ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS).

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS)."

Transcript

1 ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS). ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ Επικ. Καθηγητής Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ ΚΑΘ. Α. ΑΝΤΣΑΚΛΗΣ

2 ΜΕΛΛΟΝΤΙΚΟΙ ΣΤΟΧΟΙ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ ΚΑΛΥΤΕΡΟ ΑΠΟΤΕΛΕΣΜΑ. ΕΜΒΡΥΟΜΕΤΑΦΟΡΑ ΕΝΟΣ ΕΜΒΡΥΟΥ ΜΕ ΠΟΣΟΣΤΟ ΕΠΙΤΥΧΙΑΣ 80%. ΑΠΛΑ ΠΡΩΤΟΚΟΛΛΑ ΠΡΟΚΛΗΣΗΣ. ΕΞΕΤΑΣΗ ΤΟΥ ΕΜΒΡΥΟΥ ΜΕ ΜΗ ΕΠΕΜΒΑΤΙΚΕΣ ΜΕΘΟΔΟΥΣ. IN VITRO ΩΡΙΜΑΝΣΗ ΩΑΡΙΩΝ. ΚΑΤΑΨΥΞΗ ΩΟΘΗΚΙΚΟΥ ΙΣΤΟΥ, ΩΑΡΙΩΝ. ΕΜΒΡΥΪΚΑ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ. ΔΗΜΙΟΥΡΓΙΑ ΓΑΜΕΤΩΝ.

3 IN VITRO FERTILIZATION (IVF) Oocyte Sperm Fertilized Egg/Zygote Blastocyst (5 days) Over a million such babies already born Implantation Frozen blastocysts in excess of clinical needs Embryonic Stem Cells

4 ΕΜΒΡΥΪΚΑ ΑΡΧΕΓΟΝΑ ΚΥΤΤΑΡΑ ΤΑ ΕΜΒΡΥΪΚΑ ΑΡΧΕΓΟΝΑ ΚΥΤΤΑΡΑ ΠΡΟΕΡΧΟΝΤΑΙ ΑΠΟ ΤΗΝ ΕΣΩ ΚΥΤΤΑΡΙΚΗ ΜΑΖΑ ΑΝΑΠΤΥΣΣΟΜΕΝΩΝ ΒΛΑΣΤΟΚΥΣΤΕΩΝ. ΕΝΑ ΤΕΤΟΙΟΥ ΕΙΔΟΥΣ ΚΥΤΤΑΡΟ ΕΙΝΑΙ ΑΥΤΟΑΝΑΝΕΩΣΙΜΟ (ΜΠΟΡΕΙ ΝΑ ΠΟΛΛΑΠΛΑΣΙΑΣΤΕΙ), ΠΟΛΥΔΥΝΑΜΟ (ΜΠΟΡΕΙ ΝΑ ΣΧΗΜΑΤΙΣΕΙ ΟΛΟΥΣ ΤΟΥ ΚΥΤΤΑΡΙΚΟΥΣ ΤΥΠΟΥΣ ΠΟΥ ΑΠΑΝΤΩΝΤΑΙ ΣΤΟ ΣΩΜΑ) ΚΑΙ ΘΕΩΡΗΤΙΚΑ ΕΙΝΑΙ ΑΘΑΝΑΤΟ.

5

6 GENERATION OF EMBRYONIC STEM CELLS

7 ΕΣΩ ΣΤΙΒΑΔΑ ΒΛΑΣΤΟΚΥΣΤΗΣ

8 ΛΗΨΗ ΕΣΩ ΣΤΙΒΑΔΑΣ ΒΛΑΣΤΟΚΥΣΤΗΣ

9 ΕΝΑΠΟΘΕΣΗ ΣΕ ΙΝΟΒΛΑΣΤΕΣ

10 ΘΕΡΑΠΕΥΤΙΚΗ ΧΡΗΣΗ ΤΩΝ STEM CELLS ΣΗΜΕΡΑ

11

12

13 ΑΝΑΓΕΝΝΗΤΙΚΗ ΙΑΤΡΙΚΗ ΙΑΤΡΙΚΕΣ ΠΑΡΕΜΒΑΣΕΙΣ ΠΟΥ ΣΤΟΧΕΥΟΥΝ ΣΤΟ ΝΑ ΑΠΟΚΑΤΑΣΤΗΣΟΥΝ ΚΑΤΕΣΤΡΑΜΜΕΝΑ ΟΡΓΑΝΑ, ΚΥΡΙΩΣ ΜΕ ΤΗ ΧΡΗΣΗ ΑΡΧΕΓΟΝΩΝ ΚΥΤΤΑΡΩΝ ΓΙΑ ΝΑ ΑΝΑΝΕΩΣΟΥΝ ΚΥΤΤΑΡΑ ΚΑΙ ΙΣΤΟΥΣ ΠΟΥ ΚΑΤΑΣΤΡΑΦΗΚΑΝ ΑΠΟ ΤΗ ΓΗΡΑΝΣΗ ΚΑΙ ΑΠΟ ΑΣΘΕΝΕΙΕΣ.

14 HUMAN STEM CELLS EMBRYONIC ADULT UMBILICAL CORD GERM STEM CELLS AMNIOTIC FLUID

15 ΔΗΜΙΟΥΡΓΙΑ ΓΑΜΕΤΩΝ ΑΠΟ ΕΜΒΡΥΪΚΑ STEM (ES) CELLS Inner Cell Mass Blastocyst (5 days) Embryonic Stem Cells Culture in vitro Appropriate Growth Factors (Azim Azim S, Nature 2004;427: ). 107). GERM Stem Cells

16 ΔΗΜΙΟΥΡΓΙΑ ΓΑΜΕΤΩΝ ΔΙΑΦΟΡΟΠΟΙΗΣΗ ΕΜΒΡΥΪΚΩΝ STEM CELLS ΣΕ ΩΑΡΙΟ. (Hϋbner K, et al. Science 2003). ΔΙΑΦΟΡΟΠΟΙΗΣΗ ΕΜΒΡΥΪΚΩΝ STEM CELLS ΣΕ ΣΠΕΡΜΑΤΟΖΩΑΡΙΟ. (Geijsen N, et al. Nature 2004). HAW TO MAKE EGGS AND SPERM. (Azim S, Nature 2004;427: ). 107).

17 ΓΑΜΕΤΕΣ ΜΕ ΤΗ ΒΟΗΘΕΙΑ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ. ΤΟΣΟ ΤΑ ΩΑΡΙΑ ΟΣΟ ΚΑΙ ΤΑ ΣΠΕΡΜΑΤΟΖΩΑΡΙΑ ΠΟΥ ΕΧΟΥΝ ΚΑΛΛΙΕΡΓΗΘΕΙ ΣΤΟ ΕΡΓΑΣΤΗΡΙΟ ΕΙΝΑΙ ΣΤΟ ΠΟΝΤΙΚΙ. ΟΙ ΜΟΡΦΕΣ ΑΥΤΕΣ ΜΕΧΡΙ ΤΩΡΑ ΕΧΟΥΝ ΔΩΣΕΙ ΑΡΧΙΚΕΣ ΜΟΡΦΕΣ ΕΜΒΡΥΟΥ ΟΤΑΝ ΧΡΗΣΙΜΟΠΟΙΗΘΗΚΑΝ ΓΙΑ ΓΟΝΙΜΟΠΟΙΗΣΗ. ΜΕΧΡΙ ΣΗΜΕΡΑ ΔΕΝ ΥΠΑΡΧΕΙ ΑΝΑΦΟΡΑ ΓΕΝΝΗΣΗΣ ΕΜΒΡΥΟΥ ΑΠΟ ΧΡΗΣΙΜΟΠΟΙΗΣΗ ΤΕΧΝΙΤΩΝ ΓΑΜΕΤΩΝ.

18 *TRANSDIFFERENTATION*- ΜΕΤΑΔΙΑΦΟΡΟΠΟΙΗΣΗ Η ΙΚΑΝΟΤΗΤΑ ΕΝΟΣ ΣΥΓΚΕΚΡΙΜΕΝΟΥ ΚΥΤΤΑΡΟΥ ΕΝΟΣ ΙΣΤΟΥ, ΟΡΓΑΝΟΥ Η ΣΥΣΤΗΜΑΤΟΣ, ΣΥΜΠΕΡΙΛΑΜΒΑΝΟΜΕΝΩΝ ΑΡΧΕΓΟΝΩΝ Η ΠΡΟΓΟΝΙΚΩΝ ΚΥΤΤΑΡΩΝ, ΝΑ ΔΙΑΦΟΡΟΠΟΙΟΥΝΤΑΙ ΣΕ ΕΙΔΗ ΚΥΤΤΑΡΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΕΝΟΣ ΑΛΛΟΥ ΙΣΤΟΥ, ΟΡΓΑΝΟΥ, Η ΣΥΣΤΗΜΑΤΟΣ; Π.Χ. ΑΡΧΕΓΟΝΑ ΑΙΜΟΠΟΙΗΤΙΚΑ ΠΟΥ ΜΕΤΑΤΡΕΠΟΝΤΑΙ ΣΕ ΗΠΑΤΟΚΥΤΤΑΡΑ.

19 PLASTICITY OF ADULT STEM CELLS

20 ΔΗΜΙΟΥΡΓΙΑ ΩΑΡΙΩΝ ΑΠΟ ΕΝΗΛΙΚΑ STEM CELLS. Dyce P W, et al.nature cell biology, 2006.

21 ΕΦΑΡΜΟΓΕΣ ΤΩΝ ΓΑΜΕΤΩΝ ΠΟΥ ΠΡΟΕΡΧΟΝΤΑΙ ΑΠΟ ΤΗΝ ΔΙΑΦΟΡΟΠΟΙΗΣΗ ΤΩΝ STEM CELLS ΔΗΜΙΟΥΡΓΙΑ ΒΛΑΣΤΟΚΥΣΤΕΩΝ ΚΑΙ ΜΕΤΕΤΕΠΕΙΤΑ ΠΟΛΛΑΠΛΩΝ ΣΕΙΡΩΝ ΕΜΒΡΥΪΚΩΝ ΠΟΛΥΔΥΝΑΜΩΝ ΚΥΤΤΑΡΩΝ. ΜΕΛΕΤΗ ΜΗΧΑΝΙΣΜΩΝ ΚΑΡΚΙΝΟΓΕΝΝΕΣΗΣ ΤΟΣΟ ΣΤΙΣ ΩΟΘΗΚΕΣ ΟΣΟ ΚΑΙ ΣΤΟΥΣ ΟΡΧΕΙΣ. ΜΕΛΕΤΗ ΕΚΦΡΑΣΗΣ ΔΙΑΦΟΡΩΝ ΓΟΝΙΔΙΩΝ ΚΑΙ ΝΕΕΣ ΑΝΑΚΑΛΥΨΕΙΣ ΣΤΗΝ ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ.

22 ΗΘΙΚΟ ΔΙΛΗΜΜΑ. ΕΙΝΑΙ ΛΙΓΟΤΕΡΟ ΑΝΗΘΙΚΟ ΝΑ ΚΑΤΑΣΤΡΕΦΕΤΑΙ ΕΝΑ ΕΜΒΡΥΟ ΠΟΥ ΕΧΕΙ ΠΡΟΕΛΘΕΙ ΑΠΟ ΤΕΧΝΗΤΟΥΣ ΓΑΜΕΤΕΣ ΑΠΟ ΕΝΑ ΕΜΒΡΥΟ ΠΟΥ ΕΧΕΙ ΠΡΟΕΛΘΕΙ ΑΠΟ ΔΩΡΕΑ ΑΠΟ ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ?? ΚΑΤΑ ΠΑΡΑΓΓΕΛΙΑ ΔΗΜΙΟΥΡΓΙΑ ΓΑΜΕΤΩΝ (ΓΕΝΕΤΙΚΕΣ ΠΑΡΕΜΒΑΣΕΙΣ).

23 ΤΕΧΝΗΤΟΙ ΓΑΜΕΤΕΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΗΣ ΣΤΕΙΡΟΤΗΤΑΣ. ΑΝΔΡΙΚΗ ΣΤΕΙΡΟΤΗΣ. ΓΥΝΑΙΚΕΙΑ ΣΤΕΙΡΟΤΗΣ. ΔΩΡΕΑ ΩΑΡΙΩΝ.

24 ΜΠΟΡΕΙ ΤΟ ΕΜΒΡΥΪΚΟ ΠΟΛΥΔΥΝΑΜΟ ΚΥΤΤΑΡΟ ΝΑ ΓΙΝΕΙ ΓΟΝΙΟΣ???? ΜΕ ΤΗΝ ΤΕΛΕΙΟΠΟΙΗΣΗ ΤΗΣ ΕΡΕΥΝΑΣ ΤΕΧΝΗΤΟΙ ΓΑΜΕΤΕΣ ΘΑ ΜΠΟΡΟΥΝ ΝΑ ΔΩΣΟΥΝ ΕΜΒΡΥΑ ΠΟΥ ΘΑ ΓΕΝΝΗΘΟΥΝ. ΟΙ ΣΕΙΡΕΣ ΤΩΝ ΕΜΒΡΥΪΚΩΝ ΠΟΛΥΔΥΝΑΜΩΝ ΚΥΤΤΑΡΩΝ ΘΑ ΠΡΕΠΕΙ ΝΑ ΔΙΑΧΩΡΙΖΟΝΤΑΙ ΩΣΤΕ ΝΑ ΔΙΝΟΥΝ ΔΙΑΦΟΡΕΤΙΚΕΣ ΣΕΙΡΕΣ ΩΑΡΙΑ ΚΑΙ ΔΙΑΦΟΡΕΤΙΚΕΣ ΣΕΙΡΕΣ ΝΑ ΔΙΝΟΥΝ ΣΠΕΡΜΑΤΟΖΩΑΡΙΑ???

25 ΕΡΓΑΣΤΗΡΙΟ STEM CELLS ΝΟΣΟΚΟΜΕΙΟ ΑΛΕΞΑΝΔΡΑ

26 ΕΡΕΥΝΗΤΙΚΑ ΠΡΩΤΟΚΟΛΛΑ ΕΡΓΑΣΤΗΡΙΟΥ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΑΝΑΓΕΝΝΗΤΙΚΗΣ ΙΑΤΡΙΚΗΣ Α ΜΑΙΕΥΤΙΚΗΣ ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ. ΚΑΛΛΙΕΡΓΕΙΑ STEM CELLS ΑΠΌ ΚΥΤΤΑΡΑ ΑΜΝΙΑΚΟΥ ΥΓΡΟΥ ΠΑΡΑΓΩΓΗ ΚΑΙ ΙΔΙΟΤΗΤΕΣ ΙΝΟΒΛΑΣΤΩΝ ΑΠΟ ΚΥΤΤΑΡΑ ΑΜΝΙΑΚΟΥ ΥΓΡΟΥ ΕΚΦΡΑΣΗ ΤΟΥ ΥΠΟΔΟΧΕΑ ΤΗΣ ΩΚΥΤΟΚΙΝΗΣ ΣΤΑ ΚΥΤΤΑΡΑ ΑΜΝΙΑΚΟΥ ΥΓΡΟΥ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΝΕΒΕΡΑΠΙΝΗΣ ΣΕ ΚΑΛΛΙΕΡΓΕΙΑ ΚΑΡΚΙΝΙΚΩΝ ΚΥΤΤΑΡΩΝ ΤΟΥ ΤΡΑΧΗΛΟΥ ΤΗΣ ΜΗΤΡΑΣ ΚΑΛΛΙΕΡΓΕΙΑ ΚΥΤΤΑΡΩΝ ΕΝΔΟΜΗΤΡΙΩΣΕΩΣ

27 EMBRYONIC- LIKE STEM CELL

28

29 OTR AND RT-PCR a b c 95 for 1 390bp 60 for 1 72 for1 40 cycles And 72 for 10 minutes Otr1:CCTTCATCGTGTGCTGGACG Otr2:CTAGGAGCAGAGCACTTATG

30 ΣΥΜΠΕΡΑΣΜΑΤΑ 1. Τα εμβρυϊκά πολυδύναμα κύτταρα φαίνεται να έχουν εξαιρετικές προοπτικές στην ιατρική επιστήμη. 2. Η χρησιμοποίηση τους στην κλινική πράξη θα πραγματοποιηθεί εφόσον αρκετές ιδιότητες τους διευκρινισθούν πλήρως.

31 ΣΥΜΠΕΡΑΣΜΑΤΑ 3. ΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΥΠΑΡΧΟΥΝ ΚΑΙ ΘΑ ΥΠΑΡΧΟΥΝ ΩΣ ΠΡΟΣ ΤΗΝ ΠΡΟΕΛΕΥΣΗ ΤΟΥΣ. 4. Η ΔΗΜΙΟΥΡΓΙΑ ΓΑΜΜΕΤΩΝ ΑΠΟ ΤΑ ΕΜΒΡΥΙΚΑ STEM CELLS ΦΑΙΝΕΤΑΙ ΟΤΙ ΘΑ ΕΙΝΑΙ Η ΝΕΑ ΕΠΑΝΑΣΤΑΣΗ ΣΤΗΝ ΑΝΘΡΩΠΙΝΗ ΑΝΑΠΑΡΑΓΩΓΗ Z. Master Embryonic stem-cell gametes: the new frontier in human reproduction Hum. Reprod., April 1, 2006; 21(4): [Abstract] [Full Text] [PDF]

32 ΣΥΜΠΕΡΑΣΜΑΤΑ 5. Η ΧΡΗΣΙΜΟΠΟΙΗΣΗ ΤΩΝ ΓΑΜΕΤΩΝ ΠΟΥ ΕΧΟΥΝ ΠΡΟΕΛΘΕΙ ΑΠΟ ΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΩΝ ΠΟΛΥΔΥΝΑΜΩΝ ΚΥΤΤΑΡΩΝ ΕΓΕΙΡΕΙ ΠΟΛΛΑ ΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΙ ΟΙ ΚΑΝΟΝΕΣ ΓΙΑ ΤΗΝ ΕΡΕΥΝΑ ΣΤΟ ΣΥΓΚΕΚΡΙΜΕΝΟ ΤΟΜΕΑ ΘΑ ΠΡΕΠΕΙ ΝΑ ΤΕΘΟΥΝ.

33 EMBRYONIC- LIKE STEM CELLS THANK YOU FOR YOUR ATTENTION

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας ΔΙΑΛΕΞΕΙΣ ΜΑΘΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑ ΙΙ Βλαστοκύτταρα Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Βλαστοκύτταρα: Κατανόηση βασικών βιολογικών διαδικασιών I.Ανάπτυξη II.Επιδιόρθωση/Αναγέννηση III.Καρκίνος

Διαβάστε περισσότερα

Στο Εργαστήριο Υποβοηθούμενης Αναπαραγωγής προσφέρονται διαγνωστικές εξετάσεις που σχετίζονται με την ανδρική υπογονιμυπογονημότηταότητα όπως:

Στο Εργαστήριο Υποβοηθούμενης Αναπαραγωγής προσφέρονται διαγνωστικές εξετάσεις που σχετίζονται με την ανδρική υπογονιμυπογονημότηταότητα όπως: Σ. Κονιδάρης Αν. Καθηγητής Μαιευτικής Γυναικολογίας Στ. Μπάκα Επ. Καθηγήτρια Βιοπαθολογίας Π. Βάκας Επ. Καθηγητής Μαιευτικής Γυναικολογίας Δ. Τζανακάκη Κλινική Εμβρυολόγος Στο Τμήμα Υποβοηθούμενης Αναπαραγωγής

Διαβάστε περισσότερα

Αναγεννητική Ιατρική Ηθικοί προβληματισμοί στις θεραπείες με

Αναγεννητική Ιατρική Ηθικοί προβληματισμοί στις θεραπείες με Αναγεννητική Ιατρική Ηθικοί προβληματισμοί στις θεραπείες με χρήση βλαστικών κυττάρων Χαρακτηριστικά βλαστικών κυττάρων 1. Ικανότητα να διαφοροποιούνται σε διαφορετικούς κυτταρικούς τύπους 2. Ικανότητα

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Οικογενειακή κατάσταση: Έγγαμος με την Αναστασία Παπαδοπούλου (Δικηγόρος)

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Οικογενειακή κατάσταση: Έγγαμος με την Αναστασία Παπαδοπούλου (Δικηγόρος) ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Όνομα: Γεώργιος - Σπυρίδων Επώνυμο: Ανυφαντής Όνομα πατρός: Ματθαίος Όνομα μητρός: Ζωή Έτος γέννησης: 20-12-1974 Τόπος γέννησης: Αθήνα Αττικής Οικογενειακή κατάσταση: Έγγαμος με την

Διαβάστε περισσότερα

Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες:

Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες: Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες: Πολυδύναμα - Pluripotent Εμβρυονικά Βλαστικά κύτταρα - Embryonic Stem Cells Ολιγοδύναμα - Multipotent Βλαστικά κύτταρα (ώριμων/εμβρυικών)

Διαβάστε περισσότερα

Αρχικά αδιαφοροποίητο κύτταρο που έχει την ικανότητα να διαφοροποιείται σε ιστικά εξειδικευμένους κυτταρικούς τύπους.

Αρχικά αδιαφοροποίητο κύτταρο που έχει την ικανότητα να διαφοροποιείται σε ιστικά εξειδικευμένους κυτταρικούς τύπους. Βλαστικό κύτταρο Αρχικά αδιαφοροποίητο κύτταρο που έχει την ικανότητα να διαφοροποιείται σε ιστικά εξειδικευμένους κυτταρικούς τύπους. Έτσι είναι σε θέση να δρα επισκευαστικά, αναδημιουργώντας κύτταρα

Διαβάστε περισσότερα

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α.

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΑΝΤΣΑΚΛΗΣ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Η ανικανότητα σύλληψης μετά από ένα χρόνο σεξουαλικών

Διαβάστε περισσότερα

Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκό Έτος 2012-2013

Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκό Έτος 2012-2013 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «ΒΙΟΛΟΓΙΑ ΤΗΣ ΑΝΑΠΑΡΑΓΩΓΗΣ» Βιόπολις, 41110 Λάρισα E-mail: messinis@med.uth.gr Τηλ. 2413502795, 2413502796 Fax.

Διαβάστε περισσότερα

Αλέξανδρος Δ. Τζεφεράκος

Αλέξανδρος Δ. Τζεφεράκος Κλασσική Εξωσωματική Γονιμοποίηση και Εμβρυομεταφορά στο στάδιο της βλαστοκύστης Αλέξανδρος Δ. Τζεφεράκος «ΜΟΝΑΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΙΑΤΡΙΚΗΣ» μαιευτήρια «ΜΗΤΕΡΑ» και «ΛΗΤΩ» 2002 Κατά τη διαδικασία της εξωσωματικής

Διαβάστε περισσότερα

ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ

ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ Ενότητα 11: Ηθική θεώρηση της εξωσωματικής γονιμοποίησης Μιλτιάδης Βάντσος Άδειες Χρήσης Το

Διαβάστε περισσότερα

Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr. μπορείτε να δείτε video της μονάδας embio

Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr. μπορείτε να δείτε video της μονάδας embio Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr μπορείτε να δείτε video της μονάδας embio 2 3 Ηλίας Θ. Γάτος MD Χειρουργός Γυναικολόγος - Μαιευτήρας Eιδικός στην εξωσωματική γονιμοποίηση και

Διαβάστε περισσότερα

Βλαστοκύτταρο. Χοτζάι Αθηνά, Στέργιο Χάιδω Τμήμα Γ5

Βλαστοκύτταρο. Χοτζάι Αθηνά, Στέργιο Χάιδω Τμήμα Γ5 Βλαστοκύτταρο Χοτζάι Αθηνά, Στέργιο Χάιδω Τμήμα Γ5 Τα βλαστοκύτταρα είναι κύτταρα που αναπαράγονται διαρκώς και έχουν την ικανότητα να μετατραπούν (να διαφοροποιηθούν) σε οποιοδήποτε άλλο είδος κυττάρου

Διαβάστε περισσότερα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα MAΡΙΑ ΠΑΠΑΛΟΥΚΑ Κλινική Εμβρυολόγος Μονάδα Αναπαραγωγικής Ιατρικής Περιεχόμενα Ορισμός Ιστορική Αναδρομή Γενετική

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙ ΑΣ Τ Μ Η Μ Α Ι ΑΤ Ρ Ι ΚΗΣ Π Ρ Ο Γ Ρ ΑΜ Μ Α Μ Ε Τ Α Π Τ Υ Χ Ι ΑΚ Ω Ν Σ Π Ο Υ Δ Ω Ν «Β Ι Ο Λ Ο Γ Ι Α Τ Η Σ Α Ν Α Π Α Ρ Α Γ Ω Γ Η Σ» Βιόπολις, 41110 Λάρισα E-mail:

Διαβάστε περισσότερα

Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010

Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010 Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010 Εβδ. Μήνας/Ημέρα MAΘΗΜΑ ιάλεξη ΕΡΓΑΣΤΗΡΙΟ Ώρα Εισηγητής 1 η 1/2/10 2/2/10 Ορισμοί,

Διαβάστε περισσότερα

Βλαστοκύτταρα:Η χρήση τους στη θεραπεία ασθενειών

Βλαστοκύτταρα:Η χρήση τους στη θεραπεία ασθενειών Βλαστοκύτταρα:Η χρήση τους στη θεραπεία ασθενειών Εργασία στο μάθημα της Βιολογίας Γυμνάσιο Κερατέας Δήμητρα Κοντού Νεφέλη Καλπάκα Γ2 Σχολικό έτος:2014-2015 ΕΙΣΑΓΩΓΗ Η πρόοδος της τεχνολογίας είναι ραγδαία

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

Κατανοώντας τα βλαστικά κύτταρα

Κατανοώντας τα βλαστικά κύτταρα θέμα Κατανοώντας τα βλαστικά κύτταρα Μια επισκόπηση της επιστήμης και των θεμάτων που εγείρονται Δημοσίευση κατόπιν αδείας από την U.S. National Academy of Sciences, www.nationalacademies.org/stemcells.

Διαβάστε περισσότερα

Συνεδρία 1η: Πρόεδροι: Ν. Πράπας, Α. Δαπόντε, Η. Τσάκος. 09:00-09:20 Αξιολόγηση των ωοθηκικών εφεδρειών 09:20-09:30 Συζήτηση Γ.

Συνεδρία 1η: Πρόεδροι: Ν. Πράπας, Α. Δαπόντε, Η. Τσάκος. 09:00-09:20 Αξιολόγηση των ωοθηκικών εφεδρειών 09:20-09:30 Συζήτηση Γ. ΣΑΒΒΑΤΟ 5-12-2015 Συνεδρία 1η: Πρόεδροι: Ν. Πράπας, Α. Δαπόντε, Η. Τσάκος 09:00-09:20 Αξιολόγηση των ωοθηκικών εφεδρειών 09:20-09:30 Συζήτηση Γ. Αντωνάκης 09:30-09:50 Πρόωρη ωοθηκική ανεπάρκεια 09:50-10:00

Διαβάστε περισσότερα

ΓΥΝΑΙΚΕΙΑ & ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ

ΓΥΝΑΙΚΕΙΑ & ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΓΥΝΑΙΚΕΙΑ & ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ WORKSHOP Σάββατο 27 Ιουνίου 2015 ΚΑΛΑΜΑΤΑ Ναυαρίνου & Ρήγα Φεραίου Καλαμάτα Οργάνωση: ΠΡΟΓΡΑΜΜΑ WORKSHOP 09:30 10:15 Χαιρετισμοί Δραστηριότητες της ΕΕΑΙ Ευγένιος Κουμαντάκης,

Διαβάστε περισσότερα

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Παρουσιάσεις Power Point με υλικό από: Campbell και Reece (2010) ΒΙΟΛΟΓΙΑ τόμος Ι, 1

Διαβάστε περισσότερα

Κ Υ Τ Τ Α Ρ Ι Κ Ε Σ Θ Ε Ρ Α Π Ε Ι Ε Σ - Α Ν Ο Σ Ο Γ Ε Ν Ε Τ Ι Κ Η

Κ Υ Τ Τ Α Ρ Ι Κ Ε Σ Θ Ε Ρ Α Π Ε Ι Ε Σ - Α Ν Ο Σ Ο Γ Ε Ν Ε Τ Ι Κ Η Κ Υ Τ Τ Α Ρ Ι Κ Ε Σ Θ Ε Ρ Α Π Ε Ι Ε Σ - Α Ν Ο Σ Ο Γ Ε Ν Ε Τ Ι Κ Η Τράπεζα Μεσεγχυματικών Κυττάρων Τι είναι τα Μεσεγχυματικά στελεχιαία κύτταρα ( MSCs); Αποτελούν ετερογενή πληθυσμό πολυδύναμων αρχέγονων

Διαβάστε περισσότερα

ΕΚ ΗΛΩΣΗ ΕΝΗΜΕΡΩΣΗΣ ΚΑΙ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗΣ ΤΟΥ ΚΟΙΝΟΥ ΣΤΙΣ ΝΕΥΡΟΕΠΙΣΤΗΜΕΣ. Πόλη Ηµεροµηνία Ώρα Αίθουσα ΠΡΟΓΡΑΜΜΑ

ΕΚ ΗΛΩΣΗ ΕΝΗΜΕΡΩΣΗΣ ΚΑΙ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗΣ ΤΟΥ ΚΟΙΝΟΥ ΣΤΙΣ ΝΕΥΡΟΕΠΙΣΤΗΜΕΣ. Πόλη Ηµεροµηνία Ώρα Αίθουσα ΠΡΟΓΡΑΜΜΑ ΕΛΛΗΝΙΚΗ ΕΤΑΙΡΕΙΑ ΓΙΑ ΤΙΣ ΝΕΥΡΟΕΠΙΣΤΗΜΕΣ ΕΚ ΗΛΩΣΗ ΕΝΗΜΕΡΩΣΗΣ ΚΑΙ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗΣ ΤΟΥ ΚΟΙΝΟΥ ΣΤΙΣ ΝΕΥΡΟΕΠΙΣΤΗΜΕΣ Πόλη Ηµεροµηνία Ώρα Αίθουσα Σαλαµίνα 17 Μαρτίου 2012 09:30 πµ Κινηµατοθέατρο Ναυστάθµου

Διαβάστε περισσότερα

ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ. Μανουρά Αντωνία. Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης

ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ. Μανουρά Αντωνία. Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ Μανουρά Αντωνία Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης Σχεδόν τριάντα χρόνια έχουν περάσει από τη γέννηση του πρώτου «µωρού του σωλήνα». Από τότε,

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ

ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ ΛΥΚΕΙΟ ΑΓΙΟΥ ΙΩΑΝΝΗ ΛΕΜΕΣΟΥ 2007-8 www.cyprusbiology.com 1 ΕΝΟΤΗΤΑ Α. ΠΩΣ ΑΡΧΙΖΕΙ Η ΖΩΗ ιαιώνιση των ειδών 1. Ποια είναι τα µέρη του σπερµατοζωαρίου; 2. Να συµπληρώσετε τις ενδείξεις του πιο κάτω σχήµατος

Διαβάστε περισσότερα

ΤΟ ΘΕΜΑ ΤΩΝ ΑΡΧΕΓΟΝΩΝ ΚΥΤΤΑΡΩΝ ΣΤΗ ΔΕΥΤΕΡΟΒΑΘΜΙΑ ΕΚΠΑΙΔΕΥΣΗ

ΤΟ ΘΕΜΑ ΤΩΝ ΑΡΧΕΓΟΝΩΝ ΚΥΤΤΑΡΩΝ ΣΤΗ ΔΕΥΤΕΡΟΒΑΘΜΙΑ ΕΚΠΑΙΔΕΥΣΗ ΤΟ ΘΕΜΑ ΤΩΝ ΑΡΧΕΓΟΝΩΝ ΚΥΤΤΑΡΩΝ ΣΤΗ ΔΕΥΤΕΡΟΒΑΘΜΙΑ ΕΚΠΑΙΔΕΥΣΗ ΜΙΑ ΠΡΟΤΑΣΗ ΓΙΑ ΔΙΔΑΣΚΑΛΙΑ ΤΟΥ ΣΕ ΜΑΘΗΤΕΣ A & Γ ΛΥΚΕΙΟΥ Παρακάτω παραθέτουμε μια ανάπτυξη του θέματος, η οποία, αυτούσια, μπορεί να χρησιμεύσει

Διαβάστε περισσότερα

Νομικό Πλαίσιο. Γενικές Αρχές

Νομικό Πλαίσιο. Γενικές Αρχές Νομικό Πλαίσιο Η ειδική ελληνική νομοθεσία Νόμοι 3089 / 2002 : «Ιατρική υποβοήθηση στην ανθρώπινη αναπαραγωγή» και νόμος 3305 / 2005 «Εφαρμογή της ιατρικώς υποβοηθούμενης αναπαραγωγής» Γενικές Αρχές Σύμφωνα

Διαβάστε περισσότερα

ΑΡΧΕΓΟΝΑ ΚΥΤΤΑΡΑ (βλαστικά κύτταρα, stem cells)

ΑΡΧΕΓΟΝΑ ΚΥΤΤΑΡΑ (βλαστικά κύτταρα, stem cells) , Φυσικός MSc 1 ΑΡΧΕΓΟΝΑ ΚΥΤΤΑΡΑ (βλαστικά κύτταρα, stem cells) Για αιώνες ο άνθρωπος γνώριζε ότι κάποια ζώα, όπως ο θαλάσσιος αστερίας και ένα είδος σαύρας ο τρίτων, μπορούν να αναγεννούν χαμένα τμήματα

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος

Ασκήσεις για το σπίτι και για σένα! 0.5 5. μελετούμε τους ζωντανούς οργανισμούς; Τρόποι μελέτης των ζωντανών οργανισμών Επιστημονική μέθοδος Προγραμματισμός Διδακτέας Ύλης Βιολογίας Α Γυμνασίου 2012-2013 Α ΤΕΤΡΑΜΗΝΟ Ενότητα Δραστηριότητες Βασικές Έννοιες Δ/κές Π/δοι Γνωριμία Εισαγωγικές σελίδες Γνωριμία με το βιβλίο μου 1 1 Ενότητα 1: Η Βιολογία

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει ανθρώπινο σπερματοζωάριο.

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει ανθρώπινο σπερματοζωάριο. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΑΝΑΠΑΡΑΓΩΓΗ ΗΜΕΡΟΜΗΝΙΑ:... ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΤΜΗΜΑ:... ΑΡ. ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει

Διαβάστε περισσότερα

ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΜΙΚΡΟΓΟΝΙΜΟΠΟΙΗΣΗ

ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΜΙΚΡΟΓΟΝΙΜΟΠΟΙΗΣΗ ΕΝΩΣΗ ΜΑΙΕΥΤΗΡΩΝ ΓΥΝΑΙΚΟΛΟΓΩΝ ΕΛΛΑΔΟΣ Ε Π Ι Σ Τ Η Μ Ο Ν Ι Κ Η Η Μ Ε Ρ Ι Δ Α ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΜΙΚΡΟΓΟΝΙΜΟΠΟΙΗΣΗ Οι αλήθειες και οι μύθοι Υπεύθυνοι Ηµερίδας Dr. Λουκάς Κλέντζερης M.D. (Sheffield)

Διαβάστε περισσότερα

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος.

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος. Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ Αρχιτομία Αγενής αναπαραγωγή Παρατομία Εκβλάστηση Εγγενής αναπαραγωγή Απλοφασικός κύκλος Διπλοφασικός κύκλος Ισογαμία Ανισογαμία Ωογαμία Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ

Διαβάστε περισσότερα

Βλαστοκύτταρα: Η μεγάλη ελπίδα της ιατρικής για τον 21ο αιώνα

Βλαστοκύτταρα: Η μεγάλη ελπίδα της ιατρικής για τον 21ο αιώνα 1 Βλαστοκύτταρα: Η μεγάλη ελπίδα της ιατρικής για τον 21ο αιώνα Ελένη Δεληγεώργη-Πολίτη,MD.PhD. Καθηγήτρια Παθολογικής Ανατομικής και Κυτταρολογίας Εθνικό και Καποδιστριακό Πανεπιστημίο Αθηνών Σώμα Ομοτίμων

Διαβάστε περισσότερα

22 η ετήσια. Ειδική Σύνοδος ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ. Τελικό Πρόγραμμα. Costa Navarino. Μεσσηνία

22 η ετήσια. Ειδική Σύνοδος ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ. Τελικό Πρόγραμμα. Costa Navarino. Μεσσηνία 22 η ετήσια Ειδική Σύνοδος ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ 25-26Ιουνίου2011 2011 Τελικό Πρόγραμμα Costa Navarino Μεσσηνία ΟΡΓΑΝΩΣΗ ΕΛΛΗΝΙΚΉ ΜΑΙΕΥΤΙΚΉ & ΓΥΝΑΙΚΟΛΟΓΙΚΉ ΕΤΑΙΡΕΊΑ Δ.Σ. ΕΛΛΗΝΙΚΗΣ

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα

ΣΑΒΒΑΤΟ 5-12-2015. 08:00-09:00: Προσέλευση - Εγγραφές. Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης

ΣΑΒΒΑΤΟ 5-12-2015. 08:00-09:00: Προσέλευση - Εγγραφές. Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης ΣΑΒΒΑΤΟ 5-12-2015 08:00-09:00: Προσέλευση - Εγγραφές Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης 09:00-09:20 Αξιολόγηση των ωοθηκικών εφεδρειών 09:20-09:30 Συζήτηση Γ. Αντωνάκης 09:30-09:50

Διαβάστε περισσότερα

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Προεμφυτευτική Γενετική Διάγνωση Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Στάδια Προεμφυτευτικής Γενετικής Διάγνωσης (P.G.D) Διέγερση ωοθηκών για την ωρίμανση μεγάλου αριθμού (ει δυνατόν ) ωοθυλακίων

Διαβάστε περισσότερα

Η διάχυση της πληροφορίας στις ευρεσιτεχνίες ζώντων οργανισμών Από την υπόθεση Chakrabarty στις εφευρέσεις ανθρώπινου γενετικού υλικού

Η διάχυση της πληροφορίας στις ευρεσιτεχνίες ζώντων οργανισμών Από την υπόθεση Chakrabarty στις εφευρέσεις ανθρώπινου γενετικού υλικού Η διάχυση της πληροφορίας στις ευρεσιτεχνίες ζώντων οργανισμών Από την υπόθεση Chakrabarty στις εφευρέσεις ανθρώπινου γενετικού υλικού Λέανδρος Λεφάκης Δρ.Ν Πανεπιστήμιο Στ. Ελλάδος Οριοθέτηση η γνώση

Διαβάστε περισσότερα

ΕΝΤΥΠΑ ΣΥΓΚΑΤΑΘΕΣΗΣ για συµµετοχή σε πρόγραµµα έρευνας (Τα έντυπα αποτελούνται συνολικά από... σελίδες)

ΕΝΤΥΠΑ ΣΥΓΚΑΤΑΘΕΣΗΣ για συµµετοχή σε πρόγραµµα έρευνας (Τα έντυπα αποτελούνται συνολικά από... σελίδες) (Τα έντυπα αποτελούνται συνολικά από... σελίδες) Καλείστε να συµµετάσχετε σε ένα ερευνητικό πρόγραµµα. Πιο κάτω (βλ. «Πληροφορίες για Ασθενείς ή/και Εθελοντές») θα σας δοθούν εξηγήσεις σε απλή γλώσσα σχετικά

Διαβάστε περισσότερα

Συνέντευξη με τον Μαιευτήρα, Χειρουργό Γυναικολόγο αναπαραγωγής, Μιχάλη Κλ. Φραγκουλίδη

Συνέντευξη με τον Μαιευτήρα, Χειρουργό Γυναικολόγο αναπαραγωγής, Μιχάλη Κλ. Φραγκουλίδη Συνέντευξη με τον Μαιευτήρα, Χειρουργό Γυναικολόγο αναπαραγωγής, Μιχάλη Κλ. Φραγκουλίδη Η ανδρική υπογονιμότητα είναι ένα θέμα που απασχολεί ιδιαίτερα τον επιστημονικό κόσμο με δεδομένο ότι τα τελευταία

Διαβάστε περισσότερα

8 η Διημερίδα Βιολογίας Η κοινωνία συναντά τη σύγχρονη Βιολογία

8 η Διημερίδα Βιολογίας Η κοινωνία συναντά τη σύγχρονη Βιολογία ΩΡΑ 10.00 Ο υπολογιστής με εκατομμύρια χρόνια έρευνας και ανάπτυξης: Προσεγγίζοντας τον εγκέφαλο. Ευθύμιος Σκουλάκης, Επικεφαλής του Τομέα Νευροεπιστημών στο Ερευνητικό Κέντρο Βιοϊατρικών Επιστημών «Αλέξανδρος

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ΜΕΡΟΣ Α: ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΑΝΑΠΑΡΑΓΩΓΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΤΟΥ ΑΝΤΡΑ

ΜΕΡΟΣ Α: ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΑΝΑΠΑΡΑΓΩΓΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΤΟΥ ΑΝΤΡΑ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 12 ο ΚΕΦΑΛΑΙΟ «ΑNAΠΑΡΑΓΩΓΗ-ΑΝΑΠΤΥΞΗ» ΜΕΡΟΣ Α: ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΑΝΑΠΑΡΑΓΩΓΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΤΟΥ ΑΝΤΡΑ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Ποιος είναι ο ρόλος της αναπαραγωγής και

Διαβάστε περισσότερα

Γενετική απαλοιφή. G. Patrinos

Γενετική απαλοιφή. G. Patrinos Γενετική απαλοιφή Γιατί το ποντίκι είναι το πιο ευρέως χρησιμοποιούμενο είδος στη βιοτεχνολογία Χαμηλό κόστος Ευκολία χειρισμών Μικρός χρόνος αναπαραγωγής (19 ημέρες) Μεγάλος αριθμός ομόμικτων (inbred)

Διαβάστε περισσότερα

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα;

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα; ΑΝΑΠΑΡΑΓΩΓΙΚΟ 1. (α) Τι αντιπροσωπεύουν οι αριθμοί 1-6 στο σχήμα; (β) Εξηγήστε τι είναι τα ωοθυλάκια και ποιος είναι ο ρόλος τους. (γ) Σε ποιο μέρος του γεννητικού συστήματος της γυναίκας αρχίζει η ανάπτυξη

Διαβάστε περισσότερα

3 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ Π.Ε.Β. 20-21/3/2004

3 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ Π.Ε.Β. 20-21/3/2004 3 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ Π.Ε.Β. 20-21/3/2004 ΣΤΡΟΓΓΥΛΗ ΤΡΑΠΕΖΑ Εκπαίδευση και Επαγγελματικά Ζητούμενα στην Παροχή Υπηρεσιών Υγείας Πανελλήνια Ένωση Κλινικών Εμβρυολόγων Χάρης Ε. Καζλαρής Δρ. Βιοχημικός

Διαβάστε περισσότερα

ΤΟ ΑΥΓΟ ΤΩΝ ΑΜΝΙΩΤΩΝ ΕΞΩΕΜΒΡΥΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΤΟ ΑΥΓΟ ΤΩΝ ΑΜΝΙΩΤΩΝ ΕΞΩΕΜΒΡΥΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΤΟ ΑΥΓΟ ΤΩΝ ΑΜΝΙΩΤΩΝ ΕΞΩΕΜΒΡΥΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 1. Λεκιθικός σάκος 2. Άμνιον 3. Αλλαντοίδα 4. Χόριο 3. Allantois 1. Yolk sac Α. Embryo Β. Shell Γ C. Shell membrane 2. Amnion 4. Chorion Α: Έμβρυο κοτόπουλου

Διαβάστε περισσότερα

Διλήμματα και προβληματισμοί σε βιοϊατρικές επιστημονικές εφαρμογές και έρευνες

Διλήμματα και προβληματισμοί σε βιοϊατρικές επιστημονικές εφαρμογές και έρευνες 1 ΠΑΓΚΥΠΡΙΟΣ ΣΥΝΔΕΣΜΟΣ ΝΟΣΗΛΕΥΤΩΝ ΚΑΙ ΜΑΙΩΝ CYPRUS NURSES AND MIDWIVES ASSOCIATION Ταγματάρχου Πουλίου, 1 Διαμ. 101, 1101 Λευκωσία, Τ. Θ. 24015 Κύπρος Τηλ : + 357 22 771994 Φαξ : +357 22 771989 Email:

Διαβάστε περισσότερα

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Περιεχόμενα Μιχάλης Φραγκουλίδης ΜSc, DFFP, BSCCP σύντομο βιογραφικό σημείωμα 11 λόγοι για να εμπιστευτείτε το γέννημα Ενότητα 1 Η θεραπεία εξωσωματικής

Διαβάστε περισσότερα

3/12/2014. Εξωσωµατική γονιµοποίηση (IVF) Πτωχές Απαντήτριες. Αίτια πτωχής απάντησης ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ

3/12/2014. Εξωσωµατική γονιµοποίηση (IVF) Πτωχές Απαντήτριες. Αίτια πτωχής απάντησης ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΛΕΥΘΕΡΙΑΔΗΣ Δ. ΝΙΚΟΛΑΟΣ Μοριακός Βιολόγος & Γενετιστής ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Μεταπτυχιακό Πρόγραµµα Σπουδών «Κλινική Φαρµακολογία και Θεραπευτική» Επιβλέπουσα: ΚΟΥΤΛΑΚΗ ΝΙΚΟΛΕΤΑ

Διαβάστε περισσότερα

«ΥΠΕΡΗΧΟΓΡΑΦΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΗΣ ΓΥΝΑΙΚΑΣ ΕΝΑ ΥΠΟΓΟΝΙΜΟ ΖΕΥΓΑΡΙ ΜΗΤΕΡΑ «ΜΟΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΙΑΤΡΙΚΗΣ» ΤΖΕΦΕΡΑΚΟΣ ΑΛΕΞΑΝΔΡΟΣ

«ΥΠΕΡΗΧΟΓΡΑΦΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΗΣ ΓΥΝΑΙΚΑΣ ΕΝΑ ΥΠΟΓΟΝΙΜΟ ΖΕΥΓΑΡΙ ΜΗΤΕΡΑ «ΜΟΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΙΑΤΡΙΚΗΣ» ΤΖΕΦΕΡΑΚΟΣ ΑΛΕΞΑΝΔΡΟΣ «ΥΠΕΡΗΧΟΓΡΑΦΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΗΣ ΓΥΝΑΙΚΑΣ ΣΕ ΕΝΑ ΥΠΟΓΟΝΙΜΟ ΖΕΥΓΑΡΙ ΠΡΙΝ ΚΑΙ ΚΑΤΑ ΤΗΝ ΔΙΕΓΕΡΣΗ ΤΩΝ ΩΟΘΗΚΩΝ» ΤΖΕΦΕΡΑΚΟΣ ΑΛΕΞΑΝΔΡΟΣ «ΜΟΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΙΑΤΡΙΚΗΣ» ΜΗΤΕΡΑ Η εξέλιξη στην υπερηχογραφική τεχνολογία

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής. Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων

ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής. Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων ΒΑΣΙΚΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΑΝΘΡΩΠΟΥ Μάθημα 12: Βασικές έννοιες γενετικής Συνοψίζοντας & Επεκτείνοντας τις γνώσεις των τριών εργαστηριακών ασκήσεων Όλοι έχουμε αναρωτηθεί κάποια στιγμή Γιατί μοιάζουμε με τους

Διαβάστε περισσότερα

Οι κυριότερες τεχνικές εξωσωματικής γονιμοποίησης

Οι κυριότερες τεχνικές εξωσωματικής γονιμοποίησης Μαρία Βενετίκου 1, Σοφία Σκυλοδήμου και Φερενίκη Κοσμά 12 Οι κυριότερες τεχνικές εξωσωματικής γονιμοποίησης εξωσωματική γονιμοποίηση (in vitro fertilization, IVF) αποτελεί την πλέον εξελιγμένη μέθοδο υποβοηθούμενης

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΕΚΠΑΙΔΕΥΣΗ

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΕΚΠΑΙΔΕΥΣΗ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΕΠΩΝΥΜΟ ΠΑΠΑΓΓΕΛΗ ΟΝΟΜΑ ΠΙΠΙΝΑ ΟΝΟΜΑ ΠΑΤΡΟΣ ΧΡΗΣΤΟΣ ΗΜΕΡΟΜΗΝΙΑ ΓΕΝΝΗΣΗΣ 7/6/1969 ΤΟΠΟΣ ΓΕΝΝΗΣΗΣ ΛΑΡΙΣΑ ΠΤΥΧΙΟ ΒΙΟΛΟΓΙΑΣ ΔΙΔΑΚΤΟΡΙΚΟ ΔΙΠΛΩΜΑ ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΠΑΡΟΥΣΑ ΘΕΣΗ ΑΝΤΙΠΡΟΕΔΡΟΣ

Διαβάστε περισσότερα

ΝΟΜΙΚΑ ΖΗΤΗΜΑΤΑ ΤΗΣ ΙΑΤΡΙΚΩΣ ΥΠΟΒΟΗΘΟΥΜΕΝΗΣ ΑΝΑΠΑΡΑΓΩΓΗΣ. 1. Το ζήτημα της ιατρικώς υποβοηθούμενης αναπαραγωγής (ΙΥΑ) παρά το γεγονός ότι απασχολεί τη

ΝΟΜΙΚΑ ΖΗΤΗΜΑΤΑ ΤΗΣ ΙΑΤΡΙΚΩΣ ΥΠΟΒΟΗΘΟΥΜΕΝΗΣ ΑΝΑΠΑΡΑΓΩΓΗΣ. 1. Το ζήτημα της ιατρικώς υποβοηθούμενης αναπαραγωγής (ΙΥΑ) παρά το γεγονός ότι απασχολεί τη ΝΟΜΙΚΑ ΖΗΤΗΜΑΤΑ ΤΗΣ ΙΑΤΡΙΚΩΣ ΥΠΟΒΟΗΘΟΥΜΕΝΗΣ ΑΝΑΠΑΡΑΓΩΓΗΣ Ι. ΓΕΝΙΚΑ 1. Το ζήτημα της ιατρικώς υποβοηθούμενης αναπαραγωγής (ΙΥΑ) παρά το γεγονός ότι απασχολεί τη χώρα μας τα τελευταία 30 χρόνια τουλάχιστον,

Διαβάστε περισσότερα

Χρησιμοποίηση των Φυτών για την παραγωγή Υψηλής Αξίας Προϊόντων

Χρησιμοποίηση των Φυτών για την παραγωγή Υψηλής Αξίας Προϊόντων Χρησιμοποίηση των Φυτών για την παραγωγή Υψηλής Αξίας Προϊόντων Γιατί σε φυτά? Διαγονιδιακοί οργανισμοί έχουν ήδη χρησιμοποιηθεί για την παραγωγή κοινών βιοφαρμακευτικών. Για παράδειγμα, βακτήρια χρησιμοποιούνται

Διαβάστε περισσότερα

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

Η κλωνοποίηση και οι κίνδυνοι της

Η κλωνοποίηση και οι κίνδυνοι της Κλωνοποίηση Ορισμός Κλωνοποίηση είναι η διαδικασία δημιουργίας ενός ή περισσοτέρων ακριβών αντιγράφων από ένα πρότυπο. Στο χώρο της Βιολογίας αυτό το πρότυπο μπορεί να αντιπροσωπεύει ένα μόριο (π.χ. DNA

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 05/09/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Βιοχημεία ή Κλινική

Διαβάστε περισσότερα

6.4 Η αναπαραγωγή στον άνθρωπο ΜΙΚΡΕΣ ΕΡΕΥΝΕΣ ΚΑΙ ΕΡΓΑΣΙΕΣ

6.4 Η αναπαραγωγή στον άνθρωπο ΜΙΚΡΕΣ ΕΡΕΥΝΕΣ ΚΑΙ ΕΡΓΑΣΙΕΣ ΜΙΚΡΕΣ ΕΡΕΥΝΕΣ ΚΑΙ ΕΡΓΑΣΙΕΣ 1. Τα νεογνά των φυτοφάγων θηλαστικών, όπως της γίδας, γεννιούνται με τρίχωμα. Τα μάτια τους είναι ανοιχτά και μπορούν αμέσως να περπατήσουν. Αντίθετα, τα νεογνά των σαρκοφάγων

Διαβάστε περισσότερα

Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης

Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης ΣΑΒΒΑΤΟ 5-12-2015 08:00-09:00: Προσέλευση - Εγγραφές Συνεδρία 1η: Πρόεδροι: Α. Λουφόπουλος, Α. Δαπόντε, Β. Τζώρτζης 09:00-09:20 Αξιολόγηση των ωοθηκικών εφεδρειών 09:20-09:30 Συζήτηση Γ. Αντωνάκης 09:30-09:50

Διαβάστε περισσότερα

Επαγωγή Ανθρώπινων Πολυδύναμων Βλαστικών Κυττάρων. Aναπρογραμματίζοντας τη Γονιδιακή Έκφραση Διαφοροποιημένων Κυττάρων

Επαγωγή Ανθρώπινων Πολυδύναμων Βλαστικών Κυττάρων. Aναπρογραμματίζοντας τη Γονιδιακή Έκφραση Διαφοροποιημένων Κυττάρων Επαγωγή Ανθρώπινων Πολυδύναμων Βλαστικών Κυττάρων. Aναπρογραμματίζοντας τη Γονιδιακή Έκφραση Διαφοροποιημένων Κυττάρων 97 ΣΕΛΙΔΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ Επαγωγή Ανθρώπινων Πολυδύναμων Βλαστικών Κυττάρων. Aναπρογραμματίζοντας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΣΥΝΕΔΡΙΟ ΣΥΝΔΕΣΜΟΥ ΥΓΕΙΟΝΟΜΙΚΩΝ ΤΕΧΝΟΛΟΓΩΝ ΠΑΡΑΣΚΕΥΑΣΤΩΝ ΕΛΛΑΔΟΣ. Πέμπτη 7 Απριλίου 2016 Ώρες Συνεδρίου: 13:00 20:00

ΠΑΝΕΛΛΗΝΙΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΣΥΝΕΔΡΙΟ ΣΥΝΔΕΣΜΟΥ ΥΓΕΙΟΝΟΜΙΚΩΝ ΤΕΧΝΟΛΟΓΩΝ ΠΑΡΑΣΚΕΥΑΣΤΩΝ ΕΛΛΑΔΟΣ. Πέμπτη 7 Απριλίου 2016 Ώρες Συνεδρίου: 13:00 20:00 Πέμπτη 7 Απριλίου 2016 Ώρες Συνεδρίου: 13:00 20:00 13:00-15:00 ΕΓΓΡΑΦΕΣ 15:00-15:30 Χαιρετισμοί Προέδρου ΔΣ Συνδέσμου Υγειονομικών Χαιρετισμοί Επίσημων Προσκεκλημένων Χαιρετισμοί Εκπροσώπων Επιστημονικών

Διαβάστε περισσότερα

Αθήνα, 10-12 Δεκεμβρίου 2010

Αθήνα, 10-12 Δεκεμβρίου 2010 Ε Λ Λ Η Ν Ι Κ Η Ε Τ Α Ι Ρ Ε Ι Α ΓΟΝIΜΟΤΗΤΑΣ & ΣΤΕΙΡΟΤΗΤΑΣ Πανελλήνιο Συνέδριο Μ Ε Ι Ε Θ Ν Η Σ Υ Μ Μ Ε ΤΟ Χ Η Αθήνα, 10-12 Δεκεμβρίου 2010 Ξενοδοχείο Divani Caravel AΝΑΚΟΙΝΩΣΗ Ε Λ Λ Η Ν Ι Κ Η Ε Τ Α Ι Ρ

Διαβάστε περισσότερα

Ι ΙΩΤΙΚΗ ΓΕΝΙΚΗ, ΜΑΙΕΥΤΙΚΗ-ΓΥΝΑΙΚΟΛΟΓΙΚΗ & ΠΑΙ ΙΑΤΡΙΚΗ ΚΛΙΝΙΚΗ Α.Ε. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΟΜΙΛΙΩΝ 2006-2007 *+)()*«ΜΗΤΕΡΑ»

Ι ΙΩΤΙΚΗ ΓΕΝΙΚΗ, ΜΑΙΕΥΤΙΚΗ-ΓΥΝΑΙΚΟΛΟΓΙΚΗ & ΠΑΙ ΙΑΤΡΙΚΗ ΚΛΙΝΙΚΗ Α.Ε. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΟΜΙΛΙΩΝ 2006-2007 *+)()*«ΜΗΤΕΡΑ» # % # " $!!"" ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΟΜΙΛΙΩΝ 2006-2007 / % # # %# &! # '()*&+!&,+&- 0 " &,." $)!($()*!)-)*1$-(!)*&+&$)*23!)4)!)* *+)()*«ΜΗΤΕΡΑ» Ο ΠΡΟΕ ΡΟΣ ΤΟΥ ΙΟΙΚΗΤΙΚΟΥ ΣΥΜΒΟΥΛΙΟΥ Ο ΠΡΟΕ ΡΟΣ ΤΟΥ ΕΠΙΣΤΗΜΟΝΙΚΟΥ

Διαβάστε περισσότερα

Αναπαραγωγή - Ανάπτυξη

Αναπαραγωγή - Ανάπτυξη Αναπαραγωγή - Ανάπτυξη ΘΕΜΑ 1ο Ένα από τα τμήματα του αναπαραγωγικού συστήματος του άνδρα είναι η εκφορητική οδός του σπέρματος η οποία ξεκινά από την επιδιδυμίδα και καταλήγει στη βάλανο. α) Πώς ονομάζεται

Διαβάστε περισσότερα

Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα

Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα Παπανικολάου Αθανάσιος Αναπληρωτής Διευθυντής ΕΣΥ Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Η αναρροφητική βιοψία των όρχεων

Διαβάστε περισσότερα

ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ

ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΤΕΧΝΗΤΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΠΡΟΚΛΗΣΗ ΩΟΘΥΛΑΚΙΟΡΡΗΞΙΑΣ ΛΗΨΗ ΩΑΡΙΩΝ ΓΟΝΙΜΟΠΟΙΗΣΗ ΕΜΒΡΥΟΜΕΤΑΦΟΡΑ

Διαβάστε περισσότερα

Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας

Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας Δρ. Ελένη Κοντογιάννη Εμβρυολόγος-Γενετιστής Επιστημονική Διευθύντρια Ινστιτούτου Γυναικολογίας και Υποβοηθούμενης Αναπαραγωγής «IVF and Genetics»

Διαβάστε περισσότερα

ΟΡΓΑΝΩΣΗ ΕΛΛΗΝΙΚΉ ΜΑΙΕΥΤΙΚΉ & ΓΥΝΑΙΚΟΛΟΓΙΚΉ ΕΤΑΙΡΕΊΑ Δ.Σ. ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ

ΟΡΓΑΝΩΣΗ ΕΛΛΗΝΙΚΉ ΜΑΙΕΥΤΙΚΉ & ΓΥΝΑΙΚΟΛΟΓΙΚΉ ΕΤΑΙΡΕΊΑ Δ.Σ. ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ ΟΡΓΑΝΩΣΗ ΕΛΛΗΝΙΚΉ ΜΑΙΕΥΤΙΚΉ & ΓΥΝΑΙΚΟΛΟΓΙΚΉ ΕΤΑΙΡΕΊΑ Δ.Σ. ΕΛΛΗΝΙΚΗΣ ΜΑΙΕΥΤΙΚΗΣ & ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΕΤΑΙΡΕΙΑΣ Πρόεδρος: Καθηγητής Άρις Αντσακλής Αντιπρόεδρος: Καθηγητής Θεόδωρος Στέφος Γεν.Γραμματέας: Δρ.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ Δομή και λειτουργία του αναπαραγωγικού συστήματος 1. Να ονομάσετε τις αριθμημένες δομές του παρακάτω σχήματος. Βλέπε εικ. 12.1 της σ. 219 του βιβλίου του μαθητή. 2. Να ενώσετε

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΤΗΝ ΑΠΑΣΧΟΛΗΣΗ ΕΞΩΤΕΡΙΚΏΝ ΣΥΝΕΡΓΑΤΩΝ ΜΕ ΣΥΜΒΑΣΕΙΣ ΕΡΓΟΥ

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΤΗΝ ΑΠΑΣΧΟΛΗΣΗ ΕΞΩΤΕΡΙΚΏΝ ΣΥΝΕΡΓΑΤΩΝ ΜΕ ΣΥΜΒΑΣΕΙΣ ΕΡΓΟΥ ΑΝΑΚΟΙΝΟΠΟΙΗΣΗ ΣΤΟ ΟΡΘΟ Ταχ. Δ/νση : Σωρανού του Εφεσίου 4, 115 27 Αθήνα Τηλέφωνο : 2106597617-619 - 620 E mail : hr@bioacademy.gr Ο ΑΣΚΩΝ ΚΑΘΗΚΟΝΤΑ ΓΕΝΙΚΟΥ ΔΙΕΥΘΥΝΤΗ ΑΘΑΝΑΣΙΟΣ ΤΣΟΥΡΟΠΛΗΣ Αθήνα: 18/12/2012

Διαβάστε περισσότερα

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Παρουσιάσεις Power Point με υλικό από: Campbell και Reece (2010) ΒΙΟΛΟΓΙΑ τόμος Ι, 1

Διαβάστε περισσότερα

ΕΥΡΥΒΙΑΔΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ

ΕΥΡΥΒΙΑΔΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ ΕΥΡΥΒΙΑΔΕΙΟ ΓΥΜΝΑΣΙΟ ΛΑΡΝΑΚΑΣ 2010-11 Κεφάλαιο 1: Η Οργάνωση της ζωής 1. Από ποια μέρη αποτελείται το μικροσκόπιο; 2. Στην εικόνα φαίνεται ένα μικροσκόπιο. Να γράψετε τα μέρη του όπως υποδεικνύονται από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

medical center Εξωσωματική Γονιμοποίηση Ηλίας Γάτος MD Επιστημονικός Διευθυντής embio

medical center Εξωσωματική Γονιμοποίηση Ηλίας Γάτος MD Επιστημονικός Διευθυντής embio medical center Εξωσωματική Γονιμοποίηση Ηλίας Γάτος MD Επιστημονικός Διευθυντής embio Εξωσωματική Γονιμοποίηση (IVF) Η εξωσωματική γονιμοποίηση αποτελεί μία ευρέως διαδεδομένη τεχνική τεκνοποίησης ανά

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 02/10/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

ιαγονιδιακή τεχνολογία G. Patrinos

ιαγονιδιακή τεχνολογία G. Patrinos ιαγονιδιακή τεχνολογία Αντίστροφη γενετική Οργανισμός Γονιδίωμα ιαγονίδιο Γονίδιο Forward genetics Επαγόμενη Οργανισμός μεταλλαξογένεση Μεταλλαγμένος οργανισμός Εύρεση και μελέτη του υπεύθυνου γονιδίου

Διαβάστε περισσότερα

«Εμβρυομητρική Ιατρική» 23-24 Οκτωβρίου 2010 «ΑΤΤΙΚΟ» Νοσοκομείο Επιστημονικό Πρόγραμμα

«Εμβρυομητρική Ιατρική» 23-24 Οκτωβρίου 2010 «ΑΤΤΙΚΟ» Νοσοκομείο Επιστημονικό Πρόγραμμα ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Γ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Π.Γ.Ν «Αττικόν» Διευθυντής: Aναπλ. Καθηγ. Δηµήτριος Κασσάνος 7 o Eτήσιο Συμπόσιο 23-24 Οκτωβρίου 2010 «ΑΤΤΙΚΟ»

Διαβάστε περισσότερα

ΚΛΩΝΟΠΟΙΗΣΗ. Κλώνος: ένας πληθυσμός γενετικά ταυτόσημων οργανισμών ή κυττάρων που έχουν προκύψει από ένα μοναδικό αρχικό οργανισμό ή κύτταρο

ΚΛΩΝΟΠΟΙΗΣΗ. Κλώνος: ένας πληθυσμός γενετικά ταυτόσημων οργανισμών ή κυττάρων που έχουν προκύψει από ένα μοναδικό αρχικό οργανισμό ή κύτταρο ΚΛΩΝΟΠΟΙΗΣΗ Κλώνος: ένας πληθυσμός γενετικά ταυτόσημων οργανισμών ή κυττάρων που έχουν προκύψει από ένα μοναδικό αρχικό οργανισμό ή κύτταρο Παραδείγματα Πληθυσμός γενετικά όμοιων μικροοργανισμών σε καλλιέργειες

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΤΗΝ ΑΠΑΣΧΟΛΗΣΗ ΕΞΩΤΕΡΙΚΏΝ ΣΥΝΕΡΓΑΤΩΝ ΜΕ ΣΥΜΒΑΣΕΙΣ ΕΡΓΟΥ

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΤΗΝ ΑΠΑΣΧΟΛΗΣΗ ΕΞΩΤΕΡΙΚΏΝ ΣΥΝΕΡΓΑΤΩΝ ΜΕ ΣΥΜΒΑΣΕΙΣ ΕΡΓΟΥ Τμήμα Προσωπικού Ταχ. Δ/νση : Σωρανού του Εφεσίου 4, 115 27 Αθήνα Τηλέφωνο : 2106597617-619 - 620 E mail : atzamali@bioacademy.gr vmaridaki@bioacademy.gr Αθήνα: 30/10/2012 Αριθμ. Πρωτοκ.: 2172 ΠΡΟΣΚΛΗΣΗ

Διαβάστε περισσότερα

Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής. Το θαύµα... της ζωής!

Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής. Το θαύµα... της ζωής! Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής Το θαύµα... της ζωής! Οι Υπέρηχοι Εγκυμοσύνης... Τμήμα Υπερήχων & Εμβρυομητρικής Ιατρικής Στο Τμήμα Υπερήχων & Εμβρυομητρικής Ιατρικής της ΡΕΑ Μαιευτικής Γυναικολογικής

Διαβάστε περισσότερα

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Περιεχόμενα Ευριπίδης Μαντούδης FRCOG σύντομο βιογραφικό σημείωμα 11 λόγοι για να εμπιστευτείτε το γέννημα Ενότητα 1 Η θεραπεία εξωσωματικής γονιμοποίησης

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ Α ΕΞΑΜΗΝΟΥ ΤΜΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ

ΠΡΟΓΡΑΜΜΑ Α ΕΞΑΜΗΝΟΥ ΤΜΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ Α ΕΞΑΜΗΝΟΥ ΤΜΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ 2016-17 Εισαγωγή στη Γενική Χημεία Γενική Χημεία Ζωολογία Εισαγωγή στη Ζωολογία Αγγλικά Ι 12.00-13.00 13.00-14.00 (Εργ. Β) (Εργ. Β) (Εργ. Β) Φυσική Φυσική Γενική

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΟΛΙΚΗ ΡΟΝΙΑ: 2012-2013 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ-ΦΥΣΙΟΓΝΩΣΤΙΚΑ ΗΜΕΡΟΜΗΝΙΑ: 21/05/2013 ΤΑΞΗ: Α ΣΥΝΟΛΙΚΗ ΔΙΑΡΚΕΙΑ ΓΡΑΠΤΟΥ ΒΙΟΛΟΓΙΑΣ-ΗΜΕΙΑΣ: 2 ΩΡΕΣ

Διαβάστε περισσότερα

ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ

ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΗΘΙΚΑ ΔΙΛΗΜΜΑΤΑ ΚΑΤΑ ΤΗΝ ΕΝΑΡΞΗ ΤΗΣ ΖΩΗΣ Ενότητα 2: Η ανάπτυξη του αγέννητου ανθρώπου Μιλτιάδης Βάντσος Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 12 ΑΝΑΠΑΡΑΓΩΓΗ-ΑΝΑΠΤΥΞΗ

ΚΕΦΑΛΑΙΟ 12 ΑΝΑΠΑΡΑΓΩΓΗ-ΑΝΑΠΤΥΞΗ ΚΕΦΑΛΑΙΟ 12 ΑΝΑΠΑΡΑΓΩΓΗ-ΑΝΑΠΤΥΞΗ 2o ΔΙΑΓΩΝΙΣΜΑ - ΓΗ_Α_ΒΙΟ_0_11208 Ι. Ένα από τα τμήματα του αναπαραγωγικού συστήματος του άνδρα είναι η εκφορητική οδός του σπέρματος η οποία ξεκινά από την επιδιδυμίδα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ. Πρόγραμμα Μαθημάτων. Ακαδ. Έτος 2014-2015. Μάθημα: Ιατρική Ευθύνη και Ηθική

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ. Πρόγραμμα Μαθημάτων. Ακαδ. Έτος 2014-2015. Μάθημα: Ιατρική Ευθύνη και Ηθική ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Πρόγραμμα Μαθημάτων Ακαδ. Έτος 2014-2015 Μάθημα: Ιατρική Ευθύνη και Ηθική Ενότητα Διδάσκων / Διδάσκουσα ΜΑΘΗΜΑ 1ο 30/09/2014 Η έννοια της Βιο-ηθικής

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ. Λάρισα 28-6-2013 Πρωτ.:30529

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ. Λάρισα 28-6-2013 Πρωτ.:30529 . ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ Λάρισα 28-6-2013 Πρωτ.:30529 5 η Υγειονομική Περιφέρεια Θεσσαλίας & Στερεάς Ελλάδας Π. Γ.Ν. ΛΑΡΙΣΑΣ- Γ.Ν.ΛΑΡΙΣΑΣ«ΚΟΥΤΛΙΜΠΑΝΕΙΟ &ΤΡΙΑΝΤΑΦΥΛΛΕΙΟ» Ταχ. Δ/νση: Μεζούρλο

Διαβάστε περισσότερα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα φυσική ή μη ειδική ανοσία δεν απαιτεί προηγούμενη έκθεση στο παθογόνο και δεν διαθέτει μνήμη. σε επίκτητη ή ειδική ανοσία χυμική ανοσία με παραγωγή

Διαβάστε περισσότερα

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Χρυσούλα Πιτσούλη, Ph.D. Τμήμα Βιολογικών Επιστημών Πανεπιστήμιο Κύπρου (pitsouli@ucy.ac.cy) Η Βιολογία μελετά τη ζωή Η Βιοϊατρική αποτελεί εφαρμογή

Διαβάστε περισσότερα