ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ"

Transcript

1 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1. Σελ. 41, «Στο γονιδίωμα των προκαρυωτικών οργανισμών σε κοινό έλεγχο της έκφρασής τους». Β2. Σελ. 14, «Η έκφραση in vivo χρησιμοποιείται 32 P στα νουκλεοτίδια για την ιχνηθέτηση του DNA». Β3. Σελ.109, «Για την ανάπτυξη τους (των μικροοργανισμών) χρησιμοποιούνται τεχνητά θρεπτικά αλλά στερεοποιείται σε μικρότερες θερμοκρασίες». Σελ.108, «Η πηγή άνθρακα για τους αυτότροφους... τα αμμωνιακά ή τα νιτρικά ιόντα». Β4. Σελ. 135, «Είναι φανερό ότι η χρησιμοποίηση διαγονιδιακών με παραδοσιακές τεχνικές» Ο τρόπος βελτίωσης της παραγωγής με τις κλασσικές μεθόδους των διασταυρώσεων είναι χρονοβόρος και επίπονος επειδή απαιτούνται συνεχείς διασταυρώσεις.

2 ΘΕΜΑ Γ Γ1. Η κωδική αλυσίδα είναι η αλυσίδα 2. Επειδή δεν γνωρίζουμε τα άκρα του τμήματος DNA διακρίνουμε 2 περιπτώσεις. 1 η περίπτωση 5 TGACTATCTGAGATTCATGTACTC3 3 ACTGATAGACTCTAAGTACATGAG5 2 η περίπτωση 3 TGACTATCTGAGATTCATGTACTC5 5 ACTGATAGACTCTAAGTACATGAG3 Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα, το πρώτο της νουκλεοτίδιο έχει πάντα μία ελεύθερη φωσφορική ομάδα συνδεδεμένη στο 5 άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο της έχει ελεύθερο το υδροξύλιο του 3 άνθρακα της πεντόζης του. Οι δυο αλυσίδες είναι αντιπαράλληλες. Παρατηρούμε ότι στην 1 η περίπτωση ξεκινώντας από το 5 άκρο της αλυσίδας 2 συναντάμε κωδικόνιο έναρξης 5ATG3 και προχωρώντας με βήμα τριπλέτας (αφού το γονίδιο είναι συνεχές και άρα δεν υπάρχουν εσώνια) καταλήγουμε σε κωδικόνιο λήξης 5TAG3. Ο γενετικός κώδικας είναι κώδικας τριπλέτας, δηλαδή μια τριάδα νουκλεοτιδίων, το κωδικόνιο, κωδικοποιεί ένα αμινοξύ. Ο γενετικός κώδικας έχει κωδικόνια έναρξης και κωδικόνια λήξης. Το κωδικόνιο έναρξης είναι το 5A UG3 στο mrna και το 5ATG3 στην κωδική αλυσίδα του DNA. Τα κωδικόνια λήξης είναι τα 5 UAG3, 5 UAA3 και 5UGA3 στο mrna και αντίστοιχα τα 5T AG3,5TAA3 και 5TGA3 στην κωδική αλυσίδα του γονιδίου. Επίσης δεν παραλείψαμε κάποιο νουκλεοτίδιο γιατι ο γενετικός κώδικας είναι συνεχής και υπολογίσαμε κάθε νουκλεοτίδιο να ανήκει σε ένα μόνο κωδικόνιο γιατί ο κώδικας είναι μη επικαλυπτόμενος. Η κατεύθυνση της μεταγραφής είναι 5 3 και το μόριο mrna που συντίθεται είναι συμπληρωματικό προς τη μια αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική.

3 Γ2. mrna 5 GAGUACAUGAAUCUCAGAUAGUCA3 Γ3. Ο υποκινητής του γονιδίου βρίσκεται στη θέση Β. Γνωρίζουμε ότι η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές. Οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου. Η μη κωδική αλυσίδα είναι η αλυσίδα 1 όπως φαίνεται στην πρώτη περίπτωση, δηλαδή, έχει το 3 άκρο της δεξιά και το 5 άκρο αριστερά. Το mrna παράγεται από την RNA πολυμεράση με κατεύθυνση 5 3 και για να συμβεί αυτό πρέπει η RNA πολυμεράση να κινηθεί από δεξιά προς τα αριστερα. Άρα ο υποκινητής βρίσκεται στη θέση Β. Γ4. i) Στο 4 ο κωδικόνιο στην κωδική αλυσίδα του DNA 5AGA3 αντικατάσταση του πρώτου νουκλεοτιδίου που φέρει αζωτούχο βάση Α με νουκλεοτίδιο που φέρει αζωτούχο βάση Τ. Έτσι, προκύπτει κωδικόνιο λήξης 5TGA3. ii) Προσθήκη ανάμεσα στο 3 ο και 4 ο κωδικόνιο ενός νουκλεοτιδίου με αζωτούχο βάση Τ. Έτσι προκύπτει πάλι κωδικόνιο λήξης 5TAG3. Γονιδιακές μεταλλάξεις είναι οι αλλαγές που αφορούν μικρό αριθμό βάσεων στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή αφαίρεση. ΘΕΜΑ Δ Δ1. Παρατηρούμε ότι από υγιείς γονείς προκύπτει παιδί που πάσχει. Άρα η ασθένεια ακολουθεί υπολειπόμενο τρόπο κληρονόμησης. Έστω ότι το αλληλόμορφο που προκαλεί την ασθένεια είναι αυτοσωμικό υπολειπόμενο. Α φυσιολογικό, επικρατεί α ασθένεια, υπολειπόμενο Για να προκύπτει από φυσιολογικούς γονείς παιδί που πάσχει πρέπει οι γονείς να είναι και οι δύο φορείς, δηλαδή ετερόζυγοι. Επομένως: Γονείς Ι 1 : Αα Ι : Αα 2 Γονείς Αα Αα Γαμέτες Αα, Αα,

4 Απόγονοι : ΑΑ, Αα, Αα, αα Γονοτυπική αναλογία : 1ΑΑ : 2Αα : 1αα Φαινοτυπική αναλογία : 3 Φυσιολογικά : 1 ασθενές Η υπόθεση είναι δεκτή γιατί προκύπτουν και φυσιολογικά (Ⅱ 1, Ⅱ 2, Ⅱ 4 ) και ασθενή (Ⅱ 3 ) παιδιά. Έστω ότι το αλληλόμορφο που προκαλεί την ασθένεια είναι φυλοσύνδετο υπολοιπόμενο Χ Α φυσιολογικό, επικρατεί Χ α ασθένεια, υπολειπόμενο Στα φυλοσύνδετα γονίδια παρατηρούνται 3 γονότυποι για τα άτομα και 2 γονότυποι για τα άτομα. Δηλαδή ΓΟΝΟΤΥΠΟΙ ΦΑΙΝΟΤΥΠΟΙ Χ Α Χ Α φυσιολογικό Χ Α Χ α φυσιολογικό Χ α Χ α ασθενές Χ Α Υ φυσιολογικό Χ α Υ ασθενές Για να προκύψει από φυσιολογικούς γονείς αγόρι που πάσχει θα πρέπει η μητέρα να είναι φορέας, δηλαδή ετερόζυγη και να έχει γονότυπο Χ Α Χ α Επομένως Ⅰ 1 : Χ Α Υ Ⅱ 2 : Χ Α Χ α Γονείς : Χ Α Χ α Χ Α Υ Γαμέτες : Χ Α,Χ α Χ Α,Υ Απόγονοι : Χ Α Χ Α, Χ Α Χ α, Χ Α Υ, Χ α Υ Γονοτυπική αναλογία : 1Χ Α Χ Α : 1Χ Α Χ α : 1Χ Α Υ : 1Χ α Υ Φαινοτυπική αναλογία : : όλα φυσιολογικά : 1 φυσιολογικό : 1 ασθενές

5 Η υπόθεση είναι δεκτή γιατί το Ⅱ 3 είναι αγόρι που πάσχει, το Ⅱ 1 είναι αγόρι φυσιολογικό ενώ όλα τα κορίτσια (Ⅱ 2, Ⅱ 4 ) είναι φυσιολογικά. Επομένως η ασθένεια μπορεί να ακολουθεί είτε αυτοσωμικό υπολειπόμενο είτε φυλοσύνδετο υπολοιπόμενο τρόπο κληρονόμησης. Όλες οι διασταυρώσεις έγιναν σύμφωνα με τον πρώτο νόμο του Mendel κατά τον οποίο τα δύο ομόλογα χρωμοσώματα και άρα και τα δύο αλληλόμορφα γονίδια διαχωρίζονται κατά την παραγωγή των γαμετών. Οι γαμέτες περιέχουν το ένα ή το άλλο αλληλόμορφο σε ίση αναλογία. Οι απόγονοι προκύπτουν από τον τυχαίο συνδυασμό των γαμετών. Δ2. Από τον πρώτο νόμο του Merdel προκύπτει ότι τα αλληλόμορφα ενός γονιδίου διαχωρίζονται στην πρώτη μειωτική διαίρεση και οι γαμέτες που προκύπτουν φέρουν το ένα ή το άλλο σε ίση πιθανότητα. Οι απόγονοι προκύπτουν από τον ελεύθερο συνδυασμό των γαμετών. Επομένως και με βάση τις προηγούμενες διασταυρώσεις, αν το γονίδιο έιναι αυτοσωμικό, η πιθανότητα να προκύψει παιδί που πάσχει είναι ¼. Η αναλογία φύλου που προκύπτει σε κάθε διασταύρωση είναι 1 (θηλυκό) : 1 (αρσενικό), δηλαδή η πιθανότητα να προκύψει αγόρι ή κορίτσι είναι ½. Αυτό αποδεικνύεται ως εξής : Τα θηλυκά άτομα έχουν 2Χ χρωμοσώματα και τα αρσενικά 1Χ και 1Υ. Δηλαδή: ΧΥ ΧΧ Γαμέτες : Χ, Υ Χ, Χ Απόγονοι : ΧΧ, ΧΧ, ΧΥ, ΧΥ Φαινοτυπική αναλογία : 1 : 1 Επειδή το γεγονός να προκύψει άτομο φυσιολογικό ή ασθενές είναι ανεξάρτητο από το γεγονός να προκύψει άτομο αρσενικό ή θηλυκό, η συνολική πιθανότητα να προκύψει αγόρι που πάσχει είναι ίση με το γινόμενο των επιμέρους πιθανοτήτων, δηλαδή 1 1 = Αν το γονίδιο είναι φυλοσύνδετο, από τα αποτελέσματα της διασταύρωσης στο υποερώτημα Δ1,προκύπτει ότι η πιθανότητα να προκύψει αγόρι που πάσχει είναι 1 4 Οι πιθανότητες ερμηνεύονται με βάση τον πρώτο νόμο του Merdel που αναφέρθηκε και δεν επηρεάζονται από τα αποτελέσματα προηγούμενων κυήσεων γιατί κάθε κύηση αποτελεί ανεξάρτητο γεγονός.

6 Δ3. Γνωρίζουμε ότι οι περιοριστικές ενδονουκλεάσες είναι ένζυμα που αναγνωρίζουν ειδικές αλληλουχίες 4-8 νουκλεοτιδίων στο δίκλωνο DNA. Το ένζυμο EcoRI, όποτε συναντά την αλληλουχία 5 GAATTC 3 3 CTTAAG 5 κόβει κάθε αλυσίδα μεταξύ του G και του Α. Παρατηρούμε ότι τα τμήματα των 2000 και 500 ζευγών βάσεων αθροιστικά δίνουν το τμήμα των 2500 ζευγών βάσεων. Επομένως στα άτομα που εμφανίζουν μετά την δράση της EcoRI μόνο το τμήμα των 2500 ζευγών βάσεων θα έχουν το φυσιολογικό αλληλόμορφο, όσα εμφανίζουν μόνο τα τμήματα των 2000 και 500 ζευγών βάσεων θα έχουν μόνο το μεταλλαγμένο αλληλόμορφο και όσα άτομα έχουν και τα τρία τμήματα (2500,2000 και 500) θα έχουν και τα 2 αλληλόμορφα. Αν θεωρήσουμε ότι το γονίδιο είναι αυτοσωμικό, τότε το άτομο Ⅰ 1 θα έχει γονότυπο ΑΑ και το άτομο Ⅰ 2 γονότυπο Αα. Κάνοντας την διασταύρωση έχουμε : Γονείς : ΑΑ Αα Γαμέτες : Α,Α Α,α Απόγονοι : ΑΑ, Αα, ΑΑ, Αα Γονοτυπική αναλογία : 2ΑΑ : 2Αα Φαινοτυπική αναλογία : όλα (100%) φυσιολογικά άτομα Έτσι καταλήγουμε σε άτοπο γιατί το άτομο Ⅱ 3 πάσχει. Επομένως το γονίδιο ακολουθεί φυλοσύνδετο υπολοιπόμενο τρόπο κληρονόμησης. Το άτομο Ⅰ 1 είναι αρσενικό φυσιολογικό και έχει γονότυπο Χ Α Υ, ενώ το Ⅱ 2 θηλυκό με γονότυπο Χ Α Χ α (φορέας).το Ⅱ 1 έχει γονότυπο Χ Α Υ (φυσιολογικό αρσενικό) και το Ⅱ 2 Χ Α Χ Α (φυσιολογικό θηλυκό ομόζυγο). Το Ⅱ 3 έχει γονότυπο Χ α Υ (ασθενές αγόρι) και το Ⅱ 4 γονότυπο Χ Α Χ α (φορέας). Επιμέλεια Καθηγητών Φροντιστηρίων Βακάλη

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. α Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012 ΘΕΜΑ Α 1. α 2. γ 3. δ 4. β 5. γ ΘΕΜΑ Β 1. Σελ 120: Τα κύτταρα των οργάνων έχουν στην επιφάνειά τους ειδικά αντιγόνα επιφανείας, που αναγνωρίζονται

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΩΝ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ 2009 ΘΕΜΑ ο. γ. 2. γ. 3. β. 4. α. 5. δ. ΘΕΜΑ 2 ο. Σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α: Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β: Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάση ε. RNA πολυμεράση Β3.

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

και ο φαινότυπος τους σε σχέση µε κάποιον συγκεκριµένο χαρακτήρα. Αυτό συνεισφέρει στη µελέτη του τρόπου κληρονόµησης διαφόρων γενετικών ασθενειών. Στ

και ο φαινότυπος τους σε σχέση µε κάποιον συγκεκριµένο χαρακτήρα. Αυτό συνεισφέρει στη µελέτη του τρόπου κληρονόµησης διαφόρων γενετικών ασθενειών. Στ ΘΕΜΑ 1 1. γ 2. α 3. α 4. β 5. δ ΘΕΜΑ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΑΒΒΑΤΟ 04 ΙΟΥΝΙΟΥ 2005 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 1. Σχολικό βιβλίο σελίδα 131 «Ένας τρόπος βελτίωσης µε επιθυµητές ιδιότητες.» Σχολικό βιβλίο σελίδα

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΘΕΜΑ Α Α1 Α2 Α3 Α4 Α5 γ β α δ α ΘΕΜΑ Β Β1 Σελ. 123-124: «Η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΘΕΜΑ 1 ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 ο 1. Σελ. 109 σχολ. Βιβλίου: Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου. ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. α, Α2 γ, Α3 γ, Α4 δ, Α5 β ΘΕΜΑ Β Β1. 1Γ, 2Β, 3Α, 4Α, 5Γ, 6Α Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.»

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Αθήνα, 30/5/2012 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ www.romvos.edu.gr ΘΕΜΑ Α Α1. Η σωστή απάντηση είναι το δ. Α2. Η σωστή απάντηση είναι το γ. Α3. Η σωστή απάντηση είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α.1. γ Α.2. β Α.3. α Α.4. δ Α.5. α ΘΕΜΑ Β Β.1. Σελ.

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 30 Μαΐου 2012 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα

ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ

ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α. Α.1. γ. Α.2. β. Α.3. α. Α.4. δ.

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α : Α1. δ, Α2. γ, Α3. β, Α4. β, Α5. β Θέμα Β : Β1. Σελ.123 η παράγραφος με τίτλο «Ανοσοδιαγνωστικά» Β2. α-8, β-1, γ-6, δ-5, ε-7, στ-3 Β3. Σελ. 84

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 την κουκίδα «Για την επιλογή οργάνων συμβατών για μεταμόσχευση.» Β2. Σελ. 136 «Το πρόβατο Dolly» έως «γέννησε τη Dolly.»

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

Λεξικό Βιολογικών όρων

Λεξικό Βιολογικών όρων Λεξικό Βιολογικών όρων ονοματεπώνυμο... Χανιά 2015-2016 1 Κεφ.1 Το Γενετικό Υλικό 2 Αδελφές χρωματίδες:... Απλοειδή:... Αυτοσωμικά χρωμοσώματα:... Βακτηριοφάγος:... Διπλοειδή:... DNA:... Ιστόνες:... 3

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα