rbcl matk psba-trnh psbk-psbi ITS ITS2 DNA rbcl matk psba-trnh psbk-psbi matk 85% 100% matk+psbk-psbi

Transcript

1 2012 Vol.14 No.1 * ** ** / PCR 6 matk psbk-psbi ITS ITS2 DNA matk psbk-psbi matk 85% matk+psbk-psbi 100% matk+psbk-psbi DNA matk+psbk-psbi doi: /j.issn Aspidistra Lili- [7~10] aceae [1] [2~6] [11] * ** D hesz8899@126.com Tel scauyaoh@sina.com slchen@implad.ac.cn 1166

2 20 1 A. longiloba [12] [5] A.Pingtangensis 2. 1 DNA PCR 2001 Hebert [13] COI Retsch MM 400,Germany 2 min 30 r s -1 COI DNA Tiangen Biotech Co. COI China DNA PCR 25 μl PCR buffer 2.5 μl 10 MgCl μl 25 mmol L -1 dntp 2.0 μl 2.5 mmol L μl μmol L -1 Taq 1.0 U DNA1.0 μl 30 ng Consortium for the Barcode of Life, CBOL 25 μl +matk 2 ABI3730XL [14] 11 DNA Applied Biosystems Co.,USA ITS 2 Kress [15] Fazekas [16] CodonCode Aligner V 2.06 CodonCode Co. USA ClustalX V 2.0 Higgins D.G. PCR ITS2 1 90% ITS2 [17~19] 1 A. pingtangensis COI 2 A. chishuiensis A. fungilliformis rpoc1 matk ps- 4 A. guizhouensis ba-trnh psba -trnh matk atpf - 20 mg DNA 5 A. liboensis atph matk atpf-atph 6 A. sichuanensis psbk-psbi [ DNA 10 matk psba -trnh psbk - 11 psbi ITS ITS2 12 DNA A. caespitosa A. fasciaria 18 A. retusa 19 A. linearifolia A. cerina

3 2012 Vol.14 No.1 psbk-psbi matk Song [22] MEGA 4.0 K2P psbk-psbi matk Ross [23] BLAST1 3. Nearest distance 5 matk 85% psbk-psbi 1. PCR 65% 50% PCR DNA matk+psbkpsbi 100% PCR ITS ITS2 0 matk+ +matk + 95% matk psba -trnh psbk -psbi 100% matk psba -trnh psbk - fwd PA psbi rev TH 100% 2. matk KIM_3F KIM_1R 1f psbk -psbi 394 ~ 724r 398 bp matk 849~855 bp psbk-psbi 3 4 ITS psbk -psbi matk psba -trnh ITS2F ATGCGATACTTGGTGTGAAT ITS2 ITS3R GACGCTTCTCCAGAC TACAAT 2 PCR 5'-3' 3 PK PI ITS5F ITS4RITS5 af ITS4R GTTATGCATGAACGTAATGCTC CGCGCATGGTGGATTCACAATCC CGTACAGTACTTTTGTGTTTACGAG ACCCAGTCCATCTGGAAATCTTGGTTC GTTTCTGTTTGTGGTGACAT GCTACTGCAGGTACATGCGA CTTGCCAAACAAAGGCTAA ATGCTTACTCTCAAACTCT GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGCCCTTAT- CATTTAGAGGAAGGAG TCCTCCGCTTATT GATATGC min 94 1 min 55 1 min min min 94 1 min s s s min 95 2 min 94 1 min s 72 1 min min 94 5 min 94 1 min 55 1 min min min 94 5 min 94 1 min 50 1 min min + 3sec/ min 94 5 min s s s min matk psbk-psbi / % / % / % / % 11/ / / / Aspidistra spp % bp 849~ ~

4 4 4 matk psbk-psbi % % % % A. sichuanensis (9) A. caespitosa (2) 0.7,0.8,0.9,0.5,0.8,0.9,1.2,0.7, 0.1,0.2,0.5,0.1,0.2,0.5,0.2,0.1, 0.6,0.0,0.1,0.4,0.1,0.7,0.1,0.0, 0.5,0.2,0.6,0.7,0.9,0.5,0.1,0.4, 0.1,0.5,0.2,0.5 (0.4) 0.3,0.0,0.0,0.2,0.2,0.2,0.2,0.5, 0.3,0.3,0.2,0.5,0.5,0.5,0.9,0.0, 0.2,0.2,0.2,0.2,0.5,0.2,0.2,0.2, 0.2,0.5,0.3,0.3,0.3,0.7,0.0,0.3, 0.7,0.3,0.7,0.7 (0.3) 0.2,0.2,0.2,0.2,0.2,0.2,0.2,0.2, 0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0, 0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0, 0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0, 0.0,0.0,0.0,0.0 (0.0) 0.8,0.8,0.5,0.5,0.5,0.5,0.8,0.8, 1.0,0.3,0.3,0.8,0.3,0.5,1.0,0.8, 0.8,0.3,0.8,0.5,0.5,0.0,0.5,0.0, 0.3,0.8,0.5,0.0,0.3,0.8,0.5,0.8, 0.3,0.3,0.8,1.0 (0.5) 0.0 (0.0) 0.5 (0.5) 0.0 (0.0) 0.0 (0.0) 5 matk % [17 20] matk CBOL KIM_3F/KIM_1R matk psbk-psbi +matk matk+ matk+psbk-psbi % psbk-psbi 6 matk psba - 100% 85% [26] 100% 45% 21.1% psbk-psbi Ki-Joong Kim [21] Lahaye [27] psbk -psbi 98% matk+psbk-psbi+atpf-atph 100% 65% DNA [28] trnh psbk-psbi ITS ITS2 ITS +psba -trnh matk +psba -trnh ITS1 ITS2 5.8S 3 + matk matk+psbk-psbi 5.8S ITS1 matk+psbk-psbi ITS2 [24] ITS1 DNA 100% % ITS ITS2 DNA DNA barcoding [17 PCR 25] DNA [29] ITS ITS2 GenBank ITS ITS ITS2 matk psbk-psbi 1169

5 2012 Vol.14 No.1 100% spacer region. PLoS ONE, 2007,2(6) e % matk+psbk-psbi DNA qually well. PLoS ONE, 2008, 3 e2802. GenBank DNA ONE, 2010,5(1) e Evol, 2011, 49(3) 165~ Chase MW, Cowan RS, Hollingsworth PM, et al. A proposal for a standardised protocol to barcode all land plants. Taxon, 2007, 56 (2) 295~ 2 Wang FT, Tang TS.Flora Reipublicae Popularia Sinicae(Liliaceae). Beijing Science Press, 1978, 15 18~ Pennisi E. Taxonomy. Wanted a barcode for plants. Science, 2007, Lin CR, Liang YY, Liu Y. Aspidistra bamaensis (Ruscaceae),a new species from Guangxi, China. Ann Bot Fennici, 2009, ~418. (5848) 190~ Song JY, Yao H, Li Y, et al. Authentication of the family Polygonaceae 4 Xu WF, He SZ, Yang L. Aspidistra chishuiensis (Ruscaceae), a new species from Guizhou, China. Ann Bot Fennici, 2010, ~120. in Chinese pharmacopoeia by DNA barcoding technique. Journal of Ethnopharmacol, 2009,124(3) 434~ He SZ, Xu WF, Wang YY. A New Species of Aspidistra (Ruscaceae) from Guizhou China. Novon, 2011, 21(2) 187~ Ross HA, Murugan S, Li WL. Testing the reliability of genetic methods of species ideniification via simulation. Syst Biol, 2008,57 216~ He SZ, He K, Wu JY.A New Species of Aspidistra (Ruscaceae) sp. nov. from Guizhou, China. Ann Bot Fennici, 2011,48(5) 439~ Chase MW, Salamin N, Wilkinson M, et al. Land plants and DNA barcodes: short -term and long -term goals. Philosophical Transactions of 7. the Royal Society B Biological Sciences, 2005, ~ (5) 565~ Chinese Plant BOL Group. Comparative analysis of a large dataset indicates 8 that internal transcribed spacer. (ITS) should be incorporated into (2) 154~156. the core barcode for seed plants. Proc Natl Acad Sci USA, 2011, ITS ~ (2) 51~ Shaw J, Lickey EB, Beck JT, et al. The tortoise and the hare. II. Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic ITS (4) 86~90. analysis. American Journal of Botany, 2005, ~ Lahaye R, Savolainen V, Duthoit S, et al. A test of psbk -psbi and (15) 1141~1146. atpf -atph as potential plant DNA barcodes using the flora of the Kruger National Park as a model system (South Africa). Nature Preced- 13 Hebert PDN, Ratnasingham S, dewaard JR. Barcoding animal life: cytochrome coxidase subunit 1 divergences among closely related species. Proc Biol Sci, 2003, ~ CBOL Plant Working Group. A DNA barcode for land plants. Proc Natl Acad Sci USA, 2009, 106 (31) 12794~ Kress WJ, Erickson DL. A two -locus global DNA barcode for land plants The coding gene complements the non-coding trnh-psba 16 Fazekas AJ, Burgess KS, Kesanakurti PR, et al. Multiple multilocus DNA barcodes from the plastid genome discriminate plant species e- 17 Chen SL, Yao H, Han JP, et al. Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS DNA (6) 747~ Li DZ, Liu JQ, Chen ZD, et al. Plant DNA barcoding in China. J Syst ings hdl 10101/npre Newmaster SG, Fazekas AJ, Ragupathy S. DNA barcoding in land plants: evaluation of in a multigene tiered approach. Can J Bot, 2006, 84(3) 335~ DNA barcoding (3) 7~12. Molecular Identification of Medicinal Plants in Aspidistra Liu Anli 1, He Shunzhi 1, Yao Hui 2,Chen Shilin 2, Song Jingyuan 2 (1. Department of Pharmacy, Guiyang College of Traditional Chinese Medicine, Guiyang China; 2. National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing , China) 1170

6 Abstract: To test the DNA molecular markers (, matk,, psbk-psbi, nr ITS and ITS2) to identify medicinal plants in Aspidistra,the efficiency of PCR amplification and sequencing, intraspecific variation and interspecific divergence and identification efficiency were used to evaluate these loci. The results showed that through analysis of 20 samples of 11 species of Aspidistra, matk and psbk -psbi had high efficiency of PCR amplification and sequencing and the success identification rate of matk was the highest (85%) in single sequence. The discrimination ability of different sequences was shown higher using the sequence combinations, in which the success identification rate of matk+psbk-psbi was 100%. Therefore, matk+psbk-psbi could be used to identify the medicinal plants in Aspidistra. Key words: DNA molecular markers; Aspidistra; identification; matk+psbk-psbi 瑀 1171