ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting

Transcript

1 China Biotechnology * ScFv-Fc 1** ScFv ScFv-Fc RT- PCR IgG1 Fc ppiczα ppiczα/fc Fc 2 ScFv-Fc ScFv ScFv ppiczα/fc 1L protein A PCR ELISA Western blotting 1L 20 ~30mg /L protein A >95% ScFv-Fc ScFv-Fc Q Skerra Better ScFv-Fc ScFv-Fc IgG1 Fc ppiczα Fc 2 ScFv-Fc ScFv ppiczα /ScFv-Fc His-tag 3-4 ScFv ScFv 37 ScFv ppiczα /Fc ScFv-Fc 5 ScFv-Fc ScFv-Fc ScFv-Fc Fc 1 A G XL1-Blue Zeocin X33 ppiczα Invitrogene * ** wangdingding305@ 163. com T4 DNA DNA

2 ScFv-Fc TaKaRa Trizol RNA DNA Invitrogene RNA LA PCR Kit TaKaRa Omega IgG-HRP ELISA ScFv -HBsAg ScFv 6 PCR United Biochemical Int 1 PCR min 294 1min ppiczα /Fc 1 ppiczα ScFv-Fc ppiczα / ScFv-Fc F1 F2 1 HBsAg ppiczα /ScFv-Fc RbAg 1μg TE 40μl min ScFv-Fc ppiczα / Xho I EcoR I ScFv-Fc HBsAg ppiczα /ScFv-Fc RbAg EcoR I Apa I Sac I 1μg Acc I Xho I EcoR I 80μl 0. 2cm ppiczα 5min fungi-pulse 16 XL1-Blue Zeocin 1ml 25 μg /ml Apa I Bgl II 1. 5ml EP 28 1 ~ 2h 50 ~ DNA 100μl Zeocin 100μg /ml 2 10ml YPD 28 2 ~ 3 10 Trizol RNA RT-PCR Zeocin 10ml BMGY 28 IgG1 Fc C H 2 C H 3 C1 C2 1 PCR min s 58 1min min ScFv-Fc PCR B1 B2 R1 R2 1min 72 2min min Xho I Apa I PCR ppiczα /Fc α 3' Fc 5' 24h OD ~ ml BMMY 28 24h 10min 0. 5% ppiczα 0h 24h 48h 72h 96h 120h 144h α 3' Apa I 1ml -HBs Xba I ppiczα ELISA Apa I Xba I Fc PCR Apa I Xba I 1 Table 1 Fc ScFv The sequences of primers and synthetic nucleotide chains Pimers and synthetic nucleotide chains Sequences 5' - 3' Fc upstream C1 5' - TAAGGGCCCCTGAGCCCAAATCTTGTG - 3' Fc downstream C2 5' - CCGTCTAGATCATTTACCCGGAGACAGGG - 3' synthetic nucleotide chain F1 TCGAGAAGAGACAGGTCGACCTGGTGGAGGGGCCCG synthetic nucleotide chain complementary F2 AATTCGGGCCCCTCCACCAGGTCGACCTGTCTCTTCTCGA anti-hbsag ScFv upstream B1 TATCTCGAGAAGAGACAGGTCGACCTGGTGGAG anti-hbsag ScFv downstream B2 ATCGAATTCGGGCCCCCGTTTGATTTCAACCTTGGTCCC anti-rabies ScFv upstream R1 TTACTCGAGAAGAGAGAGGTGCAGCTGCTGCAG anti-rabies ScFv downstream R2 ATTGAATTCGGGCCCTTTGATTTCCACCTTGGTCCC The restriction enzymes sites for Xho I CTCGAG BamH I GAATTC Xba I TCTAGA and Apa I GGGCCC included in the PCR primers are indicated by underlining. 111

3 China Biotechnology Vol. 31 No DNA PCR 200 mmol /L ph7. 0 ph DNA PCR 7. 0 A 5 20 ScFv-Fc mmol /L ph mol /L pmd18-t DNA 7 ph mol /L Tris SDS-PAGE ELISA HCl ph ~ 200μl /ml SDS-PAGE 10% ph 5% Bradford BSA 72h SDS 8 3 ~ 5min SDS-PAGE ScFvr /min 30s 60μl 40V Fc ELISA 100V ELISA 1 ScFv-Fc 0. 1 mol /L NaHCO 3 ph Western blot 1 ScFv-Fc IgG % BSA 37 SDS-PAGE 1 h 37 1 h HRP 2% BSA IgG h NC 2 NC 2 mol /L H 2 SO 4 OD ml /cm 2 IgG 2 ScFv-Fc IgG ~ ~ 4h TTBS NC 5min / 3 ~ h 72h 96h 120h 144h ELISA ~ ~4h TTBS NC 5min / 3 ~ 5 DAB 2 10min DAB ScFv-Fc 1 ~ 3min HRIG ScFv-Fc TBS 2 RV ScFv-Fc SDS-PAGE NC -HBs ScFv-Fc ScFv-Fc HRP IgG DAB ScFv-Fc ScFv-Fc 1L 2. 1 ppiczα 0. 5% 10% ~ 30% Xho I EcoR I ppiczα 45% ~ 70% r /min 4 20min PBS 1 DNA 24 ~ 48h 4 3 ~ 6h ppiczα -HBs ELISA 24h RV h 6 30 μl Xho I EcoR I Bgl II Apa I 1100bp EcoR I Apa I Protein A Sepharose CL-4B 2. 2 Fc ScFv-Fc 1. 5 RT-PCR 5 20 mmol /L 750bp 2 ph /10 Fc 112

4 ScFv-Fc 2. 3 ppiczα/fc ppiczα α 3' ApaI Xba I ppiczα ApaI Xba I Fc ppiczα ppiczα /Fc ApaI Xba I 750bp 3 DNA ppiczα /Fc ScFv-Fc PCR Zeocin 0h 24h ScFv anti-rabies 48h 72h 96h 120h 1ml ScFv anti-hbsag -HBs 750bp Xho I Apa ELISA I ppiczα /Fc SDS-PAGE Western blot Zeocin ScFv-Fc anti-rabies ScFv Fc 6 XhoI ApaI XhoI Xba I 750bp 1500bp 6 DNA ScFv 2. 5 DNA PCR 8 DNA PCR 1500bp pmd18- T DNA 2. 6 ScFv-Fc ScFv-Fc anti-rabies ScFv- Fc anti-hbsag YPD 10 anti-hbsag 56kDa 113

5 China Biotechnology Vol. 31 No SDS-PAGE ScFv-Fc 115kDa 55kDa 7 Bradford 1L 20 ~ 30mg /L protein A > 95% ELISA ScFv-Fc anti-rabies ScFv-Fc anti-hbsag ScFv-Fc 2. 8 ScFv-Fc ScFv-Fc 1L Protein A Sepharose CL- ScFv-Fc RV 4B 100% HRIG HRIG 150 IU /ml 114

6 ScFv-Fc ScFv-Fc RV and Drug Administration FDA % % ScFv-Fc 2 2 ScFv-Fc Table 2 Detection of rabies virus in supernatant of ScFv-Fc fusion protein by inoculating mouse brain Group Survival no. after 5 days Survival no. after 14 days survival % HRIG + RV Virus control Negative control ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV Asn-X-Ser /Thr ScFv-Fc ScFv ScFv-Fc 90% 15 4 AOX1 15 Fab ScFv Fv C g C 10g ScFv scfv Fab 18 scfv-fc sc Fv scfv Fc Fc 4. 2 g /L 21 Freyre 22 CEA immunoadhesin g /L TNFR 93% IgG Fc TNFR-Fc TNF-α 3 1 AOXI 2 8 ~ 14 ppiczα ScFv-Fc FDA Food IgG1 Fc 115

7 China Biotechnology Vol. 31 No ppiczα 6 Yan W Q Wang D D. Recombinant antibody against rabies Fc 2 ScFv-Fc ScFv antigen. China Sambrook J Russell D. Molecular Cloning A Laboratory Manual ppiczα /ScFv-Fc 8 Bradford M M. A rapid and sensitive method for the quantitation ScFv of microgram quantities of protein utilizing the principle of ppiczα /ScFv-Fc protein-dye binding Anal Biochem Stish B J Chen H Shu Y et al. Increasing anticarcinoma ScFv-Fc activity of an anti-erbb2 recombinant immunotoxin by the addition ppiczα / of an anti-epcam sfv. Clin Cancer Res ScFv-Fc Fc ScFv 10 Hamada T S Suzuki K Akahori Y. Antibody-dependent cellmediated cytotoxicity is induced by a single-chain Fv-protein III EcoR I ppiczα Apa I Acc I ScFv fusion in the presence of a rabbit anti-protein III polyclonal ScFv Acc antibody. Immunol Lett I 11 Niculescu-/duvaz I Springer C J. Antibody-dircted enzyme prodrug therapy ADEPT a review. Adv Drup Deliv Rev Chamow S M Ashkenazi A. Immunoadhesins principles and app1ication. TIBTECH Fischer R Drossard J Emans N et al. Towards molecular farming in the future Pichia pastoris-based production of singlechain antibody fragments. Biotechnol Appl Biochem His-tag Ni 14 Shapiro R I Wen D Levesque M et al. Expression of Sonic protein A hedgehog-fc fusion protein in Pichia pastoris. Identification and control of post-translational chemical and proteolytic modifications. Protein Expr Purif Cregg J M Vedvick T S Raschke W C. Advances in the expression of foreign genes in Pichia pastoris. Biotechnology 1 Skerra A Pluckthun A. Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science Better M Chang C P Robinson R R et al. Escherichia coli secretion of an active chimeric antibody fragment. Science Desplancq D Rinaldi A Stoessed A et al. Single-chain Fv fragment antibodies selected from an intrabody library as effective mono-or bivalent reagents for in vitro proten detection. J immunol Methods 2011 in print. 4 Sakamoto S Taura F Tsuchihashi R et al. Expression purification and characterization of anti-plumbagin single-chain variable fragment antibody in Sf9 insect cell. Hybridoma Larchmt Sandrine M Ahmed E M Ole V et al. A multi-fc-species system for recombinant antibody production. BMC Biotechnology Article ID Jafari R Sundstrom B E Holm P. Optimization of production of the anti-keratin 8 single-chain Fv TS1-218 in Pichia pastoris using design of experiments. Microb Cell Fact Gurkan C Symeonides S N Ellar D J. High-level production in Pichia pastoris of an anti-p185her-2 single-chain antibody fragment using an alternative secretion expression vector. Biotechnol Appl Biochem Schoonooghe S Kaigorodov V Zawisza M et al. Efficient production of human bivalent and trivalent anti-muc1 Fab-scFv antibodies in Pichia pastoris. BMC Biotechnol Yamawaki S Matsumoto T Ohnishi Y et al. Production of single-chain variable fragment antibody scfv in fed-batch and continuous culture of Pichia pastoris by two different methanol feeding methods. J Biosci Bioeng Jafari R Holm P Piercecchi M et al. Construction of divalent anti-keratin 8 single-chain antibodies sc Fv 2 expression

8 ScFv-Fc in Pichia pastoris and their reactivity with multicellular tumor spheroids. J Immunol Methods Damasceno L M Pla I Chang H J et al. An optimized fermentation process for high-level production of a single-chain Fv antibody fragment in Pichia pastoris. Protein Expr Purif Freyre F M Vazquez J E Ayala M et al. Very high expression of an anti-carcinoembryonic antigen single chain Fv antibody fragment in the yeast Pichia pastoris. J Biotechnol A Vector System for the Production of Single-chain Fv-Fc Fusions in Pichia pastoris WANG Ding-ding 1 SU Man-man 2 HU Li-li 1 YUAN Li-ying 4 SUN Yan 1 WANG Ju 3 YAN Wei-qun 2 1 Institute of Life Science and Biological Pharmacy Guangdong Pharmaceutical University Guangzhou China 2 College of Pharmaceutical Jilin University Changchun China 3 College of Life Science and Technology Jinan University Guangzhou China 4 The 3rd Kindergarten Affiliated to Jilin University Changchun China Abstract Recombinant antibodies especially ScFv fragments can be applied as detection reagents and even substitute for some reagents used in immunoassays such as antibody-enzyme conjugates. For ScFv fragments a universal system available is necessary. A vector system was constructed based on ppiczα /Fc in which the hinge CH2 and CH3 domains Fc fragment of human IgG1 and His-tag were cloned into the Pichia expression vector ppiczα. Two fragments of ScFv were introduced into ppiczα /Fc which can bind HBsAg and rabies virus antigen to yield the expression cassette ppiczα /ScFv-Fc. Following fermentation in a 1-liter reactor the fusions were expressed at high levels in the methylotrophic yeast Pichia pastoris secreted as dimeric forms in the culture and purified by protein A column chromatography. The expression yield can reach 20 ~ 30mg / L of culture medium. The ScFv-Fc fusion proteins retain the biological binding ability of the parent ScFv. Furthermore successful expression and maintenance of the binding activity verify the efficacy of the vector system for use as detection reagents in vitro by reacting with the specific antigens and being readily detected using general anti-human IgG antibodies. Key words Fusion protein ScFv-Fc Vector system Expression Pichia pastoris 117