Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ"

Transcript

1 Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συµπληρώνει σωστά την ηµιτελή πρόταση. 1. Τα πρωταρχικά τµήµατα κατά την αντιγραφή του DNA συντίθενται από α. την DNA πολυµεράση. β. την DNA δεσµάση. γ. το πριµόσωµα. δ. Το πολύσωµα. 2. Σε µια κλειστή καλλιέργεια οι µικροοργανισµοί διαιρούνται µε ταχύ ρυθµό α. στη λανθάνουσα φάση. β. στην εκθετική φάση. γ. στη στατική φάση. δ. στη φάση θανάτου. 3. Τα άτοµα που πάσχουν από σύνδροµο Turner έχουν στον καρυότυπό τους α. 45 χρωµοσώµατα. β. 46 χρωµοσώµατα. γ. 47 χρωµοσώµατα. δ. 44 χρωµοσώµατα. 4. Το πλασµίδιο είναι α. δίκλωνο γραµµικό µόριο DNA. β. δίκλωνο κυκλικό µόριο DNA. γ. δίκλωνο κυκλικό µόριο RNA. δ. δίκλωνο γραµµικό µόριο RNA. 1

2 5. Η κυστική ίνωση κληρονοµείται µε α. φυλοσύνδετο επικρατή τύπο κληρονοµικότητας. β. φυλοσύνδετο υπολειπόµενο τύπο κληρονοµικότητας. γ. αυτοσωµικό επικρατή τύπο κληρονοµικότητας. δ. αυτοσωµικό υπολειπόµενο τύπο κληρονοµικότητας. 1. γ 2. β 3. α 4. β 5. δ ΘΕΜΑ 2o Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ηµιαυτόνοµα (µονάδες 2) και για ποιο λόγο; (µονάδες 7) Μονάδες 7 2. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται; Μονάδες Γιατί η συχνότητα των ετερόζυγων ατόµων µε β-θαλασσαιµία είναι αυξηµένη σε περιοχές, όπως οι χώρες της Μεσογείου; Μονάδες 6 1. Σχολικό βιβλίο, σελ. 21: Τα µιτοχόνδρια και οι χλωροπλάστες έχουν δικό τους γενετικό υλικό. 2. Ο γενετικός κώδικας είναι ο κώδικας αντιστοίχισης των νουκλεοτιδίων του mrna µε τα αµινοξέα των πρωτεϊνών. Σχολικό βιβλίο, σελ. 35: Τα βασικά χαρακτηριστικά του γενετικού κώδικα είναι τα εξής:... της πολυπεπτιδικής αλυσίδας. 3. Σχολικό βιβλίο, σελ. 93: Η συχνότητα των ατόµων µε δρεπανοκυτταρική αναιµία... και δυνατότητα αναπαραγωγής. 2

3 ΘΕΜΑ 3o Η Βιοτεχνολογία µε την ανάπτυξη της τεχνολογίας του ανασυνδυασµένου DNA, τη χρήση της τεχνικής PCR και την παραγωγή µονοκλωνικών αντισωµάτων συνεισφέρει σε τοµείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική. 1. Τι επιτρέπει η µέθοδος της αλυσιδωτής αντίδρασης της πολυµεράσης (PCR); (µονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρµογές της (µονάδες 3). Μονάδες 7 2. Να περιγράψετε τη διαδικασία παραγωγής στο εργαστήριο µονοκλωνικών αντισωµάτων για ένα επιλεγµένο αντιγόνο. Μονάδες 8 3. Να περιγράψετε τη διαδικασία παραγωγής διαγονιδιακών φυτών, ανθεκτικών στα έντοµα, µε τη χρήση της τεχνολογίας του ανασυνδυασµένου DNA και του βακτηρίου Bacillus thuringiensis. Μονάδες Σχολικό βιβλίο, σελ. 61: Από: Η αλυσιδωτή αντίδραση πολυµεράσης (PCR) επιτρέπει µελέτη DNA από απολιθώµατα. 2. Σχολικό βιβλίο, σελ. 119: Από: Ήταν, εποµένως σηµαντικό,... σε µεγάλες ποσότητες. 3. Σχολικό βιβλίο, σελ. 131: Το Agrobacterium tumefaciens µπορεί να µεταφέρει γονίδια στα φυτά. Σχολικό βιβλίο, σελ. 133: Από: Το βακτήριο Βacillus thurigiensis... ποικιλίες Bt). ΘΕΜΑ 4o Τα παρακάτω γενεαλογικά δέντρα αναπαριστούν τον τρόπο µε τον οποίο κληρονοµείται στα µέλη της ίδιας οικογένειας η µερική αχρωµατοψία στο πράσινο και το κόκκινο χρώµα (γενεαλογικό δέντρο Α) και η δρεπανοκυτταρική αναιµία (γενεαλογικό δέντρο Β). 3

4 Ι 1 2 φυσιολογικό άτοµο ΙΙ 1 2 άτοµο µε µερική αχρωµατοψία στο πράσινο και το κόκκινο χρώµα Γενεαλογικό δέντρο Α Ι 1 2 φυσιολογικό άτοµο ΙΙ 1 2 άτοµο µε δρεπανοκυτταρική αναιµία Γενεαλογικό δέντρο Β Να γράψετε τους γονότυπους όλων των µελών της οικογένειας που απεικονίζεται στο γενεαλογικό δέντρο Α και να αιτιολογήσετε την απάντησή σας (µονάδες 5). Να γράψετε τους γονότυπους όλων των µελών της οικογένειας που απεικονίζεται στο γενεαλογικό δέντρο Β και να αιτιολογήσετε την απάντησή σας (µονάδες 5). Το ζευγάρι (Ι1, Ι2) περιµένει τρίτο παιδί. Να υπολογίσετε την πιθανότητα να γεννηθεί παιδί µε δρεπανοκυτταρική αναιµία και φυσιολογική όραση (µονάδες 6). Να αιτιολογήσετε την απάντησή σας (µονάδες 5). Να αναφέρετε τις διαδικασίες που ακολουθούνται κατά τον προγεννητικό έλεγχο για τη δρεπανοκυτταρική αναιµία, όταν η µητέρα βρίσκεται στην 11 η εβδοµάδα της κύησης (µονάδες 4). Γενεαλογικό δέντρο Α: Η µερική αχρωµατοψία στο κόκκινο πράσινο κληρονοµείται µε φυλοσύνδετο υπολειπόµενο τύπο κληρονοµικότητας. Συµβολίζουµε µε Χ Α το φυσιολογικό αλληλόµορφο και µε Χ α το υπολειπόµενο αλληλόµορφο που καθορίζει την εµφάνιση της ασθένειας. Οι πιθανοί γονότυποι και οι αντίστοιχοι φαινότυποι για τα αρσενικά άτοµα είναι: Χ Α Υ υγιές, Χ α Υ ασθενές. Οι πιθανοί γονότυποι και οι αντίστοιχοι φαινότυποι για τα θηλυκά άτοµα είναι: Θηλυκά άτοµα: Χ Α Χ Α και Χ Α Χ α φαινοτυπικά φυσιολογικά, Χ α Χ α ασθενές. Οι γονότυποι των ατόµων στο γενεαλογικό δέντρο είναι οι ακόλουθοι: Ι1: Χ Α Υ, Ι2: Χ α Χ α, ΙΙ1: Χ α Υ, ΙΙ2: Χ Α Χ α 4

5 Το άτοµο Ι1 έχει γονότυπο Χ Α Υ διότι είναι αρσενικό υγιές. Το άτοµο Ι2 είναι θηλυκό το οποίο πάσχει άρα έχει γονότυπο Χ α Χ α. Το άτοµο ΙΙ1 είναι αρσενικό το οποίο πάσχει άρα έχει γονότυπο Χ α Υ. Το άτοµο ΙΙ2 έχει γονότυπο Χ Α Χ α γιατί είναι φαινοτυπικά υγιές ως προς τη συγκεκριµένη ασθένεια, άρα έχει το αλληλόµορφο Χ Α το οποίο έχει κληρονοµήσει από τον αρσενικό γονέα, αλλά παράλληλα διαθέτει και το αλληλόµορφο Χ α που έχει κληρονοµήσει από τον θηλυκό γονέα, ο οποίος µόνο το Χ α αλληλόµορφο µπορεί να κληροδοτήσει στους απογόνους του. Γενεαλογικό δέντρο Β: Η δρεπανοκυτταρική αναιµία κληρονοµείται µε αυτοσωµικό υπολειπόµενο τύπο κληρονοµικότητας. Συµβολίζουµε µε β το φυσιολογικό αλληλόµορφο και µε β s το υπολειπόµενο αλληλόµορφο που καθορίζει την εµφάνιση της ασθένειας (παραγωγή τροποποιηµένης β αλυσίδας, δηλαδή της β s ). Άτοµα µε γονότυπο ββ και ββ s έχουν φυσιολογικό φαινότυπο, ενώ τα άτοµα µε γονότυπο β s β s πάσχουν από την ασθένεια. Οι γονότυποι των ατόµων στο γενεαλογικό δέντρο είναι οι ακόλουθοι: Ι1: ββ s, Ι2: ββ s, ΙΙ1: ββ ή ββ s, ΙΙ2: β s β s Το άτοµο ΙΙ2 έχει γονότυπο β s β s διότι πάσχει. Το άτοµο Ι1 έχει γονότυπο ββ s διότι είναι υγιές και αποκτά απόγονο που πάσχει. Το άτοµο Ι2 έχει γονότυπο ββ s διότι είναι υγιές και αποκτά απόγονο που πάσχει. Το άτοµο ΙΙ1 έχει πιθανούς γονότυπους ββ ή ββ s διότι έχει τουλάχιστον ένα φυσιολογικό αλληλόµορφο, αφού είναι φαινοτυπικά υγιές. Για κάθε αυτοσωµική γενετική θέση από το ζεύγος των αλληλόµορφων γονιδίων που διαθέτει ένα άτοµο, το ένα αλληλόµορφο είναι πατρικής και το άλλο µητρικής προέλευσης. Οι γονότυποι των γονέων για την ταυτόχρονη µελέτη της κληνονόµησης των δύο ασθενειών είναι: Ι1: ββ s Χ Α Υ (x) Ι2: ββ s Χ α Χ α. γαµέτες: βχ Α, βυ βχ α, β s Χ α β s Χ Α,β s Υ Με βάση το τετράγωνο του Punnett οι πιθανοί γονότυποι και φαινότυποι των απογόνων θα είναι: βχ Α βυ β s X A β s Υ βχ α ββχ Α Χ α ββχ α Υ ββ s Χ Α Χ α ββ s Χ α Υ β s X α ββ s Χ Α Χ α ββ s Χ α Υ β s β s Χ Α Χ α β s β s Χ α Υ 5

6 Γ. Α. : 1ββΧ Α Χ α : 2ββ s Χ Α Χ α : 1ββΧ α Υ : 2ββ s Χ α Υ : 1β s β s Χ Α Χ α : 1β s β s Χ α Υ Φ. Α. : 3 θηλυκά φυσιολογικά µε κανονική όραση: 1 θηλυκά µε δρεπανοκυτταρική αναιµία και κανονική όραση: 3 αρσενικά που δεν πάσχουν από δρεπανοκυτταρική αναιµία αλλά εµφανίζουν µερική αχρωµατοψία: 1 αρσενικά µε δρεπανοκυτταρική αναιµία και µε µερική αχρωµατοψία. Άρα η πιθανότητα που ζητείται είναι 1/8. Ισχύει ο 2 ος Νόµος του Mendel: «Σχολικό βιβλίο σελ. 74», διότι µελετάται ο τρόπος κληρονόµησης δύο ζευγών αλληλοµόρφων γονιδίων που στην περίπτωσή µας είναι το ένα αυτοσωµικό και το άλλο φυλοσύνδετο. Επίσης ισχύει ο 1 ος Νόµος του Mendel: «Σχολικό βιβλίο σελ. 71». Λήψη χοριακών λαχνών προκειµένου να συλλεχθούν εµβρυϊκά κύτταρα (γίνεται κατά την 9 η 12 η εβδοµάδα της κύησης) και στη συνέχεια στα κύτταρα αυτά γίνεται µοριακή διάγνωση * προκειµένου να εντοπιστεί το µεταλλαγµένο αλληλόµορφο β s. * Μοριακή διάγνωση είναι η τεχνική που επιτρέπει τον εντοπισµό της αλληλουχίας των βάσεων του µεταλλαγµένου γονιδίου. Η µέθοδος διάγνωσης µε βιοχηµική δοκιµασία δεν ενδείκνυται διότι η σύνθεση των µεταλλαγµένων β s αλυσίδων άρα και της αιµοσφαιρίνης ΗbS πραγµατοποιείται στα ερυθροκύτταρα (πρόδροµα) µόνο µετά τη γέννηση του ατόµου. ΑΞΙΟΛΟΓΗΣΗ Τα φετινά θέµατα καλύπτουν όλο το φάσµα της ύλης, είναι σαφώς διατυπωµένα, και µπορούν να διαβαθµίσουν τις βαθµολογίες. Ο κατάλληλα προετοιµασµένος µαθητής µπορεί να αντεπεξέλθει στο συγκεκριµένο διαγώνισµα και να πετύχει υψηλές βαθµολογίες. 6

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Πώς ονοµάζονται

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ν γράψετε στο τετράδιό σς τον ριθμό κθεμιάς πό τις πρκάτω ημιτελείς προτάσεις Α1 έως Α5 κι δίπλ το γράμμ που

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ. Κεφάλαιο Πρώτο Το γενετικό υλικό

ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ. Κεφάλαιο Πρώτο Το γενετικό υλικό ΕΠΑΝΑΛΗΨΗ ΕΝΝΟΙΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο Πρώτο Το γενετικό υλικό Με βάση ποιο πείραμα αποδείχθηκε ότι το DNA είναι το γενετικό υλικό; Πότε ήρθε η οριστική επιβεβαίωση ότι το DNA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ Α.1.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ Α Θέµα 1ο (Μονάδες 5) (Μονάδες 5) (Μονάδες 5) (Μονάδες 5)

ΔΙΑΓΩΝΙΣΜΑ Α Θέµα 1ο (Μονάδες 5) (Μονάδες 5) (Μονάδες 5) (Μονάδες 5) ΔΙΓΩΝΙΣΜ Θέµ 1 ο πό τις πρκάτω πολλπλές πντήσεις ν επιλέξετε τη σωστή. 1. Ηκυττρική διφοροποίηση συνίσττι. στην πύση της λειτουργίς όλων των γονιδίων β. στην εκλεκτική λειτουργί των γονιδίων γ. σε δυνµί

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα