Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ"

Transcript

1 Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. 1. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται α. χειριστής. β. υποκινητής. γ. snrna. δ. δομικά γονίδια. 2. Τα νουκλεοσώματα α. αποτελούνται αποκλειστικά από DNA. β. δεν σχηματίζονται κατά τη μεσόφαση. γ. αποτελούνται από DNA που τυλίγεται γύρω από πρωτεΐνες. δ. είναι ορατά μόνο με το οπτικό μικροσκόπιο. 3. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται α. παράγοντας IX. β. αυξητική ορμόνη. γ. ινσουλίνη. δ. α1-αντιθρυψίνη. 4. Διαγονιδιακά είναι φυτά α. τα οποία έχουν υποστεί γενετική αλλαγή. β. στα οποία έχουν εισαχθεί ορμόνες. γ. τα οποία έχουν εμβολιαστεί με αντιγόνα in vitro. δ. στα οποία έχουν εισαχθεί αντιβιοτικά. 1

2 5. Μετασχηματισμός βακτηριακού κυττάρου ξενιστή είναι α. η εισαγωγή αντισώματος. β. η εισαγωγή DNA πλασμιδίου. γ. η εισαγωγή θρεπτικών συστατικών. δ. η εισαγωγή αντίστροφης μεταγραφάσης. 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2o Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Τι εννοούμε με τον όρο ζύμωση και ποια τα προϊόντα της; Μονάδες 4 2. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια είναι τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2) Μονάδες 7 3. Τι είναι η μετατόπιση και τι είναι η αμοιβαία μετατόπιση; Ποια προβλήματα μπορεί να προκαλέσει η αμοιβαία μετατόπιση στον άνθρωπο; Μονάδες 6 4. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση; Μονάδες 8 1. Σχολικό βιβλίο σελ. 109 από: «Με τον όρο ζύμωση εννοούμε έως πρωτεΐνες και αντιβιοτικά.» 2. Σχολικό βιβλίο σελ. 119, 120 από: «Τα αντισώματα μπορούν έως και τα καταστρέφουν.» Σχολικό βιβλίο σελ. 120 από: «Επιτρέπουν έτσι έως χημειοθεραπείας.» 3. Σχολικό βιβλίο σελ. 97, 98 από: «Τέλος, η μετατόπιση είναι αποτέλεσμα έως και μη-φυσιολογικοί γαμέτες.» 4. Σχολικό βιβλίο σελ. 99 από: «Παρ ότι γενετική καθοδήγηση μπορούν να ζητήσουν έως γυναίκες με πολλαπλές αποβολές.» 2

3 ΘΕΜΑ 3o Α. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες 1 και 2. Στην 1 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα I2, II2, II3 (μαυρισμένα) ενώ στην 2 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα II2, II3 (μαυρισμένα). Να προσδιορίσετε τον τρόπο κληρονόμησης του χαρακτηριστικού με βάση τα παραπάνω στοιχεία, αιτιολογώντας την απάντησή σας με τις κατάλληλες διασταυρώσεις (Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου). (μονάδες 8) Να γράψετε τους γονότυπους όλων των ατόμων. (μονάδες 5) Μονάδες 13 Β. Να υποδείξετε το μηχανισμό που μπορεί να εξηγήσει τη γέννηση ατόμου με σύνδρομο Turner από γονείς με φυσιολογικό αριθμό χρωμοσωμάτων. (μονάδες 6) Να περιγράψετε τη διαδικασία με την οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμου με σύνδρομο Turner, μετά τη γέννησή του. (μονάδες 6) Μονάδες 12 Α. Από τη 2 η οικογένεια μπορούμε να καταλάβουμε ότι το συγκεκριμένο μονογονιδιακό χαρακτηριστικό ακολουθεί υπολειπόμενο τύπο κληρονομικότητας. Εάν ήταν επικρατές τότε θα συνέβαινε το εξής: Γονείς χωρίς το χαρακτηριστικό θα εμφάνιζαν μόνο απογόνους χωρίς το χαρακτηριστικό. Απόγονοι με το χαρακτηριστικό θα διέθεταν τουλάχιστον έναν γονέα με το χαρακτηριστικό. Έστω Α: επικρατές αλληλόμορφο α: υπολειπόμενο αλληλόμορφο Οικογένεια 2 διασταύρωση: I1 (x) I2 Θα ήταν P: αα (x) αα Γαμέτες: α // α Απόγονοι: αα 3

4 Στην περίπτωση αυτή όλοι οι απόγονοι που θα προέκυπταν δε θα διέθεταν το γνώρισμα, το οποίο είναι άτοπο αφού τα άτομα II2 και II3 έχουν το γνώρισμα αυτό. Από την 1 η οικογένεια μπορούμε να καταλάβουμε ότι το χαρακτηριστικό δεν ακολουθεί φυλοσύνδετη υπολειπόμενη κληρονομικότητα διότι στην περίπτωση αυτή ο θηλυκός απόγονος II3 θα έπρεπε να είχε αρσενικό γονέα με το χαρακτηριστικό. Έστω X A : επικρατές αλληλόμορφο α : υπολειπόμενο αλληλόμορφο που καθορίζει την εμφάνιση του χαρακτηριστικού Οικογένεια 1 διασταύρωση: I1 (x) I2 Θα ήταν P: X A Υ(x) X α X α Γαμέτες: X A, Υ // X α Απόγονοι: X A X α, X α Υ Στην περίπτωση αυτή όλοι οι θηλυκοί απόγονοι που θα προέκυπταν δε θα διέθεταν το γνώρισμα. Ο μοναδικός αποδεκτός τύπος κληρονομικότητας του χαρακτηριστικού είναι ο αυτοσωμικός υπολειπόμενος. Οι γονότυποι των ατόμων των δύο οικογενειών με τον αποδεκτό τύπο κληρονομικότητας, αυτοσωμικό υπολειπόμενο, είναι οι εξής: ΟΙΚΟΓΕΝΕΙΑ 1 ΟΙΚΟΓΕΝΕΙΑ 2 I1: Αα I1: Αα I2: αα I2: Αα II1: Αα II1: ΑΑ ή Αα II2: αα II2: αα II3: αα II3: αα Για κάθε αυτοσωμική γονιδιακή θέση υπάρχει ζεύγος αλληλομόρφων γονιδίων, ένα πατρικής και ένα μητρικής προέλευσης. Πραγματοποιούνται οι κατάλληλες διασταυρώσεις που επιβεβαιώνουν τους γονότυπους των συγκεκριμένων ατόμων των δύο οικογενειών. Κάθε διασταύρωση πραγματοποιήθηκε με βάση τον 1 ο νόμο του Mendel που αναφέρει ότι: σχολικό βιβλίο σελ. 71 από: «Κατά την παραγωγή των γαμετών έως διαχωρισμού των αλληλομόρφων γονιδίων.» Σχολικό βιβλίο σελ. 79 από: «Κάθε κύηση είναι ανεξάρτητο γεγονός και δε σχετίζεται με το αποτέλεσμα των προηγούμενων κυήσεων έως μέσα σε μια οικογένεια.» Β. Σχολικό βιβλίο σελ. 96 (μηχανισμός δημιουργίας αριθμητικών χρωμοσωμικών ανωμαλιών γενικά) από: «Αν κατά τη διάρκεια έως ενώ η ύπαρξη ενός επιπλέον τρισωμία.» Επιλέγουμε μία περίπτωση. Έστω μη διαχωρισμός κατά την 1 η μειωτική σε θηλυκό άτομο. Τότε, οι γαμέτες που προκύπτουν θα είναι ως προς τη σύσταση των 4

5 φυλετικών τους χρωμοσωμάτων:, Ο. Η γονιμοποίηση του ωαρίου που δεν περιέχει φυλετικό χρωμόσωμα με σπερματοζωάριο που περιέχει το φυλετικό χρωμόσωμα οδηγεί σε ζυγωτό και κατ επέκταση σε απόγονο με σύσταση φυλετικών χρωμοσωμάτων: Ο. Σχηματικά: Πριν από την αντιγραφή Μετά την αντιγραφή Αωρο γεννητικό κύτταρο θηλυκού γονέα Μη διαχωρισµός οµόλογων χρωµοσωµάτων στην 1 η διαίρεση της µείωσης Φυσιολογικός γαµέτης Μη Φυσιολογικό ζυγωτό Ο Σχολικό βιβλίο σελ. 20,21 (παρατήρηση χρωμοσωμάτων ανθρώπου καρυότυπος) από: «Η μελέτη των χρωμοσωμάτων είναι δυνατή έως και ένα ζεύγος.» Στην περίπτωση που το άτομο έχει σύνδρομο Turner διαθέτει μόνο ένα φυλετικό χρωμόσωμα και συγκεκριμένα το χρωμόσωμα. 5

6 ΘΕΜΑ 4o Δίνεται δίκλωνο μόριο DNA το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mrna. α) Πού συναντάμε ασυνεχή γονίδια; (μονάδες 2) β) Να προσδιορίσετε τα 3 και 5 άκρα του παραπάνω μορίου DNA. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) γ) Να γράψετε το τμήμα του πρόδρομου mrna και του ώριμου mrna που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση. (μονάδες 2) δ) Πώς προκύπτει το ώριμο mrna; (μονάδες 3) ε) Μπορεί η περιοριστική ενδονουκλεάση EcoRI να κόψει το παραπάνω τμήμα DNA; (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) στ) Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cdna βιβλιοθήκη; (μονάδες 8) Μονάδες 25 α) Σχολικό βιβλίο σελ. 33 από: «Τα περισσότερα γονίδια των ευκαρυωτικών έως είναι ασυνεχή ή διακεκομμένα.» β) Το ελεύθερο υδροξύλιο υποδηλώνει την παρουσία του 3 άκρου του δοθέντος τμήματος DNA λόγω του γεγονότος ότι τα νουκλεοτίδια κάθε πολυνουκλεοτιδικής αλυσίδας συνδέονται με 3-5 φωσφοδιεστερικό δεσμό, δηλαδή ενώνεται πάντα το OH που βρίσκεται στο 3 άκρο του προηγούμενου νουκλεοτιδίου με τη φωσφορική ομάδα του επόμενου νουκλεοτιδίου. Άρα το τελευταίο νουκλεοτίδιο που τοποθετείται στην αλυσίδα θα έχει ελεύθερο OH. Επειδή κάθε πολυνουκλεοτιδική αλυσίδα έχει προσανατολισμό 5 3 το άλλο άκρο (αριστερό άκρο) είναι το 5. Οι δύο αλυσίδες είναι μεταξύ τους συμπληρωματικές και αντιπαράλληλες (μοντέλο W-C). 6

7 γ) Η κωδική αλυσίδα είναι η πάνω αλυσίδα όπως φαίνεται στο σχήμα με άκρα 5 3 Πρόδρομο mrna: 5 GAAGGAGGUUGCUUAAGGGGCCCUACCAAU 3 εσώνιο ώριμο mrna: 5 GAAGGAGGUUGCUUAACUACCAAU 3 δ) Σχολικό βιβλίο σελ. 33, 34 από: «Το πρόδρομο mrna μετατρέπεται σε mrna έως αμετάφραστες περιοχές αντίστοιχα.» ε) Η EcoRI δεν μπορεί να κόψει το παραπάνω τμήμα DNA. Αυτό συμβαίνει διότι δεν υπάρχει η αλληλουχία αναγνώρισης 5 GAATTC 3 3 CTTAAG 5 με κατεύθυνση από 5 προς 3 Σχολικό βιβλίο σελ. 57 από: «Μία από τις περιοριστικές ενδονουκλεάσες έως βάσεις στα κομμένα άκρα.» στ) Γονίδια που δεν εκφράζονται στο συγκεκριμένο κυτταρικό τύπο και οδηγούν στη σύνθεση πρωτεϊνών που δεν απαιτούνται για να επιτευχθεί η συγκεκριμένη μορφή και λειτουργία του συγκεκριμένου κυτταρικού τύπου. Γονίδια που οδηγούν στη σύνθεση των άλλων ειδών RNA, δηλαδή του trna, rrna, snrna. ( θα μπορούσε να αναφερθεί επιπλέον: γονίδια που δεν εκφράζονται τη συγκεκριμένη χρονική στιγμή λήψης του ολικού ώριμου mrna) ΑΞΙΟΛΟΓΗΣΗ Τα θέματα καλύπτουν ευρύ φάσμα της ύλης. Είναι σαφώς διατυπωμένα και απαιτούν από τον υποψήφιο καλή γνώση της θεωρίας και των εφαρμογών της. Εμφανίζουν διαβάθμιση ως προς τη δυσκολία με αποτέλεσμα μικρό ποσοστό υποψηφίων να κυμαίνεται στην κλίμακα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 16 ΣΕΠΤΕΜΒΡΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 30 Μαΐου 2012 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Να επιλέξετε τη σωστή απάντηση: 1. Σιωπηλή μετάλλαξη λόγω αντικατάστασης βάσης δε μπορεί να επιτευχθεί στο κωδικόνιο που κωδικοποιεί: α. τη βαλίνη γ. τη μεθειονίνη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη Ριζηνίας 69 & Λασαίας 21 τηλ.2810313170 www.kmathisi.com ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:..

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Α1=β,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα