Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ"


1 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. 1. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται α. χειριστής. β. υποκινητής. γ. snrna. δ. δομικά γονίδια. 2. Τα νουκλεοσώματα α. αποτελούνται αποκλειστικά από DNA. β. δεν σχηματίζονται κατά τη μεσόφαση. γ. αποτελούνται από DNA που τυλίγεται γύρω από πρωτεΐνες. δ. είναι ορατά μόνο με το οπτικό μικροσκόπιο. 3. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται α. παράγοντας ΙΧ. β. αυξητική ορμόνη. γ. ινσουλίνη. δ. α 1 - αντιθρυψίνη. 4. ιαγονιδιακά είναι φυτά α. τα οποία έχουν υποστεί γενετική αλλαγή. β. στα οποία έχουν εισαχθεί ορμόνες. γ. τα οποία έχουν εμβολιαστεί με αντιγόνα in vitro. δ. στα οποία έχουν εισαχθεί αντιβιοτικά. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 5. Μετασχηματισμός βακτηριακού κυττάρου ξενιστή είναι α. η εισαγωγή αντισώματος. β. η εισαγωγή DNA πλασμιδίου. γ. η εισαγωγή θρεπτικών συστατικών. δ. η εισαγωγή αντίστροφης μεταγραφάσης. ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Τι εννοούμε με τον όρο ζύμωση και ποια τα προϊόντα της; Μονάδες 4 2. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια είναι τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2) Μονάδες 7 3. Τι είναι η μετατόπιση και τι είναι η αμοιβαία μετατόπιση; Ποια προβλήματα μπορεί να προκαλέσει η αμοιβαία μετατόπιση στον άνθρωπο; Μονάδες 6 4. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση; Μονάδες 8 ΘΕΜΑ 3ο Α. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες 1 και 2. I I II II η οικογένεια 2η οικογένεια ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

3 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Στην 1 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα Ι 2, ΙΙ 2, ΙΙ 3 (μαυρισμένα) ενώ στην 2 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα ΙΙ 2, ΙΙ 3 (μαυρισμένα). Να προσδιορίσετε τον τρόπο κληρονόμησης του χαρακτηριστικού με βάση τα παραπάνω στοιχεία, αιτιολογώντας την απάντησή σας με τις κατάλληλες διασταυρώσεις (Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου). (μονάδες 8) Να γράψετε τους γονότυπους όλων των ατόμων. (μονάδες 5) Μονάδες 13 Β. Να υποδείξετε ένα πιθανό μηχανισμό που μπορεί να εξηγήσει τη γέννηση ατόμου με σύνδρομο Turner από γονείς με φυσιολογικό αριθμό χρωμοσωμάτων. (μονάδες 6) Να περιγράψετε τη διαδικασία με την οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμου με σύνδρομο Turner, μετά τη γέννησή του. (μονάδες 6) ΘΕΜΑ 4ο Μονάδες 12 ίνεται δίκλωνο μόριο DNA το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mrna. εσώνιο..gaaggaggttgcttaaggggccctaccaat... OH.. C TTCCTCCAACGAATTCCCCGGGATGG TTA... εσώνιο Κατεύθυνση μεταγραφής - ελεύθερο α) Πού συναντάμε ασυνεχή γονίδια; (μονάδες 2) ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ β) Να προσδιορίσετε τα 3 και 5 άκρα του παραπάνω μορίου DNA. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) γ) Να γράψετε το τμήμα του πρόδρομου mrna και του ώριμου mrna που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση. (μονάδες 2) δ) Πώς προκύπτει το ώριμο mrna; (μονάδες 3) ε) Μπορεί η περιοριστική ενδονουκλεάση ΕcoRI να κόψει το παραπάνω τμήμα DNA; (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) στ) Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cdna βιβλιοθήκη; (μονάδες 8) Μονάδες 25 Ο ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων, αμέσως μόλις σας παραδοθούν. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. 5. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 6. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. 7. ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 8. Χρόνος δυνατής αποχώρησης: π.μ. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις 1 έως και 5, να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. 1. Το πλασμίδιο Τ i εντοπίζεται στο βακτήριο α. πνευμονιόκοκκος (Diplococcus pneumoniae). β. Escherichia coli. γ. Bacillus thuringiensis. δ. Agrobacterium tumefaciens. 2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες α. ινσουλίνης. β. ιντερφερονών. γ. μονοκλωνικών αντισωμάτων. δ. α 1 αντιθρυψίνης. 3. Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται α. 23 χρωμοσώματα. β. 22 ζεύγη χρωμοσωμάτων. γ. 23 ζεύγη χρωμοσωμάτων. δ. 46 ζεύγη χρωμοσωμάτων. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

6 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 4. Η επιλογή ενός βακτηριακού κλώνου που περιέχει το ανασυνδυασμένο πλασμίδιο γίνεται με: α. χρήση ειδικών μορίων ανιχνευτών. β. χρήση αντιβιοτικών. γ. ένζυμα πρωτεϊνοσύνθεσης. δ. χρήση βιοαντιδραστήρων. 5. Το κωδικόνιο έναρξης της μετάφρασης του mrna σε όλους τους οργανισμούς είναι το α. ΑUG. β. UUU. γ. CAA. δ. UAA. ΘΕΜΑ 2ο Α. Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και, δίπλα σε κάθε αριθμό, το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. ύο στοιχεία της Στήλης ΙΙ περισσεύουν: Στήλη Ι Στήλη ΙΙ 1. διαβήτης α. αδελφές χρωματίδες 2. διαγονιδιακά ζώα β. ριβονουκλεοπρωτεϊνικά σωματίδια 3. κεντρομερίδιο γ. ινσουλίνη 4. ωρίμανση mrna δ. μικροέγχυση 5. βιοαντιδραστήρας ε. ιντερφερόνη ζ. ζύμωση η. περιοριστικές ενδονουκλεάσες Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

7 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ Β. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία. 1. Ποιος είναι ο στόχος της γονιδιακής θεραπείας; 2. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας; Μονάδες 6 3. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας. Μονάδες 4 ΘΕΜΑ 3ο Πρόκειται να καλλιεργηθεί στο εργαστήριο ένας ετερότροφος μικροοργανισμός. 1. Να αναφέρετε ονομαστικά τα θρεπτικά συστατικά τα οποία πρέπει να προστεθούν στο μέσο καλλιέργειας, ώστε ο μικροοργανισμός αυτός να αναπτυχθεί φυσιολογικά. Μονάδες 8 2. Πώς μπορούμε να διαπιστώσουμε αν ο μικροοργανισμός αυτός είναι υποχρεωτικά αναερόβιος; Μονάδες 7 3. Τι γνωρίζετε για τους άλλους παράγοντες που επιδρούν στην ανάπτυξη του μικροοργανισμού; Μονάδες 10 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

8 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 4ο ίνεται το παρακάτω τμήμα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής: 1. Στις θέσεις Α,Β,Γ,,Ε,Ζ να αντιστοιχίσετε τις ενδείξεις 3 ή 5 ώστε να φαίνεται ο προσανατολισμός των αρχικών και των νεοσυντιθέμενων αλυσίδων. Μονάδες 6 2. Τι είναι τα πρωταρχικά τμήματα, πως δημιουργούνται και πως επιμηκύνονται; Μονάδες 9 3. Εξηγήστε γιατί πρέπει, στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυμο DNA δεσμάση και πώς θα δράσει αυτό; Μονάδες 6 4. Ποια ένζυμα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής; Μονάδες 4 Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

9 ΑΡΧΗ 5ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. 5. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. 6. ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 7. Χρόνος δυνατής αποχώρησης: μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

10 ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5, και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. 1. ύο αδελφές χρωματίδες συγκροτούν α. τον καρυότυπο. β. το νουκλεόσωμα. γ. κάθε μεταφασικό χρωμόσωμα. δ. το μόριο DNA. 2. Η DNA δεσμάση α. επιδιορθώνει λάθη της αντιγραφής. β. συνδέει το αμινοξύ με το trna. γ. συνδέει τμήματα DNA. δ. μεταγράφει την πολυνουκλεοτιδική αλυσίδα. 3. Αποδιάταξη είναι το φαινόμενο κατά το οποίο α. κόβεται το DNA. β. αποχωρίζονται οι κλώνοι του DNA. γ. συνδέονται μεταξύ τους οι κλώνοι του DNA. δ. ιχνηθετείται το DNA. 4. Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση α. της κυστικής ίνωσης. β. του αλφισμού. γ. της υπερχοληστερολαιμίας. δ. του συνδρόμου Down. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

11 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 5. Το πλασμίδιο Ti α. προέρχεται από το βακτήριο Escherichia coli. β. προκαλεί καθυστέρηση στην αύξηση του φυτού. γ. εισάγεται με μικροέγχυση στα φυτικά κύτταρα. δ. προκαλεί όγκους στα φυτά στα οποία εισέρχεται. ΘΕΜΑ 2ο 1. Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNA είναι το γενετικό υλικό. 2. Να αναφέρετε τα συστατικά που πρέπει να περιέχονται σε στερεό θρεπτικό υλικό για την ανάπτυξη των μικροοργανισμών. 3. Ποια γονίδια οργανώνονται σε οπερόνια; (μονάδες 3) Πώς επιτυγχάνεται η καταστολή στο οπερόνιο της λακτόζης; (μονάδες 6) Μονάδες 9 4. Να περιγράψετε τη διαδικασία της κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο «Dolly». ΘΕΜΑ 3ο Μονάδες 6 Α. Άνδρας που πάσχει από φαινυλκετονουρία και συνθέτει φυσιολογική ποσότητα μελανίνης, αποκτά απογόνους με γυναίκα που πάσχει από αλφισμό, αλλά μπορεί να μετατρέπει τη φαινυλαλανίνη σε τυροσίνη. Να βρείτε τους πιθανούς γονότυπους και φαινότυπους των παιδιών. Τα γονίδια που ελέγχουν την φαινυλκετονουρία και τον αλφισμό, βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Μονάδες 12 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

12 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Β. Να διακρίνετε περιπτώσεις κατά τις οποίες είναι αιμορροφιλικό το παιδί, που αποκτά φυσιολογικός άνδρας με φυσιολογική γυναίκα της οποίας ο πατέρας είναι αιμορροφιλικός. Οι γονείς και το παιδί έχουν φυσιολογικό καρυότυπο. Μονάδες 13 ΘΕΜΑ 4ο ίνεται το παρακάτω τμήμα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αμινοξέα μιας πολυπεπτιδικής αλυσίδας. Η κατεύθυνση στην οποία κινείται η RNA πολυμεράση κατά τη μεταγραφή υποδεικνύεται από το βέλος. α. Ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η μη κωδική; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 7) Μονάδες 9 β. Να γράψετε την αλληλουχία του mrna, που προκύπτει από τη μεταγραφή του παραπάνω DNA. Μονάδες 3 γ. Να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του trna, που μεταφέρει το 2 ο αμινοξύ της πολυπεπτιδικής αλυσίδας. δ. Τι είναι το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (μονάδες 5) και ποια είναι η μετέπειτα πορεία του trna, που συμμετέχει σε αυτό; (μονάδες 3) Μονάδες 8 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

13 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα,). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων, αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. 4. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. 5. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 6. ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 7. Χρόνος δυνατής αποχώρησης: π.μ. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

14 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. 1. Πολύσωμα ονομάζεται α. το σύμπλεγμα του DNA με τις ιστόνες. β. η τρισωμία του 21 χρωμοσώματος. γ. το σύμπλεγμα των ριβοσωμάτων με το mrna. δ. το ειδικό σύμπλοκο που συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA. 2. Τα πλασμίδια είναι α. δίκλωνα κυκλικά μόρια RNA. β. δίκλωνα γραμμικά μόρια RNA. γ. δίκλωνα κυκλικά μόρια DNA. δ. μονόκλωνα κυκλικά μόρια DNA. 3. Στο σύνδρομο Klinefelter ο καρυότυπος των ατόμων είναι α. 44 XY. β. 44 XXY. γ. 44 XΟ. δ. 44 XYY. 4. Η μεταφορά ανασυνδυασμένου μορίου DNA στο κύτταρο ξενιστή λέγεται α. μετασχηματισμός. β. υβριδοποίηση. γ. αποδιάταξη. δ. κλωνοποίηση. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

15 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 5. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες α. λιπιδίων. β. DNA. γ. RNA. δ. μονοκλωνικών αντισωμάτων. ΘΕΜΑ 2ο 1. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο. Μονάδες 9 2. Τι ονομάζεται νουκλεόσωμα και ποια είναι η δομή του; Μονάδες 4 3. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια; Μονάδες 4 4. Ποια πλεονεκτήματα του μοσχομπίζελου το καθιστούν κατάλληλο στη μελέτη της Μενδελικής κληρονομικότητας; Μονάδες 8 ΘΕΜΑ 3ο ίνεται το παρακάτω ολιγοπεπτίδιο έξι αμινοξέων το οποίο δεν έχει υποστεί καμία τροποποίηση μετά τη σύνθεσή του Η 2 Ν Μεθειονίνη Γλυκίνη Λυσίνη Τρυπτοφάνη Βαλίνη Αλανίνη - COOH Α. Με τη βοήθεια του τμήματος του γενετικού κώδικα που παρατίθεται, γράψτε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του τμήματος mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. ικαιολογήστε την απάντησή σας. Μονάδες 13 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

16 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Β. Γράψτε με τον κατάλληλο προσανατολισμό την αλληλουχία νουκλεοτιδίων στο δίκλωνο μόριο DNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Ποια είναι η κωδική και ποια η μη κωδική αλυσίδα; Μονάδες 6 Γ. Εάν η τριπλέτα 5 -UGG-3 στο mrna αντικατασταθεί από την τριπλέτα 5 -UGA-3, γράψτε την αλληλουχία των αμινοξέων στο νέο ολιγοπεπτίδιο που θα συντεθεί. Μονάδες 6 ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: GUCöΒαλίνη UGGöΤρυπτοφάνη GGUöΓλυκίνη AUGöΜεθειονίνη AAAöΛυσίνη GCCöΑλανίνη ΘΕΜΑ 4ο Στο παρακάτω γενεαλογικό δέντρο απεικονίζεται ο τρόπος με τον οποίο κληρονομείται στα μέλη μιας οικογένειας η αιμορροφιλία Α. (Είναι μαυρισμένα τα ΙΙ 1, ΙΙ 4 και ΙΙΙ 1). ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

17 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Α. Πώς κληρονομείται η αιμορροφιλία Α; Β. Να γράψετε και να δικαιολογήσετε με τις κατάλληλες διασταυρώσεις τους γονοτύπους όλων των μελών που απεικονίζονται στο γενεαλογικό δέντρο. Μονάδες 13 Γ. Εάν οι γονείς ΙΙ 3 και ΙΙ 4 αποκτήσουν επόμενο παιδί, ποια είναι η πιθανότητα να νοσεί από αιμορροφιλία Α; Μονάδες 7 Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. 7. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. Μπορείτε να χρησιμοποιήσετε μολύβι μόνο για σχέδια, διαγράμματα και πίνακες. 8. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5


Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή α. αυξητικής ορμόνης. β. μικροβιακής βιομάζας. γ. νουκλεϊκών οξέων. δ. σακχάρων.

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή α. αυξητικής ορμόνης. β. μικροβιακής βιομάζας. γ. νουκλεϊκών οξέων. δ. σακχάρων. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΣΑΒΒΑΤΟ 22 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φροντιστήριο Μ.Ε "ΕΠΙΛΟΓΗ" Καλαμάτα


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΚΥΡΙΑΚΗ 27/03/2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 12/04/2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ο.Π. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΧΤΩ (8) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να αιτιολογήσετε την επιλογή σας. Μονάδες 3

Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων.

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων. ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε τον αριθμό της

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 4 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα