 ± 0.028 1.406 ± 0.071 1.145 ± 0.216 C59 1 2 59 0.23 ± 0.033 0.954 ± 0.074 1.109 ± 0.147 C60 1 2 80 0.17 ± 0.017 1.150 ± 0.037 0.804 ± 0.080 C61 1 2 75 0.21 ± 0.001 1.352 ± 0.085 1.506 ± 0.059 C62 1 2 69 0.18 ± 0.015 0.814 ± 0.038 1.295 ± 0.097 C63 1 1 64 0.20 ± 0.085 1.698 ± 0.293 1.401 ± 0.103 C64 1 2 64 0.17 ± 0.004 0.844 ± 0.045 1.320 ± 0.134 C65 1 1 76 0.15 ± 0.003 1.227 ± 0.085 0.810 ± 0.062 C66 1 1 66 0.25 ± 0.031 1.385 ± 0.134 0.889 ± 0.062 C67 1 2 42 0.15 ± 0.001 0.912 ± 0.127 2.007 ± 0.198 C68 1 2 63 0.22 ± 0.005 1.061 ± 0.049 1.194 ± 0.203 C69 1 1 72 0.15 ± 0.014 1.115 ± 0.164 0.817 ± 0.153 C70 1 1 64 0.16 ± 0.015 0.815 ± 0.030 0.818 ± 0.079 C71 1 1 75 0.21 ± 0.006 0.717 ± 0.086 0.784 ± 0.082 C72 1 2 61 0.16 ± 0.005 0.705 ± 0.019 0.986 ± 0.025 C73 1 2 69 0.14 ± 0.002 0.983 ± 0.091 1.292 ± 0.157 C74 1 1 44 0.22 ± 0.026 1.029 ± 0.099 0.758 ± 0.068 C75 1 1 40 0.13 ± 0.008 0.877 ± 0.058 0.458 ± 0.057 C76 1 1 42 0.15 ± 0.013 0.740 ± 0.113 0.650 ± 0.017 C77 1 1 52 0.18 ± 0.014 0.509 ± 0.050 0.462 ± 0.047 C78 1 2 76 0.16 ± 0.0002 0.575 ± 0.078 0.453 ± 0.050 C79 1 1 43 0.16 ± 0.009 0.502 ± 0.023 1.617 ± 0.084 7
C80 1 2 47 0.16 ± 0.010 0.439 ± 0.026 0.198 ± 0.037 C81 1 2 44 0.18 ± 0.002 0.933 ± 0.066 0.504 ± 0.113 C82 1 1 26 0.15 ± 0.003 0.482 ± 0.024 0.616 ± 0.137 C83 1 2 59 0.14 ± 0.022 1.321 ± 0.133 0.851 ± 0.076 C84 1 1 54 0.17 ± 0.007 0.520 ± 0.037 0.706 ± 0.283 C85 1 1 46 0.21 ± 0.040 0.654 ± 0.052 0.546 ± 0.044 C86 1 1 57 0.14 ± 0.011 0.799 ± 0.110 1.155 ± 0.026 C87 1 2 57 0.16 ± 0.029 0.553 ± 0.003 0.526 ± 0.036 C88 1 1 49 0.20 ± 0.009 1.228 ± 0.028 0.784 ± 0.050 C89 1 2 34 0.19 ± 0.040 0.600 ± 0.081 0.413 ± 0.043 C90 1 2 54 0.15 ± 0.012 1.041 ± 0.216 0.801 ± 0.034 C91 1 1 57 0.17 ± 0.012 0.767 ± 0.096 0.642 ± 0.067 C92 1 1 32 0.14 ± 0.010 0.934 ± 0.218 0.491 ± 0.020 a Group: 1, Control subjects; 2, T2DM. b Gender: 1, Male; 2, Female. c Relative mrna expression level of ALKBH5 gene. d Relative mrna expression level of FTO gene. 8
Supplemental Table 2. Primers used for qpcr. Primers were designed to target the location of exon/intron junction to avoid the amplification of contaminated DNA. Genes ALKBH5 (human) FTO (human) GAPDH (human) β-actin (human) ALKBH5 (Rat) FTO (Rat) GAPDH (Rat) β-actin (Rat) Primers (5 3 ) Forward: AGGGGAAGCGTGACTGTGC Reverse: GGGTGCATCTAATCTTGTCTTCC Forward: CTTCACCAAGGAGACTGCTATTTC Reverse: CAAGGTTCCTGTTGAGCACTCTG Forward: TCTATAAATTGAGCCCGCAGC Reverse: CCAATACGACCAAATCCGTTG Forward: CCAGCTCCTCCCTGGAGAAG Reverse: ACAGGACTCCATGCCCAGG Forward: CAGTGGGTATGCTGCTGATG Reverse: GGGTCTCTGGTGTTTCCTGA Forward: GGCTGTGGAAGAAGATGGAG Reverse: TGCTGTGCTGGTAGAGTTCG Forward: TTCCAGTATGACTCTACCCACGGCA Reverse: GCACCAGCATCACCCCATTTG Forward: AGGGTGTGATGGTGGGTATGGGT Reverse: GTGGTGCCAAATCTTCTCCATATCG Amplicon Length 123 bp 129 bp 151 bp 122 bp 186 bp 190 bp 137 bp 143 bp 9
Supplemental Table 3. Primers used for HRM and DNA sequencing. FTO SNPs Primers (5 3 ) rs1121980 HRM Forward: AGGCAGGTGGATCTGAAA Reverse: TCCTAGTCACGTGTCTTGG DNA Forward: AGCTGGACCTGAACAAGG sequencing Reverse: AAGGCACAATAAGAGGAGAT Amplicon Length 49 bp 301 bp rs7202116 HRM Forward: CATCTGTAAGTCTGGTATATCTAACTAAT Reverse: CATGCTACACAGTCTAAGATGAAAG DNA Forward: AGGAGAAGCCTGATTGTTCC sequencing Reverse: TCTGGGTTTGCTCTTCCATAA 65 bp 311 bp rs8050136 HRM Forward: TTGCCCACTGTGGCAAT Reverse: AGTCCATCTCTACAGTTTACCTAAG DNA Forward: CCCAGACAAGTGCCCGTAT sequencing Reverse: GAGGTGCCATTCCTCAAT 67 bp 425 bp rs9939609 DNA Forward: CGCTGCTATGGTTCTACAGTTC 491 bp sequencing Reverse: GCCCAAGGATGGTGTTTCTA 10
Supplemental Table 4. Linearity, LOD and LOQ of m 6 A by LC-ESI-MS/MS. Analyte Linear range (m 6 A/rA, %) Slope Regression line Intercept R 2 LOD (fmol) LOQ (fmol) m 6 A 0.05-5 0.0322 ± 0.0003 0.0008 ± 0.0001 0.9982 1.2 4.0 11
Supplemental Table 5. The preparation of the quality control (QC) samples with the synthesized m 6 A-containing oligonucleotides. Methylation level m 6 A/A (%) Molar ratio (%) RNA standard 1 RNA Standard 2 0.100 99.7 0.3 0.200 99.4 0.6 0.300 99.1 0.9 RNA standard 1 (10-mer RNA) RNA standard 2 (15-mer RNA) 5 -AUCUAUAUGC-3 5 - UAAUAC(m 6 A)GAGAAAUC-3 12
Supplemental Table 6. Accuracy and precision for the detection of m 6 A. Nominal [m 6 A]/[A]% QC samples 0.05 0.10 0.20 0.50 1.00 2.00 5.00 0.10 0.20 0.30 Day 1 n=3 Measured mean 0.05 0.10 0.19 0.49 1.04 2.04 4.96 0.09 0.22 0.29 [m 6 A]/[A]% RSD a (%) 7.8 3.7 2.4 7.7 4.7 1.2 1.3 3.7 4.7 0.4 RE b (%) 7.7-0.5-6.4-2.9 4.4 2.1-0.9-8.8 8.3-4.4 Day 2 n=3 Measured mean 0.04 0.09 0.18 0.45 0.92 2.13 5.48 0.09 0.20 0.30 [m 6 A]/[A]% RSD (%) 11.2 1.8 4.6 3.7 7.6 3.4 4.2 4.8 2.7 2.4 RE (%) -11.5-8.1-10.0-9.2-7.9 6.5 9.6-11.2-0.2-1.4 Day 3 n=3 Measured mean 0.05 0.10 0.22 0.55 1.09 1.99 4.67 0.11 0.19 0.28 [m 6 A]/[A]% RSD (%) 6.7 3.1 4.0 3.3 5.8 2.2 1.6 7.1 0.8 2.8 RE (%) -5.8 2.7 9.7 9.0 9.4-0.7-6.6 5.6-4.3-5.9 a Relative standard deviation. b Relative error. QC, quality control. 13
Supplemental Table 7. Risk estimation based on the distributions of genotype and allele frequency of FTO SNPs Model Genotype Controls n (%) T2DMs n (%) OR a (95% CI) P AIC BIC rs1121980 Codominant CC 60 (75.0) 60 (68.2) 1.00 CT 17 (21.2) 26 (29.6) 1.53 (0.75-3.12) 0.41 240.7 256.3 TT 3 (3.8) 2 (2.3) 0.64 (0.10-4.04) Dominant CC 60 (75.0) 60 (68.2) 1.00 CT+TT 20 (25.0) 28 (31.8) 1.40 (0.71-2.75) 0.33 239.5 252 Recessive CC+CT 77 (96.2) 86 (97.7) 1.00 TT 3 (3.8) 2 (2.3) 0.58 (0.09-3.60) 0.55 240 252.6 Overdominant CC+TT 63 (78.8) 62 (70.5) 1.00 CT 17 (21.2) 26 (29.6) 1.56 (0.77-3.16) 0.21 238.9 251.4 Addictive 1.21 (0.68-2.17) 0.52 240 252.5 Allele C 137 (85.6) 146 (83.0) 1.00 T 23 (14.4) 30 (17.0) 1.22(0.68-2.21) 0.56 rs7202116 Codominant AA 63 (78.8) 66 (75.9) 1.00 AG 14 (17.5) 17 (19.5) 1.16 (0.53-2.55) 0.91 241 256.5 GG 3 (3.8) 4 (4.6) 1.26 (0.27-5.88) Dominant AA 63 (78.8) 66 (75.9) 1.00 AG+GG 17 (21.2) 21 (24.1) 1.18 (0.57-2.43) 0.66 239 251.4 Recessive AA+AG 77 (96.20) 83 (95.4) 1.00 GG 3 (3.8) 4 (4.6) 1.23 (0.26-5.68) 0.79 239.1 251.6 Overdominant AA+GG 66 (82.5) 70 (80.5) 1.00 AG 14 (17.5) 17 (19.5) 1.14 (0.52-2.51) 0.74 239 251.5 Addictive 1.14 (0.64-2.03) 0.66 239 251.4 Allele A 140 (87.5) 149 (85.6) 1.00 G 20 (12.5) 25 (14.4) 1.17(0.63-2.21) 0.63 rs8050136 Codominant CC 65 (81.2) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.48 (0.68-3.24) 0.14 238.5 254.1 AA 2 (2.5) 0 (0) 0.00 (0.00-NA) Dominant CC 65 (81.2) 68 (77.3) 1.00 AC+AA 15 (18.8) 20 (22.7) 1.27 (0.60-2.70) 0.53 240.1 252.6 Recessive CC+AC 78 (97.5) 88 (100) 1.00 AA 2 (2.5) 0 (0) 0.00 (0.00-NA) 0.082 237.4 249.9 Overdominant CC+AA 67 (83.8) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.52 (0.69-3.32) 0.29 239.4 251.8 Addictive 1.07 (0.54-2.14) 0.84 240.4 252.9 Allele C 143 (89.4) 156 (88.6) 1.00 0.86 14
A 17 (10.6) 20 (11.4) 1.08(0.54-2.14) rs9939609 Codominant TT 64 (80.0) 66 (75.0) 1.00 AT 15 (18.8) 22 (25.0) 1.42 (0.68-2.99) 0.3 240 255.7 AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Dominant TT 64 (80.0) 66 (78.8) 1.00 AT+AA 16 (20.0) 22 (75.0) 1.33 (0.64-2.76) 0.44 239.9 252.4 Recessive TT+AT 79 (98.8) 88 (100.0) 1.00 0.22 238.9 251.4 AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Overdominant TT+AA 65 (81.2) 66 (75.0) 1.00 0.33 239.5 252 AT 15 (18.8) 22 (75.0) 1.44 (0.69-3.03) Addictive 1.22 (0.60-2.45) 0.58 240.2 252.7 Allele A 143 (89.4) 154 (87.5) 1.00 0.61 T 17 (10.6) 22 (12.5) 1.20(0.61-2.35) T2DM, Type 2 diabetes mellitus; OR, odds ratio; CI, confidence interval; AIC, Akaike Information Criterion; BIC, Bayesian Information Criterion. NA, not available a Adjusted for age and gender. 15
Supplemental Figure 1. Oxidative demethylation of m 6 A to adenosine in RNA by FTO or ALKBH5 in the presence of Fe(II) and α-kg. 16
Supplemental Figure 2. The MRM chromatograms of nucleosides. (A) Standard nucleosides. (B) 20 ng RNA from human peripheral blood. Shown in inset is the enlargement chromatogram of m 6 A. Experimental conditions: separation column, Hisep C18-T column; temperature, 35 C; flow rate, 0.2 ml/min; mobile phase, a mixture of formic acid in water (0.1%, v/v, solvent A) and a mixture of 0.1% formic acid in methanol (v/v, solvent B); gradient elution, 5 min 5% B, 10 min 5-30% B, 5 min 30-50% B, 3 min 50% B-5% B and 17 min 5% B. 17
Supplemental Figure 3. The genotyping results of high-resolution melting and DNA sequencing for the common four SNPs in FTO gene. (A) Three genotypes of rs1121980, rs7202116 and rs8050136 by high-resolution melting. (B)-(E) Three genotypes of rs1121980, rs7202116, rs8050136 and rs9939609 by DNA sequencing. 18
Supplemental Figure 4. The standard curves, amplification plots and melting peaks of qpcr for ALKBH5, FTO, β-actin and GAPDH. ALKBH5 19
FTO 20
β-actin 21
GAPDH 22
Supplemental Figure 5. Gel electrophoresis of qpcr products for ALKBH5, FTO, β-actin and GAPDH. 23