Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου Απαντήσεις Θεμάτων

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων"


1 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA A2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του: γ. trna A3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται: β. μετασχηματισμός A4. Στην εκθετική φάση σε μία κλειστή καλλιέργεια, ο αριθμός των μικροοργανισμών: γ. αυξάνεται ταχύτατα A5. Με τη γονιδιακή θεραπεία: β. γίνεται εισαγωγή του φυσιολογικού αλληλομόρφου γονιδίου ΘΕΜΑ Β Β1. Τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι: Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Η διάγνωση των γενετικών ασθενειών μπορεί να πραγματοποιηθεί: Με τη μελέτη του καρυότυπου, όπως για παράδειγμα κατά τον προγεννητικό έλεγχο. Με διάφορες βιοχημικές δοκιμασίες. Με την ανάλυση της αλληλουχίας των βάσεων του DNA (μοριακή διάγνωση). Σελ.98 του σχολικού βιβλίου Β4. Διαγονιδιακά ονομάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθεί το γενετικό υλικό τους με την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδος. Γενικά, τα ζώα που έχουν που έχουν υποστεί γενετική αλλαγή με τη χρήση των τεχνικών Γενετικής Μηχανικής ονομάζονται διαγονιδιακά ή γενετικά τροποποιημένα. Σελ.133 και 131 του σχολικού βιβλίου

2 Β5. Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες. Ο όρος ζύμωση παλιότερα χρησιμοποιείτο μόνο για αναερόβιες διεργασίες αλλά σήμερα χρησιμοποιείται με την ευρεία έννοια και περιλαμβάνει όλες τις διεργασίες, αερόβιες και αναερόβιες. Τα προϊόντα της ζύμωσης είναι είτε τα ίδια τα κύτταρα που ονομάζονται βιομάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά. Σελ.109 του σχολικού βιβλίου. ΘΕΜΑ Γ Γ1. Η μονογονιδιακή ασθένεια οφείλεται σε υπολειπόμενο γονίδιο. Περιγραφικά: Αν είναι αυτοσωμικό τότε από τη διασταύρωση των φυσιολογικών γονέων Ι1 και Ι2 γεννιέται ο απόγονος ΙΙ3 που πάσχει από την ασθένεια. Αυτό σημαίνει ότι το γονίδιο α που είναι υπεύθυνο για την εμφάνιση της ασθένειας υπήρχε στους γονείς αλλά δεν εκφράστηκε. Άρα είναι το υπολειπόμενο και η έκφρασή του στους γονείς καλύφθηκε από το φυσιολογικό που είναι το επικρατές. Αν είναι φυλοσύνδετο τότε η μητέρα Ι2 που εκφράζει τον υπολειπόμενο φαινότυπο είναι ομόζυγη στο υπολειπόμενο, γιατί ένα υπολειπόμενο φυλοσύνδετο αλληλόμορφο εκφράζεται φαινοτυπικά σε όλα τα αρσενικά άτομα που το φέρουν αλλά μόνο σε εκείνα τα θηλυκά που είναι ομόζυγα στο υπολειπόμενο γονίδιο. Άρα μεταβιβάζει μόνο το υπολειπόμενο αλληλόμορφο στους απογόνους της. Οι αρσενικοί απόγονοι κληρονομούν το Υ χρωμόσωμά τους από τον πατέρα και το Χ από τη μητέρα. Εφόσον η μητέρα μεταβιβάζει μόνο το υπολειπόμενο αλληλόμορφο αποκλείεται να αποχτήσει αρσενικό απόγονο που εκφράζει τον επικρατή φαινότυπο. Όμως ο απόγονος ΙΙ3 που πάσχει εκφράζει τον επικρατή φαινότυπο. Άρα η περίπτωση της επικρατούς φυλοσύνδετης κληρονομικότητας απορρίπτεται. Με διασταυρώσεις: Έστω ότι το γονίδιο που είναι υπεύθυνο για την εμφάνιση της ασθένειας είναι αυτοσωμικό επικρατές. Τότε ισχύει: Α: αλληλόμορφο υπεύθυνο για την εμφάνιση της ασθένειας α: φυσιολογικό αλληλόμορφο Οι γονείς Ι1 και Ι2 εφόσον δεν πάσχουν, εκφράζουν τον υπολειπόμενο φαινότυπο και είναι ομόζυγοι στο υπολειπόμενο με γονότυπο αα. Η διασταύρωση μεταξύ τους θα ήταν η εξής:

3 P : αα X αα Γαμέτες : α α αα Γον. Αναλ: όλα αα Φαιν. Αναλ. : όλα φυσιολογικά Από την παραπάνω διασταύρωση δεν γεννιούνται απόγονοι που πάσχουν από την ασθένεια, ενώ ο απόγονος ΙΙ3, πάσχει. Άρα η περίπτωση η ασθένεια να οφείλεται σε επικρατές αυτοσωμικό γονίδιο απορρίπτεται. Έστω ότι το γονίδιο που είναι υπεύθυνο για την εμφάνιση της ασθένειας είναι φυσύνδετο επικρατές. Τότε ισχύει: Χ Α : αλληλόμορφο υπεύθυνο για την εμφάνιση της ασθένειας Χ α : φυσιολογικό αλληλόμορφο Οι γονείς Ι1 και Ι2 που δεν πάσχουν εκφράζουν τον υπολειπόμενο φαινότυπο και έχουν γονότυπο Χ α Υ και Χ α Χ α αντίστοιχα, γιατί ένα υπολειπόμενο φυλοσύνδετο αλληλόμορφο εκφράζεται φαινοτυπικά σε όλα τα αρσενικά άτομα που το φέρουν αλλά μόνο σε εκείνα τα θηλυκά που είναι ομόζυγα στο υπολειπόμενο γονίδιο. Η διασταύρωση μεταξύ τους είναι η εξής: P : X α Υ X Χ α Χ α Γαμέτες : X α, Υ Χ α X α Υ, Χ α Χ α Γον. Αναλ: 1 X α Υ : 1Χ α Χ α Φαιν. Αναλ. : 1αρσενικό φυσιολογικό: 1 θηλυκό φυσιολογικό Από την παραπάνω διασταύρωση δεν γεννιούνται απόγονοι που πάσχουν από την ασθένεια, αλλά ο απόγονος ΙΙ3 πάσχει. Άρα η περίπτωση η ασθένεια να οφείλεται σε επικρατές φυλοσύνδετο γονίδιο απορρίπτεται. Γ2. Η ασθένεια κληρονομείται ως αυτοσωμικός χαρακτήρας. Περιγραφικά: Από τη διασταύρωση των γονέων ΙΙ4 και ΙΙ5 γεννιέται ο θηλυκός απόγονος ΙΙΙ4 που πάσχει από την ασθένεια. Η περίπτωση της φυλοσύνδετης κληρονομηκότητας αποκλείεται επειδή ο αρσενικός γονέας μεταβιβάζει το μοναδικό Χ χρωμόσωμά που έχει σε όλους τους θηλυκούς απογόνους. Επειδή εκφράζει τον επικρατή φαινότυπο, έχει το επικρατές αλληλόμορφο το οποίο μεταβιβάζει σε όλες τις κόρες, άρα αποκλείεται να πάσχουν. (ο αρσενικός γονέας όταν

4 μεταβιβάζει το Υ χρωμόσωμα γεννιέται αρσενικός απόγονος). Εφόσον η κόρη ΙΙΙ1 πάσχει αποκλείεται η περίπτωση της φυλοσύνδετης υπολειπόμενης κληρονομικότητας. Άρα η ασθένεια κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Α: φυσιολογικό αλληλόμορφο α: αλληλόμορφο υπεύθυνο για την εμφάνιση της ασθένειας Η διασταύρωση μεταξύ των ατόμων Ι1 και Ι2 είναι η εξής: P : Αα X Αα Γαμέτες : Α, α Α, α ΑΑ, Αα, Αα, αα Γον. Αναλ: 1ΑΑ : 2Αα : 1αα Φαιν. Αναλ. : 3 φυσιολογικά: 1 ασθενές Γεννιούνται απόγονοι φυσιολογικοί και απόγονοι που πάσχουν όπως προκύπτει και στο γενεαλογικό δέντρο. Η διασταύρωση μεταξύ των ατόμων ΙΙ4 και ΙΙ5 είναι η εξής: P : Αα X αα Γαμέτες : Α, α α Αα, αα Γον. Αναλ: 1Αα : 1αα Φαιν. Αναλ. : 1 φυσιολογικό : 1 ασθενές Γεννιέται απόγονος που πάσχει όπως και στο γενεαλογικό δέντρο. Με διασταυρώσεις: Αν το γνώρισμα οφείλεται σε φυλοσύνδετο υπολειπόμενο γονίδιο τότε ισχύει: Χ Α : φυσιολογικό αλληλόμορφο Χ α : αλληλόμορφο υπεύθυνο για την εμφάνιση της ασθένειας Οι γονότυποι των γονέων ΙΙ4 και ΙΙ5 είναι οι εξής: Χ Α Υ και Χ α Χ α αντίστοιχα, επειδή ένα υπολειπόμενο φυλοσύνδετο αλληλόμορφο εκφράζεται φαινοτυπικά σε όλα τα αρσενικά άτομα που το φέρουν αλλά μόνο σε εκείνα τα θηλυκά που είναι ομόζυγα στο υπολειπόμενο γονίδιο. Η διασταύρωση θα ήταν η εξής: P : X Α Υ X Χ α Χ α Γαμέτες : X Α, Υ Χ α X α Υ, Χ Α Χ α Γον. Αναλ: 1 X α Υ : 1Χ Α Χ α Φαιν. Αναλ. : 1αρσενικό ασθενές: 1 θηλυκό φυσιολογικό

5 Από την παραπάνω διασταύρωση δε γεννιούνται θηλυκοί απόγονοι που πάσχουν, άρα η περίπτωση της υπολειπόμενης φυλοσύνδετης κληρονομικότητας απορρίπτεται. Άρα η ασθένεια κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Α: φυσιολογικό αλληλόμορφο α: αλληλόμορφο υπεύθυνο για την εμφάνιση της ασθένειας Η διασταύρωση μεταξύ των ατόμων Ι1 και Ι2 είναι η εξής: P : Αα X Αα Γαμέτες : Α, α Α, α ΑΑ, Αα, Αα, αα Γον. Αναλ: 1ΑΑ : 2Αα : 1αα Φαιν. Αναλ. : 3 φυσιολογικά : 1 ασθενές Γεννιούνται απόγονοι φυσιολογικοί και απόγονοι που πάσχουν όπως προκύπτει και στο γενεαλογικό δέντρο. Η διασταύρωση μεταξύ των ατόμων ΙΙ4 και ΙΙ5 είναι η εξής: P : Αα X αα Γαμέτες : Α, α α Αα, αα Γον. Αναλ: 1Αα : 1αα Φαιν. Αναλ. : 1 φυσιολογικό : 1 ασθενές 1 ασθενές Γεννιέται απόγονος που πάσχει όπως και στο γενεαλογικό δέντρο. Γ3. Με βάση τα δεδομένα του γενεαλογικού δέντρου οι πιθανοί γονότυποι είναι οι εξής: ΙΙ1: ΑΑ ή Αα ΙΙ2: ΑΑ ή Αα ΙΙ3: αα ΙΙ4: Αα Γ4. Οι γονότυποι των ατόμων ΙΙ1 και ΙΙ2 είναι οι εξής: ΙΙ1: ΑΑ ΙΙ2: Αα

6 Οι ανώτεροι ευκαρυωτικοί οργανισμοί όπως είναι ο άνθρωπος είναι διπλοειδείς. Σε κάθε σωματικό τους κύτταρο έχουν 2 αντίγραφα της γενετικής τους πληροφορίας και έχουν τα χρωμοσώματά τους σε ζεύγη ομόλογων χρωμοσωμάτων. Τα ομόλογα χρωμοσώματα έχουν την ίδια μορφολογία και ελέγχουν τις ίδιες γενετικές ιδιότητες. Άρα για τις γενετικές ιδιότητες υπάρχουν δύο αλληλόμορφα γονίδια να τις ελέγχουν, ένα σε κάθε ομόλογο χρωμόσωμα. Όταν ένα άτομο είναι ομόζυγο στο επικρατές γονίδιο έχει 2 φυσιολογικά αλληλόμορφα, τα οποία δεν υβριδοποιούνται. Άρα στο άτομο ΙΙ1 που δεν πραγματοποιείται υβριδοποίηση έχει μόνο το φυσιολογικό γονίδιο και είναι ομόζυγο στο επικρατές. Όταν ένα άτομο είναι φορέας έχει ένα φυσιολογικό και ένα μεταλλαγμένο αλληλόμορφο. Σε αυτή την περίπτωση πραγματοποιείται μόνο μία υβριδοποίηση στο μεταλλαγμένο γονίδιο. Άρα το άτομο ΙΙ2 είναι φορέας. (στο άτομο ΙΙ3 που πάσχει, πραγματοποιούνται 2 υβριδοποιήσεις γιατί έχει 2 μεταλλαγμένα αλληλόμορφα και είναι ομόζυγο στο υπολειπόμενο). ΘΕΜΑ Δ Δ1. Η κωδική αλυσίδα είναι η αλυσίδα I. Ο προσανατολισμός των αλυσίδων είναι ο παρακάτω: 5 AGCTATGACCATGATTACGGATTCACTG 3 αλυσίδα Ι. 3 TCGATACTGGTACTAATGCCTAAGTGAC 5 αλυσίδα ΙΙ Η μεταγραφή έχει προσανατολισμό 5' 3'. Το μόριο RNA που συντίθεται είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Σύμφωνα με το μοντέλο της διπλής έλικας οι δύο αλυσίδες του DNA είναι αντιπαράλληλες (το 3' άκρο της μιας είναι απέναντι από το 5' άκρο της άλλης) και επειδή το RNA είναι συμπληρωματικό με την μη κωδική αλυσίδα, θα είναι αντιπαράλληλο με αυτή, και θα έχει τον ίδιο προσανατολισμό με την κωδική αλυσίδα του DNA του γονιδίου. Ο γενετικός κώδικας έχει κωδικόνιο έναρξης και κωδικόνια λήξης. Το κωδικόνιο έναρξης σε όλους τους οργανισμούς είναι το AUG και κωδικοποιεί το αμινοξύ μεθειονίνη. Υπάρχουν τρία κωδικόνια λήξης, τα UAG, UGA και UAA. Άρα το mrna που κωδικοποιεί τα 8 πρώτα αμινοξέα με προσανατολισμό 5' 3' θα έχει κωδικόνιο έναρξης ΑUG. Ο όρος κωδικόνιο δεν αφορά μόνο το mrna αλλά και το γονίδιο από το οποίο παράγεται. Το κωδικόνιο έναρξης AUG αντιστοιχεί στο κωδικόνιο έναρξης της κωδικής αλυσίδα του γονιδίου ATG. Άρα στο παραπάνω τμήμα DNA η αλυσίδα Ι που με προσανατολισμό 5' 3' έχει κωδικόνιο έναρξης ATG και ακολουθούν 7 κωδικόνια που κωδικοποιούν αμινοξέα, είναι η κωδική αλυσίδα. Δ2.

7 Η αλληλουχία βάσεων του mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου είναι η εξής: 5' AGCUAUGACCAUGAUUACGGAUUCACUG 3' ''Κατά την έναρξη της μεταγραφής... επιτρέπουν την απελευθέρωση του''. Σελ.32 και 33 σχολικού βιβλίου Δ3. Κατά την έναρξη της μετάφρασης το mrna προσδένεται, μέσω μιας αλληλουχίας που υπάρχει στην 5' αμετάφραστη περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος, σύμφωνα με τον κανόνα συμπληρωματικότητας των αζωτούχων βάσεων. Άρα, το τμήμα του mrna στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης είναι η 5' αμετάφραστη περιοχή του, δηλαδή η αλληλουχία πριν το κωδικόνιο έναρξης που είναι η 5' AGCU 3'. Δ4. Η μεταλαγμένη πρωτεΐνη αποτελείται από δύο λιγότερα αμινοξέα. Αυτό μπορεί να συνέβει αν πραγματοποιήθηκε μία αντικατάσταση βάσης στο κωδικόνιο έναρξης της κωδικής αλυσίδας ATG που είχε αποτέλεσμα να μετατραπεί σε κωδικόνιο που κωδικοποιεί άλλο αμινοξύ. Άρα η έναρξη της μεταγραφής θα ξεκινήσει από το επόμενο κωδικόνιο έναρξης (ATG), το οποίο είναι το τρίτο κωδικόνιο της κωδικής αλυσίδας. Άρα η μεταλαγμέμη πρωτεΐνη θα αποτελείται από δύο λιγότερα αμινοξέα, γιατί η μετάφραση θα ξεκινήσει από το 3 ο κωδικόνιο. Δ5. Το τροποποιημένο mrna του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης φέρει 4 επιπλέον διαδοχικές βάσεις μεταξύ του 3 ου και 4 ου κωδικονίου του. Άρα η μετάλλαξη στην κωδική αλυσίδα του γονιδίου είναι προσθήκη 4 διαδοχικών βάσεων ανάμεσα στο 3 ο και 4 ο κωδικόνιο. Επειδή ο αριθμός των βάσεων που προστέθηκαν είναι διαφορετικός του τρία ή πολλαπλασίων του, αλλάζουν όλα τα κωδικόνια που ακολουθούν και η αλληλουχία των αμινοξέων της παραγόμενης πρωτεΐνης δεν εμφανίζει πλέον πολλές ομοιότητες με την αρχική. Ο καταστολέας είναι μια πρωτεΐνη που προσδένεται ισχυρά στο χειριστή και δεν επιτρέπει στην RNA πολυμεράση που προσδένεται στον υποκινητή να μεταγράψει τα τρία δομικά γονίδια. Το αποτέλεσμα της μετάλλαξης θα είναι ότι ο τροποποιημένος καταστολέας δεν θα προσδένεται στο χειριστή. Σε αυτή την περίπτωση η RNA πολυμεράση είναι ελεύθερη να αρχίσει τη μεταγραφή των δομικών γονιδίων του οπερονίου ανεξάρτητα από την απουσία της λακτόζης και της γλυκόζης στο θρεπτικό υλικό. Άρα θα παράγονται συνεχώς τα ένζυμα που μεταβολίζουν τη λακτόζη. Επιμέλεια: Αναστασίου Γιάννης

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α: Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β: Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάση ε. RNA πολυμεράση Β3.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημερομηνία: 19 Ιουνίου 2018

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημερομηνία: 19 Ιουνίου 2018 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημερομηνία: 19 Ιουνίου 2018 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4. α Α5. β

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ :


Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Β.2 Σελίδα 24 σχ. βιβλίο. «Κάθε φυσιολογικό μεταφασικό καρυότυπο.» και «Ο αριθμός και η μορφολογία ζεύγος ΧΧ.»


Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 19/06/2018 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 19/06/2018 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4. α Α5. β ΘΕΜΑ Β Β1 1-γ 2-β 3-γ 4-α 5-γ 6-γ 7-β Β2 Μικροοργανισμός Β σχολικό βιβλίο σελ. 112 "Το PH επηρεάζει...σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

φροντιστήρια Απαντήσεις Βιολογίας Γ λυκείου Προσανατολισμός Θετικών Σπουδών

φροντιστήρια   Απαντήσεις Βιολογίας Γ λυκείου Προσανατολισμός Θετικών Σπουδών Απαντήσεις Βιολογίας Γ λυκείου Προσανατολισμός Θετικών Σπουδών Θέμα Α Α1. α. 2 β. 1 γ. 4 δ. 1 ε. 2 Θέμα Β Β1. α. 1-Γ, 2-Γ, 3-Β, 4-Β, 5-Α, 6-B, 7-Α β. 1. Σύμπλοκο έναρξης πρωτεϊνοσύνθεσης: Το σύμπλοκο που

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ημερομηνία: Τετάρτη 3 Ιανουαρίου 2017 Διάρκεια Εξέτασης: 3 ώρες

Ημερομηνία: Τετάρτη 3 Ιανουαρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΑΠΟ ΕΩΣ 23/12/17 ΕΩΣ 05/01/2018 ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Τετάρτη 3 Ιανουαρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα