JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
|
|
- Ἀράχνη Δαγκλής
- 7 χρόνια πριν
- Προβολές:
Transcript
1 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC CT ACC CT Q78 A Cloning of Acetyl-Coenzyme A Carboxylase Gene ACC from Rhodotorula glutinis and Prokaryotic Expression of Its CT Functional Domain Gene LI Jie-qiong WANG Li-bing LIU Yang ZHENG Shi-xue YU Zi-niu State Key Lab. of Agric. Microbiol. Natl. Engin. Res. Ctr. of Microbial Pesticides Huazhong Agric. Uni. Wuhan Abstract A full length of sequence message of acetyl-coa carboxylase ACC gene from Rhodotorula glutinis was obtained using degenerate PCR and chromosome walking methods for the first time. Sequence analysis showed that ACC gene had two introns located at 42 ~ 147 bp and 315 ~ 677 bp and the total length of coding region was bp. Secondary structure analysis of the deduced amino acid sequence revealed that it had three typical functional domains of ACC biotin carboxylase BC biotin carboxyl carrier protein BCCP and carboxyl transferase CT. cdna sequence of CT functional domain was cloned and introduced into the prokaryotic expression vector pet-28a and successfully expressed in Escherichia coli BL21 DE3 and purified using Ni-NTA resin column and obtained soluble recombinant protein at concentration of 1. 8 mg / ml. This provided a valuable material to study the function of ACC and herbicidal mechanism aiming at the function of CT. Keywords Rhodotorula glutinis ACC gene clone CT functional domain prokaryotic expression A acetyl-coa carboxylase 1 4 ACC biotin carboxylase BC A biotin carboxyl carrier protein BCCP A carboxyltransferase α -CT β -CT ACC 2009ZX B ljq @ 126. com * Tel zhengsx@ mail. hzau. edu. cn
2 3 A ACC CT 7 A BC CT Ex Taq TM Polymerase LA Taq TM Polymerase 2 BCCP RNase A TaKaRa E. Z. BC CT N. A. TM Yeast RNA Kit E. Z. N. A. TM Yeast DNA ATP Mg 2 + BC BCCP Kit Omega RevertAid TM First Strand cd- CT BCCP NA Synthesis Kit T4 DNA Fermentas A AxyPrep TM DNA Gel Extraction Kit A 1 AxyPrep TM PCR Cleanup Kit AXYGEN ACC 2 HisTrap FF1 ACC YPD LB Kan 50 μg /ml DNA RNA DNA RNA Meng Omega E. Z. N. A. TM Yeast DNA Kit 3 Acinetobacter calcoaceticus E. Z. N. A. TM Yeast RNA Kit ACC PCR ACC 6 KEGG 5. 6 Ruenwai 4 Mucor A rouxii ACC Hansenula polymorpha 40% IA QKIIEEA WGYFSV 2 IN- 3 IANNG- Rhodotorula glutinis F /FY-R QK-F /WG-R 1 PCR 70% ACC PCR 50 μl DNA 1 BC BCCP CT 3 μl 10 Ex Taq TM buffer 5 μl 2. 5 mmol /L dntps GenBank 4 μl 10 μmol /L 1 μl Ex Taq TM 0. 5 μl 5 U /μl ddh 2 O μl ACC PCR 94 5 min s 51 ACC CT 45 s 72 1 min s s 72 ACCase CT AC- 1 min min Case CT PCR PMD-18T ACC CT DH5α PCR CT GenomeWalker Universal kit ACC 7 5' Rhodotorula glutinis AP1 AP2 2 GW5-1 GW5-2 Genomewalker universal kit Escherichia coli DH5α GW5-1 /AP1 GW5-2 /AP2 PCR BL21 DE3 pet28a 1 PMD-18T TaKaRa DNA OMEGA DNA 2 4 EcoR Ⅴ Pvu Ⅱ Dra Ⅰ
3 8 31 Stu Ⅰ DNA 3 4 AP2 GW5-2 PCR 6 PCR DNA Adaptor Genome walking 4 Genome walking DNA AP1 GW5-1 3' PCR 5 1 Table 1 1 ACC Primers used in the work of ACC gene clone from Rhodotorula glutinis QK-F CAGAAGATYATYGAGGAGGC 1 WG-R ACVGAGAAGTAACCCCA 1 IN-F ATYGCBAACAACGGNATYGC 2 FY-R GAGCCTCCTCRATRATCTTCTG 2 GW3-1-1 TGATTTCGACTTCTCGGGCGAGGATGCTG 3' 1 GW3-1-2 GGAGGTACTATGCACGAGCTCAACTTC 3' 1 GW3-2-1 TCCACTCTTCAGGAGATGGTTGGTCTG 3' 2 GW3-2-2 TCTCCAGTGGGCTCATCAGGTGTCTTC 3' 2 GW3-3-1 GAAGTATGACGGCAAGGCTCCCGACGA 3' 3 GW3-3-2 CGTCGGTATGGTTGCGTGGAAGTTTGA 3' 3 GW5-1-1 AAAGGTCTCGTAGGCCCATTTTCGTAC 5' GW5-1-2 CCTTTACTGAGGCAATCCCGTTGTTAG 5' AP1 GTAATACGACTCACTATAGGGC AP2 ACTATAGGGCACGCGTGGT RT-PCR ACC CT RevertAid TM First Strand cdna Synthesis Kit PCR cdna NH-3-E-F /NH-3-H-R CT cdna NH-3-E-F CG GAATTC CCCGAGTACCCTCGAG NH-3-H-R CCC AAGCTT AGCATCCTTCCACACAAG NH-3-E-F 16 h SDS-PAGE EcoRⅠ NH-3-H-R Ni- HindⅢ NTA PMD-18T DH5α PCR 2. 1 ACC CT DNA PMD-18T-CT EcoRⅠ HindⅢ CT 2 DNA 500 bp pet-28a 1A 808 bp 1B DH5α pet-28a-ct BL21 DE3 50 μg /ml Kan LB OD 600 = mmol /L IPTG 25 2 QK-F /WG-R IN-F /FY-R PCR bp DNA NH-IW
4 3 A ACC CT 9 1 PCR ACC DNA Fig. 1 The result of cloning partial sequence of ACC gene kb from Rhodotorula glutinis by degenerate PCR A QK-F /WG-R PCR B IN-F /FY-R PCR M DL2000 Marker A The result of PCR amplification using primers QK-F / WG-R B The result of PCR amplification using primers IN- F /FY-R M DL2000 Marker A4 A 88% A 2. 2 ACC NH-IW 5' 3' ~ 147 bp 315 ~ 677 bp bp NCBI A 3 BC BCCP CT BlastX BlastX Yarrowia lipolytica GenBank YALI0C11407p A A 98% Aspergillus nidulan FGSC 2 NH-IW Fig. 2 The result of genome walking of upstream and downstream of the partial sequence NH-IW A 5' 1 EcovⅠ B 3' 1 1 StuⅠ 2 PvuⅡ C 3' 2 1 StuⅠ D 3' 3 1 DraⅠ 2 StuⅠ M DL2000 Marker A 5' region genome walking 1 using EcovⅠ library as template B The first round of 3' region genome walking 1 using StuⅠ library as template using PvuⅡ library as template C The second round of 3' region genome walking 1 using StuⅠ library as template D The third round of 3' region genome walking 1 using DraⅠ library as template 2 using StuⅠ library as template M DL2000 Marker 2. 3 ACC CT 3A 28S RNA 18S RNA 5S RNA 3 E. Z. N. A. TM Yeast RNA Kit RNA A260 /A280 RNA RNA RNA
5 10 31 cdna CT cdna bp 3B 2. 4 ACC CT pet-28a-ct 25 SDS-PAGE 1 62 ku 3 CT 4A Fig. 3 Ni SDS- PAGE 4B 1. 8 mg /ml RNA CT cdna Total RNA of Rhodotorula glutinis and amplification of CT cdna A RNA B CT cdna M DL2000 Marker A Total RNA of Rhodotorula glutinis B cdna sequence of CT domain M DL2000 Marker 4 CT SDS-PAGE Fig. 4 SDS-PAGE analysis of the expression of CT domain A SDS-PAGE 1 pet-28a /BL21 DE3 1 ~ 4 pet-28a-ct /BL21 DE3 B Ni SDS-PAGE 1 M Marker A SDS-PAGE analysis of the expression of recombinant strains 1 control strain pet-28a /BL21 DE3 1 ~ 4 recombinant strains pet- 28a-CT /BL21 DE3 Arrow represents the location of target proteins B SDS-PAGE analysis of recombinant protein purified by Ni- NTA resin 1 the purified recombinant protein M Protein marker PCR 3 A PCR ACC PCR BC BCCP CT 3 PCR Tail-PCR 6. 5 ~ 7 kb PCR 10 SON-PCR 11 SEFA-PCR 12 cdna PCR PCR cdna PCR 10 Clonetech ACC GenomeWalker Universal kit PCR
6 3 A ACC CT 11 PCR PCR PCR PCR 4 Ruenwai R Cheevadhanarak S A 13 ACC 4 BC BCCP α- CT β-ct ACC J J J. D. W. M. - acyl- ACPs ACC 14 9 J. D. W. M. ACC ACC 11 Antal Z Rascle C ACC 5 Zhang et al. Self-Formed Adaptor PCR a Simple and Efficient Method for Chromosome Walking J. Ap- 15 CT CT ACC 12 Wang SM He J Gui ZL pl Environ Microbiol ACC CT for single cell oil production J 1 Cronan JE Jr Waldrop GL. Multi-subunit acetyl-coa carboxylases J. Progress in Lipid Research Nikolau BJ Ohlrogge JB Wurtele ES. Plant biotin-containing carboxylases J. Arch Biochem Biophys Meng X Yang JM Cao YJ et al. Increasing fatty acid production in E. coli by simulating the lipid accumulation of oleaginous microorganisms J. J Ind Microbiol Biotechnol 2010 DOI / s z. Laoteng K. Overexpression of Acetyl-CoA Carboxylase Gene of Mucor rouxii Enhanced Fatty Acid Content in Hansenula polymorpha J. Mol Biotechnol Tong L. Acetyl-coenzyme A carboxylase crucial metabolic enzyme and attractive target for drug discovery J. Cell Mol Life Sci PCR PCR J Fevre M et al. Single oligonucleotide nested PCR a rapid method for the isolation of genes and their flanking regions from expressed sequence tags J. Current Genetics Ratledge C. Fatty aid biosynthesis in microorganisms being used Biochimie Davis MS Cronan JE JR. Inhibition of Escherichia coli Acetyl Coenzyme A Carboxylase by Acyl-Acyl Carrier Protein J. J Bacteriol Zhang H Tweel B Tong L. Molecular basis for the inhibition of the carboxyltransferase domain of acetyl-coenzyme A carboxylase by haloxyfop and diclofop J. Proc Natl Acad Sci USA
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna
2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 4 28 4 380 ~ 384-1 2 1 1 1 * 1 310021 2 210095 2 min DNA 2 min Q78 Digesting Plasmid
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING Η εταιρία Macrogen χρησιμοποιεί την τελευταία λέξη της τεχνολογίας για την καλύτερη δυνατή παροχή Υπηρεσιών Sequencing. Μέσα από την 10ετη της εμπειρία, συγκέντρωσε
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.
Supplementary Table 1. Primers and PCR conditions used for the amplification of the goat SCD1 cdna (PCR1 to PCR6) and three SCD1 polymorphic regions (PCR7 to PCR9) PCR Primers Sequence Position 1 Thermal
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X
I Acknowledgements... 3... I Figures... VII Tables... IX Abbreviations... X Amino acids... XII Nucleobases... XII 1 Introduction... 1 1.1 Polyketides and non-ribosomal peptides... 1 1.2 Polyketide synthases...
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ Εργαςτήριο Γεωργικών Καταςκευών ΠΜΣ Ενεργειακά Συςτήματα και Ανανεώςιμεσ Πηγέσ Ενέργειασ Διδακτορική διατριβή Καιιηέξγεηα
Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Optimization of fermentation process for achieving high product concentration high yield and high productivity
1128 CHEMICAL INDUSTRY AND ENGINEERING PROGRESS 2006 25 10 ( 214036) (1) (2) (3) (4) (5) TQ 92 A 1000 6613 2006 10 1128 06 Optimization of fermentation process for achieving high product concentration
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA
Research Paper Acta Microbiologica Sinica 51 2 203-207 4 February 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Botrytis cinerea T-DNA * 310014 Botrytis cinerea T-DNA Agrobactirium
The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis
Chinese Journal of Applied Entomology 2011 48 4 820 825 * S - RNA 1 1 2 1 1** 1. 030006 2. 030006 Locusta migratoria manilensis Meyen GST GST 4 RNA dsrna dsrna Real time RT-PCR mrna 4 GST delta LmGSTd1
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS
Electronic Supplementary Material (ESI) for Journal of Analytical Atomic Spectrometry. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTAL INFORMATION Fully Automated Total Metals and Chromium
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
SUPPORTING INFORMATION
SUPPORTING INFORMATION Trichodermides A E: New Peptaibols isolated from Australian Termite Nestderived Fungus Trichoderma virens CMB-TN16 Wei-Hua Jiao,, Zeinab Khalil, Pradeep Dewapriya, Angela A. Salim,
Original Article. Corynebacterium. (
> >>?> @ >> @ 88 82 > ??> Corynebacterium glutamicum?> ddh @E @? > > > > 4 4 3 2 @ < < >? < @>>? > < >>> < 7 6 5 @?? > < @? >? < > @> > @ @ >@ < > >>?> @ >>
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»
ΦΟΡΕΑΣ ΔΙΑΧΕΙΡΙΣΗΣ ΕΘΝΙΚΟΥ ΘΑΛΑΣΣΙΟΥ ΠΑΡΚΟΥ ΖΑΚΥΝΘΟΥ ΤΕΥΧΟΣ ΠΡΟΚΗΡΥΞΗΣ ΑΝΟΙΚΤΟΥ ΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΟ ΕΡΓΟ «ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ» Για τις ανάγκες της Πράξης ΟΡΓΑΝΩΣΗ ΤΗΣ ΠΡΟΣΤΑΣΙΑΣ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Research Paper Corynebacterium crenatum γ- EC γ-glutamyl kinase prob. prob PCR. prob prob. C. crenatum ΔproB
Acta Microbiologica Sinica 51 11 1476-1484 4 November 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Research Paper γ- L- 8-193 1 2 1 1 1 1* 1 100101 2 100049 L- L- L- 8-193
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΠΡΟΜΗΘΕΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΕΡΓΑΣΤΗΡΙΟΥ (CPV: )
Αθήνα, 26 Νοεμβρίου 2014 Αρ. Πρωτ.: 3450 ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Το Ελληνικό Ινστιτούτο Παστέρ, στο πλαίσιο υλοποίησης του έργου με τίτλο: «Ανάπτυξη Βιοαισθητήρων Τύπου Ταινίας Ξηρών Αντιδραστηρίων
Χαρακτηριςμόσ και δυναμική ζκφραςη του γονιδίου CYP450 τησ οικογζνειασ 71Α από την ελιά
Γεωπονικό Πανεπιστήμιο Αθηνών Τμήμα Γεωπονικής Βιοτεχνολογίας Εργαστήριο Μοριακής Βιολογίας Χαρακτηριςμόσ και δυναμική ζκφραςη του γονιδίου CYP450 τησ οικογζνειασ 71Α από την ελιά ΚΟΤΥΑ ΑΙΚΑΣΕΡΙΝΗ Μεταπτυχιακή
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
abs acces acces Sample test results. Actual results may vary. Antioxidants B-Vitamins Minerals Order Today At Results Overview
Order Today At www.accesalabs. Antioxidants B-Vitamins Minerals Vitamin C Pyridoxine - Biotin Vitamin A / Carotenoids Vitamin E / Tocopher α-lipoic A Co T ami B1 cer R bo a n - B2 N acin - B3 Results Overview
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 1 32 1 93 ~ 98 DOI 10. 13865 /j. cnki. cjbmb. 2016. 01. 14 HdeA 1 3 2 3 3 3 * 1 422000
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S
16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP
38 2010 12 FENXI HUAXUE Chinese Journal of Analytical Chemistry 12 1708 ~ 1713 DOI 10. 3724 /SP. J. 1096. 2010. 01708 1 1 2 2 1 1 1 1 2 * 1 2 1 210096 2 412008 Single nucleoitide polymorphism SNP PCR Gold
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής
Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Research Paper. glda. glda AT glda-wt. glda-4 pet- 32a + E. coli U / ml E. coli-wt U / ml 3 A Q814
Acta Microbiologica Sinica 51 4 504-509 4 April 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Research Paper 1 1 1 1 2* 1 361021 2 361005 glda glda AT AT PCR glda-wt glda-4
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].
2009 54 24 : 3823 ~ 3829 www.scichina.com csb.scichina.com SCIENCE IN CHINA PRESS gn,,,,,,, 310021;, 712100 E-mail: cunzh2004@yahoo.com.cn 2009-07-16, 2009-08-02 pha2 ZJ UL15 UL18, rbhv1-ha; DNA, DH10B,
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
2 ( EC ) 2D2
29 2 2010 4 Journal of Huazhong Agricultural University Vol. 29 No. 2 Apr. 2010,175 180 3 3, 430070 PCR lac4,p ET2 28a ( + ),BL21, (44. 78 2. 84) U/ ml Ni2Resin HP,SDS2PA GE, 122 ku, 43, 37 30 min, p H
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Z58 Taxus x media Z min M + Na +
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 12 28 12 1141 ~ 1146 1 2 3 * 2 2 2 2 * 1 044099 2 430074 3 430064 Taxus x media Z58 10
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Supplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
A/A Είδος Προδιαγραφές
A/A Είδος Προδιαγραφές 1 Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους αρχικών δειγμάτων, όπως ιστούς, κύτταρα, βακτήρια, αίμα, buffy coat & ιούς. Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΠΜΣ ΘΕΤΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΣΤΗΝ ΓΕΩΠΟΝΙΑ ΚΛΑΔΟΣ III: ΜΕΛΕΤΗ ΚΑΙ ΑΞΙΟΠΟΙΗΣΗ ΦΥΣΙΚΩΝ ΠΡΟΪΟΝΤΩΝ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ ΜΕΛΕΤΗ ΤΗΣ ΧΗΜΙΚΗΣ ΣΥΣΤΑΣΗΣ
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Food Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR
Food Research And Development 2011 9 32 9 69 Ara h1 * 518060 Ara h1 GenBank Ara h1 DNA AF432231 2 SYBR Green -CT 2 8 Ara h1 SYBR Green 3 10 2 3 10 8 copies R 2 0.993 5 3 10 3 copies 2 8 2 Ara h1 Ara h1
Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province
Chinese Journal of Applied Entomology 2011 48 1 48 53 * Q 1 2 1 1 2 1 1. 225009 2. 100081 3 Q Bemisia tabaci Gennadius 5 Q RCR 287 bp 184 bp ace1 para- Q F331W L925I T929V Resistance monitoring and target
Prey-Taxis Holling-Tanner
Vol. 28 ( 2018 ) No. 1 J. of Math. (PRC) Prey-Taxis Holling-Tanner, (, 730070) : prey-taxis Holling-Tanner.,,.. : Holling-Tanner ; prey-taxis; ; MR(2010) : 35B32; 35B36 : O175.26 : A : 0255-7797(2018)01-0140-07
Vol. 39 No Journal of Jiangxi Normal University Natural Science Jan Western blot %. 40 kda
39 1 Vol 39 No 1 2015 1 Journal of Jiangxi Normal University Natural Science Jan 2015 1000-5862 2015 01-0101-05 1 2 1 1 1 1* 1 518060 2 330006 R 392 11 A DOI 10 16357 /j cnki issn1000-5862 2015 01 19 pet-28a
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΜΕΑΣ ΦΑΡΜΑΚΟΓΝΩΣΙΑΣ ΦΑΡΜΑΚΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ ΦΑΡΜΑΚΟΛΟΓΙΑ ΚΑΙ ΘΕΡΑΠΕΥΤΙΚΗ In vitro και in vivo φαρμακοκινητική
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
Methodology Research on Loss of Heterozygosity of APC Gene Detection Exon 11 of Gastric Cancer by Capillary Electrophoresis
30 5 2011 5 FENXI CESHI XUEBAO Journal of Instrumental Analysis Vol. 30 No. 5 498 ~ 502 APC 1 2 1 2 2 1 2 3 2 2 1. 730000 2. 730050 3. 730070 PCR APC 96 RsaⅠ CE - SS- CP CE - RFLP PAGE - SSCP PAGE 15%
ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting
China Biotechnology 2011 31 8 110-117 * ScFv-Fc 1** 2 1 4 1 3 2 1 510006 2 130021 3 510632 4 130021 ScFv ScFv-Fc RT- PCR IgG1 Fc ppiczα ppiczα/fc Fc 2 ScFv-Fc ScFv ScFv ppiczα/fc 1L protein A PCR ELISA
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 5 29 5 475 ~ 481 T7 cdna 1 1 2 * 1 1 1 071002 2 Western University of Health Sciences
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer