ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β"


1 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Το 1928 ο Griffith χρησιµοποίησε δύο στελέχη του βακτηρίου πνευµονιόκοκκος (Dίplococcus pneumoniae),τα οποία ξεχωρίζουν µορφολογικά, όταν καλλιεργηθούν σε θρεπτικό υλικό, λόγω της παρουσίας ή µη ενός προστατευτικού καλύµµατος. Το στέλεχος που είχε κάλυµµα σχηµάτιζε λείες αποικίες και ήταν παθογόνο, δηλαδή σκότωνε τα ποντίκια που µόλυνε, ενώ εκείνο που δεν είχε κάλυµµα σχηµάτιζε αδρές αποικίες και δεν ήταν παθογόνο. Ο Griffith χρησιµοποίησε υψηλή θερµοκρασία, για να σκοτώσει τα λεία βακτήρια και µε αυτά µόλυνε ποντικούς, οι οποίοι παρέµεναν ζωντανοί. Όταν όµως ανέµειξε νεκρά λεία βακτήρια µε ζωντανά αδρά και µε το µείγµα µόλυνε ποντικούς, τότε αυτοί πέθαναν. Στο αίµα των νεκρών ποντικών βρέθηκαν ζωντανά λεία βακτήρια. Ο Griffith συµπέρανε ότι µερικά αδρά βακτήρια «µετασχηµατίστηκαν» σε λεία παθογόνα ύστερα από αλληλεπίδραση µε τα νεκρά λεία βακτήρια, αλλά δεν µπόρεσε να δώσει ικανοποιητική απάντηση για το πώς γίνεται αυτό Β2. Τέλος, βλάβες στους µηχανισµούς επιδιόρθωσης του DΝΑ έχουν ως αποτέλεσµα την αυξηµένη συχνότητα εµφάνισης καρκίνου. Τα άτοµα, για παράδειγµα, που πάσχουν από µελαγχρωµατική ξηροδερµία εµφανίζουν πολλαπλάσια συχνότητα καρκίνων του δέρµατος, κυρίως στις περιοχές που εκτίθενται στην ακτινοβολία του ήλιου, σε σχέση µε τα φυσιολογικά άτοµα. Είναι γνωστό ότι η ασθένεια δηµιουργείται από ανικανότητα επιδιόρθωσης βλαβών που προκαλούνται από την υπεριώδη ακτινοβολία λόγω µετάλλαξης των γονιδίων που κωδικοποιούν τα επιδιορθωτικά ένζυµα. Β3. α) Το σύνολο των βακτηριακών κλώνων που περιέχει το συνολικό DΝΑ του οργανισµού δότη και αποτελεί µία γονιδιωµατική βιβλιοθήκη. β) Αν θέλουµε να κλωνοποιήσουµε µόνο τα γονίδια που εκφράζονται σε συγκεκριµένα κύτταρα, τότε κατασκευάζουµε τις cdna βιβλιοθήκες. Οι cdna βιβλιοθήκες περιέχουν αντίγραφα των mrna όλων των γονιδίων που εκφράζονται στα κύτταρα αυτά και έχουν το πλεονέκτηµα αποµόνωσης µόνο των αλληλουχιών των γονιδίων που µεταφράζονται σε αµινοξέα, δηλαδή των εξωνίων.

2 Β4. Στα βακτήρια το DNA είναι δίκλωνο κυκλικό µόριο. Με βάση τον κανόνα της συµπληρωµατικότητας, στο δίκλωνο µόριο DNA ισχύει Α=Τ και G=C. Συνεπώς, στο πρώτο µόριο Α=Τ= 28% και G=C=22%. Στο δεύτερο, Α=Τ=22% και G=C=28%. Επίσης, βρέθηκε ότι η αναλογία των βάσεων [(Α+ T)/(G+C)] διαφέρει από είδος σε είδος και σχετίζεται µε το είδος του οργανισµού. Άρα ο λόγος για το πρώτο είναι 56/44 και για το δεύτερο 44/56, οπότε ανήκουν σε διαφορετικό είδος. ΘΕΜΑ Γ Γ1. Στο φυτό µοσχοµπίζελο το χρώµα των σπερµάτων µπορεί να είναι είτε κίτρινο είτε πράσινο. Το επικρατές αλληλόµορφο που είναι υπεύθυνο για το κίτρινο χρώµα σπέρµατος συµβολίζεται µε Κ ενώ το υπολειπόµενο αλληλόµορφο που είναι υπεύθυνο για το πράσινο χρώµα σπέρµατος συµβολίζεται µε το κ. Το επικρατές αλληλόµορφο που καθορίζει το ψηλό φυτό συµβολίζεται µε Ψ και το υπολειπόµενο αλληλόµορφο που καθορίζει το κοντό φυτό συµβολίζεται µε το ψ. Τα ψηλά φυτά µε κίτρινα σπέρµατα µπορεί να έχουν 4 διαφορετικούς γονότυπους: ΨΨΚΚ, ΨψΚΚ, ΨΨΚκ και ΨψΚκ. Για να βρούµε τους γονότυπους κάνουµε 4 διασταυρώσεις ελέγχου. ιασταύρωση ελέγχου ονοµάζεται η διασταύρωση ενός ατόµου άγνωστου γονότυπου µε ένα άτοµο οµόζυγο για το υπολειπόµενο αλληλόµορφο. Σύµφωνα µε τον 1 ο νόµο του Mendel ή νόµο του διαχωρισµού των αλληλόµορφων γονιδίων, κατά τη µείωση διαχωρίζονται τα οµόλογα χρωµοσώµατα και κατά συνέπεια και τα αλληλόµορφα γονίδια που βρίσκονται σ αυτά και σχηµατίζονται οι γαµέτες. Έτσι, κάθε γαµέτης περιέχει ένα µόνο από τα δύο αλληλόµορφα κάθε γονιδίου. Επίσης, σύµφωνα µε τον 2 ο νόµο του Mendel, της ανεξάρτητης µεταβίβασης των γονιδίων, η µεταβίβαση στους γαµέτες ενός γονιδίου που ελέγχει ένα χαρακτήρα δεν επηρεάζει τη µεταβίβαση του γονιδίου που ελέγχει έναν άλλο χαρακτήρα, αρκεί τα δύο γονίδια να βρίσκονται σε διαφορετικά ζεύγη οµολόγων χρωµοσωµάτων. Οι απόγονοι προκύπτουν από τον τυχαίο συνδυασµό των γαµετών των δύο γονέων. α) P: ΨΨΚΚ (x) ψψκκ Γαµέτες: ΨΚ, ψκ F1: ΨψΚκ Φαινοτυπική αναλογία: Όλα ψηλά φυτά µε κίτρινα σπέρµατα β) P: ΨψΚΚ (x) ψψκκ Γαµέτες: ΨΚ, ψκ, ψκ F1: ΨψΚκ, ψψκκ Φαινοτυπική αναλογία: 1 ψηλό φυτό µε κίτρινα σπέρµατα : 1 κοντό φυτό µε κίτρινα σπέρµατα

3 γ) P: ΨΨΚκ (x) ψψκκ Γαµέτες: ΨΚ, Ψκ, ψκ F1: ΨψΚκ, ΨΨκκ Φαινοτυπική αναλογία: 1 ψηλό φυτό µε κίτρινα σπέρµατα : 1 ψηλό φυτό µε πράσινα σπέρµατα δ) P: ΨψΚκ (x) ψψκκ Γαµέτες: ΨΚ, Ψκ, ψκ, ψκ, ψκ F1: ΨψΚκ, Ψψκκ, ψψκκ, ψψκκ Φαινοτυπική αναλογία: 1 ψηλό φυτό µε κίτρινα σπέρµατα : 1 ψηλό φυτό µε πράσινα σπέρµατα : 1 κοντό φυτό µε κίτρινα σπέρµατα :1 κοντό φυτό µε πράσινα σπέρµατα Συνεπώς από τις φανοτυπικές αναλογίες των απογόνων µπορούµε να εξακριβώσουµε το γονότυπο του αρχικού ατόµου. Γ2. Τα άτοµα που πάσχουν από το σύνδροµο Τurner έχουν φυσιολογικό αριθµό αυτοσωµικών χρωµοσωµάτων (44) αλλά µόνο ένα χρωµόσωµα Χ από το ζεύγος των φυλετικών χρωµοσωµάτων (ΧΟ). Αυτή είναι η µοναδική µονοσωµία που έχει βρεθεί στον άνθρωπο. Τα άτοµα αυτά δεν εµφανίζουν δευτερογενή χαρακτηριστικά του φύλου, παρ' όλο που έχουν φαινότυπο θηλυκού ατόµου, και είναι στείρα. Τα άτοµα µε σύνδροµο Turner (ΧΟ) µπορούν να προκύψουν από µη διαχωρισµό των οµόλογων χρωµοσωµάτων ή των αδελφών χρωµατίδων κατά την 1 η ή 2 η µειωτική διαίρεση αντίστοιχα (κατά τη δηµιουργία των γαµετών) τόσο στη µητέρα όσο και στον πατέρα. ηλαδή Μη ιαχωρισµός Οµολόγων Χρωµοσωµάτων (Μείωση Ι) στη µητέρα, Φυσιολογικός ιαχωρισµός στον πατέρα. Έτσι προκύπτει θηλυκός γαµέτης χωρίς φυλετικό χρωµόσωµα, ο οποίος γονιµοποιήθηκε από αρσενικό γαµέτη µε Χ φυλετικό χρωµόσωµα και προέκυψε το άτοµο ΧΟ. Μη ιαχωρισµός Οµολόγων Χρωµοσωµάτων (Μείωση Ι) στον πατέρα, Φυσιολογικός ιαχωρισµός στη µητέρα Έτσι προκύπτει αρσενικός γαµέτης χωρίς φυλετικό χρωµόσωµα, ο οποίος γονιµοποίησε θηλυκό γαµέτη µε Χ φυλετικό χρωµόσωµα και προέκυψε το άτοµο ΧΟ. Μη ιαχωρισµός Αδελφών Χρωµατίδων (Μείωση ΙΙ) στη µητέρα, Φυσιολογικός ιαχωρισµός στον πατέρα Έτσι προκύπτει θηλυκός γαµέτης χωρίς φυλετικό χρωµόσωµα, ο οποίος γονιµοποιήθηκε από αρσενικό γαµέτη µε Χ φυλετικό χρωµόσωµα και προέκυψε το άτοµο ΧΟ. Μη ιαχωρισµός Αδελφών Χρωµατίδων (Μείωση ΙΙ) στον πατέρα, Φυσιολογικός ιαχωρισµός στη µητέρα Έτσι προκύπτει αρσενικός γαµέτης χωρίς φυλετικό χρωµόσωµα, ο οποίος γονιµοποίησε θηλυκό γαµέτη µε Χ φυλετικό χρωµόσωµα και προέκυψε το άτοµο ΧΟ.

4 Γ3. Η αλληλουχία του γονιδίου είναι µεγαλύτερη από αυτή που κωδικοποιεί τη συγκεκριµένη πολυπεπτιδική αλυσίδα γιατί στο γονίδιο περιέχονται: - οι αλληλουχίες λήξης της µεταγραφής - τα εσώνια - οι 5 και 3 αµετάφραστες περιοχές - το κωδικόνιο λήξης. - Επίσης, η πρωτεΐνη αυτή προκειµένου να καταστεί βιολογικά λειτουργική είναι δυνατό να υπέστη µετά-µεταφραστική επεξεργασία, ωρίµανση µε αποκοπή είτε αµινοξέων από το αµινικό άκρο ή ενδιάµεσου πεπτιδίου, οπότε το αντίστοιχο γονίδιο θα διαθέτει και την αλληλουχία των νουκλεοτιδίων που αντιστοιχούν σ αυτά τα αποµακρυθέντα αµινοξέα. - Το γονίδιο είναι δίκλωνο και µεταγράφεται µόνο η µη-κωδική αλυσίδα ΘΕΜΑ 1. Οι DΝΑ πολυµεράσες λειτουργούν µόνο προς καθορισµένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3' άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόµενης αλυσίδας. Έτσι, λέµε ότι αντιγραφή γίνεται µε προσανατολισµό 5' προς 3'. Κάθε νεοσυντιθέµενη αλυσίδα θα έχει προσανατολισµό 5' 3'. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τµήµα DΝΑ που γίνεται η αντιγραφή, η σύνθεση του DΝΑ είναι συνεχής στη µια αλυσίδα και ασυνεχής στην άλλη. 2. Επειδή οι DNA πολυµεράσες δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύµπλοκο που αποτελείται από πολλά ένζυµα, το πριµόσωµα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής µικρά τµήµατα RNA, συµπληρωµατικά προς τις µητρικές αλυσίδες, τα οποία ονοµάζονται πρωταρχικά τµήµατα. Αφού η αντιγραφή γίνεται µε φορά 5 3 και το πρωταρχικό τµήµα τοποθετείται στη θέση έναρξης της αντιγραφής, συνεπώς και αυτό θα έχει κατεύθυνση 5 3. Άρα το πρωταρχικό τµήµα είναι το ακόλουθο: 5 - UCAGAUCU ATG-TCG-CGA-TGC-AAG-TTC-TAΑ -3

5 CAAGTTCTAAT GTTCAAGATTA TACATGTCGCGATGATTAGAACTTG CTCAATAΤCTT-3 3 ATGTACAGCGCTACTAATCTTGAAC GAGTTATΑGAA-5 Η αναστροφή δηµιουργείται από θραύσεις σε δύο διαφορετικά σηµεία ενός χρωµοσώµατος και επανένωση του τµήµατος ύστερα από αναστροφή. Για να µπορέσει να γίνει η επανένωση θα πρέπει τα νουκλεοτίδια στα άκρα του θραύσµατος να επασυνδεθούν µε 3 5 φωσφοδιεστερικούς δεσµούς στα σηµεία θραύσης. Συνεπώς, µετά την αναστροφή, θα πρέπει να έχουν τον ίδιο προσανατολισµό και τις ίδιες ελεύθερες οµάδες (φωσφορική ή υδροξύλιο) Στο συγκεκριµένο µόριο DNA το νουκλεοτίδιο του θραύσµατος που φέρει ως αζωτούχο βάση την C στην πάνω αλυσίδα έχει ελεύθερη P οµάδα στον 5 άνθρακα της πεντόζης του, και µετά την αναστροφή εξακολουθεί να έχει τον ίδιο προσανατολισµό και την ίδια ελεύθερη οµάδα. Οπότε συνδέεται µε 3 5 φωσφοδιεστερικό δεσµό µε το ελεύθερο υδροξύλιο στον 3 άνθρακα της πεντόζης του νουκλεοτίδιου που φέρει ως αζωτούχο βάση τη G. Τα ίδια ισχύουν και για το νουκλεοτίδιο του θραύσµατος που φέρει ως αζωτούχο βάση την Α. Τα νουκλεοτίδια, στα άκρα του θραύσµατος που φέρουν ως αζωτούχες βάσεις τη G και τη Τ έχουν ελεύθερο ΟΗ στον 3 άνθρακα της πεντόζης τους και µετά την αναστροφή εξακολουθούν να έχουν τον ίδιο προσανατολισµό και την ίδια ελεύθερη οµάδα οπότε και πάλι σχηµατίζεται ο 3 5 φωσφοδιεστερικός δεσµός. Τα κωδικόνια του µορίου DNA που κωδικοποιούν το νέο πεπτίδιο είναι: 5 ATG-TCG-CGA-TGA -3



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2011 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2011 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Β. Σελ. 3, σχολικού βιβλίου : «Το 928 ο Griffith πώς γίνεται αυτό». Β2. Σελ. 0, σχολικού βιβλίου : «βλάβες στους µηχανισµούς

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α, Α2 δ, Α3 γ, Α4 β, Α5 β ΘΕΜΑ Β Β1. Σελ. 13 βιβλίου: «το 1928...με τα νεκρά λεία βακτήρια» Β2. Σελ. 101 βιβλίου: «βλάβες στους μηχανισμούς... τα επιδιορθωτικά

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β2. σελ. 101 σχολικού βιβλίου "Βλάβες στους μηχανισμούς επιδιόρθωσης τα επιδιορθωτικά ένζυμα".

Β2. σελ. 101 σχολικού βιβλίου Βλάβες στους μηχανισμούς επιδιόρθωσης τα επιδιορθωτικά ένζυμα. ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ. 13 σχολικού βιβλίου "Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη αλλά δεν μπόρεσε να δώσει ικανοποιητική απάντηση για το πώς γίνεται αυτό" Β2. σελ.

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β


Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2015 ΘΕΜΑ Α Α1. β, Α2. γ, Α3. α, Α4. δ, Α5. γ ΘΕΜΑ Β Β1. 1-Α, 2-Β, 3-Β, 4-Α, 5-Α, 6-Α, 7-Β, 8-Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΘΕΜΑ 1 ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 ο 1. Σελ. 109 σχολ. Βιβλίου: Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

Β1. Η απάντηση περιέχεται στις σελ.13 του σχολικού βιβλίου από «Το 1928 ο Griffith για το πως γίνεται αυτό».

Β1. Η απάντηση περιέχεται στις σελ.13 του σχολικού βιβλίου από «Το 1928 ο Griffith για το πως γίνεται αυτό». Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΗ ΒΙΟΕΠΙΣΗΜΟΝΩΝ ΘΕΜΑ Α 1. αντιστοιχεί στο α 2. αντιστοιχεί στο δ 3. αντιστοιχεί στο γ 4. αντιστοιχεί στο β 5. αντιστοιχεί στο β ΘΕΜΑ Β Β1. Η απάντηση περιέχεται στις σελ.13

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα