Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. Α2. Το νουκλεόσωμα αποτελείται α. από RNA και ιστόνες β. μόνο από RNA γ. από DNA και ιστόνες δ. μόνο από DNA. Α3. Για τη θεραπεία του εμφυσήματος χρησιμοποιείται α. η α 1 -αντιθρυψίνη β. η ινσουλίνη γ. ο παράγοντας VIIΙ δ. η αυξητική ορμόνη. Α4. Η κυστική ίνωση κληρονομείται ως α. αυτοσωμικός επικρατής χαρακτήρας β. φυλοσύνδετος υπολειπόμενος χαρακτήρας γ. φυλοσύνδετος επικρατής χαρακτήρας δ. αυτοσωμικός υπολειπόμενος χαρακτήρας. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Α5. Με καρυότυπο μπορεί να διαγνωστεί α. η β-θαλασσαιμία β. ο αλφισμός γ. το σύνδρομο Down δ. η οικογενής υπερχοληστερολαιμία. ΘΕΜΑ Β Β1. Να αντιστοιχίσετε σωστά τον αριθμό καθεμίας από τις φράσεις της στήλης Ι με ένα μόνο γράμμα, Α ή Β, της στήλης ΙΙ. Στήλη Ι Στήλη ΙΙ 1. Στην πλειονότητά τους έχουν την ικανότητα κυτταρικής διαίρεσης. 2. Παράγονται με μείωση. 3. Δεν έχουν την ικανότητα κυτταρικής διαίρεσης. 4. Στον άνθρωπο έχουν DNA συνολικού μήκους δύο μέτρων. Α: Σωματικά κύτταρα στην αρχή της μεσόφασης 5. Παράγονται με μίτωση. 6. Οι μεταλλάξεις στο DNA τους δεν κληρονομούνται στην επόμενη γενιά. 7. Στον άνθρωπο έχουν DNA συνολικού μήκους 3X10 9 ζεύγη βάσεων. 8. Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά. Β: Γαμέτες Μονάδες 8 Β2. Από τι αποτελείται το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης; Μονάδες 7 Β3. Σήμερα μπορούμε να κατασκευάσουμε στο δοκιμαστικό σωλήνα ένα «ανασυνδυασμένο» μόριο DNA. Τι είναι το ανασυνδυασμένο μόριο DNA; Μονάδες 4 Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της; ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

3 ΘΕΜΑ Γ ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Στην εικόνα 1 φαίνεται ένα μέρος μίας βιολογικής διαδικασίας, η οποία βρίσκεται σε εξέλιξη. CUCUUTC T GAGAAAC ATGCATACGAC Εικόνα 1 Γ1. Να ονομάσετε τη διαδικασία, που βρίσκεται σε εξέλιξη, στην εικόνα 1 και να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας (μονάδες 2). Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1 (μονάδες 3). Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού (μονάδα 1). Γ2. Να ονομάσετε τα ένζυμα που είναι απαραίτητα για τη δημιουργία του τελικού δίκλωνου μορίου του ερωτήματος Γ1 και να αναφέρετε τη δράση του καθενός ενζύμου. Σε ένα είδος εντόμου ένα γονίδιο είναι υπεύθυνο για την παραγωγή του ενζύμου Α, ενώ το αλληλόμορφό του δεν παράγει το ένζυμο Α. Ένα άλλο γονίδιο καθορίζει το χαρακτήρα «ανοιχτό χρώμα σώματος», ενώ το αλληλόμορφό του καθορίζει το «σκούρο χρώμα σώματος». Διασταυρώνεται ένα θηλυκό έντομο που παράγει το ένζυμο Α και έχει ανοιχτό χρώμα σώματος με ένα αρσενικό έντομο που παράγει το ένζυμο Α και έχει ανοιχτό χρώμα σώματος. Από τη διασταύρωση προκύπτουν: 600 θηλυκοί απόγονοι που παράγουν το ένζυμο Α και έχουν ανοιχτό χρώμα σώματος, 300 αρσενικοί απόγονοι που παράγουν το ένζυμο Α και έχουν σκούρο χρώμα σώματος και 300 αρσενικοί απόγονοι που παράγουν το ένζυμο Α και έχουν ανοιχτό χρώμα σώματος. Δίνονται: i. Για τον τρόπο κληρονόμησης των δύο χαρακτήρων ισχύει ο 2 ος νόμος του Mendel. ii. Για τη σύνθεση του ενζύμου Α, τα άτομα που διασταυρώθηκαν είναι ετερόζυγα. iii. Το έντομο είναι διπλοειδής ευκαρυωτικός οργανισμός και το φύλο του καθορίζεται όπως στον άνθρωπο. Γ3. Να γράψετε τον τρόπο με τον οποίο κληρονομείται το γονίδιο που δεν παράγει το ένζυμο Α (μονάδες 2). Να γράψετε τον τρόπο με τον οποίο κληρονομείται το γονίδιο που καθορίζει το ανοιχτό χρώμα σώματος (μονάδες 2). Μονάδες 4 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Γ4. Να αιτιολογήσετε τον τρόπο κληρονόμησης των παραπάνω χαρακτήρων, κάνοντας την κατάλληλη διασταύρωση ή τις κατάλληλες διασταυρώσεις. Δεν απαιτείται η διατύπωση των νόμων του Mendel. ΘΕΜΑ Δ Μονάδες 10 Στην εικόνα 2 δίνονται δύο μη ομόλογα αυτοσωμικά χρωμοσώματα ενός κυττάρου, το χρωμόσωμα Α και το χρωμόσωμα Β. Σε κάθε χρωμόσωμα απεικονίζεται η αλληλουχία του DNA που υπάρχει στο άκρο του. Χρωμόσωμα Α...A C G GATTCAC.....T G C CTAAGTG-3 Χρωμόσωμα Β.....ATACGATCTA TATGCTAGAT Εικόνα 2 Έστω ότι σε καθένα από τα χρωμοσώματα της εικόνας 2 συμβαίνει θραύση στα σημεία που δείχνουν τα βέλη. Στη συνέχεια πραγματοποιείται αμοιβαία μετατόπιση των ακραίων σκιασμένων τμημάτων ανάμεσα στο χρωμό σωμα Α και στο χρωμόσωμα Β. Δ1. Να γράψετε όλα τα πιθανά χρωμοσώματα που θα προκύψουν μετά την αμοιβαία μετατόπιση, με τις αντίστοιχες αλληλουχίες DNA (μονάδες 4). Να σημειώσετε τους προσανατολισμούς όλων των μορίων DNA που προκύπτουν (μονάδες 2). Μία από τις παραπάνω αμοιβαίες μετατοπίσεις γίνεται σε ζυγωτό, από το οποίο προκύπτει ένας ενήλικος άνθρωπος με φυσιολογικό φαινότυπο. Στον άνθρωπο αυτόν συμβολίζουμε το χρωμόσωμα Α που έχει την μετάλλαξη ως χρωμόσωμα α και το χρωμόσωμα Β που έχει την μετάλλαξη ως χρωμόσωμα β. Δ2. Να γράψετε όλους τους πιθανούς γαμέτες αυτού του ενήλικα, χρησιμοποιώντας τους συμβολισμούς των χρωμοσωμάτων, όπως σας έχουν δοθεί. Μονάδες 4 Δ3. Κάθε γαμέτης που προκύπτει στο ερώτημα Δ2 γονιμοποιείται με φυσιολογικό γαμέτη. Να εξηγήσετε τι ποσοστό των απογόνων θα έχει φυσιολογικό φαινότυπο (μονάδες 5) και τι ποσοστό των απογόνων θα έχει φυσιολογικό καρυότυπο (μονάδες 4). Μονάδες 9 Δ4. Να εξηγήσετε το είδος ή τα είδη των δομικών χρωμοσωμικών ανωμαλιών, που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο. ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

5 ΑΡΧΗ 5ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Ώρα δυνατής αποχώρησης: π.μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

6 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. Α2. Το νουκλεόσωμα αποτελείται α. από RNA και ιστόνες β. μόνο από RNA γ. από DNA και ιστόνες δ. μόνο από DNA. Α3. Για τη θεραπεία του εμφυσήματος χρησιμοποιείται α. η α 1 -αντιθρυψίνη β. η ινσουλίνη γ. ο παράγοντας VIIΙ δ. η αυξητική ορμόνη. Α4. Το πλασμίδιο Ti βρίσκεται στο βακτήριο α. E. coli β. Bacillus thuringiensis γ. Lactobacillus δ. Agrobacterium tumefaciens. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙΔΕΣ

7 ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Α5. Οι περιοριστικές ενδονουκλεάσες α. παράγονται φυσιολογικά από ευκαρυωτικά κύτταρα β. αναγνωρίζουν και κόβουν μόρια DΝΑ σε συγκεκριμένες αλληλουχίες γ. παράγονται από ιούς δ. εισάγονται στα βακτήρια από βακτηριοφάγους. ΘΕΜΑ Β Β1. Να αντιστοιχίσετε σωστά τον αριθμό καθεμίας από τις φράσεις της στήλης Ι με ένα μόνο γράμμα, Α ή Β, της στήλης ΙΙ. Στήλη Ι 1. Στον άνθρωπο περιέχουν ένα φυλετικό χρωμόσωμα. 2. Στον άνθρωπο περιέχουν δύο φυλετικά χρωμοσώματα. 3. Έχουν 23 χρωμοσώματα. 4. Στον άνθρωπο έχουν DNA συνολικού μήκους δύο μέτρων. 5. Στον άνθρωπο έχουν DNA συνολικού μήκους 6X10 9 ζεύγη βάσεων. 6. Είναι διπλοειδή κύτταρα. 7. Στον άνθρωπο έχουν DNA συνολικού μήκους 3X10 9 ζεύγη βάσεων. Στήλη ΙΙ Α: Σωματικά κύτταρα στην αρχή της μεσόφασης Β: Γαμέτες 8. Είναι απλοειδή κύτταρα. Μονάδες 8 Β2. Από τι αποτελείται το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης; Μονάδες 7 Β3. Σήμερα μπορούμε να κατασκευάσουμε στο δοκιμαστικό σωλήνα ένα «ανασυνδυασμένο» μόριο DNA. Τι είναι το ανασυνδυασμένο μόριο DNA; Μονάδες 4 Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της; ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙΔΕΣ

8 ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΘΕΜΑ Γ Στην εικόνα 1 απεικονίζεται μία βιολογική διαδικασία, η οποία βρίσκεται σε εξέλιξη. CUCUUTC T GAGAAAC ATGCATACGAC Εικόνα 1 Γ1. Να ονομάσετε τη διαδικασία της εικόνας 1 και να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας (μονάδες 2). Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1 (μονάδες 3). Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού (μονάδα 1). Γ2. Να ονομάσετε τα ένζυμα που είναι απαραίτητα για τη δημιουργία του τελικού δίκλωνου μορίου του ερωτήματος Γ1 και να αναφέρετε τη δράση του καθενός ενζύμου. Στην εικόνα 2 απεικονίζεται η καμπύλη ανάπτυξης ενός μικροοργανισμού και του προϊόντος που παράγει, όταν αυτός καλλιεργηθεί σε βιοαντιδραστήρα. Εικόνα 2 Γ3. Ποια καμπύλη απεικονίζει την ανάπτυξη του μικροοργανισμού και ποια καμπύλη το παραγόμενο προϊόν (μονάδες 2); Να αιτιολογήσετε την απάντησή σας (μονάδες 3). Γ4. Να ονομάσετε τις φάσεις ανάπτυξης του μικροοργανισμού που σχετίζονται με την παραγωγή του προϊόντος, αναφέροντας τα αντίστοιχα χρονικά διαστήματα. Μονάδες 4 Γ5. Ποιες διαδικασίες θα ακολουθήσουμε για την παραλαβή και αξιοποίηση του προϊόντος, αν υποθέσουμε ότι αυτό εκκρίνεται από τον μικροοργανισμό; ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙΔΕΣ

9 ΘΕΜΑ Δ ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Ένα βακτήριο περιέχει κυκλικό μόριο DNA που αποτελείται από ζεύγη βάσεων. Το βακτήριο αυτό αναπτύσσεται σε θρεπτικό υλικό που περιέχει αποκλειστικά ως πηγή φωσφόρου ραδιενεργό 32 P, με αποτέλεσμα όλα τα νέα νουκλεοτίδια να είναι ραδιενεργά. Δ1. Να υπολογίσετε τον αριθμό των ραδιενεργών νουκλεοτιδίων που θα περιέχονται στο σύνολο των βακτηρίων μετά από δύο διαδοχικές διαιρέσεις του αρχικού βακτηρίου (μονάδες 4). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Μονάδες 8 Στον πίνακα Ι δίνονται τα αντικωδικόνια των trnas και η σειρά με την οποία χρησιμοποιούνται κατά τη μετάφραση ενός μορίου mrna, που περιέχει 7 κωδικόνια. Πίνακας Ι Σειρά 1 ο 2 ο 3 ο 4 ο 5 ο 6 ο Αντικωδικόνια 3 UAC5 5 AUC3 3 GAC5 5 AUC3 5 CAG3 3 UGG5 trna Δ2. Να γράψετε μία αλληλουχία βάσεων του μορίου mrna, συμπεριλαμβανομένου του 7 ου κωδικονίου, για τη μετάφραση του οποίου χρησιμοποιούνται τα trnas του πίνακα Ι. Μονάδες 9 Δ3. Να γράψετε την αλληλουχία βάσεων του γονιδίου, η μεταγραφή του οποίου δίνει το mrna του ερωτήματος Δ1 (μονάδες 2) και να ορίσετε τα 5 και 3 άκρα του (μονάδες 2). Να εντοπίσετε την κωδική και μη κωδική αλυσίδα (μονάδες 2). Να υποδείξετε τη θέση του υποκινητή στο παραπάνω γονίδιο, τοποθετώντας το γράμμα Υ στο κατάλληλο άκρο του μορίου (μονάδες 2). Μονάδες 8 ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: π.μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙΔΕΣ

10 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι α. γραμμικό δίκλωνο μόριο DNA β. κυκλικό δίκλωνο μόριο DNA γ. γραμμικό μονόκλωνο μόριο DNA δ. κυκλικό μονόκλωνο μόριο DNA. Α2. Κατά την ενήλικη ζωή, η κύρια αιμοσφαιρίνη υγιούς ανθρώπου είναι η α. HbS β. HbA 2 γ. HbA δ. HbF. Α3. Οι ιντερφερόνες είναι α. πρωτεΐνες β. αντιβιοτικά γ. εμβόλια δ. αντισώματα. Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε α. α1-αντιθρυψίνη β. ιντερφερόνες γ. ινσουλίνη δ. παράγοντα ΙΧ. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

11 ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Α5. Τα γενετικά τροποποιημένα φυτά ποικιλίας Bt είναι ανθεκτικά σε α. εντομοκτόνα β. ζιζανιοκτόνα γ. παγετό δ. έντομα και σκώληκες. ΘΕΜΑ Β Β1. Να συνδυάσετε τους όρους της στήλης Ι με τα βιομόρια της στήλης ΙΙ, αντιστοιχίζοντας κάθε φορά έναν αριθμό της στήλης Ι με ένα μόνο γράμμα, Α ή Β ή Γ, της στήλης ΙΙ. Στήλη Ι Στήλη ΙΙ 1. DNA δεσμάση 2. Πρωταρχικό τμήμα Α: DNA 3. Υποκινητής 4. Μεταγραφικοί παράγοντες 5. Χειριστής Β: Πρωτεΐνη 6. RNA πολυμεράση 7. Πλασμίδιο Γ: RNA 8. Αντικωδικόνιο Μονάδες 8 Β2. Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας τη λέξη Σωστό ή Λάθος, δίπλα στο γράμμα που αντιστοιχεί στην κάθε πρόταση: α. Κατά τη δημιουργία των διαγονιδιακών ζώων χρησιμοποιούνται ωάρια που έχουν γονιμοποιηθεί στο εργαστήριο. β. Όλα τα αντιγόνα έχουν πάντα μία μόνο περιοχή που αναγνωρίζεται από μόνο ένα αντίσωμα. γ. Οι μεταλλάξεις στα σωματικά κύτταρα ενός οργανισμού μεταβιβάζονται στους απογόνους του. δ. Στα προκαρυωτικά κύτταρα υπάρχουν γονίδια που μεταγράφονται σε snrna. ε. Η μελέτη των χρωμοσωμάτων με καρυότυπο είναι δυνατή μόνο σε κύτταρα που διαιρούνται. ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

12 ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Β3. Με ποιον τρόπο κληρονομείται η φαινυλκετονουρία (μονάδα 1); Από τι προκαλείται (μονάδες 2); Με ποιον τρόπο μπορούν να αποφευχθούν τα συμπτώματα της ασθένειας (μονάδες 3); Β4. Να αναφέρετε πώς ρυθμίζεται η γονιδιακή έκφραση στους ευκαρυωτικούς οργανισμούς στο επίπεδο μετά τη μεταγραφή (μονάδες 2) και στο επίπεδο της μετάφρασης (μονάδες 2). Μονάδες 4 Β5. Ποια γονίδια ονομάζονται αλληλόμορφα; ΘΕΜΑ Γ Μονάδες 2 Στην εικόνα 1 απεικονίζονται διαγραμματικά 3 μόρια DNA, στα οποία ο υποκινητής σημειώνεται με Υ. Εικόνα 1 Γ1. Να μεταφέρετε στο τετράδιό σας τα τρία σχήματα της εικόνας 1 και να σημειώσετε με ένα βέλος την κατεύθυνση μεταγραφής σε καθένα από τα γονίδια Α, Β και Γ (μονάδες 3). Να γράψετε για το κάθε γονίδιο Α, Β και Γ ποια από τις δύο αλυσίδες Ι ή ΙΙ είναι η κωδική (μονάδες 3). Μια γενετική ασθένεια οφείλεται σε γονιδιακή μετάλλαξη. Το φυσιολογικό γονίδιο κόβεται σε μία θέση από την περιοριστική ενδονουκλεάση EcoRI, ενώ το μεταλλαγμένο αλληλόμορφό του δεν κόβεται. Τα συμπτώματα της ασθένειας εμφανίζονται μετά την ηλικία των 30 ετών. Ένας υγιής άντρας 40 ετών είναι παντρεμένος με γυναίκα 35 ετών που εμφανίζει τα συμπτώματα της ασθένειας και αποκτούν ένα κορίτσι. Για τον εντοπισμό του φυσιολογικού και του μεταλλαγμένου γονιδίου, απομονώθηκαν από σωματικά κύτταρα κάθε μέλους της οικογένειας τμήματα DNA μήκους ζευγών βάσεων, που περιέχουν τα αλληλόμορφα γονίδια. Στα τμήματα αυτά έγινε επίδραση με την περιοριστική ενδονουκλεάση EcoRI. Τα αποτελέσματα της επίδρασης της EcoRI επιβεβαίωσαν τους φαινοτύπους των γονέων, ενώ για το κορίτσι έδειξαν ότι όλα τα τμήματα DNA που αναλύθηκαν είναι μήκους ζευγών βάσεων. Γ2. Ποια είναι η αλληλουχία που αναγνωρίζει η περιοριστική ενδονουκλεάση EcoRI; Μονάδες 4 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

13 ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Γ3. Να διερευνήσετε αν η ασθένεια αυτή κληρονομείται με φυλοσύνδετο υπολειπόμενο τρόπο κληρονομικότητας (μονάδες 6) και αν κληρονομείται με αυτοσωμικό υπολειπόμενο τρόπο κληρονομικότητας (μονάδες 6). Μονάδες 12 Γ4. Να γράψετε τους γονοτύπους των μελών της οικογένειας. Μονάδες 3 ΘΕΜΑ Δ Στην εικόνα 2 απεικονίζεται ένα ασυνεχές γονίδιο ανθρώπινου ηπατικού κυττάρου. Το γονίδιο αυτό είναι υπεύθυνο για την παραγωγή του ολιγοπεπτιδίου της εικόνας 3. 5 G CTCAGCAGTAGGCAATTCTGCTTCCACATCT 3 3 C GAGTCGTCATCCGTTAAGACGAAGGTGTAGA 5 Εικόνα 2 H 2 N-trp-lys-pro-tyr-cys-COOH Εικόνα 3 Δ1. Να εντοπίσετε και να γράψετε την αλληλουχία βάσεων του εσωνίου του γονιδίου της εικόνας 2 (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Να γράψετε το πρόδρομο μόριο του mrna που δημιουργείται από την μεταγραφή του γονιδίου της εικόνας 2 (μονάδα 1). Να γράψετε το ώριμο mrna που προκύπτει από τη διαδικασία της ωρίμανσης (μονάδες 2). Μονάδες 3 Ένας ερευνητής θέλει να κλωνοποιήσει το γονίδιο της εικόνας 2 για να το μελετήσει. Επίσης, θέλει να κλωνοποιήσει το ίδιο γονίδιο, για την παραγωγή του ολιγοπεπτιδίου της εικόνας 3, από βακτηριακή καλλιέργεια σε μεγάλη ποσότητα. Δ3. Τι είδους βιβλιοθήκη θα πρέπει να κατασκευάσει σε καθεμία περίπτωση (μονάδες 2); Να αιτιολογήσετε την απάντησή σας (μονάδες 4). ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

14 ΑΡΧΗ 5ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Ο ίδιος ερευνητής έχει στην διάθεσή του μια γονιδιωματική βιβλιοθήκη και μία cdna βιβλιοθήκη ανθρώπινων ηπατικών κυττάρων και τα δύο μόρια ανιχνευτές Α και Β της εικόνας 4. 5 CAATTCT 3 5 GAUGUGG 3 Ανιχνευτής Α Ανιχνευτής Β Εικόνα 4 Δ4. Να διερευνήσετε την καταλληλότητα του ανιχνευτή Α και του ανιχνευτή Β να εντοπίζει σε κάθε μια από τις δύο βιβλιοθήκες τον βακτηριακό κλώνο που περιέχει το υπεύθυνο γονίδιο για τη σύνθεση του ολιγοπεπτιδίου της εικόνας 2. Δ5. Να εξηγήσετε γιατί ο αριθμός των αμινοξέων του ολιγοπεπτιδίου της εικόνας 3 είναι διαφορετικός από τον αριθμό των κωδικονίων του ώριμου mrna από το οποίο προκύπτει. Μονάδες 4 Δίνονται: Κωδικόνια 5 UGG 3 5 CCC 3 5 UGC 3 5 AAG 3 5 UAC 3 Αμινοξέα trp pro cys lys tyr ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1. Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Ώρα δυνατής αποχώρησης: 18:00 ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

15 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ A Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως και Α5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. A1. Δύο διαδοχικά νουκλεοτίδια μιας πολυνουκλεοτιδικής αλυσίδας συνδέονται μεταξύ τους με δεσμό που ονομάζεται α. 5-3 φωσφοδιεστερικός δεσμός β. δεσμός υδρογόνου γ. πεπτιδικός δεσμός δ. 3-5 φωσφοδιεστερικός δεσμός. A2. Η περιοριστική ενδονουκλεάση EcoRI α. αναγνωρίζει ειδικές αλληλουχίες δίκλωνου DNA β. κόβει μονόκλωνα μόρια DNA γ. παράγεται από ευκαρυωτικά κύτταρα δ. αναγνωρίζει ειδικές αλληλουχίες RNA. A3. Η σύνδεση μονόκλωνων συμπληρωματικών αλυσίδων DNA ονομάζεται α. αποδιάταξη β. μετασχηματισμός γ. υβριδοποίηση δ. κλωνοποίηση. A4. Σε χρωμοσωμική ανωμαλία οφείλεται α. η οικογενής υπερχοληστερολαιμία β. το σύνδρομο φωνή της γάτας γ. η α-θαλασσαιμία δ. ο αλφισμός. A5. Η μικροέγχυση χρησιμοποιείται για τη δημιουργία α. διαγονιδιακών φυτών β. διαγονιδιακών ζώων γ. γονιδιωματικής βιβλιοθήκης δ. cdna βιβλιοθήκης. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

16 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ B B1. Να αντιστοιχίσετε σωστά τον αριθμό καθεμιάς από τις φράσεις της στήλης Ι με ένα μόνο γράμμα, Α, Β ή Γ, της στήλης ΙΙ. Στήλη Ι 1. Πρωταρχικά τμήματα 2. Μεταγραφικοί παράγοντες 3. Πολύσωμα 4. Αμινοξέα 5. RNA πολυμεράση 6. Πριμόσωμα 7. Σύμπλοκο έναρξης πρωτεϊνοσύνθεσης 8. Επιδιορθωτικά ένζυμα 9. snrna Στήλη ΙΙ Α: Αντιγραφή Β: Μεταγραφή Γ: Μετάφραση Μονάδες 9 B2. Πώς καθορίζεται το φύλο στον άνθρωπο; Μονάδες 4 B3. Ποια είναι η σημασία του οξυγόνου για την ανάπτυξη των μικροοργανισμών σε μια καλλιέργεια; B4. Τι ονομάζεται αντιγονικός καθοριστής (μονάδες 3) και ποια αντισώματα ονομάζονται μονοκλωνικά (μονάδες 3); ΘΕΜΑ Γ Στην εικόνα 1 παρουσιάζεται το mrna που προκύπτει από τη μεταγραφή του γονιδίου Ζ ενός βακτηρίου. Το γονίδιο Ζ κωδικοποιεί ένα ολιγοπεπτίδιο. Γ1. Να γράψετε τη μη κωδική αλυσίδα του γονιδίου Ζ από τη μεταγραφή του οποίου προκύπτει το mrna της εικόνας 1 (μονάδες 2) και να σημειώσετε τον προσανατολισμό της (μονάδες 2). Να αιτιολογήσετε τις απαντήσεις σας (μονάδες 4). Μονάδες 8 Γ2. Να γράψετε την αλληλουχία των αμινοξέων του ολιγοπεπτιδίου που προκύπτει από τη μετάφραση του mrna της εικόνας 1. ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

17 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Μια μετάλλαξη που έγινε στην κωδική αλυσίδα του γονιδίου Ζ οδήγησε στη σύνθεση ενός διαφορετικού mrna, το οποίο απεικονίζεται στην εικόνα 2. Γ3. Να εντοπίσετε την αλλαγή που έγινε στην κωδική αλυσίδα του γονιδίου Ζ (μονάδες 2) και να ονομάσετε τον τύπο της μετάλλαξης (μονάδες 2). Μονάδες 4 Γ4. Να γράψετε την αλληλουχία των αμινοξέων του ολιγοπεπτιδίου που προκύπτει από τη μετάφραση του mrna της εικόνας 2 (μονάδες 4). Ποια είναι η συνέπεια της μετάλλαξης στη λειτουργικότητα του ολιγοπεπτιδίου (μονάδες 4); Μονάδες 8 Δίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από τον γενετικό κώδικα: ΘΕΜΑ Δ Ο Βασίλης και η Σοφία είναι υγιείς και αποκτούν ένα γιο, τον Ηλία, και μια κόρη, τη Μαρία. Ο Ηλίας πάσχει μόνο από αιμορροφιλία Α και η Μαρία πάσχει μόνο από φαινυλκετονουρία. Δ1. Να αναφέρετε με ποιον τύπο κληρονομείται η αιμορροφιλία Α και με ποιον τύπο κληρονομείται η φαινυλκετονουρία. Μονάδες 4 Δ2. Να σχεδιάσετε για καθεμιά από τις δύο ασθένειες ξεχωριστά το αντίστοιχο γενεαλογικό δένδρο. Δ3. Να γράψετε όλους τους πιθανούς γονότυπους των μελών της οικογένειας για την αιμορροφιλία Α (μονάδες 5) και όλους τους πιθανούς γονότυπους των μελών της οικογένειας για την φαινυλκετονουρία (μονάδες 5). Μονάδες 10 Δ4. Εάν η οικογένεια αποκτήσει και άλλη μία κόρη, ποια είναι η πιθανότητα η κόρη αυτή να πάσχει από αιμορροφιλία (μονάδα 1); Να αιτιολογήσετε την απάντησή σας (μονάδες 4). ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

18 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ ΟΔΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό ανεξίτηλης μελάνης. 5. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 6. Διάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 7. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων και όχι πριν τις 17:00. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KAΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1.Σε ένα σωματικό κύτταρο ανθρώπου στο στάδιο της μετάφασης υπάρχουν: α. 4 γονίδια για την α-αλυσίδα της αιμοσφαιρίνης β. 8 γονίδια για

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΚΥΡΙΑΚΗ 27/03/2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή α. αυξητικής ορμόνης. β. μικροβιακής βιομάζας. γ. νουκλεϊκών οξέων. δ. σακχάρων.

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή α. αυξητικής ορμόνης. β. μικροβιακής βιομάζας. γ. νουκλεϊκών οξέων. δ. σακχάρων. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΣΑΒΒΑΤΟ 22 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων.

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων. ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε τον αριθμό της

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5


Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα